Goodhardt, M; Babinet, C; Lutfalla, G; Kallenbach, S; Cavelier, P; Rougeon, F
1989-01-01
We have produced transgenic mice which synthesize chimeric mouse-rabbit immunoglobulin (Ig) kappa light chains following in vivo recombination of an injected unrearranged kappa gene. The exogenous gene construct contained a mouse germ-line kappa variable (V kappa) gene segment, the mouse germ-line joining (J kappa) locus including the enhancer, and the rabbit b9 constant (C kappa) region. A high level of V-J recombination of the kappa transgene was observed in spleen of the transgenic mice. Surprisingly, a particularly high degree of variability in the exact site of recombination and the presence of non germ-line encoded nucleotides (N-regions) were found at the V-J junction of the rearranged kappa transgene. Furthermore, unlike endogenous kappa genes, rearrangement of the exogenous gene occurred in T-cells of the transgenic mice. These results show that additional sequences, other than the heptamer-nonamer signal sequences and the promoter and enhancer elements, are required to obtain stage- and lineage- specific regulation of Ig kappa light chain gene rearrangement in vivo. Images PMID:2508061
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kipps, T.J.; Fong, S.; Tomhave, E.
Malignant B lymphocytes from several patients with chronic lymphocytic leukemia (CLL) were examined for reactivity with murine monoclonal antibody 17.109. This antibody, prepared against the rheumatoid factor (RF) paraprotein Sie, recognizes a cross reactive idiotype on 48% of human IgM RF paraproteins, but does not react with IgM paraproteins without RF activity or substantially with normal pooled immunoglobulin. The 17.109-reactive idiotype is a marker for a kappa III variable-region gene, designated V/sub kappa/RF, that is conserved in outbred human populations. In a limited study of 31 CLL patients, the leukemic cells from 5 of 20 patients with kappa light chain-expressingmore » CLL were recognized by the 17.109 monoclonal antibody. Despite having malignant cells specifically reactive with this antibody, patients with 17.109-positive CLL did not have elevated serum levels of circulating antibody bearing 17.109-reactive determinants. Total RNAs isolated from the CLL B lymphocytes, or from hybridomas produced by fusing the CLL cells with the WI-L2-729-HF/sub 2/ cell line, were fractionated electrophoretically and examined by blot hybridization. Under stringent hybridization conditions capable of discerning a single base-pair mismatch, RNA from the 17.109-idiotype-positive CLL cells hybridized to synthetic oligonucleotide probes corresponding to framework and complementary-determining regions in the V/sub kappa/RF gene. The high frequency of the 17.109-associated idiotype and the V/sub kappa/RF gene in CLL suggests that the disease may arise from B lymphocytes that express a restricted set of inherited immunoglobulin variable-region genes with little or no somatic mutation.« less
Duan, L; Pomerantz, R J
1994-01-01
The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635
The LIM-homeodomain transcription factor LMX1B regulates expression of NF-kappa B target genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rascle, Anne; Neumann, Tanja; Raschta, Anne-Sarah
2009-01-01
LMX1B is a LIM-homeodomain transcription factor essential for development. Putative LMX1B target genes have been identified through mouse gene targeting studies, but their identity as direct LMX1B targets remains hypothetical. We describe here the first molecular characterization of LMX1B target gene regulation. Microarray analysis using a tetracycline-inducible LMX1B expression system in HeLa cells revealed that a subset of NF-{kappa}B target genes, including IL-6 and IL-8, are upregulated in LMX1B-expressing cells. Inhibition of NF-{kappa}B activity by short interfering RNA-mediated knock-down of p65 impairs, while activation of NF-{kappa}B activity by TNF-{alpha} synergizes induction of NF-{kappa}B target genes by LMX1B. Chromatin immunoprecipitation demonstratedmore » that LMX1B binds to the proximal promoter of IL-6 and IL-8 in vivo, in the vicinity of the characterized {kappa}B site, and that LMX1B recruitment correlates with increased NF-{kappa}B DNA association. IL-6 promoter-reporter assays showed that the {kappa}B site and an adjacent putative LMX1B binding motif are both involved in LMX1B-mediated transcription. Expression of NF-{kappa}B target genes is affected in the kidney of Lmx1b{sup -/-} knock-out mice, thus supporting the biological relevance of our findings. Together, these data demonstrate for the first time that LMX1B directly regulates transcription of a subset of NF-{kappa}B target genes in cooperation with nuclear p50/p65 NF-{kappa}B.« less
A new gene in A. rubens: A sea star Ig kappa gene.
Vincent, Nadine; Osteras, Magne; Otten, Patricia; Leclerc, Michel
2014-12-01
The sea star Asterias rubens reacts specifically to the antigen:HRP (horse-radish peroxydase) and produces an antibody anti-HRP. We previously identified a candidate Ig kappa gene corresponding to this manuscript. We show now the gene referred to as: "sea star Ig kappa gene in its specificity".
Townsend, Catherine L; Laffy, Julie M J; Wu, Yu-Chang Bryan; Silva O'Hare, Joselli; Martin, Victoria; Kipling, David; Fraternali, Franca; Dunn-Walters, Deborah K
2016-01-01
Antibody variable regions are composed of a heavy and a light chain, and in humans, there are two light chain isotypes: kappa and lambda. Despite their importance in receptor editing, the light chain is often overlooked in the antibody literature, with the focus being on the heavy chain complementarity-determining region (CDR)-H3 region. In this paper, we set out to investigate the physicochemical and structural differences between human kappa and lambda light chain CDR regions. We constructed a dataset containing over 29,000 light chain variable region sequences from IgM-transcribing, newly formed B cells isolated from human bone marrow and peripheral blood. We also used a published human naïve dataset to investigate the CDR-H3 properties of heavy chains paired with kappa and lambda light chains and probed the Protein Data Bank to investigate the structural differences between kappa and lambda antibody CDR regions. We found that kappa and lambda light chains have very different CDR physicochemical and structural properties, whereas the heavy chains with which they are paired do not differ significantly. We also observed that the mean CDR3 N nucleotide addition in the kappa, lambda, and heavy chain gene rearrangements are correlated within donors but can differ between donors. This indicates that terminal deoxynucleotidyl transferase may work with differing efficiencies between different people but the same efficiency in the different classes of immunoglobulin chain within one person. We have observed large differences in the physicochemical and structural properties of kappa and lambda light chain CDR regions. This may reflect different roles in the humoral immune response.
Townsend, Catherine L.; Laffy, Julie M. J.; Wu, Yu-Chang Bryan; Silva O’Hare, Joselli; Martin, Victoria; Kipling, David; Fraternali, Franca; Dunn-Walters, Deborah K.
2016-01-01
Antibody variable regions are composed of a heavy and a light chain, and in humans, there are two light chain isotypes: kappa and lambda. Despite their importance in receptor editing, the light chain is often overlooked in the antibody literature, with the focus being on the heavy chain complementarity-determining region (CDR)-H3 region. In this paper, we set out to investigate the physicochemical and structural differences between human kappa and lambda light chain CDR regions. We constructed a dataset containing over 29,000 light chain variable region sequences from IgM-transcribing, newly formed B cells isolated from human bone marrow and peripheral blood. We also used a published human naïve dataset to investigate the CDR-H3 properties of heavy chains paired with kappa and lambda light chains and probed the Protein Data Bank to investigate the structural differences between kappa and lambda antibody CDR regions. We found that kappa and lambda light chains have very different CDR physicochemical and structural properties, whereas the heavy chains with which they are paired do not differ significantly. We also observed that the mean CDR3 N nucleotide addition in the kappa, lambda, and heavy chain gene rearrangements are correlated within donors but can differ between donors. This indicates that terminal deoxynucleotidyl transferase may work with differing efficiencies between different people but the same efficiency in the different classes of immunoglobulin chain within one person. We have observed large differences in the physicochemical and structural properties of kappa and lambda light chain CDR regions. This may reflect different roles in the humoral immune response. PMID:27729912
IKK{epsilon} modulates RSV-induced NF-{kappa}B-dependent gene transcription
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang
2010-12-20
Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B). In this study we have investigated the role of the non canonical I{kappa}B kinase (IKK){epsilon} in modulating RSV-induced NF-{kappa}B activation. Our results show that inhibition of IKK{epsilon} activation results in significant impairment of viral-induced NF-{kappa}B-dependent gene expression, through a reduction in NF-{kappa}B transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absencemore » of IKK{epsilon} results in a significant decrease of RSV-induced NF-{kappa}B phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-{kappa}B-dependent gene expression, known to regulate NF-{kappa}B transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKK{epsilon} regulates viral-induced cellular signaling.« less
Lee, Dong-Kee; Kang, Jae-Eun; Park, Hye-Jin; Kim, Myung-Hwa; Yim, Tae-Hee; Kim, Jung-Min; Heo, Min-Kyu; Kim, Kyu-Yeun; Kwon, Ho Jeong; Hur, Man-Wook
2005-07-29
The POZ domain is a highly conserved protein-protein interaction motif found in many regulatory proteins. Nuclear factor-kappaB (NF-kappaB) plays a key role in the expression of a variety of genes in response to infection, inflammation, and stressful conditions. We found that the POZ domain of FBI-1 (factor that binds to the inducer of short transcripts of human immunodeficiency virus-1) interacted with the Rel homology domain of the p65 subunit of NF-kappaB in both in vivo and in vitro protein-protein interaction assays. FBI-1 enhanced NF-kappaB-mediated transcription of E-selectin genes in HeLa cells upon phorbol 12-myristate 13-acetate stimulation and overcame gene repression by IkappaB alpha or IkappaB beta. In contrast, the POZ domain of FBI-1, which is a dominant-negative form of FBI-1, repressed NF-kappaB-mediated transcription, and the repression was cooperative with IkappaB alpha or IkappaB beta. In contrast, the POZ domain tagged with a nuclear localization sequence polypeptide of FBI-1 enhanced NF-kappaB-responsive gene transcription, suggesting that the molecular interaction between the POZ domain and the Rel homology domain of p65 and the nuclear localization by the nuclear localization sequence are important in the transcription enhancement mediated by FBI-1. Confocal microscopy showed that FBI-1 increased NF-kappaB movement into the nucleus and increased the stability of NF-kappaB in the nucleus, which enhanced NF-kappaB-mediated transcription of the E-selectin gene. FBI-1 also interacted with IkappaB alpha and IkappaB beta.
Kappa2 opioid receptor subtype binding requires the presence of the DOR-1 gene.
Ansonoff, Michael A; Wen, Ting; Pintar, John E
2010-01-01
Over the past several years substantial evidence has documented that opioid receptor homo- and heterodimers form in cell lines expressing one or more of the opioid receptors. We used opioid receptor knockout mice to determine whether in vivo pharmacological characteristics of kappa1 and kappa2 opioid receptors changed following knockout of specific opioid receptors. Using displacement of the general opioid ligand diprenorphine, we observed that occupancy or knockout of the DOR-1 gene increases the binding density of kappa1 receptors and eliminates kappa2 receptors in crude membrane preparations while the total density of kappa opioid binding sites is unchanged. Further, the analgesic potency of U69,593 in cumulative dose response curves is enhanced in mice lacking the DOR-1 gene. These results demonstrate that the DOR-1 gene is required for the expression of the kappa2 opioid receptor subtype and are consistent with the possibility that a KOR-1/DOR-1 heterodimer mediates kappa2 pharmacology.
Bussmann, Bianca M.; Horn, Susanne; Sieg, Michael; Jassoy, Christian
2015-01-01
The diversity of virus-specific antibodies and of B cells among different individuals is unknown. Using single-cell cloning of antibody genes, we generated recombinant human monoclonal antibodies from influenza nucleoprotein-specific memory B cells in four adult humans with and without preceding influenza vaccination. We examined the diversity of the antibody repertoires and found that NP-specific B cells used numerous immunoglobulin genes. The heavy chains (HCs) originated from 26 and the kappa light chains (LCs) from 19 different germ line genes. Matching HC and LC chains gave rise to 43 genetically distinct antibodies that bound influenza NP. The median lengths of the CDR3 of the HC, kappa and lambda LC were 14, 9 and 11 amino acids, respectively. We identified changes at 13.6% of the amino acid positions in the V gene of the antibody heavy chain, at 8.4 % in the kappa and at 10.6 % in the lambda V gene. We identified somatic insertions or deletions in 8.1% of the variable genes. We also found several small groups of clonal relatives that were highly diversified. Our findings demonstrate broadly diverse memory B cell repertoires for the influenza nucleoprotein. We found extensive variation within individuals with a high number of point mutations, insertions, and deletions, and extensive clonal diversification. Thus, structurally conserved proteins can elicit broadly diverse and highly mutated B-cell responses. PMID:26086076
Feng, Jian Q; Xing, Lianping; Zhang, Jiang-Hong; Zhao, Ming; Horn, Diane; Chan, Jeannie; Boyce, Brendan F; Harris, Stephen E; Mundy, Gregory R; Chen, Di
2003-08-01
Bone morphogenetic protein-2 (BMP-2) regulates growth plate chondrogenesis during development and postnatal bone growth, but the control mechanisms of BMP-2 expression in growth plate chondrocytes are unknown. Here we have used both in vitro and in vivo approaches to demonstrate that transcription factor, NF-kappaB, regulates BMP-2 gene expression in chondrocytes. Two putative NF-kappaB response elements were found in the -2712/+165 region of the BMP-2 gene. Cotransfection of mutant I-kappaBalpha expression plasmids with BMP-2 promoter-luciferase reporters into TMC-23 chondrocyte cell line suppressed BMP-2 transcription. Mutations in NF-kappaB response elements in the BMP-2 gene lead to decreases in BMP-2 promoter activity. Electrophoretic mobility shift assay using nuclear extracts from TMC-23 chondrocytic cells revealed that the NF-kappaB subunits p50 and p65 bound to the NF-kappaB response elements of the BMP-2 gene. Thus, NF-kappaB may positively regulate BMP-2 gene transcription. Consistent with these findings, expression of BMP-2 mRNA was significantly reduced in growth plate chondrocytes in NF-kappaB p50/p52 dKO mice, which associated with decreased numbers of 5-bromo-2'-deoxyuridine (BrdUrd)-positive cells in the proliferating zone of growth plate in these mice. Therefore, in postnatal growth plate chondrocytes, expression of BMP-2 is regulated by NF-kappaB, which may play an important role in chondrogenesis.
Lee, Byung Lan; Lee, Hye Seung; Jung, Jieun; Cho, Sung Jin; Chung, Hee-Yong; Kim, Woo Ho; Jin, Young-Woo; Kim, Chong Soon; Nam, Seon Young
2005-04-01
Because the biological significance of constitutive nuclear factor-kappaB (NF-kappaB) activation in human gastric cancer is unclear, we undertook this study to clarify the regulatory mechanism of NF-kappaB activation and its clinical significance. Immunohistochemistry for NF-kappaB/RelA was done on 290 human gastric carcinoma specimens placed on tissue array slides. The correlations between NF-kappaB activation and clinicopathologic features, prognosis, Akt activation, tumor suppressor gene expression, or Bcl-2 expression were analyzed. We also did luciferase reporter assay, Western blot analysis, and reverse transcription-PCR using the SNU-216 human gastric cancer cell line transduced with retroviral vectors containing constitutively active Akt or the NF-kappaB repressor mutant of IkappaBalpha. Nuclear expression of RelA was found in 18% of the gastric carcinomas and was higher in early-stage pathologic tumor-node-metastasis (P = 0.019). A negative correlation was observed between NF-kappaB activation and lymphatic invasion (P = 0.034) and a positive correlation between NF-kappaB activation and overall survival rate of gastric cancer patients (P = 0.0228). In addition, NF-kappaB activation was positively correlated with pAkt (P = 0.047), p16 (P = 0.004), adenomatous polyposis coli (P < 0.001), Smad4 (P = 0.002), and kangai 1 (P < 0.001) expression. An in vitro study showed that NF-kappaB activity in gastric cancer cells is controlled by and controls Akt. NF-kappaB activation was frequently observed in early-stage gastric carcinoma and was significantly correlated with better prognosis and Akt activation. These findings suggest that NF-kappaB activation is a valuable prognostic variable in gastric carcinoma.
Transcription factor NF-kappaB participates in regulation of epithelial cell turnover in the colon.
Inan, M S; Tolmacheva, V; Wang, Q S; Rosenberg, D W; Giardina, C
2000-12-01
The transcription factor nuclear factor (NF)-kappaB regulates the expression of genes that can influence cell proliferation and death. Here we analyze the contribution of NF-kappaB to the regulation of epithelial cell turnover in the colon. Immunohistochemical, immunoblot, and DNA binding analyses indicate that NF-kappaB complexes change as colonocytes mature: p65-p50 complexes predominate in proliferating epithelial cells of the colon, whereas the p50-p50 dimer is prevalent in mature epithelial cells. NF-kappaB1 (p50) knockout mice were used to study the role of NF-kappaB in regulating epithelial cell turnover. Knockout animals lacked detectable NF-kappaB DNA binding activity in isolated epithelial cells and had significantly longer crypts with a more extensive proliferative zone than their wild-type counterparts (as determined by proliferating cell nuclear antigen staining and in vivo bromodeoxyuridine labeling). Gene expression profiling reveals that the NF-kappaB1 knockout mice express the potentially growth-enhancing tumor necrosis factor (TNF)-alpha and nerve growth factor-alpha genes at elevated levels, with in situ hybridization localizing some of the TNF-alpha expression to epithelial cells. TNF-alpha is NF-kappaB regulated, and its upregulation in NF-kappaB1 knockouts may result from an alleviation of p50-p50 repression. NF-kappaB complexes may therefore influence cell proliferation in the colon through their ability to selectively activate and/or repress gene expression.
Biased immunoglobulin light chain gene usage in the shark1
Iacoangeli, Anna; Lui, Anita; Naik, Ushma; Ohta, Yuko; Flajnik, Martin; Hsu, Ellen
2015-01-01
This study of a large family of kappa light (L) chain clusters in nurse shark completes the characterization of its classical immunoglobulin (Ig) gene content (two heavy chain classes, mu and omega, and four L chain isotopes, kappa, lambda, sigma, and sigma-2). The shark kappa clusters are minigenes consisting of a simple VL-JL-CL array, where V to J recombination occurs over a ~500 bp interval, and functional clusters are widely separated by at least 100 kb. Six out of ca. 39 kappa clusters are pre-rearranged in the germline (GL-joined). Unlike the complex gene organization and multistep assembly process of Ig in mammals, each shark Ig rearrangement, somatic or in the germline, appears to be an independent event localized to the minigene. This study examined the expression of functional, non-productive, and sterile transcripts of the kappa clusters compared to the other three L chain isotypes. Kappa cluster usage was investigated in young sharks, and a skewed pattern of split gene expression was observed, one similar in functional and non-productive rearrangements. These results show that the individual activation of the spatially distant kappa clusters is non-random. Although both split and GL-joined kappa genes are expressed, the latter are prominent in young animals and wane with age. We speculate that, in the shark, the differential activation of the multiple isotypes can be advantageously used in receptor editing. PMID:26342033
Hsuan, S L; Kannan, M S; Jeyaseelan, S; Prakash, Y S; Malazdrewich, C; Abrahamsen, M S; Sieck, G C; Maheswaran, S K
1999-05-01
In bovine alveolar macrophages (BAMs), exposure to leukotoxin (Lkt) and endotoxin (LPS) from Pasteurella haemolytica results in expression of inflammatory cytokine genes and intracellular calcium ([Ca2+]i) elevation. Leukotoxin from P. haemolytica interacts only with leukocytes and platelets from ruminant species. Upregulation of cytokine genes in different cells by LPS involves activation of the transcription factor NF-kappaB (NF-kappaB), resulting in its translocation from the cytoplasm to the nucleus. Using immunocytochemical staining and confocal imaging, we studied whether NF-kappaB activation represents a common mechanism for the expression of multiple cytokine genes in BAMs (Lkt-susceptible cells) stimulated with Lkt and LPS. Bovine pulmonary artery endothelial cells and porcine alveolar macrophages were used as nonsusceptible cells. The role of Ca2+ and tyrosine kinases in NF-kappaB activation and inflammatory cytokine gene expression was studied, since an inhibitor of tyrosine kinases attenuates LPS-induced [Ca2+]i elevation in BAMs. The results are summarized as follows: (a) Lkt induced NF-kappaB activation and [Ca2+]i elevation only in BAMs, while LPS effects were demonstrable in all cell types; (b) chelation of [Ca2+]i blocked NF-kappaB activation and IL-1beta, TNFalpha, and IL-8 mRNA expression; and (c) tyrosine kinase inhibitor herbimycin A blocked expression of all three cytokine genes in BAMs stimulated with Lkt, while only the expression of IL-1beta was blocked in BAMs stimulated with LPS. We conclude that cytokine gene expression in BAMs requires NF-kappaB activation and [Ca2+]i elevation, and Lkt effects exhibit cell type- and species specificity. Copyright 1999 Academic Press.
c-rel activates but v-rel suppresses transcription from kappa B sites.
Inoue, J; Kerr, L D; Ransone, L J; Bengal, E; Hunter, T; Verma, I M
1991-01-01
We show that the product of the protooncogene c-rel is a constituent of an NF-kappa B-like complex that binds to the kappa B site originally identified in the enhancer of immunoglobulin kappa light chain gene. c-rel protein synthesized in bacteria binds to the kappa B site in a sequence-specific manner. The rel-kappa B complex can be disrupted by incubation with anti-rel antibodies. The rel protein can form oligomers. The c-rel protein can activate transcription from promoters containing kappa B sites; v-rel, on the other hand, suppresses the transcription of genes linked to kappa B sites. Thus, v-rel may interfere with the normal transcriptional machinery of the cell by acting as a dominant negative mutant. Images PMID:2023921
Feddersen, R M; Van Ness, B G
1990-01-01
Previous characterization of mouse immunoglobulin kappa gene rearrangement products cloned from murine plasmacytomas has indicated that two recombination events can take place on a single kappa allele (R. M. Feddersen and B. G. Van Ness, Proc. Natl. Acad. Sci. USA 82:4792-4797, 1985; M. A. Shapiro and M. Weigert, J. Immunol. 139:3834-3839, 1987). To determine whether multiple recombinations on a single kappa allele can contribute to the formation of productive V-J genes through corrective recombinations, we have examined several Abelson murine leukemia virus-transformed pre-B-cell clones which rearrange the kappa locus during cell culture. Clonal cell lines which had rearranged one kappa allele nonproductively while maintaining the other allele in the germ line configuration were grown, and secondary subclones, which subsequently expressed kappa protein, were isolated and examined for further kappa rearrangement. A full spectrum of rearrangement patterns was observed in this sequential cloning, including productive and nonproductive recombinations of the germ line allele and secondary recombinations of the nonproductive allele. The results show that corrective V-J recombinations, with displacement of the nonproductive kappa gene, occur with a significant frequency (6 of 17 kappa-producing subclones). Both deletion and maintenance of the primary (nonfunctional) V-J join, as a reciprocal product, were observed. Images PMID:2153918
Kim, Byung Hak; Hong, Seong Su; Kwon, Soon Woo; Lee, Hwa Young; Sung, Hyeran; Lee, In-Jeong; Hwang, Bang Yeon; Song, Sukgil; Lee, Chong-Kil; Chung, Daehyun; Ahn, Byeongwoo; Nam, Sang-Yoon; Han, Sang-Bae; Kim, Youngsoo
2008-11-01
Diarctigenin was previously isolated as an inhibitor of nitric oxide (NO) production in macrophages from the seeds of Arctium lappa used as an alternative medicine for the treatment of inflammatory disorders. However, little is known about the molecular basis of these effects. Here, we demonstrated that diarctigenin inhibited the production of NO, prostaglandin E(2), tumor necrosis factor-alpha, and interleukin (IL)-1beta and IL-6 with IC(50) values of 6 to 12 miciroM in zymosan- or lipopolysaccharide-(LPS) activated macrophages. Diarctigenin attenuated zymosan-induced mRNA synthesis of inducible NO synthase (iNOS) and also inhibited promoter activities of iNOS and cytokine genes in the cells. Because nuclear factor (NF)-kappaB plays a pivotal role in inflammatory gene transcription, we next investigated the effect of diarctigenin on NF-kappaB activation. Diarctigenin inhibited the transcriptional activity and DNA binding ability of NF-kappaB in zymosan-activated macrophages but did not affect the degradation and phosphorylation of inhibitory kappaB (IkappaB) proteins. Moreover, diarctigenin suppressed expression vector NF-kappaB p65-elicited NF-kappaB activation and also iNOS promoter activity, indicating that the compound could directly target an NF-kappa-activating signal cascade downstream of IkappaB degradation and inhibit NF-kappaB-regulated iNOS expression. Diarctigenin also inhibited the in vitro DNA binding ability of NF-kappaB but did not affect the nuclear import of NF-kappaB p65 in the cells. Taken together, diarctigenin down-regulated zymosan- or LPS-induced inflammatory gene transcription in macrophages, which was due to direct inhibition of the DNA binding ability of NF-kappaB. Finally, this study provides a pharmacological potential of diarctigenin in the NF-kappaB-associated inflammatory disorders.
TAK1 regulates NF-{Kappa}B and AP-1 activation in airway epithelial cells following RSV infection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dey, Nilay; Liu Tianshuang; Garofalo, Roberto P.
2011-09-30
Respiratory syncytial virus (RSV) is the most common cause of epidemic respiratory diseases in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B) and AP-1. In this study, we have investigated the signaling pathway leading to activation of these two transcription factors in response to RSV infection. Our results show that IKK{beta} plays a key role in viral-induced NF-{kappa}B activation, while JNK regulates AP-1-dependent gene transcription, as demonstrated by using kinase inactive proteins and chemical inhibitors of the two kinases.more » Inhibition of TAK1 activation, by overexpression of kinase inactive TAK1 or using cells lacking TAK1 expression, significantly reduced RSV-induced NF-{kappa}B and AP-1 nuclear translocation and DNA-binding activity, as well as NF-{kappa}B-dependent gene expression, identifying TAK1 as an important upstream signaling molecule regulating RSV-induced NF-{kappa}B and AP-1 activation. - Highlights: > IKK{beta} is a major kinase involved in RSV-induced NF-{kappa}B activation. > JNK regulates AP-1-dependent gene transcription in RSV infection. > TAK1 is a critical upstream signaling molecule for both pathways in infected cells.« less
Arun, Pattatheyil; Brown, Matthew S; Ehsanian, Reza; Chen, Zhong; Van Waes, Carter
2009-10-01
Aberrant nuclear activation and phosphorylation of the canonical NF-kappaB subunit RELA/p65 at Serine-536 by inhibitor kappaB kinase is prevalent in head and neck squamous cell carcinoma (HNSCC), but the role of other kinases in NF-kappaB activation has not been well defined. Here, we investigated the prevalence and function of p65-Ser276 phosphorylation by protein kinase A (PKA) in the malignant phenotype and gene transactivation, and studied p65-Ser276 as a potential target for therapy. Phospho and total p65 protein expression and localization were determined in HNSCC tissue array and in cell lines. The effects of the PKA inhibitor H-89 on NF-kappaB activation, downstream gene expression, cell proliferation and cell cycle were examined. Knockdown of PKA by specific siRNA confirmed the specificity. NF-kappaB p65 phosphorylated at Ser276 was prevalent in HNSCC and adjacent dysplastic mucosa, but localized to the cytoplasm in normal mucosa. In HNSCC lines, tumor necrosis factor-alpha (TNF-alpha) significantly increased, whereas H-89 inhibited constitutive and TNF-alpha-induced nuclear p65 (Ser276) phosphorylation, and significantly suppressed NF-kappaB and target gene IL-8 reporter activity. Knockdown of PKA by small interfering RNA inhibited NF-kappaB, IL-8, and BCL-XL reporter gene activities. H-89 suppressed cell proliferation, induced cell death, and blocked the cell cycle in G(1)-S phase. Consistent with its biological effects, H-89 down-modulated expression of NF-kappaB-related genes Cyclin D1, BCL2, BCL-XL, COX2, IL-8, and VEGF, as well as induced cell cycle inhibitor p21(CIP1/WAF1), while suppressing proliferative marker Ki67. NF-kappaB p65 (Ser276) phosphorylation by PKA promotes the malignant phenotype and holds potential as a therapeutic target in HNSCC.
NF-kappaB mediates FGF signal regulation of msx-1 expression.
Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V
2001-09-01
The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.
Cismasiu, Valeriu B; Duque, Javier; Paskaleva, Elena; Califano, Danielle; Ghanta, Sailaja; Young, Howard A; Avram, Dorina
2009-01-15
BCL11B is a transcriptional regulator with an important role in T-cell development and leukaemogenesis. We demonstrated recently that BCL11B controls expression from the IL (interleukin)-2 promoter through direct binding to the US1 (upstream site 1). In the present study, we provide evidence that BCL11B also participates in the activation of IL-2 gene expression by enhancing NF-kappaB (nuclear factor kappaB) activity in the context of TCR (T-cell receptor)/CD28-triggered T-cell activation. Enhanced NF-kappaB activation is not a consequence of BCL11B binding to the NF-kappaB response elements or association with the NF-kappaB-DNA complexes, but rather the result of higher translocation of NF-kappaB to the nucleus caused by enhanced degradation of IkappaB (inhibitor of NF-kappaB). The enhanced IkappaB degradation in cells with increased levels of BCL11B was specific for T-cells activated through the TCR, but not for cells activated through TNFalpha (tumour necrosis factor alpha) or UV light, and was caused by increased activity of IkappaB kinase, as indicated by its increase in phosphorylation. As BCL11B is a transcription factor, we investigated whether the expression of genes upstream of IkappaB kinase in the TCR/CD28 signalling pathway was affected by increased BCL11B expression, and found that Cot (cancer Osaka thyroid oncogene) kinase mRNA levels were elevated. Cot kinase is known to promote enhanced IkappaB kinase activity, which results in the phosphorylation and degradation of IkappaB and activation of NF-kappaB. The implied involvement of Cot kinase in BCL11B-mediated NF-kappaB activation in response to TCR activation is supported by the fact that a Cot kinase dominant-negative mutant or Cot kinase siRNA (small interfering RNA) knockdown blocked BCL11B-mediated NF-kappaB activation. In support of our observations, in the present study we report that BCL11B enhances the expression of several other NF-kappaB target genes, in addition to IL-2. In addition, we provide evidence that BCL11B associates with intron 2 of the Cot kinase gene to regulate its expression.
Fiedler, M A; Wernke-Dollries, K; Stark, J M
1998-08-01
The working hypothesis of the studies described herein was that inhibition of proteasome-mediated IkappaB degradation would inhibit TNF-alpha-induced nuclear factor-kappaB (NF-kappaB) activation, interleukin-8 (IL-8) gene transcription, and IL-8 protein release in A549 cells. Mutational analysis of the 5' flanking region of the IL-8 gene confirmed that an intact NF-kappaB site is necessary for TNF-alpha-induced IL-8 gene transcription. The addition of TNF-alpha to A549 cells resulted in rapid loss of IkappaB from the cytoplasm of cells, associated with a corresponding increase in NF-kappaB-binding activity in nuclear extracts from the cells. However, pretreatment of the cells with the proteasome inhibitor N-cbz-Leu-Leu-leucinal (MG-132, 10 microM) reversed the effects of TNF-alpha on IL-8 release from A549 cells (as determined with an enzyme-linked immunosorbent assay [ELISA]) and on IL-8 gene transcription (as determined with reporter-gene assays). MG-132 reversed the effects of TNF-alpha on IkappaB degradation as determined by Western blot analysis. IkappaB phosphorylation and ubiquination were not altered by MG-132, which implies that the effects of MG-132 were secondary to proteasome inhibition. MG-132 also reversed the increase in NF-kappaB binding in nuclear extracts from TNF-alpha-treated cells. These studies show that inhibition of proteasome-mediated IkappaB degradation results in inhibition of TNF-alpha induced IL-8 production in A549 cells by limiting NF-kappaB-mediated gene transcription.
Simonin, F; Gavériaux-Ruff, C; Befort, K; Matthes, H; Lannes, B; Micheletti, G; Mattéi, M G; Charron, G; Bloch, B; Kieffer, B
1995-01-01
Using the mouse delta-opioid receptor cDNA as a probe, we have isolated genomic clones encoding the human mu- and kappa-opioid receptor genes. Their organization appears similar to that of the human delta receptor gene, with exon-intron boundaries located after putative transmembrane domains 1 and 4. The kappa gene was mapped at position q11-12 in human chromosome 8. A full-length cDNA encoding the human kappa-opioid receptor has been isolated. The cloned receptor expressed in COS cells presents a typical kappa 1 pharmacological profile and is negatively coupled to adenylate cyclase. The expression of kappa-opioid receptor mRNA in human brain, as estimated by reverse transcription-polymerase chain reaction, is consistent with the involvement of kappa-opioid receptors in pain perception, neuroendocrine physiology, affective behavior, and cognition. In situ hybridization studies performed on human fetal spinal cord demonstrate the presence of the transcript specifically in lamina II of the dorsal horn. Some divergences in structural, pharmacological, and anatomical properties are noted between the cloned human and rodent receptors. Images Fig. 3 Fig. 4 PMID:7624359
Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H
1990-11-01
Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia.
Paul, N L; Lenardo, M J; Novak, K D; Sarr, T; Tang, W L; Ruddle, N H
1990-01-01
Human T-cell leukemia virus type I (HTLV-I)-infected T-cell lines constitutively produce high levels of biologically active lymphotoxin (LT; tumor necrosis factor-beta) protein and LT mRNA. To understand the regulation of LT transcription by HTLV-I, we analyzed the ability of a series of deletions of the LT promoter to drive the chloramphenicol acetyltransferase (CAT) reporter gene in HTLV-I-positive MT-2 cells. The smallest LT promoter fragment (-140 to +77) that was able to drive CAT activity contained a site that was similar to the immunoglobulin kappa-chain NF-kappa B-binding site. Since the HTLV-I tax gene activates the nuclear form of NF-kappa B, this finding suggested a possible means of HTLV-I activation of LT production. We found that the LT kappa B-like site specifically formed a complex with NF-kappa B-containing nuclear extract from MT-2, C81-66-45, and other activated T cells. Mutation of the LT kappa B site in the context of the LT promoter (-293 to +77) (mutant M1) reduced the ability of the promoter to drive the CAT gene in HTLV-I-infected and noninfected human T-cell lines. These data suggest a general role for NF-kappa B activation in the induction of LT gene transcription. Activation of LT in HTLV-I-infected cells may explain the pathology associated with HTLV-I infection, including the hypercalcemia that is prevalent in adult T-cell leukemia. Images PMID:1976820
Merin, J P; Matsuyama, M; Kira, T; Baba, M; Okamoto, T
1996-09-23
Gene expression of human immunodeficiency virus (HIV) depends on a host cellular transcription factors including nuclear factor-kappaB (NF-kappaB). The involvement of reactive oxygen intermediates (ROI) has been implicated as intracellular messengers in the inducible activation of NF-kappaB. In this study, we compared the efficacy of two antioxidants, alpha-lipoic acid (LA) and N-acetylcysteine (NAC), which are widely recognized NF-kappaB inhibitors. Here, we demonstrate that LA has a more potent activity in inhibiting NF-KappaB-mediated gene expression in THP-1 cells that have been stably transfected with a plasmid bearing a hygromycin B resistance gene under the control of HIV-1 long terminal repeat (LTR) promoter. The spontaneous activation of NF-kappaB in this cell culture system leads to expression of the hygromycin phosphotransferase gene hence rendering the cells resistance to hygromycin B. In this study, the effect of the test compounds against transcriptional activity of HIV-1 LTR was evaluated based on the degree of cellular toxicity due to the inhibitory activity on the expression of hygromycin B resistance gene in the presence of hygromycin B. We also found that 0.2 mM LA could cause 40% reduction in the HIV-1 expression from the TNF-alpha-stimulated OM 10.1, a cell line latently infected with HIV-1. On the other hand, 10 mM NAC was required to elicit the same effect. Furthermore, the initiation of HIV-1 induction by TNF-alpha was completely abolished by 1 mM LA. These findings confirm the involvement of ROI in NF-kappaB-mediated HIV gene expression as well as the efficacy of LA as a therapeutic regimen for HIV infection and acquired immunodeficiency syndrome (AIDS). Moreover, this study validates the applicability of our present assay system which we primarily designed for the screening of candidate drugs against HIV-1 gene expression.
Ryu, Hoon; Smith, Karen; Camelo, Sandra I; Carreras, Isabel; Lee, Junghee; Iglesias, Antonio H; Dangond, Fernando; Cormier, Kerry A; Cudkowicz, Merit E; Brown, Robert H; Ferrante, Robert J
2005-06-01
Multiple molecular defects trigger cell death in amyotrophic lateral sclerosis (ALS). Among these, altered transcriptional activity may perturb many cellular functions, leading to a cascade of secondary pathological effects. We showed that pharmacological treatment, using the histone deacetylase inhibitor sodium phenylbutyrate, significantly extended survival and improved both the clinical and neuropathological phenotypes in G93A transgenic ALS mice. Phenylbutyrate administration ameliorated histone hypoacetylation observed in G93A mice and induced expression of nuclear factor-kappaB (NF-kappaB) p50, the phosphorylated inhibitory subunit of NF-kappaB (pIkappaB) and beta cell lymphoma 2 (bcl-2), but reduced cytochrome c and caspase expression. Curcumin, an NF-kappaB inhibitor, and mutation of the NF-kappaB responsive element in the bcl-2 promoter, blocked butyrate-induced bcl-2 promoter activity. We provide evidence that the pharmacological induction of NF-kappaB-dependent transcription and bcl-2 gene expression is neuroprotective in ALS mice by inhibiting programmed cell death. Phenylbutyrate acts to phosphorylate IkappaB, translocating NF-kappaB p50 to the nucleus, or to directly acetylate NF-kappaB p50. NF-kappaB p50 transactivates bcl-2 gene expression. Up-regulated bcl-2 blocks cytochrome c release and subsequent caspase activation, slowing motor neuron death. These transcriptional and post-translational pathways ultimately promote motor neuron survival and ameliorate disease progression in ALS mice. Phenylbutyrate may therefore provide a novel therapeutic approach for the treatment of patients with ALS.
Respiratory syncytial virus M2-1 protein induces the activation of nuclear factor kappa B
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reimers, Kerstin; Buchholz, Katja; Werchau, Hermann
2005-01-20
Respiratory syncytial virus (RSV) induces the production of a number of cytokines and chemokines by activation of nuclear factor kappa B (NF-{kappa}B). The activation of NF-{kappa}B has been shown to depend on viral replication in the infected cells. In this study, we demonstrate that expression of RSV M2-1 protein, a transcriptional processivity and anti-termination factor, is sufficient to activate NF-{kappa}B in A549 cells. Electromobility shift assays show increased NF-{kappa}B complexes in the nuclei of M2-1-expressing cells. M2-1 protein is found in nuclei of M2-1-expressing cells and in RSV-infected cells. Co-immunoprecipitations of nuclear extracts of M2-1-expressing cells and of RSV-infected cellsmore » revealed an association of M2-1 with Rel A protein. Furthermore, the activation of NF-{kappa}B depends on the C-terminus of the RSV M2-1 protein, as shown by NF-{kappa}B-induced gene expression of a reporter gene construct.« less
NF-{kappa}B regulates Lef1 gene expression in chondrocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yun, Kangsun; Choi, Yoo Duk; Nam, Jong Hee
The relation of Wnt/{beta}-catenin signaling to osteoarthritis progression has been revealed with little information on the underlying molecular mechanism. In this study we found overexpression of Lef1 in cartilage tissue of osteoarthritic patients and elucidated molecular mechanism of NF-{kappa}B-mediated Lef1 gene regulation in chondrocytes. Treatment of IL-1{beta} augmented Lef1 upregulation and nuclear translocation of NF-{kappa}B in chondrocytes. Under IL-1{beta} signaling, treatment of NF-{kappa}B nuclear translocation inhibitor SN-50 reduced Lef1 expression. A conserved NF-{kappa}B-binding site between mouse and human was selected through bioinformatic analysis and mapped at the 14 kb upstream of Lef1 transcription initiation site. NF-{kappa}B binding to the sitemore » was confirmed by chromatin immunoprecipitation assay. Lef1 expression was synergistically upregulated by interactions of NF-{kappa}B with Lef1/{beta}-catenin in chondrocytes. Our results suggest a pivotal role of NF-{kappa}B in Lef1 expression in arthritic chondrocytes or cartilage degeneration.« less
Interrater reliability: the kappa statistic.
McHugh, Mary L
2012-01-01
The kappa statistic is frequently used to test interrater reliability. The importance of rater reliability lies in the fact that it represents the extent to which the data collected in the study are correct representations of the variables measured. Measurement of the extent to which data collectors (raters) assign the same score to the same variable is called interrater reliability. While there have been a variety of methods to measure interrater reliability, traditionally it was measured as percent agreement, calculated as the number of agreement scores divided by the total number of scores. In 1960, Jacob Cohen critiqued use of percent agreement due to its inability to account for chance agreement. He introduced the Cohen's kappa, developed to account for the possibility that raters actually guess on at least some variables due to uncertainty. Like most correlation statistics, the kappa can range from -1 to +1. While the kappa is one of the most commonly used statistics to test interrater reliability, it has limitations. Judgments about what level of kappa should be acceptable for health research are questioned. Cohen's suggested interpretation may be too lenient for health related studies because it implies that a score as low as 0.41 might be acceptable. Kappa and percent agreement are compared, and levels for both kappa and percent agreement that should be demanded in healthcare studies are suggested.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Shanqin; Zhi, Hui; Hou, Xiuyun
2011-07-08
Highlights: {yields} We examine how angiotensin II modulates ERK-NF-{kappa}B crosstalk and gene expression. {yields} Angiotensin II suppresses IL-1{beta}-induced prolonged ERK and NF-{kappa}B activation. {yields} ERK-RSK1 signaling is required for IL-1{beta}-induced prolonged NF-{kappa}B activation. {yields} Angiotensin II modulates NF-{kappa}B responsive genes via regulating ERK-NF-{kappa}B crosstalk. {yields} ERK-NF-{kappa}B crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. Inmore » cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1{beta}-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-{kappa}B, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1{beta}-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1{beta}, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE{sup -/-}) mice. VCAM-1 and iNOS expression were higher in ApoE{sup -/-} than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE{sup -/-} mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin II can differentially modulate inflammatory gene expression in aortic smooth muscle cells through influencing ERK-NF-{kappa}B crosstalk, which may contribute to angiotensin II-induced inflammatory disorders related to cardiovascular diseases.« less
Genetics Home Reference: anhidrotic ectodermal dysplasia with immune deficiency
... The proteins produced from these two genes regulate nuclear factor-kappa-B. Nuclear factor-kappa-B is a group of related ... proteins with impaired function, which reduces activation of nuclear factor-kappa-B. These changes disrupt certain signaling ...
Wolschendorf, Frank; Duverger, Alexandra; Jones, Jennifer; Wagner, Frederic H; Huff, Jason; Benjamin, William H; Saag, Michael S; Niederweis, Michael; Kutsch, Olaf
2010-09-01
Current antiretroviral therapy (ART) efficiently controls HIV-1 replication but fails to eradicate the virus. Even after years of successful ART, HIV-1 can conceal itself in a latent state in long-lived CD4(+) memory T cells. From this latent reservoir, HIV-1 rebounds during treatment interruptions. Attempts to therapeutically eradicate this viral reservoir have yielded disappointing results. A major problem with previously utilized activating agents is that at the concentrations required for efficient HIV-1 reactivation, these stimuli trigger high-level cytokine gene expression (hypercytokinemia). Therapeutically relevant HIV-1-reactivating agents will have to trigger HIV-1 reactivation without the induction of cytokine expression. We present here a proof-of-principle study showing that this is a possibility. In a high-throughput screening effort, we identified an HIV-1-reactivating protein factor (HRF) secreted by the nonpathogenic bacterium Massilia timonae. In primary T cells and T-cell lines, HRF triggered a high but nonsustained peak of nuclear factor kappa B (NF-kappaB) activity. While this short NF-kappaB peak potently reactivated latent HIV-1 infection, it failed to induce gene expression of several proinflammatory NF-kappaB-dependent cellular genes, such as those for tumor necrosis factor alpha (TNF-alpha), interleukin-8 (IL-8), and gamma interferon (IFN-gamma). Dissociation of cellular and viral gene induction was achievable, as minimum amounts of Tat protein, synthesized following application of a short NF-kappaB pulse, triggered HIV-1 transactivation and subsequent self-perpetuated HIV-1 expression. In the absence of such a positive feedback mechanism, cellular gene expression was not sustained, suggesting that strategies modulating the NF-kappaB activity profile could be used to selectively trigger HIV-1 reactivation.
EWS-FLI1 inhibits TNF{alpha}-induced NF{kappa}B-dependent transcription in Ewing sarcoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagirand-Cantaloube, Julie, E-mail: julie.cantaloube@crbm.cnrs.fr; Laud, Karine, E-mail: karine.laud@curie.fr; Institut Curie, Genetique et biologie des cancers, Paris
2010-09-03
Research highlights: {yields} EWS-FLI1 interferes with TNF-induced activation of NF{kappa}B in Ewing sarcoma cells. {yields} EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NF{kappa}B binding to DNA. {yields} EWS-FLI1 reduces TNF-stimulated NF{kappa}B-dependent transcriptional activation. {yields} Constitutive NF{kappa}B activity is not affected by EWS-FLI1. {yields} EWS-FLI1 physically interacts with NF{kappa}B p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NF{kappa}B) is a tightly regulated transcription factor controllingmore » cell survival, proliferation and differentiation, as well as tumorigenesis. NF{kappa}B activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NF{kappa}B activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NF{kappa}B basal activity, but impairs TNF-induced NF{kappa}B-driven transcription, at least in part through inhibition of NF{kappa}B binding to DNA. We detected an in vivo physical interaction between the fusion protein and NF{kappa}B p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NF{kappa}B.« less
Majumdar, Sekhar; Lamothe, Betty; Aggarwal, Bharat B
2002-03-15
Thalidomide ([+]-alpha-phthalimidoglutarimide), a psychoactive drug that readily crosses the blood-brain barrier, has been shown to exhibit anti-inflammatory, antiangiogenic, and immunosuppressive properties through a mechanism that is not fully established. Due to the central role of NF-kappaB in these responses, we postulated that thalidomide mediates its effects through suppression of NF-kappaB activation. We investigated the effects of thalidomide on NF-kappaB activation induced by various inflammatory agents in Jurkat cells. The treatment of these cells with thalidomide suppressed TNF-induced NF-kappaB activation, with optimum effect occurring at 50 microg/ml thalidomide. These effects were not restricted to T cells, as other hematopoietic and epithelial cell types were also inhibited. Thalidomide suppressed H(2)O(2)-induced NF-kappaB activation but had no effect on NF-kappaB activation induced by PMA, LPS, okadaic acid, or ceramide, suggesting selectivity in suppression of NF-kappaB. The suppression of TNF-induced NF-kappaB activation by thalidomide correlated with partial inhibition of TNF-induced degradation of an inhibitory subunit of NF-kappaB (IkappaBalpha), abrogation of IkappaBalpha kinase activation, and inhibition of NF-kappaB-dependent reporter gene expression. Thalidomide abolished the NF-kappaB-dependent reporter gene expression activated by overexpression of TNFR1, TNFR-associated factor-2, and NF-kappaB-inducing kinase, but not that activated by the p65 subunit of NF-kappaB. Overall, our results clearly demonstrate that thalidomide suppresses NF-kappaB activation specifically induced by TNF and H(2)O(2) and that this may contribute to its role in suppression of proliferation, inflammation, angiogenesis, and the immune system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zezza, D.J.; Stewart, S.E.; Steiner, L.A.
1992-12-15
Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less
Activation of endothelial-leukocyte adhesion molecule 1 (ELAM-1) gene transcription
DOE Office of Scientific and Technical Information (OSTI.GOV)
Montgomery, K.F.; Tarr, P.I.; Bomsztyk, K.
1991-08-01
Leukocyte adherence to endothelium is in part mediated by the transient expression of endothelial-leukocyte adhesion molecule 1 (ELAM-1) on endothelial surfaces stimulated by tumor necrosis factor {alpha} (TNF), interleukin (IL) 1, or bacterial lipopolysaccharide (LPS). The intracellular factors controlling induction of ELAM-1 mRNA and protein are unknown. In nuclear runoff experiments with cultured human umbilical vein endothelial cells (HUVEC), the authors demonstrate that transcriptional activation of the ELAM-1 gene occurs following stimulation with TNF. Sequence analysis of the 5{prime} flanking region of the ELAM-1 gene reveals consensus DNA-binding sequences for two known transcription factors, NF-{kappa}B and AP-1. Gel mobility shiftmore » assays demonstrate that TNF, IL-1, or LPS induces activation of NF-{kappa}B-like DNA binding activity in HUVEC. Phorbol 12-myristate 13-acetate, a known activator of protein kinase C (PKC), weakly induces NF-{kappa}B-like activity, ELAM-1 mRNA, and ELAM-1 surface expression in HUVEC. However, TNF, IL-1, and LPS do not activate PKC in HUVEC at doses that strongly induce NF-{kappa}B-like protein activation and ELAM-1 gene expression. PKC blockade with H7 does not inhibit activation of these NF-kB-like proteins but does inhibit ELAM-1 gene transcription. They conclude that PKC-independent activation of NF-{kappa}B in HUVEC with TNF, IL-1, or LPS is associated with, but not sufficient for, activation of ELAM-1 gene transcription.« less
Vermes, C; Roebuck, K A; Chandrasekaran, R; Dobai, J G; Jacobs, J J; Glant, T T
2000-09-01
Particulate wear debris generated mechanically from prosthetic materials is phagocytosed by a variety of cell types within the periprosthetic space including osteoblasts, which cells with an altered function may contribute to periprosthetic osteolysis. Exposure of osteoblast-like osteosarcoma cells or bone marrow-derived primary osteoblasts to either metallic or polymeric particles of phagocytosable sizes resulted in a marked decrease in the steady-state messenger RNA (mRNA) levels of procollagen alpha1[I] and procollagen alpha1[III]. In contrast, no significant effect was observed for the osteoblast-specific genes, such as osteonectin and osteocalcin (OC). In kinetic studies, particles once phagocytosed, maintained a significant suppressive effect on collagen gene expression and type I collagen synthesis for up to five passages. Large particles of a size that cannot be phagocytosed also down-regulated collagen gene expression suggesting that an initial contact between cells and particles can generate gene responsive signals independently of the phagocytosis process. Concerning such signaling, titanium particles rapidly increased protein tyrosine phosphorylation and nuclear transcription factor kappaB (NF-kappaB) binding activity before the phagocytosis of particles. Protein tyrosine kinase (PTK) inhibitors such as genistein and the NF-kappaB inhibitor pyrrolidine dithiocarbamate (PDTC) significantly reduced the suppressive effect of titanium on collagen gene expression suggesting particles suppress collagen gene expression through the NF-kappaB signaling pathway. These results provide a mechanism by which particulate wear debris can antagonize the transcription of the procollagen alpha1[I] gene in osteoblasts, which may contribute to reduced bone formation and progressive periprosthetic osteolysis.
African swine fever virus IAP-like protein induces the activation of nuclear factor kappa B.
Rodríguez, Clara I; Nogal, María L; Carrascosa, Angel L; Salas, María L; Fresno, Manuel; Revilla, Yolanda
2002-04-01
African swine fever virus (ASFV) encodes a homologue of the inhibitor of apoptosis (IAP) that promotes cell survival by controlling the activity of caspase-3. Here we show that ASFV IAP is also able to activate the transcription factor NF-kappaB. Thus, transient transfection of the viral IAP increases the activity of an NF-kappaB reporter gene in a dose-responsive manner in Jurkat cells. Similarly, stably transfected cells expressing ASFV IAP have elevated basal levels of c-rel, an NF-kappaB-dependent gene. NF-kappaB complexes in the nucleus were increased in A224L-expressing cells compared with control cells upon stimulation with phorbol myristate acetate (PMA) plus ionomycin. This resulted in greater NF-kappaB-dependent promoter activity in ASFV IAP-expressing than in control cells, both in basal conditions and after PMA plus ionophore stimulation. The elevated NF-kappaB activity seems to be the consequence of higher IkappaB kinase (IKK) basal activity in these cells. The NF-kappaB-inducing activity of ASFV IAP was abrogated by an IKK-2 dominant negative mutant and enhanced by expression of tumor necrosis factor receptor-associated factor 2.
Faruqi, R M; Poptic, E J; Faruqi, T R; De La Motte, C; DiCorleto, P E
1997-08-01
We have examined the effects of N-acetyl-L-cysteine (NAC), a well-characterized, thiol-containing antioxidant, on agonist-induced monocytic cell adhesion to endothelial cells (EC). NAC inhibited interleukin-1 (IL-1 beta)-induced, but not basal, adhesion with 50% inhibition at approximately 20 mM. Monocytic cell adhesion to EC in response to tumor necrosis factor-alpha (TNF-alpha), lipopolysaccharide (LPS), alpha-thrombin, or phorbol 12-myristate 13-acetate (PMA) was similarly inhibited by NAC. Unlike published studies with pyrrolidinedithiocarbamate, which specifically inhibited vascular cell adhesion molecule 1 (VCAM-1), NAC inhibited IL-1 beta-induced mRNA and cell surface expression of both E-selectin and VCAM-1. NAC had no effect on the half-life of E-selectin or VCAM-1 mRNA. Although NAC reduced nuclear factor-kappa B (NF-kappa B) activation in EC as measured by gel-shift assays using an oligonucleotide probe corresponding to the consensus NF-kappa B binding sites of the VCAM-1 gene (VCAM-NF-kappa B), the antioxidant had no appreciable effect when an oligomer corresponding to the consensus NF-kappa B binding site of the E-selectin gene (E-selectin-NF-kappa B) was used. Because NF-kappa B has been reported to be redox sensitive, we studied the effects of NAC on the EC redox environment. NAC caused an expected dramatic increase in the reduced glutathione (GSH) levels in EC. In vitro studies demonstrated that whereas the binding affinity of NF-kappa B to the VCAM-NF-kappa B oligomer peaked at a GSH-to-oxidized glutathione (GSSG) ratio of approximately 200 and decreased at higher ratios, the binding to the E-selectin-NF-kappa B oligomer appeared relatively unaffected even at ratios > 400, i.e., those achieved in EC treated with 40 mM NAC. These results suggest that NF-kappa B binding to its consensus sequences in the VCAM-1 and E-selectin gene exhibits marked differences in redox sensitivity, allowing for differential gene expression regulated by the same transcription factor. Our data also demonstrate that NAC increases the GSH-to-GSSG ratio within the EC suggesting one possible mechanism through which this antioxidant inhibits agonist-induced monocyte adhesion to EC.
Hass, R; Brach, M; Gunji, H; Kharbanda, S; Kufe, D
1992-10-20
The treatment of human myeloid leukemia cells (HL-60, U-937, THP-1) with 12-O-tetradecanoylphorbol-13-acetate (TPA) is associated with growth arrest and appearance of a differentiated monocytic phenotype. While previous studies have reported that the glucocorticoid dexamethasone blocks phenotypic characteristics of monocytic differentiation, we demonstrated in the present work that dexamethasone delays the effects of TPA on the loss of U-937 cell proliferation. We also demonstrated that this glucocorticoid inhibits TPA-induced increases in expression of the EGR-1 early response gene. The results of nuclear run-on assays and half-life experiments indicated that this effect of dexamethasone is regulated at the post-transcriptional level. Similar studies were performed for the NF-kappa B gene. While TPA treatment was associated with transient increases in NF-kappa B mRNA levels, this induction was blocked by dexamethasone. In contrast, dexamethasone had no significant effect on the activation of pre-existing NF-kappa B protein as determined in DNA-binding assays. Taken together, these findings suggest that the activated glucocorticoid receptor inhibits signaling pathways which include expression of the EGR-1 and NF-kappa B genes and that such effects may contribute to a block in TPA-induced monocytic differentiation.
Gomes, Douglas S; Porto, Simone S; Balabram, Débora; Gobbi, Helenice
2014-06-19
This study aimed to assess inter-observer variability between the original diagnostic reports and later review by a specialist in breast pathology considering lobular neoplasias (LN), columnar cell lesions (CCL), atypical ductal hyperplasia (ADH), and ductal carcinoma in situ (DCIS) of the breast. A retrospective, observational, cross-sectional study was conducted. A total of 610 breast specimens that had been formally sent for consultation and/or second opinions to the Breast Pathology Laboratory of Federal University of Minas Gerais were analysed between January 2005 and December 2010. The inter-observer variability between the original report and later review was compared regarding the diagnoses of LN, CCL, ADH, and DCIS. Statistical analyses were conducted using the Kappa index. Weak correlations were observed for the diagnoses of columnar cell change (CCC; Kappa=0.38), columnar cell hyperplasia (CCH; Kappa=0.32), while a moderate agreement (Kappa=0.47) was observed for the diagnoses of flat epithelial atypia (FEA). Good agreement was observed in the diagnoses of atypical lobular hyperplasia (ALH; Kappa=0.62) and lobular carcinoma in situ (LCIS; Kappa=0.66). However, poor agreement was observed for the diagnoses of pleomorphic LCIS (Kappa=0.22). Moderate agreement was observed for the diagnoses of ADH (Kappa=0.44), low-grade DCIS (Kappa=0.47), intermediate-grade DCIS (Kappa=0.45), and DCIS with microinvasion (Kappa=0.56). Good agreement was observed between the diagnoses of high-grade DCIS (Kappa=0.68). According to our data, the best diagnostic agreements were observed for high-grade DCIS, ALH, and LCIS. CCL without atypia and pleomorphic LCIS had the worst agreement indices. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1640072350119725.
Ghiotto, Fabio; Marcatili, Paolo; Tenca, Claudya; Calevo, Maria Grazia; Yan, Xiao-Jie; Albesiano, Emilia; Bagnara, Davide; Colombo, Monica; Cutrona, Giovanna; Chu, Charles C; Morabito, Fortunato; Bruno, Silvia; Ferrarini, Manlio; Tramontano, Anna; Fais, Franco; Chiorazzi, Nicholas
2011-01-01
B-cell chronic lymphocytic leukemia (CLL) patients display leukemic clones bearing either germline or somatically mutated immunoglobulin heavy variable (IGHV ) genes. Most information on CLL immunoglobulins (Igs), such as the definition of stereotyped B-cell receptors (BCRs), was derived from germline unmutated Igs. In particular, detailed studies on the distribution and nature of mutations in paired heavy- and light-chain domains of CLL clones bearing mutated Igs are lacking. To address the somatic hyper-mutation dynamics of CLL Igs, we analyzed the mutation pattern of paired IGHV–diversity-joining (IGHV-D-J ) and immunoglobulin kappa/lambda variable-joining (IGK/LV-J ) rearrangements of 193 leukemic clones that displayed ≥2% mutations in at least one of the two immunoglobulin variable (IGV ) genes (IGHV and/or IGK/LV ). The relationship between the mutation frequency in IGHV and IGK/LV complementarity determining regions (CDRs) and framework regions (FRs) was evaluated by correlation analysis. Replacement (R) mutation frequency within IGK/LV chain CDRs correlated significantly with mutation frequency of paired IGHV CDRs in λ but not κ isotype CLL clones. CDRs of IGKV-J rearrangements displayed a lower percentage of R mutations than IGHVs. The frequency/pattern of mutations in kappa CLL Igs differed also from that in κ-expressing normal B cells described in the literature. Instead, the mutation frequency within the FRs of IGHV and either IGKV or IGLV was correlated. Notably, the amount of diversity introduced by replaced amino acids was comparable between IGHVs and IGKVs. The data indicate a different mutation pattern between κ and λ isotype CLL clones and suggest an antigenic selection that, in κ samples, operates against CDR variation. PMID:21785810
Corn, Radiah A; Aronica, Mark A; Zhang, Fuping; Tong, Yingkai; Stanley, Sarah A; Kim, Se Ryoung Agnes; Stephenson, Linda; Enerson, Ben; McCarthy, Susan; Mora, Ana; Boothby, Mark
2003-08-15
NF-kappaB/Rel transcription factors are linked to innate immune responses and APC activation. Whether and how the induction of NF-kappaB signaling in normal CD4(+) T cells regulates effector function are not well-understood. The liberation of NF-kappaB dimers from inhibitors of kappaB (IkappaBs) constitutes a central checkpoint for physiologic regulation of most forms of NF-kappaB. To investigate the role of NF-kappaB induction in effector T cell responses, we targeted inhibition of the NF-kappaB/Rel pathway specifically to T cells. The Th1 response in vivo is dramatically weakened when T cells defective in their NF-kappaB induction (referred to as IkappaBalpha(DeltaN) transgenic cells) are activated by a normal APC population. Analyses in vivo, and IL-12-supplemented T cell cultures in vitro, reveal that the mechanism underlying this T cell-intrinsic requirement for NF-kappaB involves activation of the IFN-gamma gene in addition to clonal expansion efficiency. The role of NF-kappaB in IFN-gamma gene expression includes a modest decrease in Stat4 activation, T box expressed in T cell levels, and differentiation efficiency along with a more prominent postdifferentiation step. Further, induced expression of Bcl-3, a trans-activating IkappaB-like protein, is decreased in T cells as a consequence of NF-kappaB inhibition. Together, these findings indicate that NF-kappaB induction in T cells regulates efficient clonal expansion, Th1 differentiation, and IFN-gamma production by Th1 lymphocytes at a control point downstream from differentiation.
Hecker, M.; Preiss, C.; Klemm, P.; Busse, R.
1996-01-01
1. In view of the potential deleterious effects of high amounts of nitric oxide (NO) produced by the inducible isoform of NO synthase (iNOS) in inflammation, the prevention of the expression of this enzyme represents an important therapeutic goal. In cytokine-stimulated cells, activation of nuclear factor kappa B (NF-kappa B) is crucial for the increase in iNOS gene expression. Since NF-kappa B activation appears to involve a redox-sensitive step, we have investigated whether three structurally unrelated antioxidants, 5,7-dihydroxyflavone (chrysin), 3,4-dichloroisocoumarin (DCI) and N-acetyl 5-hydroxytryptamine (N-acetylserotonin, NAS), affect iNOS expression in cultured RAW 264.7 monocyte/macrophages stimulated with bacterial lipopolysaccharide (LPS, 140 ng ml-1) and interferon-gamma (IFN gamma, 5 u ml-1). 2. During a 6 h incubation period neither LPS nor IFN gamma alone exerted a significant effect but when combined, caused a prominent increase in nitrite formation, iNOS mRNA and protein abundance. Co-incubation with chrysin (50 microM), DCI (50 microM) or NAS (1 mM) markedly attenuated this increase in iNOS gene expression. 3. DCI, but not chrysin or NAS, prevented the activation of NF-kappa B in cells exposed to LPS plus IFN gamma for 30 min. In contrast, all three antioxidants significantly blunted the DNA-binding activity of interferon regulatory factor 1 (IRF-1), which mediates the synergistic effect of IFN gamma on iNOS gene expression in cells treated for 2 h with LPS plus IFN gamma. 4. DCI thus appears to inhibit iNOS gene expression at the transcriptional level by preventing the activation of both NF-kappa B and IRF-1. The inhibitory effect of DCI on NF-kappa B activation, however, does not seem to be related to its antioxidative properties, since DCI, unlike chrysin or NAS, is a potent serine protease inhibitor which stabilizes the inactive NF-kappa B complex by protecting the inhibitory I kappa B-alpha subunit from proteolytic degradation. 5. The virtually identical inhibitory effect of chrysin, DCI and NAS on the activation of IRF-1 points to a redox-sensitive step in the activation of this transcription factor, which in contrast to NF-kappa B requires de novo protein synthesis. 6. Since iNOS gene expression in human cells and tissues usually requires the combination of several cytokines, antioxidants such as chrysin and NAS which do not interfere with the activation of NF-kappa B may be of therapeutic value for selectively inhibiting the enhanced expression of this enzyme in inflammation. Images Figure 4 Figure 6 Figure 7 PMID:8864559
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morrison, Thomas E.; Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599; Kenney, Shannon C.
We have previously demonstrated that the Epstein-Barr virus immediate-early BZLF1 protein interacts with, and is inhibited by, the NF-{kappa}B family member p65. However, the effects of BZLF1 on NF-{kappa}B activity have not been intensively studied. Here we show that BZLF1 inhibits p65-dependent gene expression. BZLF1 inhibited the ability of IL-1, as well as transfected p65, to activate the expression of two different NF-{kappa}B-responsive genes, ICAM-1 and I{kappa}B-{alpha}. BZLF1 also reduced the constitutive level of I{kappa}B-{alpha} protein in HeLa and A549 cells, and increased the amount of nuclear NF-{kappa}B to a similar extent as tumor necrosis factor-alpha (TNF-{alpha}) treatment. In spitemore » of this BZLF1-associated increase in the nuclear form of NF-{kappa}B, BZLF1 did not induce binding of NF-{kappa}B to NF-{kappa}B responsive promoters (as determined by chromatin immunoprecipitation assay) in vivo, although TNF-{alpha} treatment induced NF-{kappa}B binding as expected. Overexpression of p65 dramatically inhibited the lytic replication cycle of EBV in 293-EBV cells, confirming that NF-{kappa}B also inhibits BZLF1 transcriptional function. Our results are consistent with a model in which BZLF1 inhibits the transcriptional function of p65, resulting in decreased transcription of I{kappa}B-{alpha}, decreased expression of I{kappa}B-{alpha} protein, and subsequent translocation of NF-{kappa}B to the nucleus. This nuclear translocation of NF-{kappa}B may promote viral latency by negatively regulating BZLF1 transcriptional activity. In situations where p65 activity is limiting in comparison to BZLF1, the ability of BZLF1 to inhibit p65 transcriptional function may protect the virus from the host immune system during the lytic form of infection.« less
Crinelli, Rita; Carloni, Elisa; Menotta, Michele; Giacomini, Elisa; Bianchi, Marzia; Ambrosi, Gianluca; Giorgi, Luca; Magnani, Mauro
2010-05-25
Oligonucleotide (ODN) decoys are synthetic ODNs containing the DNA binding sequence of a transcription factor. When delivered to cells, these molecules can compete with endogenous sequences for binding the transcription factor, thus inhibiting its ability to activate the expression of target genes. Modulation of gene expression by decoy ODNs against nuclear factor-kappaB (NF-kappaB), a transcription factor regulating many genes involved in immunity, has been achieved in a variety of immune/inflammatory disorders. However, the successful use of transcription factor decoys depends on an efficient means to bring the synthetic DNA to target cells. It is known that single-walled carbon nanotubes (SWCNTs), under certain conditions, are able to cross the cell membrane. Thus, we have evaluated the possibility to functionalize SWCNTs with decoy ODNs against NF-kappaB in order to improve their intracellular delivery. To couple ODNs to CNTs, we have exploited the carbodiimide chemistry which allows covalent binding of amino-modified ODNs to carboxyl groups introduced onto SWCNTs through oxidation. The effective binding of ODNs to nanotubes has been demonstrated by a combination of microscopic, spectroscopic, and electrophoretic techniques. The uptake and subcellular distribution of ODN decoys bound to SWCNTs was analyzed by fluorescence microscopy. ODNs were internalized into macrophages and accumulated in the cytosol. Moreover, no cytotoxicity associated with SWCNT administration was observed. Finally, NF-kappaB-dependent gene expression was significantly reduced in cells receiving nanomolar concentrations of SWCNT-NF-kappaB decoys compared to cells receiving SWCNTs or SWCNTs functionalized with a nonspecific ODN sequence, demonstrating both efficacy and specificity of the approach.
Gómez, Raúl; Castro, Ana; Martínez, Jessica; Rodríguez-García, Víctor; Burgués, Octavio; Tarín, Juan J; Cano, Antonio
2018-06-22
The system integrated by the receptor activator of nuclear factor kappa B (RANK) and its ligand, RANKL, modulates the role of hormones in the genesis and progression of breast tumors. We investigated whether the expression of RANK was related with clinicopathological features of primary endometrial tumors. Immunohistochemistry was used in an endometrial cancer tissue array containing samples from 36 tumors. The amount of RANK mRNA was examined in a tissue scan cDNA array containing cDNA from 40 tumors. Normal endometrium was examined for comparison. Immunohistochemical analyses showed that RANK expression was higher in malignant than in normal endometrium ( p < 0.05). RANK expression was related to histological grade (Pearson correlation index = 0.484, p < 0.001), but not to tumor stage or to age of the women. The gene expression was similar in malignant and normal endometrium. The study of RANK isoforms confirmed that the overall relative abundance of the three clearly identified transcripts was similar in normal and pathological endometrium. RANK protein expression increased from normal to malignant endometrium, and the expression level was related with tumor grade but not with stage or the age of subjects in endometrial cancer. In contrast, similar comparisons showed no change in RANK gene expression.
Wang, Y; Zhang, J J; Dai, W; Lei, K Y; Pike, J W
1997-07-15
The synthetic glucocorticoid dexamethasone, an immunosuppressive and anti-inflammatory agent, was investigated for its effect on PMA-mediated expression of the inflammatory cytokine IL-1beta in the human monocytic leukemic cell line THP-1. PMA alone induced the production of low levels of IL-1beta in THP-1 cells, whereas dexamethasone alone had no effect. However, dexamethasone potently enhanced PMA-mediated IL-1beta production. Using a selective and potent inhibitor of protein kinase C, we found that synergistic interaction between PMA and dexamethasone requires protein kinase C activation. PMA has been known to activate nuclear factor NF-kappaB in THP-1 cells. Using an oligonucleotide probe corresponding to an NF-kappaB DNA-binding motif of the IL-1beta gene promoter in gel electrophoresis mobility shift assays, we demonstrated that PMA-induced NF-kappaB activation was greatly potentiated by dexamethasone. Our results indicate that glucocorticoids can be positive regulators of inflammatory cytokine gene expression during monocytic cell differentiation.
Natarajan, M; Nayak, B K; Galindo, C; Mathur, S P; Roldan, F N; Meltz, M L
2006-06-01
The objective of this study was to investigate whether exposure of human monocytes to a pulsed ultra-wideband electromagnetic field (EMF) of 1 kV/cm average peak power triggers a signaling pathway responsible for the transcriptional regulation of NFKB (NF-kappaB)-dependent gene expression. Human Mono Mac 6 (MM6) cells were exposed intermittently to EMF pulses for a total of 90 min. The pulse width was 0.79+/-0.01 ns and the pulse repetition rate was 250 pps. The temperature of the medium was maintained at 37 degrees C in both sham- and EMF-exposed flasks. Total NFKB DNA-binding activity was measured in the nuclear extracts by the electrophoretic mobility shift assay. Cells exposed to the EMFs and incubated for 24 h postexposure showed a 3.5+/-0.2-fold increase in the NFKB DNA-binding activity. Since activation of NFKB was observed, the possibility of kappaB-dependent gene expression in response to exposure to the EMFs was investigated using NFKB signal-specific gene arrays. The results revealed no difference in the NFKB-dependent gene expression profiles at 8 or 24 h postexposure, indicating that activated NFKB does not lead to the differential expression of kappaB-dependent target genes. To determine whether the absence of the kappaB-dependent gene expression was due to compromised transcriptional regulation of NFKB, the functional activity of NFKB was examined in cells transiently transfected with Mercury Pathway constructs containing 4x NFKB binding sites associated either with the luciferase reporter system or a control vector. Pulsed EMF exposure did not induce NFKB-driven luciferase activity in these cells, indicating that the activation of NFKB at 24 h after the 1 kV/cm EMF exposure is functionally inactive. From these results, it is clear that the EMF-induced NFKB activation is only a transient response, with minimal or no downstream effect.
de Re, Valli; Simula, Maria Paola; Pavan, Alessandro; Garziera, Marica; Marin, Dolores; Dolcetti, Riccardo; de Vita, Salvatore; Sansonno, Domenico; Geremia, Silvano; Toffoli, Giuseppe
2009-09-01
Autoimmune type-II cryoglobulinemia (II-MC) is sustained by hepatitis C virus (HCV) infection and B-cell (oligo)clones. This is the reason why the disease may be considered an "indolent B-cell lymphoma (NHL)." B clones show a restricted use of immunoglobulin variable genes (BCR), in particular in the use of the variable kappa (VK)3-20/15 light chain, and show a homology between their BCR functional regions and those of autoimmune rheumatoid factors. We underlined the BCR unique repertoire with frequent rheumatoid factor activity also observed in other autoimmune disorders associated with NHL. The immunoglobulin idiotype is a clonal B-cell marker and an ideal target for immunotherapy. Five monoclonal antibodies were produced in our laboratory toward the VK3-20 of a subject with HCV infection and a II-MC-associated NHL. Epitope determination was performed using the epitope excision approach. Monoclonal antibody reactivity was tested in vitro in ELISA, Western blot, and cytofluorimetry. Data confirmed that a panel of antibodies, reactive against shared idiotypes, can be produced from patients with HCV-associated B-cell lymphoproliferative diseases, thus obviating the need to produce an anti-idiotype antibody for each patient.
Ren, Ke; Zhang, Wei; Shi, Yujun; Gong, Jianping
2010-06-01
Pim-2 is proved to be relevant to the tumorigenesis of hepatocellular carcinoma (HCC), but the mechanism is unclear. We studied the relationship among Pim-2, NF-kappaB and API-5. In our experiment, expression level of the three factors and phosphorylation level of API-5, as well as NF-kappaB activity, were detected in HCC tissues and the nontumorous controls. Then Pim-2 gene was transfected into nontumorous liver cells L02, and Pim-2 SiRNA was transfected into hepatoblastoma cell line HepG2. Parthenolide was added as NF-kappaB inhibitor. The same detections as above were repeated in the cells, along with the apoptosis analysis. We found the levels of Pim-2, NF-kappaB and API-5, as well as NF-kappaB activity, were significantly higher in HCC tissues. Pim-2 level was increased in L02 cells after the transfection of Pim-2 gene, but decreased in HepG2 cells after the transfection of Pim-2 SiRNA. The levels of NF-kappaB and API-5, as well as NF-kappaB activity and API-5 phosphorylation level, were in accordance with Pim-2 level, but could be reversed by Parthenolide. Cell apoptosis rates were negatively correlated with API-5 phosphorylation level. Therefore, we infer that Pim-2 could activate API-5 to inhibit the apoptosis of liver cells, and NF-kappaB is the key regulator.
Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsukasaki, Masayuki; Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp; Suzuki, Dai
2011-07-15
Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- andmore » dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Nam Hee; Jung, Hye Jin; Shibasaki, Futoshi
2010-01-15
Nuclear factor-{kappa}B (NF-{kappa}B) is a crucial transcription factor that contributes to cancer development by regulating a number of genes involved in angiogenesis and tumorigenesis. Here, we describe (Z)-N-(3-(7-nitro-3-oxobenzo[d][1,2]selenazol-2(3H)-yl)benzylidene) propan-2-amine oxide (NBBA) as a new anti-angiogenic small molecule that targets NF-{kappa}B activity. NBBA showed stronger growth inhibition on human umbilical vein endothelial cells (HUVECs) than on the cancer cell lines we tested. Moreover, NBBA inhibited tumor necrosis factor-alpha (TNF-{alpha})-induced tube formation and invasion of HUVECs. In addition, NBBA suppressed the neovascularization of chorioallantonic membrane from growing chick embryos in vivo. To address the mode of action of the compound, the effectmore » of NBBA on TNF-{alpha}-induced NF-{kappa}B transcription activity was investigated. NBBA suppressed TNF-{alpha}-induced c-Jun N-terminal kinase phosphorylation, which resulted in suppression of transcription of NF-{kappa}B and its target genes, including interleukin-8, interleukin-1{alpha}, and epidermal growth factor. Collectively, these results demonstrated that NBBA is a new anti-angiogenic small molecule that targets the NF-{kappa}B signaling pathway.« less
Seal, S N; Hoet, R M; Raats, J M; Radic, M Z
2000-09-01
To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.
The lymphotoxin promoter is stimulated by HTLV-I tax activation of NF-kappa B in human T-cell lines.
Paul, N L; Millet, I; Ruddle, N H
1993-07-01
The HTLV-I transcriptional activator tax was used to gain insight into the mechanism of lymphotoxin (LT; TNF-beta) gene induction. Tax-expressing cell lines produce LT biologic activity. An LT promoter (LT-293) CAT construct that contained an NF-kappa B site was active in the LT-producing C81-66-45 cell line, which contains defective HTLV-I but expresses tax. The observation that a mutated LT-kappa B construct (M1-CAT) was inactive in C81-66-45, confirmed the importance of NF-kappa B in LT gene expression. Tax was transfected into HTLV-I-negative human T-cell lines. Jurkat T cells stably expressing tax contained elevated levels of NF-kappa B that directly bound to the LT-kappa B site. Tax co-transfected with reporter constructs into Jurkat cells maximally activated HTLV-I-LTR-CAT and kappa B-fos-CAT and also activated LT-293 to a lesser extent. In JM T cells, tax induced LT-293 activity by two- to four-fold, though there was no induction of M1-CAT. The increase in LT-293 CAT activity mirrored the increase in LT biologic activity seen under these conditions. These studies, the first to demonstrate induction of LT promoter activity over basal levels, indicate that HTLV-I tax causes low-level activation of both endogenous LT and the LT promoter, at least in part through activation of NF-kappa B.
The active movement scale: an evaluative tool for infants with obstetrical brachial plexus palsy.
Curtis, Christine; Stephens, Derek; Clarke, Howard M; Andrews, David
2002-05-01
Newborns with peripheral nerve lesions involving the upper extremity are difficult to evaluate. The reliability of the Active Movement Scale (AMS), a tool for assessing motor function in infants with obstetrical brachial plexus palsy (OBPP), was examined in 2 complementary studies. Part A was an interrater reliability study in which 63 infants younger than 1 year with OBPP were independently evaluated by 2 physical therapists using the AMS. The scores were compared for reliability and controlled for chance agreement by using kappa statistics. Overall kappa analysis of the 15 tested movements showed a moderate strength of score agreement (kappa = 0.51). Quadratic-weighted kappa (kappa(quad)) statistics showed that 8 of the 15 movements tested were in the highest strength of agreement category (kappa(quad) = 0.81-1.00). Five movements showed substantial agreement (kappa(quad) = 0.61-0.80), and 2 movements had moderate agreement (kappa(quad) = 0.41- 0.60). The overall kappa(quad) was 0.89. Part B was a variability study designed to examine the dispersion of scores when infants with OBPP were evaluated with the AMS by multiple raters. Ten pediatric physical therapists with varying degrees of experience using the scale attended a 1(1/2)-hour instructional workshop on administration of the tool for infants with OBPP. A chain-block study design was used to obtain 30 assessments of 10 infants by 10 raters. A 2-way analysis of variance indicated that the variability of scores due to rater factors was low compared with the variability due to patient factors and that variation in scores due to rater experience was minimal. The results of part A indicate that the AMS is a reliable tool for the assessment of infants with OBPP when raters familiar with the scale are compared. The results of part B suggest that, with minimal training, raters with a range of experience using the AMS are able to reliably evaluate infants with upper-extremity paralysis.
Hsiang, Chien-Yun; Chen, Yueh-Sheng; Ho, Tin-Yun
2009-06-01
Establishment of a comprehensive platform for the assessment of host-biomaterial interaction in vivo is an important issue. Nuclear factor-kappaB (NF-kappaB) is an inducible transcription factor that is activated by numerous stimuli. Therefore, NF-kappaB-dependent luminescent signal in transgenic mice carrying the luciferase genes was used as the guide to monitor the biomaterials-affected organs, and transcriptomic analysis was further applied to evaluate the complex host responses in affected organs in this study. In vivo imaging showed that genipin-cross-linked gelatin conduit (GGC) implantation evoked the strong NF-kappaB activity at 6h in the implanted region, and transcriptomic analysis showed that the expressions of interleukin-6 (IL-6), IL-24, and IL-1 family were up-regulated. A strong luminescent signal was observed in spleen on 14 d, suggesting that GGC implantation might elicit the biological events in spleen. Transcriptomic analysis of spleen showed that 13 Kyoto Encyclopedia of Genes and Genomes pathways belonging to cell cycles, immune responses, and metabolism were significantly altered by GGC implants. Connectivity Map analysis suggested that the gene signatures of GGC were similar to those of compounds that affect lipid or glucose metabolism. GeneSetTest analysis further showed that host responses to GGC implants might be related to diseases states, especially the metabolic and cardiovascular diseases. In conclusion, our data provided a concept of molecular imaging-guided transcriptomic platform for the evaluation and the prediction of host-biomaterial interaction in vivo.
Bex, F; Yin, M J; Burny, A; Gaynor, R B
1998-04-01
The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.
Stevenson, M A; Zhao, M J; Asea, A; Coleman, C N; Calderwood, S K
1999-11-15
Sodium salicylate (NaSal) and other nonsteroidal anti-inflammatory drugs (NSAIDs) coordinately inhibit the activity of NF-kappa B, activate heat shock transcription factor 1 and suppress cytokine gene expression in activated monocytes and macrophages. Because our preliminary studies indicated that these effects could be mimicked by inhibitors of signal transduction, we have studied the effects of NSAIDs on signaling molecules potentially downstream of LPS receptors in activated macrophages. Our findings indicate that ribosomal S6 kinase 2 (RSK2), a 90-kDa ribosomal S6 kinase with a critical role as an effector of the RAS-mitogen-activated protein kinase pathway and a regulator of immediate early gene transcription is a target for inhibition by the NSAIDs. NSAIDs inhibited the activity of purified RSK2 kinase in vitro and of RSK2 in mammalian cells and suppressed the phosphorylation of RSK2 substrates cAMP response element binding protein (CREB) and I-kappa B alpha in vivo. Additionally, NaSal inhibited the phosphorylation by RSK2 of CREB and I-kappa B alpha on residues crucial for their transcriptional activity in vivo and thus repressed CREB and NF-kappa B-dependent transcription. These experiments suggest that RSK2 is a target for NSAIDs in the inhibition of monocyte-specific gene expression and indicate the importance of RSK2 and related kinases in cell regulation, indicating a new area for anti-inflammatory drug discovery.
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
Manipulation of NF-KappaBetta Activity in the Macrophage Lineage as a Novel Therapeutic Approach
2007-05-01
Sadikot, J. W. Christman, and T. S. Blackwell. 2003. Bioluminescent detection of endotoxin effects on HIV-1 LTR-driven transcription in vivo. J...differences in proliferation rates, expression of downstream gene expression and effects mediated by altered macrophages on associated epithelial...kappaB activity within macrophages has significant effects on mammary ductal development. 15. SUBJECT TERMS NF-kappaB, macrophages, mammary ductal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro
2011-08-12
Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less
Matheson, Louise S; Bolland, Daniel J; Chovanec, Peter; Krueger, Felix; Andrews, Simon; Koohy, Hashem; Corcoran, Anne E
2017-01-01
V(D)J recombination is essential for the generation of diverse antigen receptor (AgR) repertoires. In B cells, immunoglobulin kappa ( Igκ ) light chain recombination follows immunoglobulin heavy chain ( Igh ) recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS) of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh , as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(D)J recombination and provide avenues for further investigation of chromatin signatures that may underpin V(D)J-mediated chromosomal translocations.
Matheson, Louise S.; Bolland, Daniel J.; Chovanec, Peter; Krueger, Felix; Andrews, Simon; Koohy, Hashem; Corcoran, Anne E.
2017-01-01
V(D)J recombination is essential for the generation of diverse antigen receptor (AgR) repertoires. In B cells, immunoglobulin kappa (Igκ) light chain recombination follows immunoglobulin heavy chain (Igh) recombination. We recently developed the DNA-based VDJ-seq assay for the unbiased quantitation of Igh VH and DH repertoires. Integration of VDJ-seq data with genome-wide datasets revealed that two chromatin states at the recombination signal sequence (RSS) of VH genes are highly predictive of recombination in mouse pro-B cells. It is unknown whether local chromatin states contribute to Vκ gene choice during Igκ recombination. Here we adapt VDJ-seq to profile the Igκ VκJκ repertoire and present a comprehensive readout in mouse pre-B cells, revealing highly variable Vκ gene usage. Integration with genome-wide datasets for histone modifications, DNase hypersensitivity, transcription factor binding and germline transcription identified PU.1 binding at the RSS, which was unimportant for Igh, as highly predictive of whether a Vκ gene will recombine or not, suggesting that it plays a binary, all-or-nothing role, priming genes for recombination. Thereafter, the frequency with which these genes recombine was shaped both by the presence and level of enrichment of several other chromatin features, including H3K4 methylation and IKAROS binding. Moreover, in contrast to the Igh locus, the chromatin landscape of the promoter, as well as of the RSS, contributes to Vκ gene recombination. Thus, multiple facets of local chromatin features explain much of the variation in Vκ gene usage. Together, these findings reveal shared and divergent roles for epigenetic features and transcription factors in AgR V(D)J recombination and provide avenues for further investigation of chromatin signatures that may underpin V(D)J-mediated chromosomal translocations. PMID:29204143
NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya
2010-12-03
Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Won Seok; Chang, Jai Won; Han, Nam Jeong
The role of spleen tyrosine kinase (Syk) in high glucose-induced intracellular signal transduction has yet to be elucidated. We investigated whether Syk is implicated in high glucose-induced transforming growth factor-{beta}1 (TGF-{beta}1) up-regulation in cultured human proximal tubular epithelial cells (HK-2 cell). High glucose increased TGF-{beta}1 gene expression through Syk, extracellular signal-regulated kinase (ERK), AP-1 and NF-{kappa}B. High glucose-induced AP-1 DNA binding activity was decreased by Syk inhibitors and U0126 (an ERK inhibitor). Syk inhibitors suppressed high glucose-induced ERK activation, whereas U0126 had no effect on Syk activation. High glucose-induced NF-{kappa}B DNA binding activity was also decreased by Syk inhibitors. Highmore » glucose increased nuclear translocation of p65 without serine phosphorylation of I{kappa}B{alpha} and without degradation of I{kappa}B{alpha}, but with an increase in tyrosine phosphorylation of I{kappa}B{alpha} that may account for the activation of NF-{kappa}B. Both Syk inhibitors and Syk-siRNA attenuated high glucose-induced I{kappa}B{alpha} tyrosine phosphorylation and p65 nuclear translocation. Depletion of p21-activated kinase 2 (Pak2) by transfection of Pak2-siRNA abolished high glucose-induced Syk activation. In summary, high glucose-induced TGF-{beta}1 gene transcription occurred through Pak2, Syk and subsequent ERK/AP-1 and NF-{kappa}B pathways. This suggests that Syk might be implicated in the diabetic kidney disease.« less
Granja, Aitor G; Nogal, Maria L; Hurtado, Carolina; Del Aguila, Carmen; Carrascosa, Angel L; Salas, María L; Fresno, Manuel; Revilla, Yolanda
2006-01-01
African swine fever virus (ASFV) is able to inhibit TNF-alpha-induced gene expression through the synthesis of A238L protein. This was shown by the use of deletion mutants lacking the A238L gene from the Vero cell-adapted Ba71V ASFV strain and from the virulent isolate E70. To further analyze the molecular mechanism by which the viral gene controls TNF-alpha, we have used Jurkat cells stably transfected with the viral gene to identify the TNF-alpha regulatory elements involved in the induction of the gene after stimulation with PMA and calcium ionophore. We have thus identified the cAMP-responsive element and kappa3 sites on the TNF-alpha promoter as the responsible of the gene activation, and demonstrate that A238L inhibits TNF-alpha expression through these DNA binding sites. This inhibition was partially reverted by overexpression of the transcriptional factors NF-AT, NF-kappaB, and c-Jun. Furthermore, we present evidence that A238L inhibits the activation of TNF-alpha by modulating NF-kappaB, NF-AT, and c-Jun trans activation through a mechanism that involves CREB binding protein/p300 function, because overexpression of these transcriptional coactivators recovers TNF-alpha promoter activity. In addition, we show that A238L is a nuclear protein that binds to the cyclic AMP-responsive element/kappa3 complex, thus displacing the CREB binding protein/p300 coactivators. Taken together, these results establish a novel mechanism in the control of TNF-alpha gene expression by a viral protein that could represent an efficient strategy used by ASFV to evade the innate immune response.
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Porcine arterivirus activates the NF-{kappa}B pathway through I{kappa}B degradation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sang-Myeong; Kleiboeker, Steven B.
2005-11-10
Nuclear factor-kappaB (NF-{kappa}B) is a critical regulator of innate and adaptive immune function as well as cell proliferation and survival. The present study demonstrated for the first time that a virus belonging to the Arteriviridae family activates NF-{kappa}B in MARC-145 cells and alveolar macrophages. In porcine reproductive and respiratory syndrome virus (PRRSV)-infected cells, NF-{kappa}B activation was characterized by translocation of NF-{kappa}B from the cytoplasm to the nucleus, increased DNA binding activity, and NF-{kappa}B-regulated gene expression. NF-{kappa}B activation was increased as PRRSV infection progressed and in a viral dose-dependent manner. UV-inactivation of PRRSV significantly reduced the level of NF-{kappa}B activation. Degradationmore » of I{kappa}B protein was detected late in PRRSV infection, and overexpression of the dominant negative form of I{kappa}B{alpha} (I{kappa}B{alpha}DN) significantly suppressed NF-{kappa}B activation induced by PRRSV. However, I{kappa}B{alpha}DN did not affect viral replication and viral cytopathic effect. PRRSV infection induced oxidative stress in cells by generating reactive oxygen species (ROS), and antioxidants inhibited NF-{kappa}B DNA binding activity in PRRSV-infected cells, suggesting ROS as a mechanism by which NF-{kappa}B was activated by PRRSV infection. Moreover, NF-{kappa}B-dependent expression of matrix metalloproteinase (MMP)-2 and MMP-9 was observed in PRRSV-infected cells, an observation which implies that NF-{kappa}B activation is a biologically significant aspect of PRRSV pathogenesis. The results presented here provide a basis for understanding molecular pathways of pathology and immune evasion associated with disease caused by PRRSV.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Genetos, Damian C., E-mail: dgenetos@ucdavis.edu; Karin, Norman J.; Geist, Derik J.
2011-04-01
Fluid shear stress regulates gene expression in osteoblasts, in part by activation of the transcription factor NF-{kappa}B. We examined whether this process was under the control of purinoceptor activation. MC3T3-E1 osteoblasts under static conditions expressed the NF-{kappa}B inhibitory protein I{kappa}B{alpha} and exhibited cytosolic localization of NF-{kappa}B. Under fluid shear stress, I{kappa}B{alpha} levels decreased, and concomitant nuclear localization of NF-{kappa}B was observed. Cells exposed to fluid shear stress in ATP-depleted medium exhibited no significant reduction in I{kappa}B{alpha}, and NF-{kappa}B remained within the cytosol. Similar results were found using oxidized ATP or Brilliant Blue G, P2X{sub 7} receptor antagonists, indicating that themore » P2X{sub 7} receptor is responsible for fluid shear-stress-induced I{kappa}B{alpha} degradation and nuclear accumulation of NF-{kappa}B. Pharmacologic blockage of the P2Y6 receptor also prevented shear-induced I{kappa}B{alpha} degradation. These phenomena involved neither ERK1/2 signaling nor autocrine activation by P2X{sub 7}-generated lysophosphatidic acid. Our results suggest that fluid shear stress regulates NF-{kappa}B activity through the P2Y{sub 6} and P2X{sub 7} receptor.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, C.-C.; Tseng, Hsiao-Wei; Hsieh, Hsi-Lung
2008-06-15
Matrix metalloproteinases (MMPs), in particular MMP-9, have been shown to be induced by cytokines including tumor necrosis factor-{alpha} (TNF-{alpha}) and contributes to airway inflammation. However, the mechanisms underlying MMP-9 expression induced by TNF-{alpha} in human A549 cells remain unclear. Here, we showed that TNF-{alpha} induced production of MMP-9 protein and mRNA is determined by zymographic, Western blotting, RT-PCR and ELISA assay, which were attenuated by inhibitors of MEK1/2 (U0126), JNK (SP600125), and NF-{kappa}B (helenalin), and transfection with dominant negative mutants of ERK2 ({delta}ERK) and JNK ({delta}JNK), and siRNAs for MEK1, p42 and JNK2. TNF-{alpha}-stimulated phosphorylation of p42/p44 MAPK and JNKmore » were attenuated by pretreatment with the inhibitors U0126 and SP600125 or transfection with dominant negative mutants of {delta}ERK and {delta}JNK. Furthermore, the involvement of NF-{kappa}B in TNF-{alpha}-induced MMP-9 production was consistent with that TNF-{alpha}-stimulated degradation of I{kappa}B-{alpha} and translocation of NF-{kappa}B into the nucleus which were blocked by helenalin, but not by U0126 and SP600125, revealed by immunofluorescence staining. The regulation of MMP-9 gene transcription by MAPKs and NF-{kappa}B was further confirmed by gene luciferase activity assay. MMP-9 promoter activity was enhanced by TNF-{alpha} in A549 cells transfected with wild-type MMP-9-Luc, which was inhibited by helenalin, U0126, or SP600125. In contrast, TNF-{alpha}-stimulated MMP-9 luciferase activity was totally lost in cells transfected with mutant-NF-{kappa}B MMP-9-luc. Moreover, pretreatment with actinomycin D and cycloheximide attenuated TNF-{alpha}-induced MMP-9 expression. These results suggest that in A549 cells, phosphorylation of p42/p44 MAPK, JNK, and transactivation of NF-{kappa}B are essential for TNF-{alpha}-induced MMP-9 gene expression.« less
Transcriptional Response of Human Cells to Microbeam Irradiation with 2.1 MeV Alpha Particles
NASA Astrophysics Data System (ADS)
Hellweg, C. E.; Bogner, S.; Spitta, L.; Arenz, A.; Baumstark-Khan, C.; Greif, K. D.; Giesen, U.
Within the next decades an increasing number of human beings in space will be simultaneously exposed to different stimuli especially microgravity and radiation To assess the risks for humans during long-duration space missions the complex interplay of these parameters at the cellular level must be understood Cellular stress protection responses lead to increased transcription of several genes via modulation of transcription factors Activation of the Nuclear Factor kappa B NF- kappa B pathway as a possible anti-apoptotic route represents such an important cellular stress response A screening assay for detection of NF- kappa B-dependent gene activation using the destabilized variant of Enhanced Green Fluorescent Protein d2EGFP as reporter protein had been developed It consists of Human Embryonic Kidney HEK 293 Cells stably transfected with a receptor-reporter-construct carrying d2EGFP under the control of a NF- kappa B response element Clones positive for Tumor Necrosis Factor alpha TNF- alpha inducible d2EGFP expression were selected as cellular reporters Irradiation was performed either with X-rays 150 kV 19 mA at DLR Cologne or with 2 1 MeV alpha particles LET sim 160 keV mu m at PTB Braunschweig After irradiation the following biological endpoints were determined i cell survival via the colony forming ability test ii time-dependent activation of NF- kappa B dependent d2EGFP gene expression using flow cytometry iii quantitative RT-PCR
Goñi, F; Frangione, B
1983-01-01
We have determined the amino acid sequence of the Fv [variable heavy (VH) and variable light (VL)] region of a human monoclonal IgM-kappa with antibody activity against 3,4-pyruvylated galactose, isolated from the plasma of patient WEA with Waldenström macroglobulinemia. The VH region has 114 residues, belongs to subgroup III, and has a very short third complementarity-determining region (CDR3), probably due to a small D segment/or an unusual D-J rearrangement (D, diversity; J, joining). The VL region has 108 residues and belongs to subgroup V kappa I. Compared to other members of the human VHIII and V kappa I families, WEA Fv does not appear to have significant differences within the framework residues but has unique CDRs that might be responsible for the particular antibody activity. Another IgM-kappa (GAL), which has an as-yet-undetermined antibody activity, shares a striking homology in V kappa with WEA, including an identical CDR1. PMID:6410398
Llacuna, Laura; Marí, Montserrat; Lluis, Josep M; García-Ruiz, Carmen; Fernández-Checa, José C; Morales, Albert
2009-05-01
Nuclear factor (NF)-kappaB participates in ischemia/reperfusion (I/R) hepatic signaling, stimulating both protective mechanisms and the generation of inflammatory cytokines. After analyzing NF-kappaB activation during increasing times of ischemia in murine I/R, we observed that the nuclear translocation of p65 paralleled Src and IkappaB tyrosine phosphorylation, which peaked after 60 minutes of ischemia. After extended ischemic periods (90 to 120 minutes) however, nuclear p65 levels were inversely correlated with the progressive induction of oxidative stress. Despite this profile of NF-kappaB activation, inflammatory genes, such as tumor necrosis factor (TNF) and interleukin (IL)-1beta, predominantly induced by Kupffer cells, increased throughout time during ischemia (30 to 120 minutes), whereas protective NF-kappaB-dependent genes, such as manganese superoxide dismutase (Mn-SOD), expressed in parenchymal cells, decreased. Consistent with this behavior, gadolinium chloride pretreatment abolished TNF/IL-1beta up-regulation during ischemia without affecting Mn-SOD levels. Interestingly, specific glutathione (GSH) up-regulation in hepatocytes by S-adenosylmethionine increased Mn-SOD expression and protected against I/R-mediated liver injury despite TNF/IL-1beta induction. Similar protection was achieved by administration of the SOD mimetic MnTBAP. In contrast, indiscriminate hepatic GSH depletion by buthionine-sulfoximine before I/R potentiated oxidative stress and decreased both nuclear p65 and Mn-SOD expression levels, increasing TNF/IL-1beta up-regulation and I/R-induced liver damage. Thus, the divergent role of NF-kappaB activation in selective liver cell populations underlies the dichotomy of NF-kappaB in hepatic I/R injury, illustrating the relevance of specifically maintaining NF-kappaB activation in parenchymal cells.
Suzuki, Munetaka; Inoue, Gen; Gemba, Takefumi; Watanabe, Tomoko; Ito, Toshinori; Koshi, Takana; Yamauchi, Kazuyo; Yamashita, Masaomi; Orita, Sumihisa; Eguchi, Yawara; Ochiai, Nobuyasu; Kishida, Shunji; Takaso, Masashi; Aoki, Yasuchika; Takahashi, Kazuhisa; Ohtori, Seiji
2009-07-01
Nuclear factor-kappa B (NF-kappaB) is a gene transcriptional regulator of inflammatory cytokines. We investigated the transduction efficiency of NF-kappaB decoy to dorsal root ganglion (DRG), as well as the decrease in nerve injury, mechanical allodynia, and thermal hyperalgesia in a rat lumbar disc herniation model. Forty rats were used in this study. NF-kappaB decoy-fluorescein isothiocyanate (FITC) was injected intrathecally at the L5 level in five rats, and its transduction efficiency into DRG measured. In another 30 rats, mechanical pressure was placed on the DRG at the L5 level and nucleus pulposus harvested from the rat coccygeal disc was transplanted on the DRG. Rats were classified into three groups of ten animals each: a herniation + decoy group, a herniation + oligo group, and a herniation only group. For behavioral testing, mechanical allodynia and thermal hyperalgesia were evaluated. In 15 of the herniation rats, their left L5 DRGs were resected, and the expression of activating transcription factor 3 (ATF-3) and calcitonin gene-related peptide (CGRP) was evaluated immunohistochemically compared to five controls. The total transduction efficiency of NF-kappaB decoy-FITC in DRG neurons was 10.8% in vivo. The expression of CGRP and ATF-3 was significantly lower in the herniation + decoy group than in the other herniation groups. Mechanical allodynia and thermal hyperalgesia were significantly suppressed in the herniation + decoy group. NF-kappaB decoy was transduced into DRGs in vivo. NF-kappaB decoy may be useful as a target for clarifying the mechanism of sciatica caused by lumbar disc herniation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nagasaki, Haruka; Yoshimura, Takeshi; Aoki, Naohito, E-mail: n-aoki@bio.mie-u.ac.jp
2012-04-13
Highlights: Black-Right-Pointing-Pointer Inflammation status in adipocytes can be monitored by the new assay system. Black-Right-Pointing-Pointer Only an aliquot of conditioned medium is required without cell lysis. Black-Right-Pointing-Pointer Inflammation-attenuating compounds can be screened more conveniently. -- Abstract: We have established 3T3-L1 cells possessing a secretory Gaussia luciferase (GLuc) gene under the control of nuclear factor-kappa B (NF-{kappa}B) response element. The 3T3-L1 cells named 3T3-L1-NF-{kappa}B-RE-GLuc could differentiate into adipocyte as comparably as parental 3T3-L1 cells. Inflammatory cytokines such as tumor necrosis factor (TNF)-{alpha} and interleukin (IL)-1{beta} induced GLuc secretion of 3T3-L1-NF-{kappa}B-RE-GLuc adipocytes in a concentration- and time-dependent manner. GLuc secretion of 3T3-L1-NF-{kappa}B-RE-GLucmore » adipocytes was also induced when cultured with RAW264.7 macrophages and was dramatically enhanced by lipopolysaccharide (LPS)-activated macrophages. An NF-{kappa}B activation inhibitor BAY-11-7085 and an antioxidant N-acetyl cysteine significantly suppressed GLuc secretion induced by macrophages. Finally, we found that rosemary-derived carnosic acid strongly suppressed GLuc secretion induced by macrophages and on the contrary up-regulated adiponectin secretion. Collectively, by using 3T3-L1-NF-{kappa}B-RE-GLuc adipocytes, inflammation status can be monitored in real time and inflammation-attenuating compounds can be screened more conveniently.« less
Nuclear factor kappa B: a potential target for anti-HIV chemotherapy.
Pande, V; Ramos, M J
2003-08-01
The Nuclear Factor Kappa B (NF-kappaB) is a lymphoid-specific transcription factor, which is sequestered in the cytoplasm by the protein IkappaB. NF-kappaB plays a major role in the regulation of HIV-1 gene expression. Upon activation, NF-kappaB is released from IkappaB, moves to the nucleus, and binds to its sites on the HIV long terminal repeat to start transcription of integrated HIV genome. The present review focuses on the NF-kappaB as a potential target for the development of chemotherapy against HIV-1. Beginning from the viral-binding to reverse transcription, integration, and gene expression, to the virion maturation, the life cycle of HIV presents drug-targets at all the stages. As a result, many drugs have been developed and have entered clinical trials. Some of the most important of these are reverse transcriptase and protease inhibitors, which have been used mostly in clinical studies in the form of combined therapy. But, this combined therapy has presented the problem of resistance, due to mutations in the virus. However, targeting NF-kappaB for the suppression of virus does not present the problem of resistance, as NF-kappaB is a normal part of the human T-4 cell, and is not subject to mutations, as is the virus. An overview of the NF-kappaB system and its role in HIV-1 is presented, followed by a critical review of its current and potential synthetic inhibitors. The drugs studied against NF-kappaB fall mainly into three categories: (1) Antioxidants, against oxidative stress conditions, which aid in NF-kappaB activation, (2) IkappaB phosphorylation and degradation inhibitors (the phosphorylation and degradation of IkappaB is necessary to make NF-kappaB free and move to the nucleus), and (3) NF-kappaB DNA binding inhibitors. The antioxidants include N-Acetyl-L-cysteine (NAC), alpha-Lipoic acid, glutathione monoester, pyrrolidine dithiocarbamate, and tepoxalin, of which NAC is the best studied. The IkappaB phosphorylation and degradation inhibitors, which have been studied in the context of HIV-1 include the salicylates (sodium salicylate, and acetylsalicylic acid (aspirin)). Finally, the NF-kappaB DNA binding inhibitors, which have received attention only recently, are reviewed. These include the most potential, aurine tricarboxylic acid (ATA), a chelating agent, which has been found to inhibit NF-kappaB DNA binding at a low concentration of 30 micro M. The probable mechanism of action of these drugs is discussed alongwith relevant suggestions and conclusions.
Murphy, Andrew J; Macdonald, Lynn E; Stevens, Sean; Karow, Margaret; Dore, Anthony T; Pobursky, Kevin; Huang, Tammy T; Poueymirou, William T; Esau, Lakeisha; Meola, Melissa; Mikulka, Warren; Krueger, Pamela; Fairhurst, Jeanette; Valenzuela, David M; Papadopoulos, Nicholas; Yancopoulos, George D
2014-04-08
Mice genetically engineered to be humanized for their Ig genes allow for human antibody responses within a mouse background (HumAb mice), providing a valuable platform for the generation of fully human therapeutic antibodies. Unfortunately, existing HumAb mice do not have fully functional immune systems, perhaps because of the manner in which their genetic humanization was carried out. Heretofore, HumAb mice have been generated by disrupting the endogenous mouse Ig genes and simultaneously introducing human Ig transgenes at a different and random location; KO-plus-transgenic humanization. As we describe in the companion paper, we attempted to make mice that more efficiently use human variable region segments in their humoral responses by precisely replacing 6 Mb of mouse Ig heavy and kappa light variable region germ-line gene segments with their human counterparts while leaving the mouse constant regions intact, using a unique in situ humanization approach. We reasoned the introduced human variable region gene segments would function indistinguishably in their new genetic location, whereas the retained mouse constant regions would allow for optimal interactions and selection of the resulting antibodies within the mouse environment. We show that these mice, termed VelocImmune mice because they were generated using VelociGene technology, efficiently produce human:mouse hybrid antibodies (that are rapidly convertible to fully human antibodies) and have fully functional humoral immune systems indistinguishable from those of WT mice. The efficiency of the VelocImmune approach is confirmed by the rapid progression of 10 different fully human antibodies into human clinical trials.
Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.
Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R
2001-08-10
The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.
Chronic intermittent hypoxia activates nuclear factor-{kappa}B in cardiovascular tissues in vivo
DOE Office of Scientific and Technical Information (OSTI.GOV)
Greenberg, Harly; Ye Xiaobing; Wilson, David
2006-05-05
Obstructive sleep apnea (OSA) is an important risk factor for cardiovascular morbidity and mortality. The mechanisms through which OSA promotes the development of cardiovascular disease are poorly understood. In this study, we tested the hypotheses that chronic exposure to intermittent hypoxia and reoxygenation (CIH) is a major pathologic factor causing cardiovascular inflammation, and that CIH-induces cardiovascular inflammation and pathology by activating the NF-{kappa}B pathway. We demonstrated that exposure of mice to CIH activated NF-{kappa}B in cardiovascular tissues, and that OSA patients had markedly elevated monocyte NF-{kappa}B activity, which was significantly decreased when obstructive apneas and their resultant CIH were eliminatedmore » by nocturnal CPAP therapy. The elevated NF-{kappa}B activity induced by CIH is accompanied by and temporally correlated to the increased expression of iNOS protein, a putative and important NF-{kappa}B-dependent gene product. Thus, CIH-mediated NF-{kappa}B activation may be a molecular mechanism linking OSA and cardiovascular pathologies seen in OSA patients.« less
Over-expression of Flt3 induces NF-kappaB pathway and increases the expression of IL-6.
Takahashi, Shinichiro; Harigae, Hideo; Ishii, Keiko Kumura; Inomata, Mitsue; Fujiwara, Tohru; Yokoyama, Hisayuki; Ishizawa, Kenichi; Kameoka, Junichi; Licht, Jonathan D; Sasaki, Takeshi; Kaku, Mitsuo
2005-08-01
Activating mutations or over-expression of the Flt3 is prevalent in acute myeloblastic leukemia (AML), associated with activation of Ras/MAP kinase and other signaling pathways. In this study, we addressed the role of Flt3 in the activation of nuclear factor-kappa B (NF-kappaB), which is a target molecule of these kinase pathways. In BaF3 cells stably expressing Flt3, a NF-kappaB-responsive reporter was upregulated and its target gene, IL-6, was increased by the involvement of Flt3-ERK/MAPK-NF-kappaB pathway. Furthermore, we found a modest positive correlation (r=0.35, p=0.096) between Flt3 and IL-6 mRNA expression in 24 AML specimens. These results suggest a role of Flt3 over-expression in NF-kappaB pathway.
NASA Astrophysics Data System (ADS)
Fuseler, John W.; Merrill, Dana M.; Rogers, Jennifer A.; Grisham, Matthew B.; Wolf, Robert E.
2006-07-01
Nuclear factor kappa B (NF-[kappa]B) is a heterodimeric transcription factor typically composed of p50 and p65 subunits and is a pleiotropic regulator of various inflammatory and immune responses. In quiescent cells, p50/p65 dimers are sequestered in the cytoplasm bound to its inhibitors, the I-[kappa]Bs, which prevent entry into the nucleus. Following cellular stimulation, the I-[kappa]Bs are rapidly degraded, activating NF-[kappa]B. The active form of NF-[kappa]B rapidly translocates into the nucleus, binding to consensus sequences in the promoter/enhancer region of various genes, promoting their transcription. In human vascular endothelial cells activated with tumor necrosis factor-alpha, the activation and translocation of NF-[kappa]B is rapid, reaching maximal nuclear localization by 30 min. In this study, the appearance of NF-[kappa]B (p65 subunit, p65-NF-[kappa]B) in the nucleus visualized by immunofluorescence and quantified by morphometric image analysis (integrated optical density, IOD) is compared to the appearance of activated p65-NF-[kappa]B protein in the nucleus determined biochemically. The appearance of p65-NF-[kappa]B in the nucleus measured by fluorescence image analysis and biochemically express a linear correlation (R2 = 0.9477). These data suggest that localization and relative protein concentrations of NF-[kappa]B can be reliably determined from IOD measurements of the immunofluorescent labeled protein.
NF-kappaB transcription factor is required for inhibitory avoidance long-term memory in mice.
Freudenthal, Ramiro; Boccia, Mariano M; Acosta, Gabriela B; Blake, Mariano G; Merlo, Emiliano; Baratti, Carlos M; Romano, Arturo
2005-05-01
Although it is generally accepted that memory consolidation requires regulation of gene expression, only a few transcription factors (TFs) have been clearly demonstrated to be specifically involved in this process. Increasing research data point to the participation of the Rel/nuclear factor-kappaB (NF-kappaB) family of TFs in memory and neural plasticity. Here we found that two independent inhibitors of NF-kappaB induced memory impairment in the one-trial step-through inhibitory avoidance paradigm in mice: post-training administration of the drug sulfasalazine and 2 h pretraining administration of a double-stranded DNA oligonucleotide containing the NF-kappaB consensus sequence (kappaB decoy). Conversely, one base mutation of the kappaB decoy (mut-kappaB decoy) injection did not affect long-term memory. Accordingly, the kappaB decoy inhibited NF-kappaB in hippocampus 2 h after injection but no inhibition was found with mut-kappaB decoy administration. A temporal course of hippocampal NF-kappaB activity after training was determined. Unexpectedly, an inhibition of NF-kappaB was found 15 min after training in shocked and unshocked groups when compared with the naïve group. Hippocampal NF-kappaB was activated 45 min after training in both shocked and unshocked groups, decreasing 1 h after training and returning to basal levels 2 and 4 h after training. On the basis of the latter results, we propose that activation of NF-kappaB in hippocampus is part of the molecular mechanism involved in the storage of contextual features that constitute the conditioned stimulus representation. The results presented here provide the first evidence to support NF-kappaB activity being regulated in hippocampus during consolidation, stressing the role of this TF as a conserved molecular mechanism for memory storage.
Poppers, D M; Schwenger, P; Vilcek, J
2000-09-22
Transcription factor NF-kappa B is normally sequestered in the cytoplasm, complexed with I kappa B inhibitory proteins. Tumor necrosis factor (TNF) and interleukin-1 induce I kappa B-alpha phosphorylation, leading to I kappa B-alpha degradation and translocation of NF-kappa B to the nucleus where it activates genes important in inflammatory and immune responses. TNF and interleukin-1 actions are typically terminated by desensitization, and I kappa B-alpha reappearance normally occurs within 30-60 min. We found that in normal human FS-4 fibroblasts maintained in the presence of TNF, I kappa B-alpha protein failed to return to base-line levels for up to 15 h. Removal of TNF at any time during the 15-h period resulted in complete I kappa B-alpha resynthesis, suggesting that I kappa B-alpha reappearance was prevented by continued TNF signaling. Long term exposure of FS-4 fibroblasts to TNF led to a persistent presence of I kappa B-alpha mRNA, sustained I kappa B kinase activation, continuous proteasome-mediated degradation of I kappa B-alpha, and sustained nuclear localization of NF-kappa B. Continuous exposure of FS-4 cells to TNF did not lead to a sustained activation of p38 or ERK mitogen-activated protein kinases, suggesting that not all TNF-induced signaling pathways are persistently activated. These findings challenge the notion that all cytokine-mediated signals are rapidly terminated by desensitization and illustrate the need to elucidate the process of deactivation of TNF-induced signaling.
Antiinflammatory effects of glucocorticoids in brain cells, independent of NF-kappa B.
Bourke, E; Moynagh, P N
1999-08-15
Glucocorticoids are potent antiinflammatory drugs. They inhibit the expression of proinflammatory cytokines and adhesion molecules. It has recently been proposed that the underlying basis to such inhibition is the induction of the protein I kappa B, which inhibits the transcription factor NF-kappa B. The latter is a key activator of the genes encoding cytokines and adhesion molecules. The present study shows that the synthetic glucocorticoid, dexamethasone, inhibits the induction of the proinflammatory cytokine IL-8 and the adhesion molecules VCAM-1 and ICAM-1 in human 1321N1 astrocytoma and SK.N.SH neuroblastoma cells. However, dexamethasone failed to induce I kappa B or inhibit activation of NF-kappa B by IL-1 in the two cell types. EMSA confirmed the identity of the activated NF-kappa B by demonstrating that an oligonucleotide, containing the wild-type NF-kappa B-binding motif, inhibited formation of the NF-kappa B-DNA complexes whereas a mutated form of the NF-kappa B-binding motif was ineffective. In addition, supershift analysis showed that the protein subunits p50 and p65 were prevalent components in the activated NF-kappa B complexes. The lack of effect of dexamethasone on the capacity of IL-1 to activate NF-kappa B correlated with its inability to induce I kappa B and the ability of IL-1 to cause degradation of I kappa B, even in the presence of dexamethasone. The results presented in this paper strongly suggest that glucocorticoids may exert antiinflammatory effects in cells of neural origin by a mechanism(s) independent of NF-kappa B.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peng, Cheng-Fei; Cardiovascular Research Institute and Department of Cardiology, Shenyang Northern Hospital, Shenyang; Han, Ya-Ling, E-mail: hanyaling53@gmail.com
2011-03-25
Research highlights: {yields} CREG protected MSCs from tumor necrosis factor-{alpha} (TNF-{alpha}) induced apoptosis. {yields} CREG inhibits the phosphorylation of I{kappa}B{alpha} and prevents the activation of NF-{kappa}B. {yields} CREG inhibits NF-{kappa}B nuclear translocation and pro-apoptosis protein transcription. {yields} CREG anti-apoptotic effect involves inhibition of the death receptor pathway. {yields} p53 is downregulated by CREG via NF-{kappa}B pathway under TNF-{alpha} stimulation. -- Abstract: Bone marrow-derived mesenchymal stem cells (MSCs) show great potential for therapeutic repair after myocardial infarction. However, poor viability of transplanted MSCs in the ischemic heart has limited their use. Cellular repressor of E1A-stimulated genes (CREG) has been identified asmore » a potent inhibitor of apoptosis. This study therefore aimed to determine if rat bone marrow MSCs transfected with CREG-were able to effectively resist apoptosis induced by inflammatory mediators, and to demonstrate the mechanism of CREG action. Apoptosis was determined by flow cytometric and terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end-labeling assays. The pathways mediating these apoptotic effects were investigated by Western blotting. Overexpression of CREG markedly protected MSCs from tumor necrosis factor-{alpha} (TNF-{alpha}) induced apoptosis by 50% after 10 h, through inhibition of the death-receptor-mediated apoptotic pathway, leading to attenuation of caspase-8 and caspase-3. Moreover, CREG resisted the serine phosphorylation of I{kappa}B{alpha} and prevented the nuclear translocation of the transcription factor nuclear factor-{kappa}B (NF-{kappa}B) under TNF-{alpha} stimulation. Treatment of cells with the NF-{kappa}B inhibitor pyrrolidine dithiocarbamate (PDTC) significantly increased the transcription of pro-apoptosis proteins (p53 and Fas) by NF-{kappa}B, and attenuated the anti-apoptotic effects of CREG on MSCs. The results of this study indicate that CREG acts as a novel and potent survival factor in MSCs, and may therefore be a useful therapeutic adjunct for transplanting MSCs into the damaged heart after myocardial infarction.« less
Down-regulation of PKHD1 induces cell apoptosis through PI3K and NF-{kappa}B pathways
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Liping; Wang, Shixuan; Hu, Chaofeng
2011-04-15
Mutations in PKHD1 (polycystic kidney and hepatic disease gene 1) gene cause the autosomal recessive polycystic kidney disease (ARPKD). Fibrocystin/polyductin (FPC), encoded by PKHD1, is a membrane-associated receptor-like protein. Although it is widely accepted that cystogenesis is mostly due to aberrant cell proliferation and apoptosis, it is still unclear how apoptosis is regulated. The aim of this study is to analyze the relationship among apoptosis, phosphatidylinositol 3-kinase (PI3K)/Akt and nuclear factor {kappa}B (NF-{kappa}B) in FPC knockdown kidney cells. We show that PKHD1-silenced HEK293 cells demonstrate a higher PI3K/Akt activity. Selective inhibition of PI3K/Akt using LY294002 or wortmannin in these cellsmore » increases serum starvation-induced HEK293 cell apoptosis with a concomitant decrease in cell proliferation and higher caspase-3 activity. PI3K/Akt inhibition also leads to increased NF-{kappa}B activity in these cells. We conclude that the PI3K/Akt pathway is involved in apoptotic function in PKHD1-silenced cells, and PI3K/Akt inhibition correlates with upregulation of NF-{kappa}B activity. These observations provide a potential platform for determining FPC function and therapeutic investigation of ARPKD.« less
Wright, Fay; Hammer, Marilyn; Paul, Steven M.; Aouizerat, Bradley E.; Kober, Kord M.; Conley, Yvette P.; Cooper, Bruce A.; Dunn, Laura B.; Levine, Jon D.; Melkus, Gail DEramo; Miaskowski, Christine
2017-01-01
Fatigue, a highly prevalent and distressing symptom during chemotherapy (CTX), demonstrates diurnal and interindividual variability in severity. Little is known about the associations between variations in genes involved in inflammatory processes and morning and evening fatigue severity during CTX. The purposes of this study, in a sample of oncology patients (N=543) with breast, gastrointestinal (GI), gynecological (GYN), or lung cancer who received two cycles of CTX, were to determine whether variations in genes involved in inflammatory processes were associated with inter-individual variability in initial levels as well as in the trajectories of morning and evening fatigue. Patients completed the Lee Fatigue Scale to determine morning and evening fatigue severity a total of six times over two cycles of CTX. Using a whole exome array, 309 single nucleotide polymorphisms among the 64 candidate genes that passed all quality control filters were evaluated using hierarchical linear modeling (HLM). Based on the results of the HLM analyses, the final SNPs were evaluated for their potential impact on protein function using two bioinformational tools. The following inflammatory pathways were represented: chemokines (3 genes); cytokines (12 genes); inflammasome (11 genes); Janus kinase/signal transducers and activators of transcription (JAK/STAT, 10 genes); mitogen-activated protein kinase/jun amino-terminal kinases (MAPK/JNK, 3 genes); nuclear factor-kappa beta (NFkB, 18 genes); and NFkB and MAP/JNK (7 genes). After controlling for self-reported and genomic estimates of race and ethnicity, polymorphisms in six genes from the cytokine (2 genes); inflammasome (2 genes); and NFkB (2 genes) pathways were associated with both morning and evening fatigue. Polymorphisms in six genes from the inflammasome (1 gene); JAK/STAT (1 gene); and NFkB (4 genes) pathways were associated with only morning fatigue. Polymorphisms in three genes from the inflammasome (2 genes) and the NFkB (1 gene) pathways were associated with only evening fatigue. Taken together, these findings add to the growing body of evidence that suggests that morning and evening fatigue are distinct symptoms. PMID:28110208
Lai, Ching-Shu; Lee, Jong Hun; Ho, Chi-Tang; Liu, Cheng Bin; Wang, Ju-Ming; Wang, Ying-Jan; Pan, Min-Hsiung
2009-11-25
Rosmanol is a natural polyphenol from the herb rosemary (Rosmarinus officinalis L.) with high antioxidant activity. In this study, we investigated the inhibitory effects of rosmanol on the induction of NO synthase (NOS) and COX-2 in RAW 264.7 cells induced by lipopolysaccharide (LPS). Rosmanol markedly inhibited LPS-stimulated iNOS and COX-2 protein and gene expression, as well as the downstream products, NO and PGE2. Treatment with rosmanol also reduced translocation of the nuclear factor-kappaB (NF-kappaB) subunits by prevention of the degradation and phosphorylation of inhibitor kappaB (IkappaB). Western blot analysis showed that rosmanol significantly inhibited translocation and phosphorylation of NF-kappaB, signal transducer and activator of transcription-3 (STAT3), and the protein expression of C/EBPbeta and C/EBPdelta. We also found that rosmanol suppressed LPS-induced phosphorylation of ERK1/2, p38 mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K)/Akt signaling. Our results demonstrate that rosmanol downregulates inflammatory iNOS and COX-2 gene expression by inhibiting the activation of NF-kappaB and STAT3 through interfering with the activation of PI3K/Akt and MAPK signaling. Taken together, rosmanol might contribute to the potent anti-inflammatory effect of rosemary and may have potential to be developed into an effective anti-inflammatory agent.
1985-01-01
Previous studies (21) have shown that two mouse kappa light (L) chain variable (V) region polymorphisms, the IB-peptide and Efla markers, reflect expression of a characteristic group of V kappa regions, called V kappa Ser, by some inbred strains and not others. Expression of V kappa Ser is controlled by a locus on chromosome 6, the chromosome that contains the kappa locus. To further characterize this V kappa group and begin to analyze the basis for its strain-specific expression, full- length complementary DNA (cDNA) copies were produced of L chain mRNA from the M75 myeloma that had been induced in the C.C58 strain of mice, and which produces a V kappa Ser L chain. The C.C58 strain is congenic with BALB/cAn, differing in the region of chromosome 6 that controls expression of the V kappa polymorphisms and the Lyt-2 and Lyt-3 T cell alloantigens. The complete nucleotide sequence of this cloned cDNA was determined and compared with the nucleotide sequences the most closely related BALB/c myeloma L chains known. Results indicated significant differences throughout the variable region, but particularly toward the 5' portion of the sequence. A probe corresponding to 200 bp of the 5' end of the cloned V kappa Ser cDNA was used in Southern hybridizations of restriction digests of liver DNA from a number of inbred, recombinant, and recombinant inbred strains. Under stringent hybridization conditions, one strongly-hybridizing fragment was observed in Bam HI, Hind III, and Eco RI digests, and based on the size of the fragments, strains could be organized into two groups. The presence of strongly hybridizing Bam HI, Hind III, and Eco RI fragments of 3.2, 2.8, and 2.1 kb, respectively, was found to correlate completely with expression by the strain of the IB-peptide and Efla markers. All nonexpressor strains yielded hybridizing fragments of 7.8, 8.4, and 2.8 kb, respectively. Possible explanations for strain- specific expression of V kappa Ser-associated phenotypic markers are discussed. PMID:3926938
Chromosomal locations of mouse immunoglobulin genes.
Valbuena, O; Marcu, K B; Croce, C M; Huebner, K; Weigert, M; Perry, R P
1978-01-01
The chromosomal locations of the structural genes coding for the constant portions of mouse heavy (H) and light chain immunoglobulins were studied by molecular hybridization techniques. Complementary DNA probes containing the constant-region sequences of kappa and lambdaI light chain and alpha, gamma2b, and mu heavy chain mRNAs were annealed to a large excess of DNA from a series of eight mouse-human hybrid cell lines that are deficient for various mouse chromosomes. The lines were scored as positive when a high proportion of a probe annealed and negative when an insignificant proportion annealed. Some lines were clearly negative for H and lambda and clearly positive for kappa. Others were positive or intermediate for lambda, positive for kappa and negative for H. Still others, including a line that was selected for the absence of the mouse X chromosome, were positive for all immunoglobulin species. These results demonstrate that the Clambda, Ckappa, and CH genes are located on different autosomes in the mouse. In contrast, the three heavy-chain families exhibited consistently uniform hybridization results, suggesting that the genes for Calpha, Cgamma, and Cmu are located on the same chromosome. A comparison of karyotypic data with hybridization data has limited the possible locations of the Ig genes to only a few chromosomes. PMID:96442
Comparison of correlated correlations.
Cohen, A
1989-12-01
We consider a problem where kappa highly correlated variables are available, each being a candidate for predicting a dependent variable. Only one of the kappa variables can be chosen as a predictor and the question is whether there are significant differences in the quality of the predictors. We review several tests derived previously and propose a method based on the bootstrap. The motivating medical problem was to predict 24 hour proteinuria by protein-creatinine ratio measured at either 08:00, 12:00 or 16:00. The tests which we discuss are illustrated by this example and compared using a small Monte Carlo study.
Adhesion of human monocytes (MOs) results in the rapid transcriptional activation of cytokine genes that are dependent on nuclear factor (NF)-kappaB. Several pathways leading to activation of NF-kappaB have been described, including those involving reactive oxygen intermediates (...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lodewick, Julie; Lamsoul, Isabelle; Polania, Angela
The oncogenic potential of the HTLV-1 Tax protein involves activation of the NF-{kappa}B pathway, which depends on Tax phosphorylation, ubiquitination and sumoylation. We demonstrate that the nuclei of Tax-expressing cells, including HTLV-1 transformed T-lymphocytes, contain a pool of Tax molecules acetylated on lysine residue at amino acid position 346 by the transcriptional coactivator p300. Phosphorylation of Tax on serine residues 300/301 was a prerequisite for Tax localization in the nucleus and correlated with its subsequent acetylation by p300, whereas sumoylation, resulting in the formation of Tax nuclear bodies in which p300 was recruited, favored Tax acetylation. Overexpression of p300 markedlymore » increased Tax acetylation and the ability of a wild type HTLV-1 provirus, -but not of a mutant provirus carrying an acetylation deficient Tax gene-, to activate gene expression from an integrated NF-{kappa}B-controlled promoter. Thus, Tax acetylation favors NF-{kappa}B activation and might play an important role in HTLV-1-induced cell transformation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Wenqing; Beilhartz, Greg; Roy, Yvette
2010-04-15
1,25 Dihydroxyvitamin D{sub 3} (1,25D{sub 3}) primes NB4 promyelocytic leukemia cells to differentiate along the monocyte/macrophage lineage through a non-genomic mechanism. Here we show that NB4 cells express high levels of the recently identified membrane receptor for 1,25D{sub 3}, which is a distinct gene product from the classical nuclear vitamin D receptor. This 57 kDa protein, named 1,25D{sub 3}-MARRS (Membrane Activated Rapid Response to Steroids)/ERp57/PIA3 appears to associate in a complex with the transcription factor, nuclear factor kappa B (NF{kappa}B). In unstimulated cells, 1,25D{sub 3}-MARRS can be co-immunoprecipitated with antibodies directed at NF{kappa}B, and NF{kappa}B is co-precipitated when antibodies againstmore » 1,25D{sub 3}-MARRS or ERp57 are used. Confocal microscopy and subcellular fractionation studies demonstrate that both 1,25D{sub 3}-MARRS and NF{kappa}B begin translocating to the nucleus within minutes of co-stimulation with 1,25D{sub 3} and phorbol ester. The predominant nuclear localization of both proteins precedes the expression of the monocyte/macrophage phenotype and suggests that this event may be critical to the differentiation pathway. This suggests a role for 1,25D{sub 3}-MARRS in the nucleus as a regulator of gene expression. Here it may also regulate the activity of NF{kappa}B and other factors with which it may be interacting.« less
Effects of decoy molecules targeting NF-kappaB transcription factors in Cystic fibrosis IB3–1 cells
Finotti, Alessia; Borgatti, Monica; Bezzerri, Valentino; Nicolis, Elena; Lampronti, Ilaria; Dechecchi, Maria; Mancini, Irene; Cabrini, Giulio; Saviano, Michele; Avitabile, Concetta; Romanelli, Alessandra; Gambari, Roberto
2012-01-01
One of the clinical features of cystic fibrosis (CF) is a deep inflammatory process, which is characterized by production and release of cytokines and chemokines, among which interleukin 8 (IL-8) represents one of the most important. Accordingly, there is a growing interest in developing therapies against CF to reduce the excessive inflammatory response in the airways of CF patients. Since transcription factor NF-kappaB plays a critical role in IL-8 expression, the transcription factor decoy (TFD) strategy might be of interest. In order to demonstrate that TFD against NF-kappaB interferes with the NF-kappaB pathway we proved, by chromatin immunoprecipitation (ChIP) that treatment with TFD oligodeoxyribonucleotides of cystic fibrosis IB3–1 cells infected with Pseudomonas aeruginosa leads to a decrease occupancy of the Il-8 gene promoter by NF-kappaB factors. In order to develop more stable therapeutic molecules, peptide nucleic acids (PNAs) based agents were considered. In this respect PNA-DNA-PNA (PDP) chimeras are molecules of great interest from several points of view: (1) they can be complexed with liposomes and microspheres; (2) they are resistant to DNases, serum and cytoplasmic extracts; (3) they are potent decoy molecules. By using electrophoretic mobility shift assay and RT-PCR analysis we have demonstrated that (1) the effects of PDP/PDP NF-kappaB decoy chimera on accumulation of pro-inflammatory mRNAs in P.aeruginosa infected IB3–1 cells reproduce that of decoy oligonucleotides; in particular (2) the PDP/PDP chimera is a strong inhibitor of IL-8 gene expression; (3) the effect of PDP/PDP chimeras, unlike those of ODN-based decoys, are observed even in the absence of protection with lipofectamine. These informations are of great impact, in our opinion, for the development of stable molecules to be used in non-viral gene therapy of cystic fibrosis. PMID:22772035
Paik, Yong-Han; Schwabe, Robert F; Bataller, Ramón; Russo, Maria P; Jobin, Christian; Brenner, David A
2003-05-01
Bacterial lipopolysaccharide (LPS) stimulates Kupffer cells and participates in the pathogenesis of alcohol-induced liver injury. However, it is unknown whether LPS directly affects hepatic stellate cells (HSCs), the main fibrogenic cell type in the injured liver. This study characterizes LPS-induced signal transduction and proinflammatory gene expression in activated human HSCs. Culture-activated HSCs and HSCs isolated from patients with hepatitis C virus-induced cirrhosis express LPS-associated signaling molecules, including CD14, toll-like receptor (TLR) 4, and MD2. Stimulation of culture-activated HSCs with LPS results in a rapid and marked activation of NF-kappaB, as assessed by in vitro kinase assays for IkappaB kinase (IKK), IkappaBalpha steady-state levels, p65 nuclear translocation, NF-kappaB-dependent luciferase reporter gene assays, and electrophoretic mobility shift assays. Lipid A induces NF-kappaB activation in a similar manner. Both LPS- and lipid A-induced NF-kappaB activation is blocked by preincubation with either anti-TLR4 blocking antibody (HTA125) or Polymyxin B. Lipid A induces NF-kappaB activation in HSCs from TLR4-sufficient (C3H/OuJ) mice but not from TLR4-deficient (C3H/HeJ) mice. LPS also activates c-Jun N-terminal kinase (JNK), as assessed by in vitro kinase assays. LPS up-regulates IL-8 and MCP-1 gene expression and secretion. LPS-induced IL-8 secretion is completely inhibited by the IkappaB super repressor (Ad5IkappaB) and partially inhibited by a specific JNK inhibitor, SP600125. LPS also up-regulates cell surface expression of ICAM-1 and VCAM-1. In conclusion, human activated HSCs utilize components of TLR4 signal transduction cascade to stimulate NF-kappaB and JNK and up-regulate chemokines and adhesion molecules. Thus, HSCs are a potential mediator of LPS-induced liver injury.
Riehemann, K; Behnke, B; Schulze-Osthoff, K
1999-01-08
Activation of transcription factor NF-kappaB is elevated in several chronic inflammatory diseases and is responsible for the enhanced expression of many proinflammatory gene products. Extracts from leaves of stinging nettle (Urtica dioica) are used as antiinflammatory remedies in rheumatoid arthritis. Standardized preparations of these extracts (IDS23) suppress cytokine production, but their mode of action remains unclear. Here we demonstrate that treatment of different cells with IDS23 potently inhibits NF-kappaB activation. An inhibitory effect was observed in response to several stimuli, suggesting that IDS23 suppressed a common NF-kappaB pathway. Inhibition of NF-kappaB activation by IDS23 was not mediated by a direct modification of DNA binding, but rather by preventing degradation of its inhibitory subunit IkappaB-alpha. Our results suggests that part of the antiinflammatory effect of Urtica extract may be ascribed to its inhibitory effect on NF-kappaB activation.
Shen, Huiyun; Oesterling, Elizabeth; Stromberg, Arnold; Toborek, Michal; MacDonald, Ruth; Hennig, Bernhard
2008-10-01
Marginal intake of dietary zinc can be associated with increased risk of cardiovascular diseases. In the current study we hypothesized that vascular dysfunction and associated inflammatory events are activated during a zinc deficient state. We tested this hypothesis using both vascular endothelial cells and mice lacking the functional LDL-receptor gene. Zinc deficiency increased oxidative stress and NF-kappaB DNA binding activity, and induced COX-2 and E-selectin gene expression, as well as monocyte adhesion in cultured endothelial cells. The NF-kappaB inhibitor CAPE significantly reduced the zinc deficiency-induced COX-2 expression, suggesting regulation through NF-kappaB signaling. PPAR can inhibit NF-kappaB signaling, and our previous data have shown that PPAR transactivation activity requires adequate zinc. Zinc deficiency down-regulated PPARalpha expression in cultured endothelial cells. Furthermore, the PPARgamma agonist rosiglitazone was unable to inhibit the adhesion of monocytes to endothelial cells during zinc deficiency, an event which could be reversed by zinc supplementation. Our in vivo data support the importance of PPAR dysregulation during zinc deficiency. For example, rosiglitazone induced inflammatory genes (e.g., MCP-1) only during zinc deficiency, and adequate zinc was required for rosiglitazone to down-regulate pro-inflammatory markers such as iNOS. In addition, rosiglitazone increased IkappaBalpha protein expression only in zinc adequate mice. Finally, plasma data from LDL-R-deficient mice suggest an overall pro-inflammatory environment during zinc deficiency and support the concept that zinc is required for proper anti-inflammatory or protective functions of PPAR. These studies suggest that zinc nutrition can markedly modulate mechanisms of the pathology of inflammatory diseases such as atherosclerosis.
Smad7 mediates inhibition of Saos2 osteosarcoma cell differentiation by NF{kappa}B
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eliseev, Roman A.; Schwarz, Edward M.; Zuscik, Michael J.
2006-01-01
The transcription factor NF{kappa}B is constitutively activated in various tumor cells where it promotes proliferation and represses apoptosis. The bone morphogenetic proteins (BMPs) delay cell proliferation and promote differentiation and apoptosis of bone cells through activation of Smad downstream effectors and via Smad-independent mechanisms. Thus, NF{kappa}B and BMP pathways play opposing roles in regulating osteoblastic cell fate. Here, we show that in osteosarcoma Saos2 osteoblasts, NF{kappa}B regulates the activity of the BMP/Smad signaling. Inhibition of NF{kappa}B by overexpression of mI{kappa}B leads to the induction of osteoblast differentiation. Saos2 cells overexpressing mI{kappa}B (Saos2-mI{kappa}B) exhibit higher expression of osteoblast phenotypic genes suchmore » as alkaline phosphatase, Runx2 and osteocalcin and are more responsive to BMP2 in comparison to wild-type cells (Saos2-wt) or empty vector infected controls (Saos2-EV). Furthermore, BMP-2 signaling and Smad phosphorylation are significantly increased in Saos2-mI{kappa}B cells in comparison to Saos2-EV cells. Inhibition of NF{kappa}B signaling in Saos2-mI{kappa}B cells is associated with decreased expression of the BMP signaling inhibitor Smad7. While gain of Smad7 function in Saos2-mI{kappa}B cells results in inhibition of BMP signaling, anti-sense knockdown of Smad7 in Saos2-EV cells leads to upregulation of BMP signaling. We therefore conclude that in osteosarcoma Saos2 cells, NF{kappa}B represses BMP/Smad signaling and BMP2-induced differentiation through Smad7.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maier, Jana V., E-mail: Jana.maier@kit.edu; Volz, Yvonne; Berger, Caroline
2010-10-22
Research highlights: {yields}Bag-1 depletion only marginally affects the action of the glucocorticoid receptor but strongly regulates the activity of NF-{kappa}B. {yields}Bag-1 depletion attenuates phosphorylation and degradation of I{kappa}B{alpha} and nuclear accumulation of NF-{kappa}B p65 and p50. {yields}Bag-1 interacts with I{kappa}B{alpha} and partially restores I{kappa}B{alpha} and NF-{kappa}B activation in Bag-1 depleted cells. -- Abstract: Bag-1 consists in humans of four isoforms generated from the same RNA by alternative translation. Overexpression of single Bag-1 isoforms has identified Bag-1 as a negative regulator of action of many proteins including the glucocorticoid receptor (GR). Here we have analysed the ability of Bag-1 to regulatemore » the transrepression function of the GR. Silencing Bag-1 expression only marginally affects the transrepression action of the GR but decreased the action of the transcription factor NF-{kappa}B. Furthermore phosphorylation and degradation of the inhibitor protein I{kappa}B{alpha} and nuclear accumulation of p65 and p50 NF-{kappa}B proteins in response to phorbol ester was attenuated following Bag-1 depletion in HeLa cells. Reconstitution of Bag-1 in depleted cells partially restored I{kappa}B{alpha} and NF-{kappa}B activation. Knock-down of Bag-1 expression also did not significantly alter GR-mediated transactivation but affected the basal transcription of some of the target genes. Thus Bag-1 proteins function as regulators of the action of selective transcription factors.« less
Hong, Samin; Kim, Chan Yun; Lee, Won Seok; Seong, Gong Je
2010-01-01
To assess the reproducibility of the new spectral domain Cirrus high-definition optical coherence tomography (HD-OCT; Carl Zeiss Meditec, Dublin, CA, USA) for analysis of peripapillary retinal nerve fiber layer (RNFL) thickness in healthy eyes. Thirty healthy Korean volunteers were enrolled. Three optic disc cube 200 x 200 Cirrus HD-OCT scans were taken on the same day in discontinuous sessions by the same operator without using the repeat scan function. The reproducibility of the calculated RNFL thickness and probability code were determined by the intraclass correlation coefficient (ICC), coefficient of variation (CV), test-retest variability, and Fleiss' generalized kappa (kappa). Thirty-six eyes were analyzed. For average RNFL thickness, the ICC was 0.970, CV was 2.38%, and test-retest variability was 4.5 microm. For all quadrants except the nasal, ICCs were 0.972 or higher and CVs were 4.26% or less. Overall test-retest variability ranged from 5.8 to 8.1 microm. The kappa value of probability codes for average RNFL thickness was 0.690. The kappa values of quadrants and clock-hour sectors were lower in the nasal areas than in other areas. The reproducibility of Cirrus HD-OCT to analyze peripapillary RNFL thickness in healthy eyes was excellent compared with the previous reports for time domain Stratus OCT. For the calculated RNFL thickness and probability code, variability was relatively higher in the nasal area, and more careful analyses are needed.
ERIC Educational Resources Information Center
Ahn, Hyung Jin; Hernandez, Caterina M.; Levenson, Jonathan M.; Lubin, Farah D.; Liou, Hsiou-Chi; Sweatt, J. David
2008-01-01
Transcription is a critical component for consolidation of long-term memory. However, relatively few transcriptional mechanisms have been identified for the regulation of gene expression in memory formation. In the current study, we investigated the activity of one specific member of the NF-[kappa]B transcription factor family, c-Rel, during…
NIK and Cot cooperate to trigger NF-kappaB p65 phosphorylation.
Wittwer, Tobias; Schmitz, M Lienhard
2008-06-27
The serine/threonine kinase Cot triggers NF-kappaB-dependent transactivation and activation of various MAPKinases. Here we identify Cot as a novel p65 interacting protein kinase. Cot expression induces p65 phosphorylation at serines 536 and 468 in dependence from its kinase function. Accordingly, shRNA-mediated knockdown of Cot expression interferes with TNF-induced NF-kappaB-dependent gene expression. Also the C-terminally truncated, oncogenic form of Cot is able to trigger p65 phosphorylation. In vitro kinase assays and dominant negative mutants revealed that NIK functions downstream of Cot to mediate p65 phosphorylation.
Saban, Marcia R; O'Donnell, Michael A; Hurst, Robert E; Wu, Xue-Ru; Simpson, Cindy; Dozmorov, Igor; Davis, Carole; Saban, Ricardo
2008-01-01
Background Despite being a mainstay for treating superficial bladder carcinoma and a promising agent for interstitial cystitis, the precise mechanism of Bacillus Calmette-Guerin (BCG) remains poorly understood. It is particularly unclear whether BCG is capable of altering gene expression in the bladder target organ beyond its well-recognized pro-inflammatory effects and how this relates to its therapeutic efficacy. The objective of this study was to determine differentially expressed genes in the mouse bladder following chronic intravesical BCG therapy and to compare the results to non-specific pro inflammatory stimuli (LPS and TNF-α). For this purpose, C57BL/6 female mice received four weekly instillations of BCG, LPS, or TNF-α. Seven days after the last instillation, the urothelium along with the submucosa was removed from detrusor muscle and the RNA was extracted from both layers for cDNA array experiments. Microarray results were normalized by a robust regression analysis and only genes with an expression above a conditional threshold of 0.001 (3SD above background) were selected for analysis. Next, genes presenting a 3-fold ratio in regard to the control group were entered in Ingenuity Pathway Analysis (IPA) for a comparative analysis in order to determine genes specifically regulated by BCG, TNF-α, and LPS. In addition, the transcriptome was precipitated with an antibody against RNA polymerase II and real-time polymerase chain reaction assay (Q-PCR) was used to confirm some of the BCG-specific transcripts. Results Molecular networks of treatment-specific genes generated several hypotheses regarding the mode of action of BCG. BCG-specific genes involved small GTPases and BCG-specific networks overlapped with the following canonical signaling pathways: axonal guidance, B cell receptor, aryl hydrocarbon receptor, IL-6, PPAR, Wnt/β-catenin, and cAMP. In addition, a specific detrusor network expressed a high degree of overlap with the development of the lymphatic system. Interestingly, TNF-α-specific networks overlapped with the following canonical signaling pathways: PPAR, death receptor, and apoptosis. Finally, LPS-specific networks overlapped with the LPS/IL-1 mediated inhibition of RXR. Because NF-kappaB occupied a central position in several networks, we further determined whether this transcription factor was part of the responses to BCG. Electrophoretic mobility shift assays confirmed the participation of NF-kappaB in the mouse bladder responses to BCG. In addition, BCG treatment of a human urothelial cancer cell line (J82) also increased the binding activity of NF-kappaB, as determined by precipitation of the chromatin by a NF-kappaB-p65 antibody and Q-PCR of genes bearing a NF-kappaB consensus sequence. Next, we tested the hypothesis of whether small GTPases such as LRG-47 are involved in the uptake of BCG by the bladder urothelium. Conclusion As expected, BCG treatment induces the transcription of genes belonging to common pro-inflammatory networks. However, BCG also induces unique genes belonging to molecular networks involved in axonal guidance and lymphatic system development within the bladder target organ. In addition, NF-kappaB seems to play a predominant role in the bladder responses to BCG therapy. Finally, in intact urothelium, BCG-GFP internalizes in LRG-47-positive vesicles. These results provide a molecular framework for the further study of the involvement of immune and nervous systems in the bladder responses to BCG therapy. PMID:18267009
Flavonoids inhibit histamine release and expression of proinflammatory cytokines in mast cells.
Park, Hyo-Hyun; Lee, Soyoung; Son, Hee-Young; Park, Seung-Bin; Kim, Mi-Sun; Choi, Eun-Ju; Singh, Thoudam S K; Ha, Jeoung-Hee; Lee, Maan-Gee; Kim, Jung-Eun; Hyun, Myung Chul; Kwon, Taeg Kyu; Kim, Yeo Hyang; Kim, Sang-Hyun
2008-10-01
Mast cells participate in allergy and inflammation by secreting inflammatory mediators such as histamine and proinflammatory cytokines. Flavonoids are naturally occurring molecules with antioxidant, cytoprotective, and antiinflammatory actions. However, effect of flavonoids on the release of histamine and proinflammatory mediator, and their comparative mechanism of action in mast cells were not well defined. Here, we compared the effect of six flavonoids (astragalin, fisetin, kaempferol, myricetin, quercetin, and rutin) on the mast cell-mediated allergic inflammation. Fisetin, kaempferol, myricetin, quercetin, and rutin inhibited IgE or phorbol-12-myristate 13-acetate and calcium ionophore A23187 (PMACI)-mediated histamine release in RBL-2H3 cells. These five flavonoids also inhibited elevation of intracellular calcium. Gene expressions and secretion of proinflammatory cytokines such as tumor necrosis factor-alpha (TNF-alpha), interleukin (IL)-1beta, IL-6, and IL-8 were assessed in PMACI-stimulated human mast cells (HMC-1). Fisetin, quercetin, and rutin decreased gene expression and production of all the proinflammatory cytokines after PMACI stimulation. Myricetin attenuated TNF-alpha and IL-6 but not IL-1beta and IL-8. Fisetin, myricetin, and rutin suppressed activation of NF-kappaB indicated by inhibition of nuclear translocation of NF-kappaB, NF-kappaB/DNA binding, and NF-kappaB-dependent gene reporter assay. The pharmacological actions of these flavonoids suggest their potential activity for treatment of allergic inflammatory diseases through the down-regulation of mast cell activation.
Dagher, Zeina; Garçon, Guillaume; Billet, Sylvain; Verdin, Anthony; Ledoux, Frédéric; Courcot, Dominique; Aboukais, Antoine; Shirali, Pirouz
2007-01-01
To contribute to improving knowledge on the adverse health effects induced by particulate matter (PM) air pollution, an extensive investigation was undertaken of the underlying mechanisms of action activated by PM(2.5) air pollution collected in Dunkerque, a strongly industrialized French seaside city. Their chemical and physical characteristics have been previously determined, and earlier in vitro short-term studies have shown them to cause dose-dependent and time-dependent oxidative damage, gene expression and protein secretion of inflammatory mediators, and apoptotic events in human lung epithelial cells (L132) in culture. Hence, this work studied the activation of nuclear factor-kappa B (NF-kappaB)/inhibitory kappa B (IkappaB) by Dunkerque city PM(2.5) in these target cells, by determination of phosphorylated p65 and phosphorylated IkappaBalpha protein levels in cytoplasmic extracts, and p65 and p50 DNA binding in nuclear extracts. In PM-exposed L132 cells, there were concentration- and/or time-dependent increases in nuclear p65 and cytoplasmic IkB-alpha phosphorylation, and nuclear p65 and p50 DNA binding. Taken together, these results showed that Dunkerque city PM(2.5) were involved in the activation of the NF-kappaB/IkappaB complex, notably through the occurrence of oxidative stress conditions, and, therefore, in the gene expression and protein secretion of inflammatory mediators in target L132 cells. Hence, these findings suggested that the activation of the NF-kappaB/IkappaB complex preceded cytotoxicity in Dunkerque city PM-exposed L132 cells. (c) 2007 John Wiley & Sons, Ltd.
Fang, Fang; Collins-Emerson, Julie M; Heuer, Cord; Hill, Fraser I; Tisdall, David J; Wilson, Peter R; Benschop, Jackie
2014-11-01
A study was performed to investigate interlaboratory test agreement between a research and a commercial veterinary diagnostic laboratory on blood and urine samples, and to investigate test agreement between blood, urine, and kidney samples (research laboratory) for leptospirosis diagnosis. Samples were sourced from 399 sheep and 146 beef cattle from a local abattoir. Interlaboratory agreement for real-time quantitative polymerase chain reaction (qPCR) results on urine samples was almost perfect (kappa = 0.90), despite the use of different amplification targets (DNA gyrase subunit B gene vs. 16s ribosomal RNA gene), chemistries (SYTO9 vs. TaqMan probe), and pre-PCR processing. Interlaboratory agreement for microscopic agglutination test (MAT) positivity was almost perfect (kappa = 0.93) for Leptospira borgpetersenii serovar Hardjo subtype Hardjobovis (Hardjobovis) but moderate (kappa = 0.53) for Leptospira interrogans serovar Pomona (Pomona). Among animals that had different titers recorded, higher Hardjobovis and lower Pomona titers were reported by the commercial laboratory than by the research laboratory (P < 0.005). These interlaboratory comparisons can assist researchers and diagnosticians in interpreting the sometimes discrepant test results. Within the research laboratory, the comparison of qPCR results on urine and kidney showed almost perfect agreement (kappa = 0.84), suggesting that the qPCR on these 2 specimens can be used interchangeably. The agreement between MAT positivity and urine and kidney qPCR results was fair (kappa = 0.32 and kappa = 0.33, respectively). However, the prevalence ratio of urine and kidney qPCR positivity in Hardjobovis-seropositive versus Hardjobovis-seronegative sheep indicated that Hardjobovis seropositivity found in sheep may be able to predict shedding or renal carriage. © 2014 The Author(s).
Reeves, Mathew J; Mullard, Andrew J; Wehner, Susan
2008-01-01
Background The Paul Coverdell National Acute Stroke Registry (PCNASR) is a U.S. based national registry designed to monitor and improve the quality of acute stroke care delivered by hospitals. The registry monitors care through specific performance measures, the accuracy of which depends in part on the reliability of the individual data elements used to construct them. This study describes the inter-rater reliability of data elements collected in Michigan's state-based prototype of the PCNASR. Methods Over a 6-month period, 15 hospitals participating in the Michigan PCNASR prototype submitted data on 2566 acute stroke admissions. Trained hospital staff prospectively identified acute stroke admissions, abstracted chart information, and submitted data to the registry. At each hospital 8 randomly selected cases were re-abstracted by an experienced research nurse. Inter-rater reliability was estimated by the kappa statistic for nominal variables, and intraclass correlation coefficient (ICC) for ordinal and continuous variables. Factors that can negatively impact the kappa statistic (i.e., trait prevalence and rater bias) were also evaluated. Results A total of 104 charts were available for re-abstraction. Excellent reliability (kappa or ICC > 0.75) was observed for many registry variables including age, gender, black race, hemorrhagic stroke, discharge medications, and modified Rankin Score. Agreement was at least moderate (i.e., 0.75 > kappa ≥; 0.40) for ischemic stroke, TIA, white race, non-ambulance arrival, hospital transfer and direct admit. However, several variables had poor reliability (kappa < 0.40) including stroke onset time, stroke team consultation, time of initial brain imaging, and discharge destination. There were marked systematic differences between hospital abstractors and the audit abstractor (i.e., rater bias) for many of the data elements recorded in the emergency department. Conclusion The excellent reliability of many of the data elements supports the use of the PCNASR to monitor and improve care. However, the poor reliability for several variables, particularly time-related events in the emergency department, indicates the need for concerted efforts to improve the quality of data collection. Specific recommendations include improvements to data definitions, abstractor training, and the development of ED-based real-time data collection systems. PMID:18547421
Chan, Julie Y H; Wu, Carol H Y; Tsai, Ching-Yi; Cheng, Hsiao-Lei; Dai, Kuang-Yu; Chan, Samuel H H; Chang, Alice Y W
2007-06-15
As the origin of a 'life-and-death' signal that reflects central cardiovascular regulatory failure during brain stem death, the rostral ventrolateral medulla (RVLM) is a suitable neural substrate for mechanistic delineation of this vital phenomenon. Using a clinically relevant animal model that employed the organophosphate pesticide mevinphos (Mev) as the experimental insult, we evaluated the hypothesis that transcriptional up-regulation of nitric oxide synthase I or II (NOS I or II) gene expression by nuclear factor-kappaB (NF-kappaB) on activation of muscarinic receptors in the RVLM underlies brain stem death. In Sprague-Dawley rats maintained under propofol anaesthesia, co-microinjection of muscarinic M2R (methoctramine) or M4R (tropicamide), but not M1R (pirenzepine) or M3R (4-diphenylacetoxy-N-dimethylpiperidinium) antagonist significantly reduced the enhanced NOS I-protein kinase G signalling ('pro-life' phase) or augmented NOS II-peroxynitrite cascade ('pro-death' phase) in ventrolateral medulla, blunted the biphasic increase and decrease in baroreceptor reflex-mediated sympathetic vasomotor tone that reflect the transition from life to death, and diminished the elevated DNA binding activity or nucleus-bound translocation of NF-kappaB in RVLM neurons induced by microinjection of Mev into the bilateral RVLM. However, NF-kappaB inhibitors (diethyldithiocarbamate or pyrrolidine dithiocarbamate) or double-stranded kappaB decoy DNA preferentially antagonized the augmented NOS II-peroxynitrite cascade and the associated cardiovascular depression exhibited during the 'pro-death' phase. We conclude that transcriptional up-regulation of NOS II gene expression by activation of NF-kappaB on selective stimulation of muscarinic M2 or M4 subtype receptors in the RVLM underlies the elicited cardiovascular depression during the 'pro-death' phase in our Mev intoxication model of brain stem death.
Diploidy and the selective advantage for sexual reproduction in unicellular organisms.
Kleiman, Maya; Tannenbaum, Emmanuel
2009-11-01
This article develops mathematical models describing the evolutionary dynamics of both asexually and sexually reproducing populations of diploid unicellular organisms. The asexual and sexual life cycles are based on the asexual and sexual life cycles in Saccharomyces cerevisiae, Baker's yeast, which normally reproduces by asexual budding, but switches to sexual reproduction when stressed. The mathematical models consider three reproduction pathways: (1) Asexual reproduction, (2) self-fertilization, and (3) sexual reproduction. We also consider two forms of genome organization. In the first case, we assume that the genome consists of two multi-gene chromosomes, whereas in the second case, we consider the opposite extreme and assume that each gene defines a separate chromosome, which we call the multi-chromosome genome. These two cases are considered to explore the role that recombination has on the mutation-selection balance and the selective advantage of the various reproduction strategies. We assume that the purpose of diploidy is to provide redundancy, so that damage to a gene may be repaired using the other, presumably undamaged copy (a process known as homologous recombination repair). As a result, we assume that the fitness of the organism only depends on the number of homologous gene pairs that contain at least one functional copy of a given gene. If the organism has at least one functional copy of every gene in the genome, we assume a fitness of 1. In general, if the organism has l homologous pairs that lack a functional copy of the given gene, then the fitness of the organism is kappa(l). The kappa(l) are assumed to be monotonically decreasing, so that kappa(0) = 1 > kappa(1) > kappa(2) > cdots, three dots, centered > kappa(infinity) = 0. For nearly all of the reproduction strategies we consider, we find, in the limit of large N, that the mean fitness at mutation-selection balance is max{2e(-mu) - 1,0} where N is the number of genes in the haploid set of the genome, epsilon is the probability that a given DNA template strand of a given gene produces a mutated daughter during replication, and mu = Nepsilon. The only exception is the sexual reproduction pathway for the multi-chromosomed genome. Assuming a multiplicative fitness landscape where kappa(l) = alpha(l) for alpha in (0, 1), this strategy is found to have a mean fitness that exceeds the mean fitness of all the other strategies. Furthermore, while other reproduction strategies experience a total loss of viability due to the steady accumulation of deleterious mutations once mu exceeds [Formula: see text] no such transition occurs in the sexual pathway. Indeed, in the limit as alpha --> 1 for the multiplicative landscape, we can show that the mean fitness for the sexual pathway with the multi-chromosomed genome converges to e(-2mu), which is always positive. We explicitly allow for mitotic recombination in this study, which, in contrast to previous studies using different models, does not have any advantage over other asexual reproduction strategies. The results of this article provide a basis for understanding the selective advantage of the specific meiotic pathway that is employed by sexually reproducing organisms. The results of this article also suggest an explanation for why unicellular organisms such as Saccharomyces cerevisiae (Baker's yeast) switch to a sexual mode of reproduction when stressed. While the results of this article are based on modeling mutation-propagation in unicellular organisms, they nevertheless suggest that, in more complex organisms with significantly larger genomes, sex is necessary to prevent the loss of viability of a population due to genetic drift. Finally, and perhaps most importantly, the results of this article demonstrate a selective advantage for sexual reproduction with fewer and much less restrictive assumptions than those of previous studies.
Benedict, Chris A; Angulo, Ana; Patterson, Ginelle; Ha, Sukwon; Huang, Huang; Messerle, Martin; Ware, Carl F; Ghazal, Peter
2004-01-01
Cytomegalovirus (CMV) is known to rapidly induce activation of nuclear factor kappaB (NF-kappaB) after infection of fibroblast and macrophage cells. NF-kappaB response elements are present in the enhancer region of the CMV major immediate-early promoter (MIEP), and activity of the MIEP is strongly upregulated by NF-kappaB in transient-transfection assays. Here we investigate whether the NF-kappaB-dependent pathway is required for initiating or potentiating human and murine CMV replication in vitro. We show that expression of a dominant negative mutant of the inhibitor of NF-kappaB-alpha (IkappaBalphaM) does not alter the replication kinetics of human or mouse CMV in cultured cells. In addition, mouse embryo fibroblasts genetically deficient for p65/RelA actually showed elevated levels of MCMV replication. Mutation of all NF-kappaB response elements within the enhancer of the MIEP in a recombinant mouse CMV containing the human MIEP (hMCMV-ES), which we have previously shown to replicate in murine fibroblasts with kinetics equivalent to that of wild-type mouse CMV, did not negatively affect replication in fibroblasts. Taken together, these data show that, for CMV replication in cultured fibroblasts activation of the canonical NF-kappaB pathway and binding of NF-kappaB to the MIEP are dispensable, and in the case of p65 may even interfere, thus uncovering a previously unrecognized level of complexity in the host regulatory network governing MIE gene expression in the context of a viral infection.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Manea, Adrian, E-mail: adrian.manea@icbp.ro; Tanase, Laurentia I.; Raicu, Monica
Inflammation-induced changes in the activity and expression of NADPH oxidases (Nox) play a key role in atherogenesis. The molecular mechanisms of Nox regulation are scantily elucidated. Since nuclear factor-{kappa}B (NF-{kappa}B) controls the expression of many genes associated to inflammation-related diseases, in this study we have investigated the role of NF-{kappa}B signaling in the regulation of Nox1 and Nox4 transcription in human aortic smooth muscle cells (SMCs). Cultured cells were exposed to tumor necrosis factor-{alpha} (TNF{alpha}), a potent inducer of both Nox and NF-{kappa}B, up to 24 h. Lucigenin-enhanced chemiluminescence and dichlorofluorescein assays, real-time polymerase chain reaction, and Western blot analysismore » showed that inhibition of NF-{kappa}B pathway reduced significantly the TNF{alpha}-dependent up-regulation of Nox-derived reactive oxygen species production, Nox1 and Nox4 expression. In silico analysis indicated the existence of typical NF-{kappa}B elements in the promoters of Nox1 and Nox4. Transient overexpression of p65/NF-{kappa}B significantly increased the promoter activities of both isoforms. Physical interaction of p65/NF-{kappa}B proteins with the predicted sites was demonstrated by chromatin immunoprecipitation assay. These findings demonstrate that NF-{kappa}B is an essential regulator of Nox1- and Nox4-containing NADPH oxidase in SMCs. Elucidation of the complex relationships between NF-{kappa}B and Nox enzymes may lead to a novel pharmacological strategy to reduce both inflammation and oxidative stress in atherosclerosis and its associated complications.« less
Miller, Susanne C; Huang, Ruili; Sakamuru, Srilatha; Shukla, Sunita J; Attene-Ramos, Matias S; Shinn, Paul; Van Leer, Danielle; Leister, William; Austin, Christopher P; Xia, Menghang
2010-05-01
Nuclear factor-kappa B (NF-kappaB) is a transcription factor that plays a critical role across many cellular processes including embryonic and neuronal development, cell proliferation, apoptosis, and immune responses to infection and inflammation. Dysregulation of NF-kappaB signaling is associated with inflammatory diseases and certain cancers. Constitutive activation of NF-kappaB signaling has been found in some types of tumors including breast, colon, prostate, skin and lymphoid, hence therapeutic blockade of NF-kappaB signaling in cancer cells provides an attractive strategy for the development of anticancer drugs. To identify small molecule inhibitors of NF-kappaB signaling, we screened approximately 2800 clinically approved drugs and bioactive compounds from the NIH Chemical Genomics Center Pharmaceutical Collection (NPC) in a NF-kappaB mediated beta-lactamase reporter gene assay. Each compound was tested at fifteen different concentrations in a quantitative high throughput screening format. We identified nineteen drugs that inhibited NF-kappaB signaling, with potencies as low as 20 nM. Many of these drugs, including emetine, fluorosalan, sunitinib malate, bithionol, narasin, tribromsalan, and lestaurtinib, inhibited NF-kappaB signaling via inhibition of IkappaBalpha phosphorylation. Others, such as ectinascidin 743, chromomycin A3 and bortezomib utilized other mechanisms. Furthermore, many of these drugs induced caspase 3/7 activity and had an inhibitory effect on cervical cancer cell growth. Our results indicate that many currently approved pharmaceuticals have previously unappreciated effects on NF-kappaB signaling, which may contribute to anticancer therapeutic effects. Comprehensive profiling of approved drugs provides insight into their molecular mechanisms, thus providing a basis for drug repurposing. Published by Elsevier Inc.
Meunier, Alice; Latrémolière, Alban; Dominguez, Elisa; Mauborgne, Annie; Philippe, Stéphanie; Hamon, Michel; Mallet, Jacques; Benoliel, Jean-Jacques; Pohl, Michel
2007-04-01
Neuropathic pain developing after peripheral nerve injury is associated with altered neuronal and glial cell functions in the spinal cord. Activated glia produces algogenic mediators, exacerbating pain. Among the different intracellular pathways possibly involved in the modified glial function, the nuclear factor kappaB (NF-kappaB) system is of particular interest, as numerous genes encoding inflammation- and pain-related molecules are controlled by this transcription factor. NF-kappaB is a pleiotropic factor also involved in central nervous system homeostasy. To study its role in chronic pain, it is thus essential to inhibit the NF-kappaB pathway selectively in activated spinal glial cells. Here, we show that when restricted to spinal cord and targeted to glial cells, lentiviral vector-mediated delivery of NF-kappaB super- repressor IkappaBalpha resulted in an inhibition of the NF-kappaB pathway activated in the rat spinal cord after sciatic nerve injury (chronic constriction injury, CCI). Concomitantly, IkappaBalpha overproduction prevented the enhanced expression of interleukin-6 and of inducible nitric oxide synthase associated with chronic constriction injury and resulted in prolonged antihyperalgesic and antiallodynic effects. These data show that targeted blockade of NF-kappaB activity in spinal glia efficiently alleviates pain behavior in CCI rats, demonstrating the active participation of the glial NF-kappaB pathway in the development of neuropathic pain after peripheral nerve injury.
Wong, Lih-Ming; Chum, Jia-Min; Maddy, Peter; Chan, Steven T F; Travis, Douglas; Lawrentschuk, Nathan
2010-07-01
Macroscopic hematuria is a common symptom and sign that is challenging to quantify and describe. The degree of hematuria communicated is variable due to health worker experience combined with lack of a reliable grading tool. We produced a reliable, standardized visual scale to describe hematuria severity. Our secondary aim was to validate a new laboratory test to quantify hemoglobin in hematuria specimens. Nurses were surveyed to ascertain current hematuria descriptions. Blood and urine were titrated at varying concentrations and digitally photographed in catheter bag tubing. Photos were processed and printed on transparency paper to create a prototype swatch or card showing light, medium, heavy and old hematuria. Using the swatch 60 samples were rated by nurses and laymen. Interobserver variability was reported using the generalized kappa coefficient of agreement. Specimens were analyzed for hemolysis by measuring optical density at oxyhemoglobin absorption peaks. Interobserver agreement between nurses and laymen was good (kappa = 0.51, p <0.001). Subgroup analysis showed substantial agreement for light hematuria (kappa = 0.71). Overall agreement improved when the moderate (kappa = 0.28) and heavy (kappa = 0.53) hematuria categories were combined (kappa = 0.70). Compared to known blood concentrations the assay of optical density at oxyhemoglobin absorption peaks showed a linear trend. A simple visual scale to grade and communicate hematuria with adequate interobserver agreement is feasible. The test for optical density at oxyhemoglobin absorption peaks is a new method, validated in our study, to quantify hemoglobin in a hematuria specimen. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Mann, Elizabeth A; Stanford, Sandra; Sherman, Kenneth E
2006-10-01
The hepatitis C virus (HCV) core protein is a key structural element of the virion but also affects a number of cellular pathways, including nuclear factor kappaB (NF-kappaB) signaling. NF-kappaB is a transcription factor that regulates both anti-apoptotic and pro-inflammatory genes and its activation may contribute to HCV-mediated pathogenesis. Amino acid sequence divergence in core is seen at the genotype level as well as within patient isolates. Recent work has implicated amino acids 9-11 of core in the modulation of NF-kappaB activation. We report that the sequence RKT is highly conserved (93%) at this position across all HCV genotypes, based on sequences collected in the Los Alamos HCV database. Of the 13 types of variants present in the database, the two most prevalent substitutions are RQT and RKP. We further show that core encoding RKP fails to activate NF-kappaB signaling in vitro while NF-kappaB activation by core encoding RQT does not differ from control RKT core. The effect of RKP core is specific to NF-kappaB signaling as activator protein 1 (AP-1) activity is not altered. Further studies are needed to assess potential associations between specific amino acid substitutions at positions 9-11 and liver disease progression and/or response to treatment in individual patients.
Transcription factor NF-kappaB regulates inducible CD83 gene expression in activated T lymphocytes.
McKinsey, T A; Chu, Z; Tedder, T F; Ballard, D W
2000-01-01
The immunoglobulin superfamily member CD83 is expressed on the surface of mature dendritic cells that present processed antigens to T lymphocytes. In addition, T cells acquire CD83 expression following mitogenic stimulation in vitro. Here we report two lines of evidence demonstrating that this inducible lymphocyte response is genetically programmed by transcription factor NF-kappaB and contingent upon proteolytic breakdown of its cytoplasmic inhibitor IkappaBalpha. First, signal-dependent induction of CD83 mRNA expression is blocked in both transformed and primary T cells harboring a degradation-resistant mutant of IkappaBalpha that constitutively represses NF-kappaB. Second, as revealed in gel retardation assays, the IkappaBalpha constitutive repressor prevents the inducible interaction of NF-kappaB with consensus recognition sites identified in the CD83 promoter. Given that IkappaBalpha is functionally coupled to the T-cell antigen receptor, these findings suggest that the downstream transcription unit for CD83 is triggered by NF-kappaB during an adaptive immune response.
1993-01-01
Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940
Zinc in human health: effect of zinc on immune cells.
Prasad, Ananda S
2008-01-01
Although the essentiality of zinc for plants and animals has been known for many decades, the essentiality of zinc for humans was recognized only 40 years ago in the Middle East. The zinc-deficient patients had severe immune dysfunctions, inasmuch as they died of intercurrent infections by the time they were 25 years of age. In our studies in an experimental human model of zinc deficiency, we documented decreased serum testosterone level, oligospermia, severe immune dysfunctions mainly affecting T helper cells, hyperammonemia, neurosensory disorders, and decreased lean body mass. It appears that zinc deficiency is prevalent in the developing world and as many as two billion subjects may be growth retarded due to zinc deficiency. Besides growth retardation and immune dysfunctions, cognitive impairment due to zinc deficiency also has been reported recently. Our studies in the cell culture models showed that the activation of many zinc-dependent enzymes and transcription factors were adversely affected due to zinc deficiency. In HUT-78 (T helper 0 [Th(0)] cell line), we showed that a decrease in gene expression of interleukin-2 (IL-2) and IL-2 receptor alpha(IL-2Ralpha) were due to decreased activation of nuclear factor-kappaB (NF-kappaB) in zinc deficient cells. Decreased NF-kappaB activation in HUT-78 due to zinc deficiency was due to decreased binding of NF-kappaB to DNA, decreased level of NF-kappaB p105 (the precursor of NF-kappaB p50) mRNA, decreased kappaB inhibitory protein (IkappaB) phosphorylation, and decreased Ikappa kappa. These effects of zinc were cell specific. Zinc also is an antioxidant and has anti-inflammatory actions. The therapeutic roles of zinc in acute infantile diarrhea, acrodermatitis enteropathica, prevention of blindness in patients with age-related macular degeneration, and treatment of common cold with zinc have been reported. In HL-60 cells (promyelocytic leukemia cell line), zinc enhances the up-regulation of A20 mRNA, which, via TRAF pathway, decreases NF-kappaB activation, leading to decreased gene expression and generation of tumor necrosis factor-alpha (TNF-alpha), IL-1beta, and IL-8. We have reported recently that in both young adults and elderly subjects, zinc supplementation decreased oxidative stress markers and generation of inflammatory cytokines.
Gui, Ling-Li; Zhang, Chuan-Han; Liu, Zhi-Heng; Chen, Zhao-Jun; Zhu, Chang
2008-04-01
To investigate the effects of different nuclear factor (NF)-KB dimers on the survival of immortalized neural progenitor cells (INPCs). The control vector RC/CMV, containing the promoter of cytomegalovirus (CMV), and the expression vectors, RcCMV-p50 and RcCMV-p65, containing the coding regions of NF-KB subunits p50 and p65 genes, were transfected into the INPCs by liposome respectively. Stably transfected clones were screened out following G418 selection. Subsequently, the plasmid RcCMV-p50 was transiently transfected into the INPCs which had been stably transfected with the plasmid RcCMV-p65. The expression of p50 or p65 gene was detected in each cell strain by Western blotting. And the NF-KB DNA binding activity in the cell nuclear extracts was measured by electrophoresis mobility shift assay (EMSA). The expression of IkappaBalpha in the cytoplasm was detected by Western blotting. After oxygen and glucose deprivation for 13 h, the cell survival rate was measured by MTT assay. After gene transfection, five different cell strains were obtained: INPC, INPC/CMV, INPC/p50, INPC/p65, and INPC/p50p65. p50 or p65 gene was translated correctly and efficiently in the cell strains which had been transfected with the corresponding plasmids. EMSA showed that the INPC/p50, INPC/p65, and INPC/p50p65 cells all gave rise to NF-kappaB specific bands, which were composed of p50 homodimer, p65 homodimer, and p50 p65 heterodimer and p50 homodimer respectively. The expression of IkappaBbeta was increased significantly in the cytoplasm of the INPC/p65 and INPC/p50p65 cells. Games-Howell test showed that after oxygen and glucose deprivation for 13 h, the survival rates of the NPC/p65 and INPC/p50p65 cells were (6.0 +/- 1.0)% and (4.6 +/- 0.6)% respectively, both significantly lower than those of the INPC, INPC/CMV, and INPC/p50 cells [(72.5 +/- 6.2)%, (70.1 +/- 4.3)%, and (70.4 +/- 7.3)% respectively, all P < 0.05]. Overexpression of p50 gene and p65 gene directly enhance the DNA binding activities of different NF-kappaB dimers in the nuclei. In neural progenitor cells, NF-kappaB dimers with transcriptive activity decreases the cellular survival after oxygen and glucose deprivation, but NF-kappaB dimers without transcriptive activity don't prevent the cells from death.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravindan, Natarajan, E-mail: naravind@ouhsc.ed; Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh
2011-03-15
Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NF{kappa}B regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NF{kappa}B-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NF{kappa}B-dependent regulation was investigated either by luciferase reporter assays using pNF{kappa}B-, pGL3-354-, pGL3-347-, or pUSE-I{kappa}B{alpha}-Luc, p50/p65, or RelA siRNA-transfectedmore » cells. NF{kappa}B activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NF{kappa}B. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NF{kappa}B becomes functionally activated after IR and mediates TA upregulation by binding to the {kappa}B-binding region in the promoter region of the TERT gene. Consistently, elimination of the NF{kappa}B-recognition site on the telomerase promoter or inhibition of NF{kappa}B by the I{kappa}B{alpha} mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NF{kappa}B overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results strongly suggest that curcumin inhibits IR-induced TA in an NF{kappa}B dependent manner in human neuroblastoma cells.« less
Polycystin-1 promotes PKC{alpha}-mediated NF-{kappa}B activation in kidney cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banzi, Manuela; Aguiari, Gianluca; Trimi, Viky
2006-11-17
Polycystin-1 (PC1), the PKD1 gene product, is a membrane receptor which regulates many cell functions, including cell proliferation and apoptosis, both typically increased in cyst lining cells in autosomal dominant polycystic kidney disease. Here we show that PC1 upregulates the NF-{kappa}B signalling pathway in kidney cells to prevent cell death. Human embryonic kidney cell lines (HEK293{sup CTT}), stably expressing a PC1 cytoplasmic terminal tail (CTT), presented increased NF-{kappa}B nuclear levels and NF-{kappa}B-mediated luciferase promoter activity. This, consistently, was reduced in HEK293 cells in which the endogenous PC1 was depleted by RNA interference. CTT-dependent NF-{kappa}B promoter activation was mediated by PKC{alpha}more » because it was blocked by its specific inhibitor Ro-320432. Furthermore, it was observed that apoptosis, which was increased in PC1-depleted cells, was reduced in HEK293{sup CTT} cells and in porcine kidney LtTA cells expressing a doxycycline-regulated CTT. Staurosporine, a PKC inhibitor, and parthenolide, a NF-{kappa}B inhibitor, significantly reduced the CTT-dependent antiapoptotic effect. These data reveal, therefore, a novel pathway by which polycystin-1 activates a PKC{alpha}-mediated NF-{kappa}B signalling and cell survival.« less
Chapman, Neil R; Webster, Gill A; Gillespie, Peter J; Wilson, Brian J; Crouch, Dorothy H; Perkins, Neil D
2002-01-01
Members of both Myc and nuclear factor kappaB (NF-kappaB) families of transcription factors are found overexpressed or inappropriately activated in many forms of human cancer. Furthermore, NF-kappaB can induce c-Myc gene expression, suggesting that the activities of these factors are functionally linked. We have discovered that both c-Myc and v-Myc can induce a previously undescribed, truncated form of the RelA(p65) NF-kappaB subunit, RelA(p37). RelA(p37) encodes the N-terminal DNA binding and dimerization domain of RelA(p65) and would be expected to function as a trans-dominant negative inhibitor of NF-kappaB. Surprisingly, we found that RelA(p37) no longer binds to kappaB elements. This result is explained, however, by the observation that RelA(p37), but not RelA(p65), forms a high-molecular-mass complex with c-Myc. These results demonstrate a previously unknown functional and physical interaction between RelA and c-Myc with many significant implications for our understanding of the role that both proteins play in the molecular events underlying tumourigenesis. PMID:12027803
Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression
Teodorov, E.; Ferrari, M.F.R.; Fior-Chadi, D.R.; Camarini, R.; Felício, L.F.
2012-01-01
The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female reproduction. PMID:22641418
Association between gene variants and response to buprenorphine maintenance treatment.
Gerra, Gilberto; Somaini, Lorenzo; Leonardi, Claudio; Cortese, Elena; Maremmani, Icro; Manfredini, Matteo; Donnini, Claudia
2014-01-30
A variety of studies were addressed to differentiate responders and non-responders to substitution treatment among heroin dependent patients, without conclusive findings. In particular, preliminary pharmacogenetic findings have been reported to predict treatment effectiveness in mental health and substance use disorders. Aim of the present study was to investigate the possible association of buprenorphine (BUP) treatment outcome with gene variants that may affect kappa-opioid receptors and dopamine system function. One hundred and seven heroin addicts (West European, Caucasians) who underwent buprenorphine maintenance treatment were genotyped and classified into two groups (A and B) on the basis of treatment outcome. Non-responders to buprenorphine (group B) have been identified taking into account early drop out, continuous use of heroin, severe behavioral or psychiatric problems, misbehavior and diversion during the 6 months treatment period. No difference was evidenced between responders and non-responders to BUP in the frequency of kappa opioid receptor (OPRK1) 36G>T SNP. The frequency of dopamine transporter (DAT) gene polymorphism (SLC6A3/DAT1), allele 10, was evidently much higher in "non-responder" than in "responder" individuals (64.9% vs. 55.93%) whereas the frequency of the category of other alleles (6, 7 and 11) was higher in responder than in non-responder individuals (11.02% vs. 2.13% respectively). On one hand, the hypothesis that possible gene-related changes in kappa-opioid receptor could consistently affect buprenorphine pharmacological action and clinical effectiveness was not confirmed in our study, at least in relation to the single nucleotide polymorphism 36G>T. On the other hand, the possibility that gene-related dopamine changes could have reduced BUP effectiveness and impaired maintenance treatment outcome was cautiously supported by our findings. DAT1 gene variants such as allele 10, previously reported in association with personality and behavioral problems, would have influenced the effects of BUP-induced dopamine release, modulated through mu and kappa opioid receptors, and probably the related reinforcing capacity of the drug. © 2013 Published by Elsevier Ireland Ltd.
Exposure to particulate matter (PM2.5-10), including diesel exhaust particles (DEP) has been reported to induce lung injury and exacerbation of asthma and chronic obstructive pulmonary disease. Alveolar macrophages play a major role in the lung's response to inhaled particles and...
Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.
Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu
2018-01-20
The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.
Kaur, Manminder; Holden, Neil S; Wilson, Sylvia M; Sukkar, Maria B; Chung, Kian Fan; Barnes, Peter J; Newton, Robert; Giembycz, Mark A
2008-09-01
In diseases such as asthma, airway smooth muscle (ASM) cells play a synthetic role by secreting inflammatory mediators such as granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-6, or IL-8 and by expressing surface adhesion molecules, including ICAM-1. In the present study, PGE(2), forskolin, and short-acting (salbutamol) and long-acting (salmeterol and formoterol) beta(2)-adrenoceptor agonists reduced the expression of ICAM-1 and the release of GM-CSF evoked by IL-1beta in ASM cells. IL-1beta-induced IL-8 release was also repressed by PGE(2) and forskolin, whereas the beta(2)-adrenoceptor agonists were ineffective. In each case, repression of these inflammatory indexes was prevented by adenoviral overexpression of PKIalpha, a highly selective PKA inhibitor. These data indicate a PKA-dependent mechanism of repression and suggest that agents that elevate intracellular cAMP, and thereby activate PKA, may have a widespread anti-inflammatory effect in ASM cells. Since ICAM-1 and GM-CSF are highly NF-kappaB-dependent genes, we used an adenoviral-delivered NF-kappaB-dependent luciferase reporter to examine the effects of forskolin and the beta(2)-adrenoceptor agonists on NF-kappaB activation. There was no effect on luciferase activity measured in the presence of forskolin or beta(2)-adrenoceptor agonists. This finding is consistent with the observation that IL-1beta-induced expression of IL-6, a known NF-kappaB-dependent gene in ASM, was also unaffected by beta(2)-adrenoceptor agonists, forskolin, PGE(2), 8-bromo-cAMP, or rolipram. Collectively, these results indicate that repression of IL-1beta-induced ICAM-1 expression and GM-CSF release by cAMP-elevating agents, including beta(2)-adrenoceptor agonists, may not occur through a generic effect on NF-kappaB.
Pan, Min-Hsiung; Hsieh, Min-Chi; Hsu, Ping-Chi; Ho, Sheng-Yow; Lai, Ching-Shu; Wu, Hou; Sang, Shengmin; Ho, Chi-Tang
2008-12-01
Ginger, the rhizome of Zingiber officinale, is a traditional medicine with carminative effect, antinausea, anti-inflammatory, and anticarcinogenic properties. In this study, we investigated the inhibitory effects of 6-shogaol and a related compound, 6-gingerol, on the induction of nitric oxide synthase (NOS) and cyclooxygenase-2 (COX-2) in murine RAW 264.7 cells activated with LPS. Western blotting and reverse transcription-PCR analyses demonstrated that 6-shogaol significantly blocked protein and mRNA expression of inducible NOS (iNOS) and COX-2 in LPS-induced macrophages. The in vivo anti-inflammatory activity was evaluated by a topical 12-O-tetradecanoylphorbol 13-acetate (TPA) application to mouse skin. When applied topically onto the shaven backs of mice prior to TPA, 6-shogaol markedly inhibited the expression of iNOS and COX-2 proteins. Treatment with 6-shogaol resulted in the reduction of LPS-induced nuclear translocation of nuclear factor-kappaB (NF kappaB) subunit and the dependent transcriptional activity of NF kappaB by blocking phosphorylation of inhibitor kappaB (I kappaB)alpha and p65 and subsequent degradation of I kappaB alpha. Transient transfection experiments using NF kappaB reporter constructs indicated that 6-shogaol inhibits the transcriptional activity of NF kappaB in LPS-stimulated mouse macrophages. We found that 6-shogaol also inhibited LPS-induced activation of PI3K/Akt and extracellular signal-regulated kinase 1/2, but not p38 mitogen-activated protein kinase (MAPK). Taken together, these results show that 6-shogaol downregulates inflammatory iNOS and COX-2 gene expression in macrophages by inhibiting the activation of NF kappaB by interfering with the activation PI3K/Akt/I kappaB kinases IKK and MAPK.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Haige; Hiroi, Toyoko; Hansen, Baranda S.
2009-11-27
Vascular endothelial cells respond to biomechanical forces, such as cyclic stretch and shear stress, by altering gene expression. Since endothelial-derived prostanoids, such as prostacyclin and thromboxane A{sub 2}, are key mediators of endothelial function, we investigated the effects of cyclic stretch on the expression of genes in human umbilical vein endothelial cells controlling prostanoid synthesis: cyclooxygenase-1 (COX-1), cyclooxygenase-2 (COX-2), prostacyclin synthase (PGIS) and thromboxane A{sub 2} synthase (TXAS). COX-2 and TXAS mRNAs were upregulated by cyclic stretch for 24 h. In contrast, PGIS mRNA was decreased and stretch had no effect on COX-1 mRNA expression. We further show that stretch-inducedmore » upregulation of COX-2 is mediated by activation of the NF-{kappa}{beta} signaling pathway.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takezako, Naoki; Hayakawa, Morisada; Hayakawa, Hiroko
2006-03-10
LPS induces the production of inflammatory cytokines via the stimulation of Toll-like receptors. In this study, we demonstrated that a soluble secreted form of the ST2 gene product (ST2), a member of the interleukin-1 receptor family, suppressed the production of IL-6 in an LPS-stimulated human monocytic leukemia cell line, THP-1. Immunofluorescence confocal microscopy revealed the binding of ST2 to the surface of the THP-1 cells, in which ST2 led to decreased binding of nuclear factor-{kappa}B to the IL-6 promoter. Furthermore, the degradation of I{kappa}B in the cytoplasm after LPS stimulation was reduced by pretreatment with ST2. These results demonstrated thatmore » ST2 negatively regulates LPS-induced IL-6 production via the inhibition of I{kappa}B degradation in THP-1 cells.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Chien-Sheng; Division of Thoracic Surgery, Department of Surgery, Taipei-Veterans General Hospital and National Yang-Ming University School of Medicine, Taipei, Taiwan; Kawamura, Tomohiro
Highlights: {yields} Hydrogen is a regulatory molecule with antiinflammatory and antiapoptotic protective effects. {yields} There is very limited information on the pathways regulated in vivo by the hydrogen. {yields} Antiapoptotic abilities of hydrogen were explained by upregulation of the antiapoptotic gene. {yields} NF{kappa}B activation during hydrogen treatment was correlated with elevated antiapoptotic protein. {yields} NF{kappa}B activation associated with increase Bcl-2 may contribute to cytoprotection of hydrogen. -- Abstract: We recently demonstrated the inhalation of hydrogen gas, a novel medical therapeutic gas, ameliorates ventilator-induced lung injury (VILI); however, the molecular mechanisms by which hydrogen ameliorates VILI remain unclear. Therefore, we investigatedmore » whether inhaled hydrogen gas modulates the nuclear factor-kappa B (NF{kappa}B) signaling pathway. VILI was generated in male C57BL6 mice by performing a tracheostomy and placing the mice on a mechanical ventilator (tidal volume of 30 ml/kg or 10 ml/kg without positive end-expiratory pressure). The ventilator delivered either 2% nitrogen or 2% hydrogen in balanced air. NF{kappa}B activation, as indicated by NF{kappa}B DNA binding, was detected by electrophoretic mobility shift assays and enzyme-linked immunosorbent assay. Hydrogen gas inhalation increased NF{kappa}B DNA binding after 1 h of ventilation and decreased NF{kappa}B DNA binding after 2 h of ventilation, as compared with controls. The early activation of NF{kappa}B during hydrogen treatment was correlated with elevated levels of the antiapoptotic protein Bcl-2 and decreased levels of Bax. Hydrogen inhalation increased oxygen tension, decreased lung edema, and decreased the expression of proinflammatory mediators. Chemical inhibition of early NF{kappa}B activation using SN50 reversed these protective effects. NF{kappa}B activation and an associated increase in the expression of Bcl-2 may contribute, in part, to the cytoprotective effects of hydrogen against apoptotic and inflammatory signaling pathway activation during VILI.« less
Regulation of the nuclear factor (NF)-kappaB pathway by ISGylation.
Minakawa, Miki; Sone, Takayuki; Takeuchi, Tomoharu; Yokosawa, Hideyoshi
2008-12-01
Post-translational modification with ISG15 (interferon-stimulated gene 15 kDa) (ISGylation) is mediated by a sequential reaction similar to ubiquitination, and various target proteins for ISGylation have been identified. We previously reported that ISGylation of the E2 ubiquitin-conjugating enzyme Ubc13 suppresses its E2 activity. Ubc13 forms a heterodimer with Uev1A, a ubiquitin-conjugating enzyme variant, and the Ubc13-Uev1A complex catalyzes the assembly of a Lys63-linked polyubiquitin chain, which plays a non-proteolytic role in the nuclear factor (NF)-kappaB pathway. In this study, we examined the effect of ISGylation on tumor necrosis factor receptor-associated factor (TRAF)-6/transforming growth factor beta-activated kinase (TAK)-1-dependent NF-kappaB activation. We found that expression of the ISGylation system suppresses NF-kappaB activation via TRAF6 and TAK1 and that the level of polyubiquitinated TRAF6 is reduced by expression of the ISGylation system. Taken together, the results suggest that the NF-kappaB pathway is negatively regulated by ISGylation.
Kim, Ju Han; Ha, Il Soo; Hwang, Chang-Il; Lee, Young-Ju; Kim, Jihoon; Yang, Seung-Hee; Kim, Yon Su; Cao, Yun Anna; Choi, Sangdun; Park, Woong-Yang
2004-11-01
Immune complexes may cause an irreversible onset of chronic renal disease. Most patients with chronic renal disease undergo a final common pathway, marked by glomerulosclerosis and interstitial fibrosis. We attempted to draw a molecular map of anti-glomerular basement membrane (GBM) glomerulonephritis in mice using oligonucleotide microarray technology. Kidneys were harvested at days 1, 3, 7, 11, and 16 after inducing glomerulonephritis by using anti-GBM antibody. In parallel with examining the biochemical and histologic changes, gene expression profiles were acquired against five pooled control kidneys. Gene expression levels were cross-validated by either reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, or immunohistochemistry. Pathologic changes in anti-GBM glomerulonephritis were confirmed in both BALB/c and C57BL/6 strains. Among the 13,680 spotted 65mer oligonucleotides, 1112 genes showing significant temporal patterns by permutation analysis of variance (ANOVA) with multiple testing correction [false discovery ratio (FDR) < 0.05] were chosen for cluster analysis. From the expression profile, acute inflammatory reactions characterized by the elevation of various cytokines, including interleukin (IL)-1 and IL-6, were identified within 3 days of disease onset. After 7 days, tissue remodeling response was prominent with highly induced extracellular-matrix (ECM) genes. Although cytokines related to lymphocyte activation were not detected, monocyte or mesangial cell proliferation-related genes were increased. Tumor necrosis factor-alpha (TNF-alpha) and nuclear factor-kappaB (NF-kappaB) pathway were consistently activated along the entire disease progression, inducing various target genes like complement 3, IL-1b, IL-6, Traf1, and Saa1. We made a large-scale gene expression time table for mouse anti-GBM glomerulonephritis model, providing a comprehensive overview on the mechanism governing the initiation and the progression of inflammatory renal disease.
Ma, Guoyi; Tabanca, Nurhayat; Husnu Can Baser, K; Kirimer, Nese; Pasco, David S; Khan, Ikhlas A; Khan, Shabana I
2009-03-01
Breast cancer is one of the most prevalent woman cancers. Genomic instability, accumulative mutations, and subsequent changes in intracellular signaling cascades play key roles in the development of human breast cancers. Activation of nuclear factor-kappaB (NF-kappaB) has been implicated in oncogenesis of breast cancers and is known to be associated with resistance to anticancer agents and apoptosis. Blocking NF-kappaB signaling may represent a therapeutic strategy in breast cancer therapy. The objective of this study is to investigate the in vitro effects of epoxypseudoisoeugenol-2-methyl butyrate (EPB), a phenylpropranoid isolated from Pimpinella corymbosa, on the activation of NF-kappaB, cell growth, cell cycle progression and apoptosis in MCF-7 (estrogen-dependent) and BT-549 (estrogen-independent) breast cancer cells. Transcriptional activity of NF-kappaB was measured by cell based reporter gene assay. Cell proliferation was determined by MTT assay. Cell cycle analysis was carried out by flow cytometry and apoptosis was observed by DAPI staining assy. EPB inhibited the NF-kappaB-mediated transcription activity induced by tumor necrosis factor-alpha (TNF-alpha) and phorbol myristate acetate (PMA) in MCF-7 cells. EPB also inhibited constitutive NF-kappaB transcriptional activity in BT-549 cells. EPB inhibited the proliferation of both MCF-7 and BT-549 cells in a concentration- and time-dependent manner. EPB induced cell cycle arrest in G(1)/G(0) phase and apoptosis in both MCF-7 and BT 549 cells. These in vitro results indicated that EPB has a potential for use against both hormone-dependent and hormone-independent breast cancers and its effects seem to be mediated by inhibiting the NF-kappaB activity.
Taylor, Shannon L; Frias-Staheli, Natalia; García-Sastre, Adolfo; Schmaljohn, Connie S
2009-02-01
Hantaviruses such as Hantaan virus (HTNV) and Andes virus cause two human diseases, hemorrhagic fever with renal syndrome and hantavirus pulmonary syndrome, respectively. For both, disease pathogenesis is thought to be immunologically mediated and there have been numerous reports of patients with elevated levels of proinflammatory and inflammatory cytokines, including tumor necrosis factor alpha (TNF-alpha), in their sera. Multiple viruses have developed evasion strategies to circumvent the host cell inflammatory process, with one of the most prevalent being the disruption of nuclear factor kappa B (NF-kappaB) activation. We hypothesized that hantaviruses might also moderate host inflammation by interfering with this pathway. We report here that the nucleocapsid (N) protein of HTNV was able to inhibit TNF-alpha-induced activation of NF-kappaB, as measured by a reporter assay, and the activation of endogenous p65, an NF-kappaB subunit. Surprisingly, there was no defect in the degradation of the inhibitor of NF-kappaB (IkappaB) protein, nor was there any alteration in the level of p65 expression in HTNV N-expressing cells. However, immunofluorescence antibody staining demonstrated that cells expressing HTNV N protein and a green fluorescent protein-p65 fusion had limited p65 nuclear translocation. Furthermore, we were able to detect an interaction between HTNV N protein and importin alpha, a nuclear import molecule responsible for shuttling NF-kappaB to the nucleus. Collectively, our data suggest that HTNV N protein can sequester NF-kappaB in the cytoplasm, thus inhibiting NF-kappaB activity. These findings, which were obtained using cells transfected with cDNA representing the HTNV N gene, were confirmed using HTNV-infected cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sandur, Santosh K.; Deorukhkar, Amit; Pandey, Manoj K.
2009-10-01
Purpose: Radiation therapy is an integral part of the preoperative treatment of rectal cancers. However, only a minority of patients achieve a complete pathologic response to therapy because of resistance of these tumors to radiation therapy. This resistance may be mediated by constitutively active pro-survival signaling pathways or by inducible/acquired mechanisms in response to radiation therapy. Simultaneous inhibition of these pathways can sensitize these tumors to radiation therapy. Methods and Materials: Human colorectal cancer cells were exposed to clinically relevant doses of gamma rays, and the mechanism of their radioresistance was investigated. We characterized the transcription factor nuclear factor-{kappa}B (NF-{kappa}B)more » activation as a mechanism of inducible radioresistance in colorectal cancer and used curcumin, the active ingredient in the yellow spice turmeric, to overcome this resistance. Results: Curcumin inhibited the proliferation and the post-irradiation clonogenic survival of multiple colorectal cancer cell lines. Radiation stimulated NF-{kappa}B activity in a dose- and time-dependent manner, whereas curcumin suppressed this radiation-induced NF-{kappa}B activation via inhibition of radiation-induced phosphorylation and degradation of inhibitor of {kappa}B alpha, inhibition of inhibitor of {kappa}B kinase activity, and inhibition of Akt phosphorylation. Curcumin also suppressed NF-{kappa}B-regulated gene products (Bcl-2, Bcl-x{sub L}, inhibitor of apoptosis protein-2, cyclooxygenase-2, and cyclin D1). Conclusions: Our results suggest that transient inducible NF-{kappa}B activation provides a prosurvival response to radiation that may account for development of radioresistance. Curcumin blocks this signaling pathway and potentiates the antitumor effects of radiation therapy.« less
Regulatory elements involved in tax-mediated transactivation of the HTLV-I LTR.
Seeler, J S; Muchardt, C; Podar, M; Gaynor, R B
1993-10-01
HTLV-I is the etiologic agent of adult T-cell leukemia. In this study, we investigated the regulatory elements and cellular transcription factors which function in modulating HTLV-I gene expression in response to the viral transactivator protein, tax. Transfection experiments into Jurkat cells of a variety of site-directed mutants in the HTLV-1 LTR indicated that each of the three motifs A, B, and C within the 21-bp repeats, the binding sites for the Ets family of proteins, and the TATA box all influenced the degree of tax-mediated activation. Tax is also able to activate gene expression of other viral and cellular promoters. Tax activation of the IL-2 receptor and the HIV-1 LTR is mediated through NF-kappa B motifs. Interestingly, sequences in the 21-bp repeat B and C motifs contain significant homology with NF-kappa B regulatory elements. We demonstrated that an NF-kappa B binding protein, PRDII-BF1, but not the rel protein, bound to the B and C motifs in the 21-bp repeat. PRDII-BF1 was also able to stimulate activation of HTLV-I gene expression by tax. The role of the Ets proteins on modulating tax activation was also studied. Ets 1 but not Ets 2 was capable of increasing the degree of tax activation of the HTLV-I LTR. These results suggest that tax activates gene expression by either direct or indirect interaction with several cellular transcription factors that bind to the HTLV-I LTR.
de Oliveira-Marques, Virgínia; Cyrne, Luísa; Marinho, H Susana; Antunes, Fernando
2007-03-15
Although the germicide role of H(2)O(2) released during inflammation is well established, a hypothetical regulatory function, either promoting or inhibiting inflammation, is still controversial. In particular, after 15 years of highly contradictory results it remains uncertain whether H(2)O(2) by itself activates NF-kappaB or if it stimulates or inhibits the activation of NF-kappaB by proinflammatory mediators. We investigated the role of H(2)O(2) in NF-kappaB activation using, for the first time, a calibrated and controlled method of H(2)O(2) delivery--the steady-state titration--in which cells are exposed to constant, low, and known concentrations of H(2)O(2). This technique contrasts with previously applied techniques, which disrupt cellular redox homeostasis and/or introduce uncertainties in the actual H(2)O(2) concentration to which cells are exposed. In both MCF-7 and HeLa cells, H(2)O(2) at extracellular concentrations up to 25 microM did not induce significantly per se NF-kappaB translocation to the nucleus, but it stimulated the translocation induced by TNF-alpha. For higher H(2)O(2) doses this stimulatory role shifts to an inhibition, which may explain published contradictory results. The stimulatory role was confirmed by the observation that 12.5 microM H(2)O(2), a concentration found during inflammation, increased the expression of several proinflammatory NF-kappaB-dependent genes induced by TNF-alpha (e.g., IL-8, MCP-1, TLR2, and TNF-alpha). The same low H(2)O(2) concentration also induced the anti-inflammatory gene coding for heme oxygenase-1 (HO-1) and IL-6. We propose that H(2)O(2) has a fine-tuning regulatory role, comprising both a proinflammatory control loop that increases pathogen removal and an anti-inflammatory control loop, which avoids an exacerbated harmful inflammatory response.
Brown, Sharron A N; Richards, Christine M; Hanscom, Heather N; Feng, Sheau-Line Y; Winkles, Jeffrey A
2003-01-01
Fn14 is a growth-factor-inducible immediate-early-response gene encoding a 102-amino-acid type I transmembrane protein. The human Fn14 protein was recently identified as a cell-surface receptor for the tumour necrosis factor (TNF) superfamily member named TWEAK (TNF-like weak inducer of apoptosis). In the present paper, we report that the human TWEAK extracellular domain can also bind the murine Fn14 protein. Furthermore, site-specific mutagenesis and directed yeast two-hybrid interaction assays revealed that the TNFR-associated factor (TRAF) 1, 2, 3 and 5 adaptor molecules bind the murine Fn14 cytoplasmic tail at an overlapping, but non-identical, amino acid sequence motif. We also found that TWEAK treatment of quiescent NIH 3T3 cells stimulates inhibitory kappaBalpha phosphorylation and transcriptional activation of a nuclear factor-kappaB (NF-kappaB) enhancer/luciferase reporter construct. Fn14 overexpression in transiently transfected NIH 3T3 cells also promotes NF-kappaB activation, and this cellular response requires an intact TRAF binding site. These results indicate that Fn14 is a functional TWEAK receptor that can associate with four distinct TRAF family members and stimulate the NF-kappaB transcription factor signalling pathway. PMID:12529173
TRAF2-binding BIR1 domain of c-IAP2/MALT1 fusion protein is essential for activation of NF-kappaB.
Garrison, J B; Samuel, T; Reed, J C
2009-04-02
Marginal zone mucosa-associated lymphoid tissue (MALT) B-cell lymphoma is the most common extranodal non-Hodgkin lymphoma. The t(11;18)(q21;q21) translocation occurs frequently in MALT lymphomas and creates a chimeric NF-kappaB-activating protein containing the baculoviral IAP repeat (BIR) domains of c-IAP2 (inhibitor of apoptosis protein 2) fused with portions of the MALT1 protein. The BIR1 domain of c-IAP2 interacts directly with TRAF2 (TNFalpha-receptor-associated factor-2), but its role in NF-kappaB activation is still unclear. Here, we investigated the role of TRAF2 in c-IAP2/MALT1-induced NF-kappaB activation. We show the BIR1 domain of c-IAP2 is essential for NF-kappaB activation, whereas BIR2 and BIR3 domains are not. Studies of c-IAP2/MALT1 BIR1 mutant (E47A/R48A) that fails to activate NF-kappaB showed loss of TRAF2 binding, but retention of TRAF6 binding, suggesting that interaction of c-IAP2/MALT1 with TRAF6 is insufficient for NF-kappaB induction. In addition, a dominant-negative TRAF2 mutant or downregulation of TRAF2 achieved by small interfering RNA inhibited NF-kappaB activation by c-IAP2/MALT1 showing that TRAF2 is indispensable. Comparisons of the bioactivity of intact c-IAP2/MALT1 oncoprotein and BIR1 E47A/R48A c-IAP2/MALT1 mutant that cannot bind TRAF2 in a lymphoid cell line provided evidence that TRAF2 interaction is critical for c-IAP2/MALT1-mediated increases in the NF-kappaB activity, increased expression of endogenous NF-kappaB target genes (c-FLIP, TRAF1), and resistance to apoptosis.
HIV-1, HTLV-I and the interleukin-2 receptor: insights into transcriptional control.
Böhnlein, E; Lowenthal, J W; Wano, Y; Franza, B R; Ballard, D W; Greene, W C
1989-01-01
In this study, we present direct evidence for the binding of the inducible cellular protein, HIVEN86A, to a 12-bp element present in the IL-2R alpha promoter. This element shares significant sequence similarity with the NF-kappa B binding sites present in the HIV-1 and kappa immunoglobulin enhancers. Transient transfection studies indicate that this kappa B element is both necessary and sufficient to confer tax or mitogen inducibility to a heterologous promoter. As summarized schematically in Fig. 5, the findings suggest that the HIVEN86A protein may play a central role in the activation of cellular genes required for T-cell growth, specifically the IL-2R alpha gene. In addition, the induced HIVEN86A protein also binds to a similar sequence present in the HIV-1 LTR leading to enhanced viral gene expression and ultimately T-cell death. Thus, mitogen activation of the HIV-1 LTR appears to involve the same inducible transcription factor(s) that normally regulates IL-2R alpha gene expression and T-cell growth. These findings further underscore the importance of the state of T-cell activation in the regulation of HIV-1 replication. Our results also demonstrate that HIVEN86A is induced by the tax protein of HTLV-I. Thus, in HTLV-I infected cells, normally the tight control of the transient expression of the IL-2R alpha gene is lost. The constitutive high-level display of IL-2 receptors may play a role in leukemic transformation mediated by HTLV-I (ATL). Apparently by the same mechanism, the tax protein also activates the HIV-1 LTR through the induction of HIVEN86A.(ABSTRACT TRUNCATED AT 250 WORDS)
Derecka, K; Wang, C K; Flint, A P F
2006-07-01
We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.
McDowell, J J; Wood, H M
1985-01-01
Four human subjects worked on all combinations of five variable-interval schedules and five reinforcer magnitudes ( cent/reinforcer) in each of two phases of the experiment. In one phase the force requirement on the operandum was low (1 or 11 N) and in the other it was high (25 or 146 N). Estimates of Herrnstein's kappa were obtained at each reinforcer magnitude. The results were: (1) response rate was more sensitive to changes in reinforcement rate at the high than at the low force requirement, (2) kappa increased from the beginning to the end of the magnitude range for all subjects at both force requirements, (3) the reciprocal of kappa was a linear function of the reciprocal of reinforcer magnitude for seven of the eight data sets, and (4) the rate of change of kappa was greater at the high than at the low force requirement by an order of magnitude or more. The second and third findings confirm predictions made by linear system theory, and replicate the results of an earlier experiment (McDowell & Wood, 1984). The fourth finding confirms a further prediction of the theory and supports the theory's interpretation of conflicting data on the constancy of Herrnstein's kappa.
McKinsey, T A; Brockman, J A; Scherer, D C; Al-Murrani, S W; Green, P L; Ballard, D W
1996-05-01
In resting T lymphocytes, the transcription factor NF-kappaB is sequestered in the cytoplasm via interactions with members of the I kappa B family of inhibitors, including IkappaBalpha and IkappaBbeta. During normal T-cell activation, IkappaBalpha is rapidly phosphorylated, ubiquitinated, and degraded by the 26S proteasome, thus permitting the release of functional NF-kappaB. In contrast to its transient pattern of nuclear induction during an immune response, NF-kappaB is constitutively activated in cells expressing the Tax transforming protein of human T-cell leukemia virus type I (HTLV-1). Recent studies indicate that HTLV-1 Tax targets IkappaBalpha to the ubiquitin-proteasome pathway. However, it remains unclear how this viral protein induces a persistent rather than transient NF-kappaB response. In this report, we provide evidence that in addition to acting on IkappaBalpha, Tax stimulates the turnover Of IkappaBbeta via a related targeting mechanism. Like IkappaBalpha, Tax-mediated breakdown of IkappaBbeta in transfected T lymphocytes is blocked either by cell-permeable proteasome inhibitors or by mutation Of IkappaBbeta at two serine residues present within its N-terminal region. Despite the dual specificity of HTLV-1 Tax for IkappaBalpha and IkappaBbeta at the protein level, Tax selectively stimulates NF-kappaB-directed transcription of the IkappaBalpha gene. Consequently, IkappaBbeta protein expression is chronically downregulated in HTLV-1-infected T lymphocytes. These findings with IkappaBbeta provide a potential mechanism for the constitutive activation of NF-kappaB in Tax-expressing cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Sun Hong; Kyeong, Min Sik; Hwang, Yuri
Highlights: Black-Right-Pointing-Pointer 1-Dehydro-10-gingerdione (1D10G) from ginger inhibits LPS binding to MD-2. Black-Right-Pointing-Pointer 1D10G suppresses MyD88- or TRIF-dependent signaling in LPS-activated macrophages. Black-Right-Pointing-Pointer 1D10G down-regulates the expression of NF-{kappa}B-, AP1- or IRF3-target genes. Black-Right-Pointing-Pointer MD-2 is a molecular target in the anti-inflammatory action of 1D10G. -- Abstract: Myeloid differentiation protein 2 (MD-2) is a co-receptor of toll-like receptor 4 (TLR4) for innate immunity. Here, we delineated a new mechanism of 1-dehydro-10-gingerdione (1D10G), one of pungent isolates from ginger (Zingiber officinale), in the suppression of lipopolysaccharide (LPS)-induced gene expression of inflammatory cytokines. 1D10G inhibited LPS binding to MD-2 with higher affinity thanmore » gingerol and shogaol from dietary ginger. Moreover, 1D10G down-regulated TLR4-mediated expression of nuclear factor-{kappa}B (NF-{kappa}B) or activating protein 1 (AP1)-target genes such as tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-1{beta}, as well as those of interferon (IFN) regulatory factor 3 (IRF3)-target IFN-{beta} gene and IFN-{gamma} inducible protein 10 (IP-10) in LPS-activated macrophages. Taken together, MD-2 is a molecular target in the anti-inflammatory action of 1D10G.« less
The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.
Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S
2000-07-01
OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.
Increased ventilatory variability and complexity in patients with hyperventilation disorder.
Bokov, Plamen; Fiamma, Marie-Noëlle; Chevalier-Bidaud, Brigitte; Chenivesse, Cécile; Straus, Christian; Similowski, Thomas; Delclaux, Christophe
2016-05-15
It has been hypothesized that hyperventilation disorders could be characterized by an abnormal ventilatory control leading to enhanced variability of resting ventilation. The variability of tidal volume (VT) often depicts a nonnormal distribution that can be described by the negative slope characterizing augmented breaths formed by the relationship between the probability density distribution of VT and VT on a log-log scale. The objectives of this study were to describe the variability of resting ventilation [coefficient of variation (CV) of VT and slope], the stability in respiratory control (loop, controller and plant gains characterizing ventilatory-chemoresponsiveness interactions) and the chaotic-like dynamics (embedding dimension, Kappa values characterizing complexity) of resting ventilation in patients with a well-defined dysfunctional breathing pattern characterized by air hunger and constantly decreased PaCO2 during a cardiopulmonary exercise test. Compared with 14 healthy subjects with similar anthropometrics, 23 patients with hyperventilation were characterized by increased variability of resting tidal ventilation (CV of VT median [interquartile]: 26% [19-35] vs. 36% [28-48], P = 0.020; slope: -6.63 [-7.65; -5.36] vs. -3.88 [-5.91; -2.66], P = 0.004) that was not related to increased chemical drive (loop gain: 0.051 [0.039-0.221] vs. 0.044 [0.012-0.087], P = 0.149) but that was related to an increased ventilatory complexity (Kappa values, P < 0.05). Plant gain was decreased in patients and correlated with complexity (with Kappa 5 - degree 5: Rho = -0.48, P = 0.006). In conclusion, well-defined patients suffering from hyperventilation disorder are characterized by increased variability of their resting ventilation due to increased ventilatory complexity with stable ventilatory-chemoresponsiveness interactions. Copyright © 2016 the American Physiological Society.
Kim, You Sun; Kim, Joo Sung; Jung, Hyun Chae; Song, In Sung
2004-04-30
The immunomodulatory and anti-inflammatory effects of thalidomide are associated with inhibition of TNF-alpha levels. However, the mechanism by which thalidomide reduces TNF-alpha production remains elusive. NF-kappaB is known to play a central role in regulating inflammatory responses in patients with inflammatory bowel disease (IBD). We tested whether thalidomide acts through inhibiting NF-kappaB activity. HT-29 cells were stimulated with LPS (1 microg/ml) alone, or after pretreatment with thalidomide (100 microg/ml), and NF-kappaB activity was determined by gel mobility shift assays. RT-PCR was used to measure expression of the proinflammatory cytokine genes TNF-alpha, IL-1beta and IL-8. The level of TNF-alpha mRNA was also analyzed by real-time quantitative RT-PCR, and TNF-alpha protein was measured by ELISA. Thalidomide pretreatment did not affect NF-kappaB activity in HT-29 cells stimulated with LPS but production of TNF-alpha was depressed. Thalidomide was found to accelerate the degradation of TNF-alpha mRNA, but had little effect on IL-1beta or IL-8. These observations suggest that the immunomodulatory effect of thalidomide in colonic epithelial cells is associated with inhibition of TNF-alpha. However, it does not act by inhibiting NF-kappaB but rather by inducing degradation of TNF-alpha mRNA.
Sargos, P; Charleux, T; Haas, R L; Michot, A; Llacer, C; Moureau-Zabotto, L; Vogin, G; Le Péchoux, C; Verry, C; Ducassou, A; Delannes, M; Mervoyer, A; Wiazzane, N; Thariat, J; Sunyach, M P; Benchalal, M; Laredo, J D; Kind, M; Gillon, P; Kantor, G
2018-04-01
The purpose of this study was to evaluate, during a national workshop, the inter-observer variability in target volume delineation for primary extremity soft tissue sarcoma radiation therapy. Six expert sarcoma radiation oncologists (members of French Sarcoma Group) received two extremity soft tissue sarcoma radiation therapy cases 1: one preoperative and one postoperative. They were distributed with instructions for contouring gross tumour volume or reconstructed gross tumour volume, clinical target volume and to propose a planning target volume. The preoperative radiation therapy case was a patient with a grade 1 extraskeletal myxoid chondrosarcoma of the thigh. The postoperative case was a patient with a grade 3 pleomorphic undifferentiated sarcoma of the thigh. Contour agreement analysis was performed using kappa statistics. For the preoperative case, contouring agreement regarding GTV, gross tumour volume GTV, clinical target volume and planning target volume were substantial (kappa between 0.68 and 0.77). In the postoperative case, the agreement was only fair for reconstructed gross tumour volume (kappa: 0.38) but moderate for clinical target volume and planning target volume (kappa: 0.42). During the workshop discussion, consensus was reached on most of the contour divergences especially clinical target volume longitudinal extension. The determination of a limited cutaneous cover was also discussed. Accurate delineation of target volume appears to be a crucial element to ensure multicenter clinical trial quality assessment, reproducibility and homogeneity in delivering RT. radiation therapy RT. Quality assessment process should be proposed in this setting. We have shown in our study that preoperative radiation therapy of extremity soft tissue sarcoma has less inter-observer contouring variability. Copyright © 2018 Société française de radiothérapie oncologique (SFRO). Published by Elsevier SAS. All rights reserved.
Anti-inflammatory effect of resveratrol on TNF-{alpha}-induced MCP-1 expression in adipocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu Jian; Key Laboratory of Human Functional Genomics of Jiangsu Province, School of Basic Medical Science, Jiangsu Province Diabetes Center, Nanjing Medical University, 140 Hanzhong Road, Nanjing 210029; Yong Wei
2008-05-02
Chronic low-grade inflammation characterized by adipose tissue macrophage accumulation and abnormal cytokine production is a key feature of obesity and type 2 diabetes. Adipose-tissue-derived monocyte chemoattractant protein (MCP)-1, induced by cytokines, has been shown to play an essential role in the early events during macrophage infiltration into adipose tissue. In this study we investigated the effects of resveratrol upon both tumor necrosis factor (TNF)-{alpha}-induced MCP-1 gene expression and its underlying signaling pathways in 3T3-L1 adipoctyes. Resveratrol was found to inhibit TNF-{alpha}-induced MCP-1 secretion and gene transcription, as well as promoter activity, which based on down-regulation of TNF-{alpha}-induced MCP-1 transcription. Nuclearmore » factor (NF)-{kappa}B was determined to play a major role in the TNF-{alpha}-induced MCP-1 expression. Further analysis showed that resveratrol inhibited DNA binding activity of the NF-{kappa}B complex and subsequently suppressed NF-{kappa}B transcriptional activity in TNF-{alpha}-stimulated cells. Finally, the inhibition of MCP-1 may represent a novel mechanism of resveratrol in preventing obesity-related pathologies.« less
Cascallana, Jose Luis; Bravo, Ana; Donet, Eva; Leis, Hugo; Lara, Maria Fernanda; Paramio, Jesús M; Jorcano, José L; Pérez, Paloma
2005-06-01
Hypohidrotic ectodermal dysplasia is a human syndrome defined by maldevelopment of one or more ectodermal-derived tissues, including the epidermis and cutaneous appendices, teeth, and exocrine glands. The molecular bases of this pathology converge in a dysfunction of the transcription factor nuclear factor of the kappa-enhancer in B cells (NF-kappaB), which is essential to epithelial homeostasis and development. A number of mouse models bearing disruptions in NF-kappaB signaling have been reported to manifest defects in ectodermal derivatives. In ectoderm-targeted transgenic mice overexpressing the glucocorticoid receptor (GR) [keratin 5 (K5)-GR mice], the NF-kappaB activity is greatly decreased due to functional antagonism between GR and NF-kappaB. Here, we report that K5-GR mice exhibit multiple epithelial defects in hair follicle, tooth, and palate development. Additionally, these mice lack Meibomian glands and display underdeveloped sweat and preputial glands. These phenotypic features appear to be mediated specifically by ligand-activated GR because the synthetic analog dexamethasone induced similar defects in epithelial morphogenesis, including odontogenesis, in wild-type mice. We have focused on tooth development in K5-GR mice and found that an inhibitor of steroid synthesis partially reversed the abnormal phenotype. Immunostaining revealed reduced expression of the inhibitor of kappaB kinase subunits, IKKalpha and IKKgamma, and diminished p65 protein levels in K5-GR embryonic tooth, resulting in a significantly reduced kappaB-binding activity. Remarkably, altered NF-kappaB activity elicited by GR overexpression correlated with a dramatic decrease in the protein levels of DeltaNp63 in tooth epithelia without affecting Akt, BMP4, or Foxo3a. Given that many of the 170 clinically distinct ectodermal dysplasia syndromes still remain without cognate genes, deciphering the molecular mechanisms of this mouse model with epithelial NF-kappaB and p63 dysfunction may provide important clues to understanding the basis of other ectodermal dysplasia syndromes.
Oakley, Fiona; Meso, Muriel; Iredale, John P; Green, Karen; Marek, Carylyn J; Zhou, Xiaoying; May, Michael J; Millward-Sadler, Harry; Wright, Matthew C; Mann, Derek A
2005-01-01
Resolution of liver fibrosis is associated with clearance of hepatic myofibroblasts by apoptosis; development of strategies that promote this process in a selective way is therefore important. The aim of this study was to determine whether the inhibitor of kappaB kinase suppressor sulfasalazine stimulates hepatic myofibroblast apoptosis and recovery from fibrosis. Hepatic myofibroblasts were generated by culture activation of rat and human hepatic stellate cells. Fibrosis was established in rat livers by chronic injury with carbon tetrachloride followed by recovery with or without sulfasalazine (150 mg/kg) treatment. Treatment of hepatic stellate cells with sulfasalazine (0.5-2.0 mmol/L) induced apoptosis of activated rat and human hepatic stellate cells. A single in vivo administration of sulfasalazine promoted accelerated recovery from fibrosis as assessed by improved fibrosis score, selective clearance of smooth muscle alpha-actin-positive myofibroblasts, reduced hepatic procollagen I and tissue inhibitor of metalloproteinase 1 messenger RNA expression, and increased matrix metalloproteinase 2 activity. Mechanistic studies showed that sulfasalazine selectively blocks nuclear factor-kappaB-dependent gene transcription, inhibits hepatic stellate cell expression of Gadd45beta, stimulates phosphorylation of Jun N-terminal kinase 2, and promotes apoptosis by a mechanism that is prevented by the Jun N-terminal kinase inhibitor SP600125. As further evidence for a survival role for the inhibitor of kappaB kinase/nuclear factor-kappaB pathway in activated hepatic stellate cells, a highly selective cell-permeable peptide inhibitor of kappaB kinase activation also stimulated hepatic stellate cell apoptosis via a Jun N-terminal kinase-dependent mechanism. Inhibition of the inhibitor of kappaB kinase/nuclear factor-kappaB pathway is sufficient to increase the rate at which activated hepatic stellate cells undergo apoptosis both in vitro and in vivo, and drugs that selectively target inhibitor of kappaB kinase have potential as antifibrotics.
Barnidge, David R; Dasari, Surendra; Ramirez-Alvarado, Marina; Fontan, Adrian; Willrich, Maria A V; Tschumper, Renee C; Jelinek, Diane F; Snyder, Melissa R; Dispenzieri, Angela; Katzmann, Jerry A; Murray, David L
2014-11-07
We previously described a microLC-ESI-Q-TOF MS method for identifying monoclonal immunoglobulins in serum and then tracking them over time using their accurate molecular mass. Here we demonstrate how the same methodology can be used to identify and characterize polyclonal immunoglobulins in serum. We establish that two molecular mass distributions observed by microLC-ESI-Q-TOF MS are from polyclonal kappa and lambda light chains using a combination of theoretical molecular masses from gene sequence data and the analysis of commercially available purified polyclonal IgG kappa and IgG lambda from normal human serum. A linear regression comparison of kappa/lambda ratios for 74 serum samples (25 hypergammaglobulinemia, 24 hypogammaglobulinemia, 25 normal) determined by microflowLC-ESI-Q-TOF MS and immunonephelometry had a slope of 1.37 and a correlation coefficient of 0.639. In addition to providing kappa/lambda ratios, the same microLC-ESI-Q-TOF MS analysis can determine the molecular mass for oligoclonal light chains observed above the polyclonal background in patient samples. In 2 patients with immune disorders and hypergammaglobulinemia, we observed a skewed polyclonal molecular mass distribution which translated into biased kappa/lambda ratios. Mass spectrometry provides a rapid and simple way to combine the polyclonal kappa/lambda light chain abundance ratios with the identification of dominant monoclonal as well as oligoclonal light chain immunoglobulins. We anticipate that this approach to evaluating immunoglobulin light chains will lead to improved understanding of immune deficiencies, autoimmune diseases, and antibody responses.
Expanding the Substantial Interactome of NEMO Using Protein Microarrays
Fenner, Beau J.; Scannell, Michael; Prehn, Jochen H. M.
2010-01-01
Signal transduction by the NF-kappaB pathway is a key regulator of a host of cellular responses to extracellular and intracellular messages. The NEMO adaptor protein lies at the top of this pathway and serves as a molecular conduit, connecting signals transmitted from upstream sensors to the downstream NF-kappaB transcription factor and subsequent gene activation. The position of NEMO within this pathway makes it an attractive target from which to search for new proteins that link NF-kappaB signaling to additional pathways and upstream effectors. In this work, we have used protein microarrays to identify novel NEMO interactors. A total of 112 protein interactors were identified, with the most statistically significant hit being the canonical NEMO interactor IKKbeta, with IKKalpha also being identified. Of the novel interactors, more than 30% were kinases, while at least 25% were involved in signal transduction. Binding of NEMO to several interactors, including CALB1, CDK2, SAG, SENP2 and SYT1, was confirmed using GST pulldown assays and coimmunoprecipitation, validating the initial screening approach. Overexpression of CALB1, CDK2 and SAG was found to stimulate transcriptional activation by NF-kappaB, while SYT1 overexpression repressed TNFalpha-dependent NF-kappaB transcriptional activation in human embryonic kidney cells. Corresponding with this finding, RNA silencing of CDK2, SAG and SENP2 reduced NF-kappaB transcriptional activation, supporting a positive role for these proteins in the NF-kappaB pathway. The identification of a host of new NEMO interactors opens up new research opportunities to improve understanding of this essential cell signaling pathway. PMID:20098747
Li, Min; Sun, Wan; Yang, Ya-ping; Xu, Bo; Yi, Wen-yuan; Ma, Yan-xia; Li, Zhong-jun; Cui, Jing-rong
2009-01-01
To investigate the anticancer property and possible mechanism of action of a novel sugar-substituted thalidomide derivative (STA-35) on HL-60 cells in vitro. TNF-alpha-induced NF-kappaB activation was determined using a reporter gene assay. The MTT assay was used to measure cytotoxicity of the compound. The appearance of apoptotic Sub-G1 cells was detected by flow cytometry analysis. PARP cleavage and protein expression of NF-kappaB p65 and its inhibitor IkappaB were viewed by Western blotting. TA-35 (1-20 micromol/L) suppressed TNF-alpha-induced NF-kappaB activation in transfected cells (HEK293/pNiFty-SEAP) in a dose- (1-20 micromol/L) and time-dependent (0-48 h) manner. It was also shown that STA-35 exerted a dose-dependent inhibitory effect on HL-60 cell proliferation with an IC(50) value of 9.05 micromol/L. In addition, STA-35 induced apoptosis in HL-60 cells, as indicated by the appearance of a Sub-G1 peak in the cell cycle distribution, as well as poly ADP-ribose polymerase (PARP) cleavage. Subsequently, both NF-kappaB p65 and its inhibitor IkappaB gradually accumulated in cytoplasmic extracts in a dose- and time-dependent manner, indicating the blockage of NF-kappaB translocation induced by TNF-alpha from the cytoplasm to the nucleus. A novel sugar-substituted thalidomide derivative, STA-35, is potent toward HL-60 cells in vitro and induces apoptosis by the suppression of NF-kappaB activation.
Common Variable Immunodeficiency Caused by FANC Mutations.
Sekinaka, Yujin; Mitsuiki, Noriko; Imai, Kohsuke; Yabe, Miharu; Yabe, Hiromasa; Mitsui-Sekinaka, Kanako; Honma, Kenichi; Takagi, Masatoshi; Arai, Ayako; Yoshida, Kenichi; Okuno, Yusuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Muramatsu, Hideki; Kojima, Seiji; Hira, Asuka; Takata, Minoru; Ohara, Osamu; Ogawa, Seishi; Morio, Tomohiro; Nonoyama, Shigeaki
2017-07-01
Common variable immunodeficiency (CVID) is the most common adult-onset primary antibody deficiency disease due to various causative genes. Several genes, which are known to be the cause of different diseases, have recently been reported as the cause of CVID in patients by performing whole exome sequencing (WES) analysis. Here, we found FANC gene mutations as a cause of adult-onset CVID in two patients. B cells were absent and CD4 + T cells were skewed toward CD45RO + memory T cells. T-cell receptor excision circles (TRECs) and signal joint kappa-deleting recombination excision circles (sjKRECs) were undetectable in both patients. Both patients had no anemia, neutropenia, or thrombocytopenia. Using WES, we identified compound heterozygous mutations of FANCE in one patient and homozygous mutation of FANCA in another patient. The impaired function of FANC protein complex was confirmed by a monoubiquitination assay and by chromosome fragility test. We then performed several immunological evaluations including quantitative lymphocyte analysis and TRECs/sjKRECs analysis for 32 individuals with Fanconi anemia (FA). In total, 22 FA patients (68.8%) were found to have immunological abnormalities, suggesting that such immunological findings may be common in FA patients. These data indicate that FANC mutations are involved in impaired lymphogenesis probably by the accumulation of DNA replication stress, leading to CVID. It is important to diagnose FA because it drastically changes clinical management. We propose that FANC mutations can cause isolated immunodeficiency in addition to bone marrow failure and malignancy.
Using global maps to predict the risk of dengue in Europe.
Rogers, David J; Suk, Jonathan E; Semenza, Jan C
2014-01-01
This article attempts to quantify the risk to Europe of dengue, following the arrival and spread there of one of dengue's vector species Aedes (Stegomyia) albopictus. A global risk map for dengue is presented, based on a global database of the occurrence of this disease, derived from electronic literature searches. Remotely sensed satellite data (from NASA's MODIS series), interpolated meteorological data, predicted distribution maps of dengue's two main vector species, Aedes aegypti and Aedes albopictus, a digital elevation surface and human population density data were all used as potential predictor variables in a non-linear discriminant analysis modelling framework. One hundred bootstrap models were produced by randomly sub-sampling three different training sets for dengue fever, severe dengue (i.e. dengue haemorrhagic fever, DHF) and all-dengue, and output predictions were averaged to produce a single global risk map for each type of dengue. This paper concentrates on the all-dengue models. Key predictor variables were various thermal data layers, including both day- and night-time Land Surface Temperature, human population density, and a variety of rainfall variables. The relative importance of each may be shown visually using rainbow files and quantitatively using a ranking system. Vegetation Index variables (a common proxy for humidity or saturation deficit) were rarely chosen in the models. The kappa index of agreement indicated an excellent (dengue haemorrhagic fever, Cohen's kappa=0.79 ± 0.028, AUC=0.96 ± 0.007) or good fit of the top ten models in each series to the data (Cohen's kappa=0.73 ± 0.018, AUC=0.94 ± 0.007 for dengue fever and 0.74 ± 0.017, AUC=0.95 ± 0.005 for all dengue). The global risk map predicts widespread dengue risk in SE Asia and India, in Central America and parts of coastal South America, but in relatively few regions of Africa. In many cases these are less extensive predictions than those of other published dengue risk maps and arise because of the key importance of high human population density for the all-dengue risk maps produced here. Three published dengue risk maps are compared using the Fleiss kappa index, and are shown to have only fair agreement globally (Fleiss kappa=0.377). Regionally the maps show greater (but still only moderate) agreement in SE Asia (Fleiss kappa=0.566), fair agreement in the Americas (Fleiss kappa=0.325) and only slight agreement in Africa (Fleiss kappa=0.095). The global dengue risk maps show that very few areas of rural Europe are presently suitable for dengue, but several major cities appear to be at some degree of risk, probably due to a combination of thermal conditions and high human population density, the top two variables in many models. Mahalanobis distance images were produced of Europe and the southern United States showing the distance in environmental rather than geographical space of each site from any site where dengue currently occurs. Parts of Europe are quite similar in Mahalanobis distance terms to parts of the southern United States, where dengue occurred in the recent past and which remain environmentally suitable for it. High standards of living rather than a changed environmental suitability keep dengue out of the USA. The threat of dengue to Europe at present is considered to be low but sufficiently uncertain to warrant monitoring in those areas of greatest predicted environmental suitability, especially in northern Italy and parts of Austria, Slovenia and Croatia, Bosnia and Herzegovina, Serbia and Montenegro, Albania, Greece, south-eastern France, Germany and Switzerland, and in smaller regions elsewhere. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
Christophi, George P; Panos, Michael; Hudson, Chad A; Christophi, Rebecca L; Gruber, Ross C; Mersich, Akos T; Blystone, Scott D; Jubelt, Burk; Massa, Paul T
2009-07-01
Recent studies in mice have demonstrated that the protein tyrosine phosphatase SHP-1 is a crucial negative regulator of proinflammatory cytokine signaling, TLR signaling, and inflammatory gene expression. Furthermore, mice genetically lacking SHP-1 (me/me) display a profound susceptibility to inflammatory CNS demyelination relative to wild-type mice. In particular, SHP-1 deficiency may act predominantly in inflammatory macrophages to increase CNS demyelination as SHP-1-deficient macrophages display coexpression of inflammatory effector molecules and increased demyelinating activity in me/me mice. Recently, we reported that PBMCs of multiple sclerosis (MS) patients have a deficiency in SHP-1 expression relative to normal control subjects indicating that SHP-1 deficiency may play a similar role in MS as to that seen in mice. Therefore, it became essential to examine the specific expression and function of SHP-1 in macrophages from MS patients. Herein, we document that macrophages of MS patients have deficient SHP-1 protein and mRNA expression relative to those of normal control subjects. To examine functional consequences of the lower SHP-1, the activation of STAT6, STAT1, and NF-kappaB was quantified and macrophages of MS patients showed increased activation of these transcription factors. In accordance with this observation, several STAT6-, STAT1-, and NF-kappaB-responsive genes that mediate inflammatory demyelination were increased in macrophages of MS patients following cytokine and TLR agonist stimulation. Supporting a direct role of SHP-1 deficiency in altered macrophage function, experimental depletion of SHP-1 in normal subject macrophages resulted in an increased STAT/NF-kappaB activation and increased inflammatory gene expression to levels seen in macrophages of MS patients. In conclusion, macrophages of MS patients display a deficiency of SHP-1 expression, heightened activation of STAT6, STAT1, and NF-kappaB and a corresponding inflammatory profile that may be important in controlling macrophage-mediated demyelination in MS.
Immature surface Ig+ B cells can continue to rearrange kappa and lambda L chain gene loci
1993-01-01
Pro and pre B cells possess the long-term capacity to proliferate in vitro on stromal cells and interleukin 7 (IL-7) and can differentiate to surface immunoglobulin (sIg+) cells upon removal of IL-7 from the cultures. A key event in this differentiation is the extensive cell loss due to apoptosis. Because the proto-oncogene bcl-2 can promote cell survival, we established pre-B cell lines from E mu-bcl-2 transgenic mice. These pre-B cells have the same properties as those derived from non-bcl-2 transgenic mice except that they do not die by apoptosis. This allowed us to study the fate of newly formed B cells in vitro for a longer period of time. Here we show that early during the differentiation of pre-B cells, upregulation of RAG-1 and RAG-2 expression go hand in hand with rearrangements of the Ig gene loci. Moreover, the newly formed sIg+ B cells continue to express RAG-1 and RAG-2 and continue to rearrange L chain gene loci, even in the absence of proliferation, in an orderly fashion, so that kappa L+ sIg+ cells can become lambda L+ sIg+ or sIg- cells, whereas lambda L+ sIg+ cells can become sIg-, but not kappa L+ sIg+ cells. Thus, deposition of a complete Ig molecule on the surface of a B cell does not automatically stop the Ig-rearrangement machinery. PMID:8376934
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fitzpatrick, Susan F.; Fábián, Zsolt; Schaible, Bettina
Hepatocyte death is an important contributing factor in a number of diseases of the liver. PHD1 confers hypoxic sensitivity upon transcription factors including the hypoxia inducible factor (HIF) and nuclear factor-kappaB (NF-κB). Reduced PHD1 activity is linked to decreased apoptosis. Here, we investigated the underlying mechanism(s) in hepatocytes. Basal NF-κB activity was elevated in PHD1{sup −/−} hepatocytes compared to wild type controls. ChIP-seq analysis confirmed enhanced binding of NF-κB to chromatin in regions proximal to the promoters of genes involved in the regulation of apoptosis. Inhibition of NF-κB (but not knock-out of HIF-1 or HIF-2) reversed the anti-apoptotic effects ofmore » pharmacologic hydroxylase inhibition. We hypothesize that PHD1 inhibition leads to altered expression of NF-κB-dependent genes resulting in reduced apoptosis. This study provides new information relating to the possible mechanism of therapeutic action of hydroxylase inhibitors that has been reported in pre-clinical models of intestinal and hepatic disease. -- Highlights: •Genetic ablation of PHD1 upregulates NF-kappaB (NF-κB) in hepatocytes. •Activation of NF-κB leads to differential DNA-binding of p50/p65 and results in differential regulation of apoptotic genes. •We identified proline 191 in the beta subunit of the I-kappaB kinase as a target for PHD1-mediated hydroxylation. •Blockade of prolyl-4-hydroxylases has been found cytoprotective in liver cells.« less
Matroule, J Y; Bonizzi, G; Morlière, P; Paillous, N; Santus, R; Bours, V; Piette, J
1999-01-29
Pyropheophorbide-a methyl ester (PPME) is a second generation of photosensitizers used in photodynamic therapy. We demonstrated that PPME photosensitization activated NF-kappaB transcription factor in colon cancer cells. Unexpectedly, this activation occurred in two separate waves, i.e. a rapid and transient one and a second slower but sustained phase. The former was due to photosensitization by PPME localized in the cytoplasmic membrane which triggered interleukin-1 receptor internalization and the transduction pathways controlled by the interleukin-1 type I receptor. Indeed, TRAF6 dominant negative mutant abolished NF-kappaB activation by PPME photosensitization, and TRAF2 dominant negative mutant was without any effect, and overexpression of IkappaB kinases increased gene transcription controlled by NF-kappaB. Oxidative stress was not likely involved in the activation. On the other hand, the slower and sustained wave could be the product of the release of ceramide through activation of the acidic sphingomyelinase. PPME localization within the lysosomal membrane could explain why ceramide acted as second messenger in NF-kappaB activation by PPME photosensitization. These data will allow a better understanding of the molecular basis of tumor eradication by photodynamic therapy, in particular the importance of the host cell response in the treatment.
CIKS, a connection to Ikappa B kinase and stress-activated protein kinase.
Leonardi, A; Chariot, A; Claudio, E; Cunningham, K; Siebenlist, U
2000-09-12
Pathogens, inflammatory signals, and stress cause acute transcriptional responses in cells. The induced expression of genes in response to these signals invariably involves transcription factors of the NF-kappaB and AP-1/ATF families. Activation of NF-kappaB factors is thought to be mediated primarily via IkappaB kinases (IKK), whereas that of AP-1/ATF can be mediated by stress-activated protein kinases (SAPKs; also named Jun kinases or JNKs). IKKalpha and IKKbeta are two catalytic subunits of a core IKK complex that also contains the regulatory subunit NEMO (NF-kappaB essential modulator)/IKKgamma. The latter protein is essential for activation of the IKKs, but its mechanism of action is not known. Here we describe the molecular cloning of CIKS (connection to IKK and SAPK/JNK), a previously unknown protein that directly interacts with NEMO/IKKgamma in cells. When ectopically expressed, CIKS stimulates IKK and SAPK/JNK kinases and it transactivates an NF-kappaB-dependent reporter. Activation of NF-kappaB is prevented in the presence of kinase-deficient, interfering mutants of the IKKs. CIKS may help to connect upstream signaling events to IKK and SAPK/JNK modules. CIKS could coordinate the activation of two stress-induced signaling pathways, functions reminiscent of those noted for tumor necrosis factor receptor-associated factor adaptor proteins.
Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L
1993-01-01
The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364
Zhu, Z; Tang, W; Ray, A; Wu, Y; Einarsson, O; Landry, M L; Gwaltney, J; Elias, J A
1996-01-01
To further understand the biology of rhinovirus (RV), we determined whether IL-6 was produced during RV infections and characterized the mechanism by which RV stimulates lung cell IL-6 production. In contrast to normals and minimally symptomatic volunteers, IL-6 was detected in the nasal washings from patients who developed colds after RV challenge. RV14 and RV1A, major and minor receptor group RVs, respectively, were potent stimulators of IL-6 protein production in vitro. These effects were associated with significant increases in IL-6 mRNA accumulation and gene transcription. RV was also a potent stimulator of IL-6 promoter-driven luciferase activity. This stimulation was modestly decreased by mutation of the nuclear factor (NF)-IL-6 site and abrogated by mutation of the NF-kappa B site in this promoter. An NF-kappa B-DNA binding activity, mediated by p65, p50, and p52 NF-kappa B moieties, was rapidly induced in RV-infected cells. Activator protein 1-DNA binding was not similarly altered. These studies demonstrate that IL-6 is produced during symptomatic RV infections, that RVs are potent stimulators of IL-6 elaboration, and that RV stimulation IL-6 production is mediated by an NF-kappa B-dependent transcriptional stimulation pathway. IL-6 may play an important role in the pathogenesis of RV infection, and NF-kappa B activation is likely to be an important event in RV-induced pathologies. PMID:8567963
Wang, Yan-Yi; Liu, Li-Juan; Zhong, Bo; Liu, Tian-Tian; Li, Ying; Yang, Yan; Ran, Yong; Li, Shu; Tien, Po; Shu, Hong-Bing
2010-01-12
Viral infection causes activation of the transcription factors NF-kappaB and IRF3, which collaborate to induce type I interferons (IFNs) and cellular antiviral response. The mitochondrial outer membrane protein VISA acts as a critical adapter for assembling a virus-induced complex that signals NF-kappaB and IRF3 activation. Using a biochemical purification approach, we identified the WD repeat protein WDR5 as a VISA-associated protein. WDR5 was recruited to VISA in a viral infection dependent manner. Viral infection also caused translocation of WDR5 from the nucleus to mitochondria. Knockdown of WDR5 impaired the formation of virus-induced VISA-associated complex. Consistently, knockdown of WDR5 inhibited virus-triggered activation of IRF3 and NF-kappaB as well as transcription of the IFNB1 gene. These findings suggest that WDR5 is essential in assembling a virus-induced VISA-associated complex and plays an important role in virus-triggered induction of type I IFNs.
Borthakur, Alip; Saksena, Seema; Gill, Ravinder K; Alrefai, Waddah A; Ramaswamy, Krishnamurthy; Dudeja, Pradeep K
2008-04-01
Butyrate, a short chain fatty acid (SCFA) produced by bacterial fermentation of undigested carbohydrates in the colon, constitutes the major fuel for colonocytes. We have earlier shown the role of apically localized monocarboxylate transporter isoform 1 (MCT1) in transport of butyrate into human colonic Caco-2 cells. In an effort to study the regulation of MCT1 gene, we and others have cloned the promoter region of the MCT1 gene and identified cis elements for key transcription factors. A previous study has shown up-regulation of MCT1 expression, and activity by butyrate in AA/C1 human colonic epithelial cells, however, the detailed mechanisms of this up-regulation are not known. In this study, we demonstrate that butyrate, a substrate for MCT1, stimulates MCT1 promoter activity in Caco-2 cells. This effect was dose dependent and specific to butyrate as other predominant SCFAs, acetate, and propionate, were ineffective. Utilizing progressive deletion constructs of the MCT1 promoter, we showed that the putative butyrate responsive elements are in the -229/+91 region of the promoter. Butyrate stimulation of the MCT1 promoter was found to be independent of PKC, PKA, and tyrosine kinases. However, specific inhibitors of the NF-kappaB pathway, lactacystein (LC), and caffeic acid phenyl ester (CAPE) significantly reduced the MCT1 promoter stimulation by butyrate. Also, butyrate directly stimulated NF-kappaB-dependent luciferase reporter activity. Histone deacetylase (HDAC) inhibitor trichostatin A (TSA) also stimulated MCT1 promoter activity, however, unlike butyrate, this stimulation was unaltered by the NF-kappaB inhibitors. Further, the combined effect of butyrate, and TSA on MCT1 promoter activity was additive, indicating that their mechanisms of action were independent. Our results demonstrate the involvement of NF-kappaB pathway in the regulation of MCT1 promoter activity by butyrate. 2007 Wiley-Liss, Inc.
Ma, Wei; Gee, Katrina; Lim, Wilfred; Chambers, Kelly; Angel, Jonathan B; Kozlowski, Maya; Kumar, Ashok
2004-01-01
IL-12 plays a critical role in the development of cell-mediated immune responses and in the pathogenesis of inflammatory and autoimmune disorders. Dexamethasone (DXM), an anti-inflammatory glucocorticoid, has been shown to inhibit IL-12p40 production in LPS-stimulated monocytic cells. In this study, we investigated the molecular mechanism by which DXM inhibits IL-12p40 production by studying the role of the mitogen-activated protein kinases (MAPKs), and the key transcription factors involved in human IL-12p40 production in LPS-stimulated monocytic cells. A role for c-Jun N-terminal kinase (JNK) MAPK in LPS-induced IL-12p40 regulation in a promonocytic THP-1/CD14 cell line was demonstrated by using specific inhibitors of JNK activation, SP600125 and a dominant-negative stress-activated protein/extracellular signal-regulated kinase kinase-1 mutant. To identify transcription factors regulating IL-12p40 gene transcription, extensive deletion analyses of the IL-12p40 promoter was performed. The results revealed the involvement of a sequence encompassing the AP-1-binding site, in addition to that of NF-kappaB. The role of AP-1 in IL-12p40 transcription was confirmed by using antisense c-fos and c-jun oligonucleotides. Studies conducted to understand the regulation of AP-1 and NF-kappaB activation by JNK MAPK revealed that both DXM and SP600125 inhibited IL-12p40 gene transcription by inhibiting the activation of AP-1 and NF-kappaB transcription factors as revealed by luciferase reporter and gel mobility shift assays. Taken together, our results suggest that DXM may inhibit IL-12p40 production in LPS-stimulated human monocytic cells by down-regulating the activation of JNK MAPK, the AP-1, and NF-kappaB transcription factors.
Hafez, Mohammad; Al-Tonbary, Youssef; El-Bayoumi, Mohammed A; Hatem, Nadia; Hawas, Samia; Mansour, Ahmed; Marzouk, Iman; Hafez, Mona M; Yahia, Sohier; Farahat, Nahla
2007-06-01
The aim of the study is to characterize markers of apoptosis in children with acute lymphoblastic leukemia (ALL) in relation to treatment outcome of the disease. The study was performed on 34 children with ALL and 39 healthy children as a control group. Apoptosis was assessed by cell morphology; DNA fragmentation; ELISA and RT-PCR for CD95, CD95L, BcL-2 and nuclear factor-kappa B (NF-kappaB); and flow cytometry for CD95, CD40, CD49d and CD11a. Apoptosis was significantly lower in patients than controls. Apoptosis detected by CD95 ligand was significantly lower in cases with no remission after treatment than those who achieved remission. Anti-apoptotic factors: CD40, BcL-2, and NF-kappaB were all found to be higher in cases than controls and in cases with no remission than those achieved remission. CD49d was significantly lower in cases than controls, and significantly lower in cases with who did not achieve remission. CD11a levels were similar in the various groups. Delayed apoptosis of ALL cells is genetically controlled either directly or indirectly by a network of oncogenes and tumor suppressor genes. CD40 appeared to stimulate both T and B lineage and is considered the most potent influencer and predictor of resistance to therapy. Inhibitors for the activity of CD40, Bcl-2 and NF-kappaB as well as stimulants to CD95 could have a potential therapeutic benefit.
Silverman, G J; Carson, D A; Patrick, K; Vaughan, J H; Fong, S
1987-06-01
The mouse monoclonal antibody 17.109 recognizes a cross-reactive idiotype (CRI) associated with kappa IIIb light chains of human IgM-rheumatoid factor (RF) paraproteins. The 17.109 idiotypic determinant is encoded by one or a group of closely related V kappa genes. The association of the idiotype with IgM- and IgA-rheumatoid factors in certain autoimmune diseases necessitates an understanding of how human B lymphocytes can be induced to express the idiotype. To investigate the cellular expression of the 17.109 CRI, peripheral blood lymphocytes from normal donors were stimulated in vitro with Epstein-Barr virus (EBV) and pokeweed mitogen (PWM). EBV induced greater expression of IgM-associated 17.109 CRI than did PWM. The 17.109 CRI was preferentially associated with IgM rather than with IgG. In vivo EBV infection was studied in college students with infectious mononucleosis and displayed similar elevation of IgM-associated 17.109 CRI in sera obtained at presentation of clinical illness. Later, IgM levels declined while IgG-associated 17.109 CRI rose. The 17.109 idiotype was unrelated to antibodies against the Epstein-Barr virus nuclear antigen and the viral capsid antigen and was probably due to generalized activation of early B cells. These observations support the hypothesis that the 17.109 CRI is expressed by in vitro and in vivo EBV-infected cells. The 17.109 idiotype identifies a highly conserved V kappa gene product, which is expressed preferentially after EBV infection, but not exclusively with RF autoantibodies.
Validating Smoking Data From the Veteran’s Affairs Health Factors Dataset, an Electronic Data Source
Brandt, Cynthia A.; Skanderson, Melissa; Justice, Amy C.; Shahrir, Shahida; Butt, Adeel A.; Brown, Sheldon T.; Freiberg, Matthew S.; Gibert, Cynthia L.; Goetz, Matthew Bidwell; Kim, Joon Woo; Pisani, Margaret A.; Rimland, David; Rodriguez-Barradas, Maria C.; Sico, Jason J.; Tindle, Hilary A.; Crothers, Kristina
2011-01-01
Introduction: We assessed smoking data from the Veterans Health Administration (VHA) electronic medical record (EMR) Health Factors dataset. Methods: To assess the validity of the EMR Health Factors smoking data, we first created an algorithm to convert text entries into a 3-category smoking variable (never, former, and current). We compared this EMR smoking variable to 2 different sources of patient self-reported smoking survey data: (a) 6,816 HIV-infected and -uninfected participants in the 8-site Veterans Aging Cohort Study (VACS-8) and (b) a subset of 13,689 participants from the national VACS Virtual Cohort (VACS-VC), who also completed the 1999 Large Health Study (LHS) survey. Sensitivity, specificity, and kappa statistics were used to evaluate agreement of EMR Health Factors smoking data with self-report smoking data. Results: For the EMR Health Factors and VACS-8 comparison of current, former, and never smoking categories, the kappa statistic was .66. For EMR Health Factors and VACS-VC/LHS comparison of smoking, the kappa statistic was .61. Conclusions: Based on kappa statistics, agreement between the EMR Health Factors and survey sources is substantial. Identification of current smokers nationally within the VHA can be used in future studies to track smoking status over time, to evaluate smoking interventions, and to adjust for smoking status in research. Our methodology may provide insights for other organizations seeking to use EMR data for accurate determination of smoking status. PMID:21911825
[Forest lighting fire forecasting for Daxing'anling Mountains based on MAXENT model].
Sun, Yu; Shi, Ming-Chang; Peng, Huan; Zhu, Pei-Lin; Liu, Si-Lin; Wu, Shi-Lei; He, Cheng; Chen, Feng
2014-04-01
Daxing'anling Mountains is one of the areas with the highest occurrence of forest lighting fire in Heilongjiang Province, and developing a lightning fire forecast model to accurately predict the forest fires in this area is of importance. Based on the data of forest lightning fires and environment variables, the MAXENT model was used to predict the lightning fire in Daxing' anling region. Firstly, we studied the collinear diagnostic of each environment variable, evaluated the importance of the environmental variables using training gain and the Jackknife method, and then evaluated the prediction accuracy of the MAXENT model using the max Kappa value and the AUC value. The results showed that the variance inflation factor (VIF) values of lightning energy and neutralized charge were 5.012 and 6.230, respectively. They were collinear with the other variables, so the model could not be used for training. Daily rainfall, the number of cloud-to-ground lightning, and current intensity of cloud-to-ground lightning were the three most important factors affecting the lightning fires in the forest, while the daily average wind speed and the slope was of less importance. With the increase of the proportion of test data, the max Kappa and AUC values were increased. The max Kappa values were above 0.75 and the average value was 0.772, while all of the AUC values were above 0.5 and the average value was 0. 859. With a moderate level of prediction accuracy being achieved, the MAXENT model could be used to predict forest lightning fire in Daxing'anling Mountains.
Chiang, Yi-Ming; Lo, Chiu-Ping; Chen, Yi-Ping; Wang, Sheng-Yang; Yang, Ning-Sun; Kuo, Yueh-Hsiung; Shyur, Lie-Fen
2005-10-01
Ethyl caffeate, a natural phenolic compound, was isolated from Bidens pilosa, a medicinal plant popularly used for treating certain inflammatory syndromes. The purpose of this study was to investigate the structural activity, and the anti-inflammatory functions and mechanism(s) of ethyl caffeate. Ethyl caffeate was found to markedly suppress the lipopolysaccharide (LPS)-induced nitric oxide (NO) production (IC(50) = 5.5 microg ml(-1)), mRNA and protein expressions of inducible nitric oxide synthase (iNOS), and prostaglandin E(2) (PGE(2)) production in RAW 264.7 macrophages. Transient gene expression assays using human cox-2 promoter construct revealed that ethyl caffeate exerted an inhibitory effect on cox-2 transcriptional activity in 12-O-tetradecanoylphorbol-13-acetate (TPA)-treated MCF-7 cells. Immunohistochemical studies of mouse skin demonstrated that TPA-induced COX-2 expression was significantly inhibited by ethyl caffeate with a superior effect to that of celecoxib, a nonsteroidal anti-inflammatory drug. The phosphorylation and degradation of inhibitor kappaB (IkappaB) and the translocation of nuclear transcription factor-kappaB (NF-kappaB) into the nucleus, as well as the activation of mitogen-activated protein kinases (MAPKs) induced by LPS in macrophages, were not affected by ethyl caffeate. Ethyl caffeate, however, could inhibit NF-kappaB activation by impairing the binding of NF-kappaB to its cis-acting element. These results suggest that ethyl caffeate suppresses iNOS and COX-2 expressions partly through the inhibition of the NF-kappaB.DNA complex formation. Structure-activity relationship analyses suggested that the catechol moiety and alpha,beta-unsaturated ester group in ethyl caffeate are important and essential structural features for preventing NF-kappaB.DNA complex formation. This study provides an insight into the probable mechanism(s) underlying the anti-inflammatory and therapeutic properties of ethyl caffeate.
Zwart, Sara R; Pierson, Duane; Mehta, Satish; Gonda, Steve; Smith, Scott M
2010-05-01
NF-kappaB is a transcriptional activator of many genes, including some that lead to muscle atrophy and bone resorption-significant concerns for astronauts. NF-kappaB activation is inhibited by eicosapentaenoic acid (EPA), but the influence of this omega-3 fatty acid on the effects of weightlessness are unknown. We report here cellular, ground analogue, and spaceflight findings. We investigated the effects of EPA on differentiation of RAW264.7 monocyte/macrophage cells induced by receptor activator of NF-kappaB ligand (RANKL) and on activation of NF-kappaB by tumor necrosis factor alpha (TNF-alpha) or exposure to modeled weightlessness. EPA (50 microM for 24 hours) inhibited RANKL-induced differentiation and decreased activation of NF-kappaB induced by 0.2 microg/mL of TNF-alpha for 30 minutes or by modeled weightlessness for 24 hours (p < .05). In human studies, we evaluated whether NF-kappaB activation was altered after short-duration spaceflight and determined the relationship between intake of omega-3 fatty acids and markers of bone resorption during bed rest and the relationship between fish intake and bone mineral density after long-duration spaceflight. NF-kappaB was elevated in crew members after short-duration spaceflight, and higher consumption of fish (a rich source of omega-3 fatty acids) was associated with reduced loss of bone mineral density after flight (p < .05). Also supporting the cell study findings, a higher intake of omega-3 fatty acids was associated with less N-telopeptide excretion during bed rest (Pearson r = -0.62, p < .05). Together these data provide mechanistic cellular and preliminary human evidence of the potential for EPA to counteract bone loss associated with spaceflight. (c) 2010 American Society for Bone and Mineral Research.
Gadgeel, Shirish M; Ali, Shadan; Philip, Philip A; Wozniak, Antoinette; Sarkar, Fazlul H
2009-05-15
Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have shown modest clinical benefit in patients with relapsed nonsmall cell lung cancer (NSCLC). Down-regulation of Akt appears to correlate with the antitumor activity of EGFR-TKIs. Akt activates nuclear factor kappa B (NF-kappaB), which transcribes genes important for cell survival, invasion, and metastasis. The authors hypothesized that genistein, through the inhibition of NF-kappaB, could enhance the activity of EGFR-TKIs in NSCLCs. Three NSCLC cell lines with various EGFR mutation status and sensitivities to EGFR-TKIs were selected: H3255 (L858R), H1650 (del E746-A750), and H1781 (wild-type EGFR). Cells were treated with erlotinib, gefitinib, genistein, or the combination of each of the EGFR-TKIs with genistein. Cell survival and apoptosis were assessed, and expression levels of EGFR, pAkt, cyclooxygenase-2 (COX-2), E-cadherin, prostaglandin E(2) (PGE(2)), and NF-kappaB were measured. Both EGFR-TKIs demonstrated growth inhibition and apoptosis in each of the cell lines, but H1650 and H1781 were much less sensitive. Genistein demonstrated some antitumor activity in all cell lines, but enhanced growth inhibition and apoptosis when combined with the EGFR-TKIs in each of the cell lines. Both combinations down-regulated NF-kappaB significantly more than either agent alone in H3255. In addition, the combinations reduced the expression of EGFR, pAkt, COX-2, and PGE(2,) consistent with inactivation of NF-kappaB. The authors concluded that genistein enhances the antitumor effects of EGFR-TKIs in 3 separate NSCLC cell lines. This enhanced activity is in part because of greater reduction in the DNA-binding activity of NF-kappaB when EGFR-TKIs were combined with genistein.
dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C
2007-02-01
Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.
[Comparative analysis of the genetic structure of Red Polish cattle in Poland and the Ukraine].
Oblap, R V; Zvezhkhovski, L; Ivanchenko, E V; Glazko, V I
2002-01-01
Comparative analysis of genetic structure of two groups of Red Polish cattle, which reproduce in Poland and Ukraine, was made. Six molecular-genetic markers (kappa-casein, beta-lactoglobulin, leptin, myostatin, growth hormone, and pituitary-specific transcription factor Pit-I) were tested by PCR-RFLP. No significant differences between the considered intrabreed groups were found. High frequency of some alleles (Csn kappa B, Blg B, and Gh L) related to the important productivity traits were observed. The rare alleles in some genes were revealed. The obtained results are evidence of the unique characteristics of the investigated breed.
Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.
Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R
2017-01-01
Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.
Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.
Stewart, A F; Willis, I M; Mackinlay, A G
1984-01-01
The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443
NASA Astrophysics Data System (ADS)
Park, M.; Stenstrom, M. K.
2004-12-01
Recognizing urban information from the satellite imagery is problematic due to the diverse features and dynamic changes of urban landuse. The use of Landsat imagery for urban land use classification involves inherent uncertainty due to its spatial resolution and the low separability among land uses. To resolve the uncertainty problem, we investigated the performance of Bayesian networks to classify urban land use since Bayesian networks provide a quantitative way of handling uncertainty and have been successfully used in many areas. In this study, we developed the optimized networks for urban land use classification from Landsat ETM+ images of Marina del Rey area based on USGS land cover/use classification level III. The networks started from a tree structure based on mutual information between variables and added the links to improve accuracy. This methodology offers several advantages: (1) The network structure shows the dependency relationships between variables. The class node value can be predicted even with particular band information missing due to sensor system error. The missing information can be inferred from other dependent bands. (2) The network structure provides information of variables that are important for the classification, which is not available from conventional classification methods such as neural networks and maximum likelihood classification. In our case, for example, bands 1, 5 and 6 are the most important inputs in determining the land use of each pixel. (3) The networks can be reduced with those input variables important for classification. This minimizes the problem without considering all possible variables. We also examined the effect of incorporating ancillary data: geospatial information such as X and Y coordinate values of each pixel and DEM data, and vegetation indices such as NDVI and Tasseled Cap transformation. The results showed that the locational information improved overall accuracy (81%) and kappa coefficient (76%), and lowered the omission and commission errors compared with using only spectral data (accuracy 71%, kappa coefficient 62%). Incorporating DEM data did not significantly improve overall accuracy (74%) and kappa coefficient (66%) but lowered the omission and commission errors. Incorporating NDVI did not much improve the overall accuracy (72%) and k coefficient (65%). Including Tasseled Cap transformation reduced the accuracy (accuracy 70%, kappa 61%). Therefore, additional information from the DEM and vegetation indices was not useful as locational ancillary data.
Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways.
Nair, Rajan P; Duffin, Kristina Callis; Helms, Cynthia; Ding, Jun; Stuart, Philip E; Goldgar, David; Gudjonsson, Johann E; Li, Yun; Tejasvi, Trilokraj; Feng, Bing-Jian; Ruether, Andreas; Schreiber, Stefan; Weichenthal, Michael; Gladman, Dafna; Rahman, Proton; Schrodi, Steven J; Prahalad, Sampath; Guthery, Stephen L; Fischer, Judith; Liao, Wilson; Kwok, Pui-Yan; Menter, Alan; Lathrop, G Mark; Wise, Carol A; Begovich, Ann B; Voorhees, John J; Elder, James T; Krueger, Gerald G; Bowcock, Anne M; Abecasis, Gonçalo R
2009-02-01
Psoriasis is a common immune-mediated disorder that affects the skin, nails and joints. To identify psoriasis susceptibility loci, we genotyped 438,670 SNPs in 1,409 psoriasis cases and 1,436 controls of European ancestry. We followed up 21 promising SNPs in 5,048 psoriasis cases and 5,041 controls. Our results provide strong support for the association of at least seven genetic loci and psoriasis (each with combined P < 5 x 10(-8)). Loci with confirmed association include HLA-C, three genes involved in IL-23 signaling (IL23A, IL23R, IL12B), two genes that act downstream of TNF-alpha and regulate NF-kappaB signaling (TNIP1, TNFAIP3) and two genes involved in the modulation of Th2 immune responses (IL4, IL13). Although the proteins encoded in these loci are known to interact biologically, we found no evidence for epistasis between associated SNPs. Our results expand the catalog of genetic loci implicated in psoriasis susceptibility and suggest priority targets for study in other auto-immune disorders.
Kriete, Andres; Mayo, Kelli L; Yalamanchili, Nirupama; Beggs, William; Bender, Patrick; Kari, Csaba; Rodeck, Ulrich
2008-07-16
Chronic inflammation is a well-known corollary of the aging process and is believed to significantly contribute to morbidity and mortality of many age-associated chronic diseases. However, the mechanisms that cause age-associated inflammatory changes are not well understood. Particularly, the contribution of cell stress responses to age-associated inflammation in 'non-inflammatory' cells remains poorly defined. The present cross-sectional study focused on differences in molecular signatures indicative of inflammatory states associated with biological aging of human fibroblasts from donors aged 22 to 92 years. Gene expression profiling revealed elevated steady-state transcript levels consistent with a chronic inflammatory state in fibroblast cell-strains obtained from older donors. We also observed enhanced NF-kappaB DNA binding activity in a subset of strains, and the NF-kappaB profile correlated with mRNA expression levels characteristic of inflammatory processes, which include transcripts coding for cytokines, chemokines, components of the complement cascade and MHC molecules. This intrinsic low-grade inflammatory state, as it relates to aging, occurs in cultured cells irrespective of the presence of other cell types or the in vivo context. Our results are consistent with the view that constitutive activation of inflammatory pathways is a phenomenon prevalent in aged fibroblasts. It is possibly part of a cellular survival process in response to compromised mitochondrial function. Importantly, the inflammatory gene expression signature described here is cell autonomous, i.e. occurs in the absence of prototypical immune or pro-inflammatory cells, growth factors, or other inflammatory mediators.
Won, Jong-Heon; Kim, Ji-Yeon; Yun, Kyung-Jin; Lee, Jin-Hee; Back, Nam-In; Chung, Hae-Gon; Chung, Sun A; Jeong, Tae-Sook; Choi, Myung-Sook; Lee, Kyung-Tae
2006-10-01
During our efforts to find bioactive natural products with anti-inflammatory activity, we isolated gigantol from the whole plants of Cymbidium goeringii (Orchidaceae) by activity-guided chromatographic fractionation. Gigantol was found to have potent inhibitory effects on LPS-induced nitric oxide (NO) and prostaglandin E (2) (PGE (2)) production in RAW 264.7 cells. Consistent with these findings, gigantol suppressed the expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) at the protein and mRNA levels in RAW 264.7 cells in a concentration-dependent manner. Our data also indicate that gigantol is a potent inhibitor of tumor necrosis factor-alpha (TNF-alpha), interleukin-1beta (IL-1beta) and interleukin-6 (IL-6) release and influenced the mRNA expression levels of these cytokines in a dose-dependent manner. Furthermore, a reporter gene assay for nuclear factor kappa B (NF-kappaB) and an electromobility shift assay (EMSA) demonstrated that gigantol effectively inhibited the activation of NF-kappaB, which is necessary for the expression of iNOS, COX-2, TNF-alpha, IL-1beta and IL-6. Thus, our studies suggest that gigantol inhibits LPS-induced iNOS and COX-2 expression by blocking NF- kappaB activation.
Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K
2010-02-19
The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.
Bannerman, Douglas D; Eiting, Kristine T; Winn, Robert K; Harlan, John M
2004-10-01
Bacterial lipopolysaccharide (LPS) via its activation of Toll-like receptor-4 contributes to much of the vascular injury/dysfunction associated with gram-negative sepsis. Inhibition of de novo gene expression has been shown to sensitize endothelial cells (EC) to LPS-induced apoptosis, the onset of which correlates with decreased expression of FLICE-like inhibitory protein (FLIP). We now have data that conclusively establish a role for FLIP in protecting EC against LPS-induced apoptosis. Overexpression of FLIP protected against LPS-induced apoptosis, whereas down-regulation of FLIP using antisense oligonucleotides sensitized EC to direct LPS killing. Interestingly, FLIP overexpression suppressed NF-kappaB activation induced by LPS, but not by phorbol ester, suggesting a specific role for FLIP in mediating LPS activation. Conversely, mouse embryo fibroblasts (MEF) obtained from FLIP -/- mice showed enhanced LPS-induced NF-kappaB activation relative to those obtained from wild-type mice. Reconstitution of FLIP-/- MEF with full-length FLIP reversed the enhanced NF-kappaB activity elicited by LPS in the FLIP -/- cells. Changes in the expression of FLIP had no demonstrable effect on other known LPS/Tlr-4-activated signaling pathways including the p38, Akt, and Jnk pathways. Together, these data support a dual role for FLIP in mediating LPS-induced apoptosis and NF-kappaB activation.
Watchorn, Tammy M; Dowidar, Nabil; Dejong, Cornelis H C; Waddell, Ian D; Garden, O James; Ross, James A
2005-10-01
A novel proteoglycan, proteolysis inducing factor (PIF), is capable of inducing muscle proteolysis during the process of cancer cachexia, and of inducing an acute phase response in human hepatocytes. We investigated whether PIF is able to activate pro-inflammatory pathways in human Kupffer cells, the resident macrophages of the liver, and in monocytes, resulting in the production of pro-inflammatory cytokines. Normal liver tissue was obtained from patients undergoing partial hepatectomy and Kupffer cells were isolated. Monocytes were isolated from peripheral blood. Following exposure to native PIF, pro-inflammatory cytokine production from Kupffer cells and monocytes was measured and the NF-kappaB and STAT3 transcriptional pathways were investigated using electrophoretic mobility shift assays. We demonstrate that PIF is able to activate the transcription factor NF-kappaB and NF-kappaB-inducible genes in human Kupffer cells, and in monocytes, resulting in the production of pro-inflammatory cytokines such as TNF-alpha, IL-8 and IL-6. PIF enhances the expression of the cell surface molecules LFA-1 and CD14 on macrophages. PIF also activates the transcription factor STAT3 in Kupffer cells. The pro-inflammatory effects of PIF, mediated via NF-kappaB and STAT3, are important in macrophage behaviour and may contribute to the inflammatory pro-cachectic process in the liver.
Duong, Luc; Cheriet, Farida; Labelle, Hubert; Cheung, Kenneth M C; Abel, Mark F; Newton, Peter O; McCall, Richard E; Lenke, Lawrence G; Stokes, Ian A F
2009-08-01
Interobserver and intraobserver reliability study for the identification of the Lenke classification lumbar modifier by a panel of experts compared with a computer algorithm. To measure the variability of the Lenke classification lumbar modifier and determine if computer assistance using 3-dimensional spine models can improve the reliability of classification. The lumbar modifier has been proposed to subclassify Lenke scoliotic curve types into A, B, and C on the basis of the relationship between the central sacral vertical line (CSVL) and the apical lumbar vertebra. Landmarks for identification of the CSVL have not been clearly defined, and the reliability of the actual CSVL position and lumbar modifier selection have never been tested independently. Therefore, the value of the lumbar modifier for curve classification remains unknown. The preoperative radiographs of 68 patients with adolescent idiopathic scoliosis presenting a Lenke type 1 curve were measured manually twice by 6 members of the Scoliosis Research Society 3-dimensional classification committee at 6 months interval. Intraobserver and interobserver reliability was quantified using the percentage of agreement and kappa statistics. In addition, the lumbar curve of all subjects was reconstructed in 3-dimension using a stereoradiographic technique and was submitted to a computer algorithm to infer the lumbar modifier according to measurements from the pedicles. Interobserver rates for the first trial showed a mean kappa value of 0.56. Second trial rates were higher with a mean kappa value of 0.64. Intraobserver rates were evaluated at a mean kappa value of 0.69. The computer algorithm was successful in identifying the lumbar curve type and was in agreement with the observers by a proportion up to 93%. Agreement between and within observers for the Lenke lumbar modifier is only moderate to substantial with manual methods. Computer assistance with 3-dimensional models of the spine has the potential to decrease this variability.
Transient Gene and miRNA Expression Profile Changes of Confluent Human Fibroblast Cells in Space
NASA Technical Reports Server (NTRS)
Zhang, Ye; Lu, Tao; Wong, Michael; Feiveson, Alan; Stodieck, Louis; Karouia, Fathi; Wang, Xiaoyu; Wu, Honglu
2015-01-01
Microgravity or an altered gravity environment from the static 1 gravitational constant has been shown to influence global gene expression patterns and protein levels in cultured cells. However, most of the reported studies conducted in space or using simulated microgravity on the ground have focused on the growth or differentiation of the cells. Whether non-dividing cultured cells will sense the presence of microgravity in space has not been specifically addressed. In an experiment conducted on the International Space Station, confluent human fibroblast cells were fixed after being cultured in space for 3 and 14 days for investigations of gene and miRNA (microRNA) expression profile changes in these cells. A fibroblast is a type of cell that synthesizes the extracellular matrix and collagen, the structural framework for tissues, and plays a critical role in wound healing and other functions. Results of the experiment showed that on Day 3, both the flown and ground cells were still proliferating slowly even though they were confluent, as measured by the expression of the protein Ki-67 positive cells, and the cells in space grew slightly faster. Gene and miRNA expression data indicated activation of NF(sub kappa)B (nuclear factor kappa-light-chain-enhancer of activated B cells) and other growth related pathways involving HGF and VEGF in the flown cells. On Day 14 when the cells were mostly non-dividing, the gene and miRNA expression profiles between the flight and ground samples were indistinguishable. Comparison of gene and miRNA expressions in the Day 3 samples in respect to Day 14 revealed that most of the changes observed on Day 3 were related to cell growth for both the flown and ground cells. Analysis of cytoskeleton changes by immunohistochemistry staining of the cells with antibodies for alpha-tubulin showed no difference between the flight and ground samples. Results of our study suggest that in true non-dividing human fibroblast cells, microgravity in space has little effect on the gene and miRNA expression. Gene and miRNA expression changes were observed in cells that were confluent, but still proliferating slowly. The faster growth in the flown cells was associated with the activation of NF(sub kappa)B pathways which triggers the expression of several growth factors and the suppression of the cell cycle checkpoint.
Genetics Home Reference: familial pityriasis rubra pilaris
... interacting proteins known as nuclear factor-kappa-B (NF-κB). NF-κB regulates the activity of multiple genes, including ... but it is particularly abundant in the skin. NF-κB signaling appears to play an important role ...
Zuckerbraun, Brian S; McCloskey, Carol A; Mahidhara, Raja S; Kim, Peter K M; Taylor, Bradley S; Tzeng, Edith
2003-10-01
Vascular injury and inflammation are associated with elaboration of a number of cytokines that signal through multiple pathways to act as smooth muscle cell (SMC) mitogens. Activation of the nuclear factor-kappa B (NF-kappaB) transcription factor is essential for SMC proliferation in vitro and is activated by vascular injury in vivo. Activation of NF-kappaB is controlled by several upstream regulators, including the inhibitors of kappa B (IkappaB). These proteins bind to and keep NF-kappaB inactivated. The purpose of this study was to determine whether adenoviral gene transfer of a mutated IkappaBalpha super-repressor (AdIkappaBalphaSR) could inhibit development of intimal hyperplasia in vivo and to investigate how over-expression of this construct influences in vitro SMC proliferation and cell cycle regulatory proteins. A rat carotid injury model was used to study prevention of intimal hyperplasia. Arteries were assayed 14 days after injury and infection with AdIkappaBalphaSR or adenoviral beta-galactosidase (AdLacZ). Untreated SMC or SMC infected with AdLacZ or AdIkappaBalphaSR were stimulated with 10% fetal bovine serum, interleukin-1beta, or tumor necrosis factor-alpha. Electrophoretic mobility shift assays were used to assay for NF-kappaB activation. Protein levels of IkappaBalpha and cyclin-dependent kinase inhibitors p21(Cip1/Waf1) and p27(Kip1) were determined with Western blot analysis. Proliferation was measured with (3)H-thymidine incorporation assays. AdIkappaBalphaSR inhibited the development of intimal hyperplasia by 49% (P <.05). Infection with AdIkappaBalphaSR significantly suppressed in vitro SMC proliferation when stimulated with serum, interleukin 1, or tumor necrosis factor alpha, and did not result in cell death. Inhibition of proliferation was associated with increased p21(Cip1/Waf1) and p27(Kip1) protein levels. Gene transfer of IkappaBalpha super-repressor inhibited development of intimal hyperplasia in vivo and SMC proliferation in vitro. The antiproliferative activity may be related to cell cycle arrest through upregulation of the cyclin-dependent kinase inhibitors p21 and p27. Overexpression of IkappaBalpha may be a future therapeutic option in treatment of vascular diseases.
Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jandova, Jana; Janda, Jaroslav; Sligh, James E, E-mail: jsligh@azcc.arizona.edu
We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarraymore » analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear genes associated with tumorigenesis. Black-Right-Pointing-Pointer MMP-9 is up-regulated and Col1a1 is down-regulated in mutant cybrids. Black-Right-Pointing-Pointer GM6001 reduced the enhanced motility of mutant cybrids caused by up-regulated MMP-9. Black-Right-Pointing-Pointer The MMP-9 expression and invasiveness of mutant cybrids were reduced by Bay 11-7802.« less
Gowda, Meghana; Kit, Laura Chang; Stuart Reynolds, W; Wang, Li; Dmochowski, Roger R; Kaufman, Melissa R
2013-10-01
To unify and organize reporting, an International Urogynecological Association (IUGA)/International Continence Society (ICS) expert consortium published terminology guidelines with a classification system for complications related to implants used in female pelvic surgery. We hypothesize that the complexity of the codification system may be a hindrance to precision, especially with decreasing levels of postgraduate expertise. Residents, fellows, and attending physicians were asked to code seven test cases taken from published literature. Category, timing, and site components of the classification system were assessed independently and according to the level of training. Interobserver reliability was calculated as percent agreement and Fleiss' kappa statistic. A total of 24 participants (6 attending physicians, 3 fellows, and 15 residents) were tested. The percent agreement showed significant variation when classified by level of training. In all categories, attending physicians had the greatest percentage agreement and largest kappa. The most agreement was seen when attending physicians classified mesh complications by time, 71% agreement with kappa 0.73 [95% confidence interval (CI) 0.58-0.88]. For the same task, the percentage agreement for fellows was 57%, kappa 0.55 (95% CI 0.23-0.87) and with residents 57%, kappa 0.71([95% CI 0.64-0.78). Interestingly, the site component of the classification system had the least overall agreement and lowest kappa [0%, kappa 0.29 (95% CI 0.26-0.32)] followed by the category component [14%, kappa 0.48 (95% CI 0.46-0.5)]. The IUGA/ICS mesh complication classification system has poor interobserver reliability. This trended downward with decreasing postgraduate level; however, we did not have sufficient statistical power to show an association when stratifying by all training levels. This highlights the complex nature of the classification system in its current form and its limitation for widespread clinical and research application.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kakita, Hiroki; Department of Pediatrics and Neonatology, Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601; Department of Neonatology, Aichi Human Service Center Central Hospital, 713-8 Kamiya-Cho, Kasugai 480-0392
2009-07-01
Recently, the number of reports of encephalitis/encephalopathy associated with influenza virus has increased. In addition, the use of a non-steroidal anti-inflammatory drug, diclofenac sodium (DCF), is associated with a significant increase in the mortality rate of influenza-associated encephalopathy. Activated astrocytes are a source of nitric oxide (NO), which is largely produced by inducible NO synthase (iNOS) in response to proinflammatory cytokines. Therefore, we investigated whether DCF enhances nitric oxide production in astrocytes stimulated with proinflammatory cytokines. We stimulated cultured rat astrocytes with three cytokines, interleukin-1{beta}, tumor necrosis factor-{alpha} and interferon-{gamma}, and then treated the astrocytes with DCF or acetaminophen (N-acetyl-p-aminophenol:more » APAP). iNOS and NO production in astrocyte cultures were induced by proinflammatory cytokines. The addition of DCF augmented NO production, but the addition of APAP did not. NF-{kappa}B inhibitors SN50 and MG132 inhibited iNOS gene expression in cytokine-stimulated astrocytes with or without DCF. Similarly, NF-{kappa}B p65 Stealth small interfering RNA suppressed iNOS gene expression in cytokine-stimulated astrocytes with or without DCF. LDH activity and DAPI staining showed that DCF induces cell damage in cytokine-stimulated astrocytes. An iNOS inhibitor, L-NMMA, inhibited the cytokine- and DCF-induced cell damage. In conclusion, this study demonstrates that iNOS and NO are induced in astrocyte cultures by proinflammatory cytokines. Addition of DCF further augments NO production. This effect is mediated via NF-{kappa}B signaling and leads to cell damage. The enhancement of DCF on NO production may explain the significant increase in the mortality rate of influenza-associated encephalopathy in patients treated with DCF.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jawan, Bruno; Kao, Y.-H.; Department of Biological Sciences, National Sun Yat-Sen University, 70 Lien-Hai Road, Kaohsiung 804, Taiwan
Propofol (PPF), a widely used intravenous anesthetic for induction and maintenance of anesthesia during surgeries, was found to possess suppressive effect on host immunity. This study aimed at investigating whether PPF plays a modulatory role in the lipopolysaccharide (LPS)-induced inflammatory cytokine expression in a cell line of rat hepatocytes. Morphological observation and viability assay showed that PPF exhibits no cytotoxicity at concentrations up to 300 {mu}M after 48 h incubation. Pretreatment with 100 {mu}M PPF for 24 h prior to LPS stimulation was performed to investigate the modulatory effect on LPS-induced inflammatory gene production. The results of semi-quantitative RT-PCR demonstratedmore » that PPF pretreatment significantly suppressed the LPS-induced toll-like receptor (TLR)-4, CD14, tumor necrosis factor (TNF)-{alpha}, and granulocyte-macrophage colony-stimulating factor (GM-CSF) gene expression. Western blotting analysis showed that PPF pretreatment potentiated the LPS-induced TLR-4 downregulation. Flow cytometrical analysis revealed that PPF pretreatment showed no modulatory effect on the LPS-upregulated CD14 expression on hepatocytes. In addition, PPF pretreatment attenuated the phosphorylation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) and I{kappa}B{alpha}, as well as the nuclear translocation of NF-{kappa}B primed by LPS. Moreover, addition of PD98059, a MAPK kinase inhibitor, significantly suppressed the LPS-induced NF-{kappa}B nuclear translocation and GM-CSF production, suggesting that the PPF-attenuated GM-CSF production in hepatocytes may be attributed to its suppressive effect on MAPK/ERK signaling pathway. In conclusion, PPF as an anesthetic may clinically benefit those patients who are vulnerable to sepsis by alleviating sepsis-related inflammatory response in livers.« less
Hemrajani, Cordula; Marches, Olivier; Wiles, Siouxsie; Girard, Francis; Dennis, Alison; Dziva, Francis; Best, Angus; Phillips, Alan D; Berger, Cedric N; Mousnier, Aurelie; Crepin, Valerie F; Kruidenier, Laurens; Woodward, Martin J; Stevens, Mark P; La Ragione, Roberto M; MacDonald, Thomas T; Frankel, Gad
2008-11-01
The human pathogen enterohemorrhagic Escherichia coli (EHEC) O157:H7 colonizes human and animal gut via formation of attaching and effacing lesions. EHEC strains use a type III secretion system to translocate a battery of effector proteins into the mammalian host cell, which subvert diverse signal transduction pathways implicated in actin dynamics, phagocytosis, and innate immunity. The genomes of sequenced EHEC O157:H7 strains contain two copies of the effector protein gene nleH, which share 49% sequence similarity with the gene for the Shigella effector OspG, recently implicated in inhibition of migration of the transcriptional regulator NF-kappaB to the nucleus. In this study we investigated the role of NleH during EHEC O157:H7 infection of calves and lambs. We found that while EHEC DeltanleH colonized the bovine gut more efficiently than the wild-type strain, in lambs the wild-type strain exhibited a competitive advantage over the mutant during mixed infection. Using the mouse pathogen Citrobacter rodentium, which shares many virulence factors with EHEC O157:H7, including NleH, we observed that the wild-type strain exhibited a competitive advantage over the mutant during mixed infection. We found no measurable differences in T-cell infiltration or hyperplasia in colons of mice inoculated with the wild-type or the nleH mutant strain. Using NF-kappaB reporter mice carrying a transgene containing a luciferase reporter driven by three NF-kappaB response elements, we found that NleH causes an increase in NF-kappaB activity in the colonic mucosa. Consistent with this, we found that the nleH mutant triggered a significantly lower tumor necrosis factor alpha response than the wild-type strain.
Postoperative Pain and Analgesia: Is There a Genetic Basis to the Opioid Crisis?
Elmallah, Randa K; Ramkumar, Prem N; Khlopas, Anton; Ramkumar, Rathika R; Chughtai, Morad; Sodhi, Nipun; Sultan, Assem A; Mont, Michael A
2018-06-01
Multiple factors have been implicated in determining why certain patients have increased postoperative pain, with the potential to develop chronic pain. The purpose of this study was to: 1) identify and describe genes that affect postoperative pain perception and control; 2) address modifiable risk factors that result in epigenetic altered responses to pain; and 3) characterize differences in pain sensitivity and thresholds between opioid-naïve and opioid-dependent patients. Three electronic databases were used to conduct the literature search: Pubmed, EBSCO host, and SCOPUS. A total of 372 abstracts were reviewed, of which 46 studies were deemed relevant and are included in this review. Specific gene alterations that were shown to affect postoperative pain control included single nucleotide polymorphisms in the mu, kappa, and delta opioid receptors, ion channel genes, cytotoxic T-cells, glutamate receptors and cytokine genes, among others. Alcoholism, obesity, and smoking were all linked with genetic polymorphisms that altered pain sensitivity. Opioid abuse was found to be associated with a poorer response to analgesics postoperatively, as well as a risk for prescription overdose. Although pain perception has multiple complex influences, the greatest variability seen in response to opioids among postoperative patients known to date can be traced to genetic differences in opioid metabolism. Further study is needed to determine the clinical significance of these genetic associations.
Understanding the Delay in Onset of Paget’s Disease of Bone
2014-09-01
Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C
Varela, Gonzalo; Jiménez, Marcelo F; Novoa, Nuria Maria; Aranda, José Luis
2009-01-01
Since there are no data in the literature regarding variability in the management of postoperative pleural drainages, we have designed a prospective randomized study aimed at measuring inter-observer variability in deciding when to withdraw chest tubes after lung resection and to evaluate if the use of an electronic device to measure postoperative air leak decreases clinical practice variations. Sixty-one patients undergoing pulmonary resection were randomly assigned to one of the following groups: digital group (electronic measure of pleural air leak using Millicore AB DigiVent chest drainage system) or traditional group (standard water seal pleural chamber). Chest tube withdrawal criteria were established in advance. During morning rounds, two thoracic surgeons with comparable clinical experience and blinded to the decision of their counterpart, evaluated chest tube withdrawal criteria and noted whether the tube should be withdrawn or not. Inter-observer variability kappa index and global, positive, and negative agreement rates were calculated on 2 x 2 tables. Each observation episode was considered in the calculation. Fifty-four observations were recorded in the traditional group. Kappa coefficient was 0.37 (overall agreement rate: 0.58; positive agreement rate: 0.72; and negative agreement rate: 0.64). In the digital group, 67 observations were recorded. Kappa coefficient was 0.88 (overall agreement rate: 0.94; positive agreement rate 0.94; and negative agreement rate 0.94). We have demonstrated a high rate of disagreement related to the indication to remove chest tubes after lung resection and the improvement of the agreement rate with the use of an electronic device to measure postoperative air leak and pleural pressures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biasi, Glenn; Anderson, John G
The parameter kappa was defined by Anderson and Hough (1984) to describe the high-frequency spectral roll-off of the strong motion seismic spectrum. In the work of Su et al., (1996) the numerical value of kappa estimated for sites near Yucca Mountain was small (~20 ms). The estimate obtained from these events has been applied through a rigorous methodology to develop design earthquake spectra with magnitude over 5.0. Smaller values of kappa lead to higher estimated ground motions in the methodology used by the Probabilistic Seismic Hazard Analysis (PSHA) for Yucca Mountain. An increase of 10 ms in kappa could resultmore » in a substantial decrease in the high frequency level of the predicted ground motions. Any parameter that plays such a critical role deserves close examination. Here, we study kappa and its associated uncertainties. The data set used by Su et al (1996) consisted of 12 M 2.8 to 4.5 earthquakes recorded at temporary stations deployed after the June 1992 Little Skull Mountain earthquake. The kappa elements of that study were revisited by Anderson and Su (MOL.20071203.0134) and substantially confirmed. One weakness of those studies is the limited data used. Few of these stations were on tuff or on Yucca Mountain itself. A decade of Southern Great Basin Digital Seismic Network (SGBDSN) recording has now yielded a larger body of on-scale, well calibrated digital ground motion records suitable for investigating kappa. We use the SGBDSN data to check some of the original assumptions, improve the statistical confidence of the conclusions, and determine values of kappa for stations on or near Yucca Mountain. The outstanding issues in kappa analysis, as they apply to Yucca Mountain, include: 1. The number itself. The kappa estimate near 20 msec from Su et al. (1996) and Anderson and Su (MOL.20071203.0134) is markedly smaller than is considered typical in California (Silva, 1995). The low kappa value has engineering consequences because when it is applied in ground motions analyses used in PSHA, it contributes to the extreme values of peak ground acceleration that the PSHA predicts. Also, in some areas precarious rock evidence indicates that no such accelerations have occurred. 2. The disagreement among analyses in the value of kappa. Previous reports indicate that smallest earthquakes yield kappa estimate 12-20 msec larger than average values from M3 to M4.5 aftershocks of Little Skull Mountain earthquake. 3. The source of kappa. Classically and in engineering usage, kappa is attributed largely to the upper tens or hundreds of meters at the recording site. However, borehole recordings imply that a significant contribution to kappa originates below several hundred meters depth. Also, when earthquakes are considered from a small source region, a true site effect should be common to all recordings. In fact kappa observations of LSM aftershocks to stations on Yucca Mountain and at network stations appear to vary greatly, as though much of kappa actually derives from near the seismic source. 4. The repository overburden contribution to kappa. PSHA estimated ground motions to a free surface at 300 meters depth with properties of confined rock at that depth. Rock mechanical and borehole estimates suggest that several milliseconds of the total kappa accrue between 300 meters to the surface. If estimates of kappa are small at the surface, little is left to reduce incident ground accelerations from the seismic source to the repository level. 5. The variability of kappa. In most cases parametric estimates of kappa have some range of values that fit the data equally well in a statistical sense, so errors in kappa estimates must be addressed. As noted above, kappa at a station also varies significantly for events from the same source area. 6. Are kappa values from small to moderate magnitude earthquakes appropriately applied to the larger, potentially damaging earthquakes of engineering concern? Put another way, is there a significant magnitude dependence in kappa? Questions 1 and 6 are of primary importance, but we find answers to several others in the course of our study. Data from southern Nevada are capable of resolving only some of these questions. In a global search, we identified data from the Japanese borehole accelerometer array KiKNet as most likely to address the questions of the shallow site structural contribution to kappa and the usefulness of moderate earthquake kappa estimates to predict strong ground motion.« less
Mindorff, Elizabeth N; O'Keefe, David D; Labbé, Alain; Yang, Jennie Ping; Ou, Yimiao; Yoshikawa, Shingo; van Meyel, Donald J
2007-08-01
To identify novel regulators of nervous system development, we used the GAL4-UAS misexpression system in Drosophila to screen for genes that influence axon guidance in developing embryos. We mobilized the Gene Search (GS) P element and identified 42 lines with insertions in unique loci, including leak/roundabout2, which encodes an axon guidance receptor and confirms the utility of our screen. The genes we identified encode proteins of diverse classes, some acting near the cell surface and others in the cytoplasm or nucleus. We found that one GS line drove misexpression of the NF-kappaB transcription factor Dorsal, causing motor axons to bypass their correct termination sites. In the developing visual system, Dorsal misexpression also caused photoreceptor axons to reach incorrect positions within the optic lobe. This mistargeting occurred without observable changes of cell fate and correlated with localization of ectopic Dorsal in distal axons. We found that Dorsal and its inhibitor Cactus are expressed in photoreceptors, though neither was required for axon targeting. However, mutation analyses of genes known to act upstream of Dorsal revealed a requirement for the interleukin receptor-associated kinase family kinase Pelle for layer-specific targeting of photoreceptor axons, validating our screen as a means to identify new molecular determinants of nervous system development in vivo.
Altavilla, D; Squadrito, F; Bitto, A; Polito, F; Burnett, B P; Di Stefano, V; Minutoli, L
2009-08-01
The flavonoids, baicalin and catechin, from Scutellaria baicalensis and Acacia catechu, respectively, have been used for various clinical applications. Flavocoxid is a mixed extract containing baicalin and catechin, and acts as a dual inhibitor of cyclooxygenase (COX) and 5-lipoxygenase (LOX) enzymes. The anti-inflammatory activity, measured by protein and gene expression of inflammatory markers, of flavocoxid in rat peritoneal macrophages stimulated with Salmonella enteritidis lipopolysaccharide (LPS) was investigated. LPS-stimulated (1 microg.mL(-1)) peritoneal rat macrophages were co-incubated with different concentrations of flavocoxid (32-128 microg.mL(-1)) or RPMI medium for different incubation times. Inducible COX-2, 5-LOX, inducible nitric oxide synthase (iNOS) and inhibitory protein kappaB-alpha (IkappaB-alpha) levels were evaluated by Western blot analysis. Nuclear factor kappaB (NF-kappaB) binding activity was investigated by electrophoretic mobility shift assay. Tumour necrosis factor-alpha (TNF-alpha) gene and protein expression were measured by real-time polymerase chain reaction and enzyme-linked immunosorbent assay respectively. Finally, malondialdehyde (MDA) and nitrite levels in macrophage supernatants were evaluated. LPS stimulation induced a pro-inflammatory phenotype in rat peritoneal macrophages. Flavocoxid (128 microg.mL(-1)) significantly inhibited COX-2 (LPS = 18 +/- 2.1; flavocoxid = 3.8 +/- 0.9 integrated intensity), 5-LOX (LPS = 20 +/- 3.8; flavocoxid = 3.1 +/- 0.8 integrated intensity) and iNOS expression (LPS = 15 +/- 1.1; flavocoxid = 4.1 +/- 0.4 integrated intensity), but did not modify COX-1 expression. PGE(2) and LTB(4) levels in culture supernatants were consequently decreased. Flavocoxid also prevented the loss of IkappaB-alpha protein (LPS = 1.9 +/- 0.2; flavocoxid = 7.2 +/- 1.6 integrated intensity), blunted increased NF-kappaB binding activity (LPS = 9.2 +/- 2; flavocoxid = 2.4 +/- 0.7 integrated intensity) and the enhanced TNF-alpha mRNA levels (LPS = 8 +/- 0.9; flavocoxid = 1.9 +/- 0.8 n-fold/beta-actin) induced by LPS. Finally, flavocoxid decreased MDA, TNF and nitrite levels from LPS-stimulated macrophages. Flavocoxid might be useful as a potential anti-inflammatory agent, acting at the level of gene and protein expression.
Test-retest reliability of the Military Pre-training Questionnaire.
Robinson, M; Stokes, K; Bilzon, J; Standage, M; Brown, P; Thompson, D
2010-09-01
Musculoskeletal injuries are a significant cause of morbidity during military training. A brief, inexpensive and user-friendly tool that demonstrates reliability and validity is warranted to effectively monitor the relationship between multiple predictor variables and injury incidence in military populations. To examine the test-retest reliability of the Military Pre-training Questionnaire (MPQ), designed specifically to assess risk factors for injury among military trainees across five domains (physical activity, injury history, diet, alcohol and smoking). Analyses were based on a convenience sample of 58 male British Army trainees. Kappa (kappa), weighted kappa (kappa(w)) and intraclass correlation coefficients (ICC) were used to evaluate the 2-week test-retest reliability of the MPQ. For index measures constituting the assessment of a given construct, internal consistency was assessed by Cronbach's alpha (alpha) coefficients. Reliability of individual items ranged from poor to almost perfect (kappa range = 0.45-0.86; kappa(w) range = 0.11-0.91; ICC range = 0.34-0.86) with most items demonstrating moderate reliability. Overall scores related to physical activity, diet, alcohol and smoking constructs were reliable between both administrations (ICC = 0.63-0.85). Support for the internal consistency of the incorporated alcohol (alpha = 0.78) and cigarette (alpha = 0.75) scales was also provided. The MPQ is a reliable self-report instrument for assessing multiple injury-related risk factors during initial military training. Further assessment of the psychometric properties of the MPQ (e.g. different types of validity) with military populations/samples will support its interpretation and use in future surveillance and epidemiological studies.
Lai, Jeffrey K C; Robertson, Patricia L; Goh, Christine; Szer, Jeff
2018-02-01
To evaluate the intraobserver and interobserver agreement for bone marrow burden (BMB) scores for individual examinations and for the change in BMB score over time in the same patient. A total of 119 sets of MR images of the lumbar spine and femora from 60 patients with Gaucher disease were included. Each set of MR images was scored using the BMB score independently by two experienced MSK radiologists. One radiologist performed a second read four weeks later. Intraobserver and interobserver agreement was assessed using Bland-Altman analysis and weighted kappa scores. BMB scores (n=119) demonstrated fair intraobserver agreement (weighted kappa=0.53) with a mean difference of -0.20 and 95% limits of agreement (LOA) of (-3.41, 3.01). Inter observer agreement was poor with weighted kappa 0.28 with mean difference of -0.16 and 95% LOA of (-4.45, 4.11). Change in BMB scores over time (n=59) demonstrated poor/fair intraobserver agreement (weighted kappa 0.41, mean difference-0.20 and 95% LOA (-4.35, 3.94)). Interobserver agreement was poor (weighted kappa 0.25, mean difference -0.12 with wide 95% LOA (-6.23, 5.99)). Significant interobserver, and to a lesser extent intraobserver, variation occurs with blinded BMB scoring of Gaucher disease. Copyright © 2016 Elsevier Inc. All rights reserved.
Csaki, Constanze; Mobasheri, Ali; Shakibaei, Mehdi
2009-01-01
Currently available treatments for osteoarthritis (OA) are restricted to nonsteroidal anti-inflammatory drugs, which exhibit numerous side effects and are only temporarily effective. Thus novel, safe and more efficacious anti-inflammatory agents are needed for OA. Naturally occurring polyphenolic compounds, such as curcumin and resveratrol, are potent agents for modulating inflammation. Both compounds mediate their effects by targeting the NF-kappaB signalling pathway. We have recently demonstrated that in chondrocytes resveratrol modulates the NF-kappaB pathway by inhibiting the proteasome, while curcumin modulates the activation of NF-kappaB by inhibiting upstream kinases (Akt). However, the combinational effects of these compounds in chondrocytes has not been studied and/or compared with their individual effects. The aim of this study was to investigate the potential synergistic effects of curcumin and resveratrol on IL-1beta-stimulated human chondrocytes in vitro using immunoblotting and electron microscopy. Treatment with curcumin and resveratrol suppressed NF-kappaB-regulated gene products involved in inflammation (cyclooxygenase-2, matrix metalloproteinase (MMP)-3, MMP-9, vascular endothelial growth factor), inhibited apoptosis (Bcl-2, Bcl-xL, and TNF-alpha receptor-associated factor 1) and prevented activation of caspase-3. IL-1beta-induced NF-kappaB activation was suppressed directly by cocktails of curcumin and resveratrol through inhibition of Ikappakappa and proteasome activation, inhibition of IkappaBalpha phosphorylation and degradation, and inhibition of nuclear translocation of NF-kappaB. The modulatory effects of curcumin and resveratrol on IL-1beta-induced expression of cartilage specific matrix and proinflammatory enzymes were mediated in part by the cartilage-specific transcription factor Sox-9. We propose that combining these natural compounds may be a useful strategy in OA therapy as compared with separate treatment with each individual compound.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Jianmin; Walsh, Stephanie B.; Verney, Zoe M.
Research highlights: {yields} Organ transplant recipients are highly susceptible to early skin cancer development. {yields} CsA-mediated TGFB1-dependent TAK1/TAB1 signaling augments invasive tumor growth. {yields} CsA enhances accumulation of upstream kinases, ZMP, AMPK and IRAK to activate TAK1. {yields} TAK1 mediates enhanced proliferation and reduced apoptosis via CsA-dependent NF{kappa}B. -- Abstract: Cyclosporine A (CsA) is an immunosuppressive drug commonly used for maintaining chronic immune suppression in organ transplant recipients. It is known that patients receiving CsA manifest increased growth of aggressive non-melanoma skin cancers. However, the underlying mechanism by which CsA augments tumor growth is not fully understood. Here, we showmore » that CsA augments the growth of A431 epidermoid carcinoma xenograft tumors by activating tumor growth factor {beta}-activated kinase1 (TAK1). The activation of TAK1 by CsA occurs at multiple levels by kinases ZMP, AMPK and IRAK. TAK1 forms heterodimeric complexes with TAK binding protein 1 and 2 (TAB1/TAB2) which in term activate nuclear factor {kappa}B (NF{kappa}B) and p38 MAP kinase. Transcriptional activation of NF{kappa}B is evidenced by IKK{beta}-mediated phosphorylation-dependent degradation of I{kappa}B and consequent nuclear translocation of p65. This also leads to enhancement in the expression of its transcriptional target genes cyclin D1, Bcl2 and COX-2. Similarly, activation of p38 leads to enhanced inflammation-related signaling shown by increased phosphorylation of MAPKAPK2 and which in turn phosphorylates its substrate HSP27. Activation of both NF{kappa}B and p38 MAP kinase provide mitogenic stimuli to augment the growth of SCCs.« less
Human immunodeficiency virus type 1 Nef protein inhibits NF-kappa B induction in human T cells.
Niederman, T M; Garcia, J V; Hastings, W R; Luria, S; Ratner, L
1992-01-01
Human immunodeficiency virus type 1 (HIV-1) can establish a persistent and latent infection in CD4+ T lymphocytes (W. C. Greene, N. Engl. J. Med. 324:308-317, 1991; S. M. Schnittman, M. C. Psallidopoulos, H. C. Lane, L. Thompson, M. Baseler, F. Massari, C. H. Fox, N. P. Salzman, and A. S. Fauci, Science 245:305-308, 1989). Production of HIV-1 from latently infected cells requires host cell activation by T-cell mitogens (T. Folks, D. M. Powell, M. M. Lightfoote, S. Benn, M. A. Martin, and A. S. Fauci, Science 231:600-602, 1986; D. Zagury, J. Bernard, R. Leonard, R. Cheynier, M. Feldman, P. S. Sarin, and R. C. Gallo, Science 231:850-853, 1986). This activation is mediated by the host transcription factor NF-kappa B [G. Nabel and D. Baltimore, Nature (London) 326:711-717, 1987]. We report here that the HIV-1-encoded Nef protein inhibits the induction of NF-kappa B DNA-binding activity by T-cell mitogens. However, Nef does not affect the DNA-binding activity of other transcription factors implicated in HIV-1 regulation, including SP-1, USF, URS, and NF-AT. Additionally, Nef inhibits the induction of HIV-1- and interleukin 2-directed gene expression, and the effect on HIV-1 transcription depends on an intact NF-kappa B-binding site. These results indicate that defective recruitment of NF-kappa B may underlie Nef's negative transcriptional effects on the HIV-1 and interleukin 2 promoters. Further evidence suggests that Nef inhibits NF-kappa B induction by interfering with a signal derived from the T-cell receptor complex. Images PMID:1527859
Liu, Saixi; Shi, Wei; Guo, Cheng; Zhao, Xinguo; Han, Yu; Peng, Chao; Chai, Xueliang; Liu, Guangxu
2016-07-01
The impact of pCO2 driven ocean acidification on marine bivalve immunity remains poorly understood. To date, this impact has only been investigated in a few bivalve species and the underlying molecular mechanism remains unknown. In the present study, the effects of the realistic future ocean pCO2 levels (pH at 8.1, 7.8, and 7.4) on the total number of haemocyte cells (THC), phagocytosis status, blood cell types composition, and expression levels of twelve genes from the NF-kappa β signaling and toll-like receptor pathways of a typical bottom burrowing bivalve, blood clam (Tegillarca granosa), were investigated. The results obtained showed that while both THC number and phagocytosis frequency were significantly reduced, the percentage of red and basophil granulocytes were significantly decreased and increased, respectively, upon exposure to elevated pCO2. In addition, exposure to pCO2 acidified seawater generally led to a significant down-regulation in the inducer and key response genes of NF-kappa β signaling and toll-like receptor pathways. The results of the present study revealed that ocean acidification may hamper immune responses of the bivalve T. granosa which subsequently render individuals more susceptible to pathogens attacks such as those from virus and bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Jenkins, G J S; Cronin, J; Alhamdani, A; Rawat, N; D'Souza, F; Thomas, T; Eltahir, Z; Griffiths, A P; Baxter, J N
2008-09-01
Deoxycholic acid (DCA) is a secondary bile acid implicated in various cancers of the gastrointestinal (GI) tract. In oesophageal adenocarcinoma, DCA is believed to contribute to carcinogenesis during reflux where stomach contents enter the lower oesophagus. It is imperative that we understand the mechanisms whereby oesophageal carcinogens function in order that therapeutic options may be developed. We have previously shown that DCA can damage chromosomes and does so through its generation of reactive oxygen species (ROS). We show here, after detailed experiments, that DCA appears to have a non-linear dose response for DNA damage. DCA induces DNA damage (as measured by the micronucleus assay) at doses of 100 microM and higher in oesophageal OE33 cells, but fails to induce such DNA damage below this cut-off dose. We also show that in terms of NF-kappaB activation (as measured by up-regulation of two NF-kappaB target genes) by DCA, a similar dose response is observed. This dose-response data may be important clinically as DCA exposure to the oesophagus may be used as a way to identify the 10% of Barrett's oesophagus patients currently progressing to cancer from the 90% of patients who do not progress. Only quantitative studies measuring DCA concentrations in refluxates correlated with histological progression will answer this question. We further show here that ROS are behind DCAs ability to activate NF-kappaB as antioxidants (epigallocatechin gallate, resveratrol and vitamin C) abrogate DCAs ability to up-regulate NF-kappaB-controlled genes. In conclusion, low doses of DCA appear to be less biologically significant in vitro. If this were to be confirmed in vivo, it might suggest that reflux patients with low DCA concentrations may be at a lower risk of cancer progression compared to patients with high levels of DCA in their refluxate. Either way, antioxidant supplementation may possibly help prevent the deleterious effects of DCA in the whole GI tract.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dambach, Donna M.; Pharmaceutical Research Institute, Bristol-Myers Squibb, Princeton, NJ 08543; Durham, Stephen K.
2006-03-01
Oxidative stress plays an important role in acetaminophen (APAP)-induced hepatotoxicity. In addition to inducing direct cellular damage, oxidants can activate transcription factors including NF-{kappa}B, which regulate the production of inflammatory mediators implicated in hepatotoxicity. Here, we investigated the role of APAP-induced oxidative stress and NF-{kappa}B in inflammatory mediator production. Treatment of mice with APAP (300 mg/kg, i.p.) resulted in centrilobular hepatic necrosis and increased serum aminotransferase levels. This was correlated with depletion of hepatic glutathione and CuZn superoxide dismutase (SOD). APAP administration also increased expression of the proinflammatory mediators, interleukin-1{beta} (IL-1{beta}), tumor necrosis factor-{alpha} (TNF{alpha}), macrophage chemotactic protein-1 (MCP-1), andmore » KC/gro, and the anti-inflammatory cytokine, interleukin-10 (IL-10). Pretreatment of mice with the antioxidant, N-acetylcysteine (NAC) prevented APAP-induced depletion of glutathione and CuZnSOD, as well as hepatotoxicity. NAC also abrogated APAP-induced increases in TNF{alpha}, KC/gro, and IL-10, but augmented expression of the anti-inflammatory cytokines interleukin-4 (IL-4) and transforming growth factor-{beta} (TGF{beta}). No effects were observed on IL-1{beta} or MCP-1 expression. To determine if NF-{kappa}B plays a role in regulating mediator production, we used transgenic mice with a targeted disruption of the gene for NF-{kappa}B p50. As observed with NAC pretreatment, the loss of NF-{kappa}B p50 was associated with decreased ability of APAP to upregulate TNF{alpha}, KC/gro, and IL-10 expression and increased expression of IL-4 and TGF{beta}. However, in contrast to NAC pretreatment, the loss of p50 had no effect on APAP-induced hepatotoxicity. These data demonstrate that APAP-induced cytokine expression in the liver is influenced by oxidative stress and that this is dependent, in part, on NF-{kappa}B. However, NF-{kappa}B p50-dependent responses do not appear to play a major role in the pathogenesis of toxicity in this model.« less
Zinc triggers microglial activation.
Kauppinen, Tiina M; Higashi, Youichirou; Suh, Sang Won; Escartin, Carole; Nagasawa, Kazuki; Swanson, Raymond A
2008-05-28
Microglia are resident immune cells of the CNS. When stimulated by infection, tissue injury, or other signals, microglia assume an activated, "ameboid" morphology and release matrix metalloproteinases, reactive oxygen species, and other proinflammatory factors. This innate immune response augments host defenses, but it can also contribute to neuronal death. Zinc is released by neurons under several conditions in which microglial activation occurs, and zinc chelators can reduce neuronal death in animal models of cerebral ischemia and neurodegenerative disorders. Here, we show that zinc directly triggers microglial activation. Microglia transfected with a nuclear factor-kappaB (NF-kappaB) reporter gene showed a severalfold increase in NF-kappaB activity in response to 30 microm zinc. Cultured mouse microglia exposed to 15-30 microm zinc increased nitric oxide production, increased F4/80 expression, altered cytokine expression, and assumed the activated morphology. Zinc-induced microglial activation was blocked by inhibiting NADPH oxidase, poly(ADP-ribose) polymerase-1 (PARP-1), or NF-kappaB activation. Zinc injected directly into mouse brain induced microglial activation in wild-type mice, but not in mice genetically lacking PARP-1 or NADPH oxidase activity. Endogenous zinc release, induced by cerebral ischemia-reperfusion, likewise induced a robust microglial reaction, and this reaction was suppressed by the zinc chelator CaEDTA. Together, these results suggest that extracellular zinc triggers microglial activation through the sequential activation of NADPH oxidase, PARP-1, and NF-kappaB. These findings identify a novel trigger for microglial activation and a previously unrecognized mechanism by which zinc may contribute to neurological disorders.
2014-01-01
Background The resistance of cancerous cells to chemotherapy remains the main limitation for cancer treatment at present. Doxorubicin (DOX) is a potent antitumor drug that activates the ubiquitin-proteasome system, but unfortunately it also activates the Nuclear factor kappa B (NF-кB) pathway leading to the promotion of tumor cell survival. MG132 is a drug that inhibits I kappa B degradation by the proteasome-avoiding activation of NF-кB. In this work, we studied the sensitizing effect of the MG132 proteasome inhibitor on the antitumor activity of DOX. Methods U937 human leukemia cells were treated with MG132, DOX, or both drugs. We evaluated proliferation, viability, apoptosis, caspase-3, -8, and −9 activity and cleavage, cytochrome c release, mitochondrial membrane potential, the Bcl-2 and Bcl-XL antiapoptotic proteins, senescence, p65 phosphorylation, and pro- and antiapoptotic genes. Results The greatest apoptosis percentage in U937 cells was obtained with a combination of MG132 + DOX. Likewise, employing both drugs, we observed a decrease in tumor cell proliferation and important caspase-3 activation, as well as mitochondrial membrane potential loss. Therefore, MG132 decreases senescence, p65 phosphorylation, and the DOX-induced Bcl-2 antiapoptotic protein. The MG132 + DOX treatment induced upregulation of proapoptotic genes BAX, DIABLO, NOXA, DR4, and FAS. It also induced downregulation of the antiapoptotic genes BCL-XL and SURVIVIN. Conclusion MG132 sensitizes U937 leukemia cells to DOX-induced apoptosis, increasing its anti-leukemic effectiveness. PMID:24495648
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huber, M. Q.; Alkofer, R.; Sorella, S. P.
2010-03-15
The low momentum behavior of the Landau gauge Gribov-Zwanziger action is investigated using the respective Dyson-Schwinger equations. Because of the mixing of the gluon and the auxiliary fields four scenarios can be distinguished for the infrared behavior. Two of them lead to inconsistencies and can be discarded. Another one corresponds to the case where the auxiliary fields behave exactly like the Faddeev-Popov ghosts and the same scaling relation as in standard Landau gauge, {kappa}{sub A}+2{kappa}{sub c}=0, is valid. Even the parameter {kappa} is found to be the same, 0.595. The mixed propagators, which appear, are suppressed in all loops, andmore » their anomalous infrared exponent can also be determined. A fourth case provides an even stricter scaling relation that includes also the mixed propagators, but possesses the same qualitative feature, i.e. the propagators of the Faddeev-Popov ghost and the auxiliary fields are infrared enhanced and the mixed and the gluon propagators are infrared suppressed. In this case the system of equations to obtain the parameter {kappa} is nonlinear in all variables.« less
The Th and U abundances in chondritic meteorites
NASA Technical Reports Server (NTRS)
Chen, J. H.; Wasserburg, G. J.; Papanastassiou, D. A.
1993-01-01
We present new analyses of Th-232/U-238 in CI and CM meteorites. The relative abundance of these nuclides is important in estimates of the age of r-process elements. The cosmochronology based upon the Th-232/U-238 ratio (kappa) depends on the precise determinations of these two different elements in meteorites and on the production ratios. Both parameters are subject to substantial errors. Recent recalculations of this chronology have used selected values from compilations but do not adequately address the errors in terms of a reliable data base. Morgan and Lovering provided extensive neutron activation analyses for ordinary chondrites which yield an average kappa of 3.6 +/- 0.4. Their work on carbonaceous chondrites showed a wide range in kappa from 2 to 6. More recent investigations by isotopic dilution have established the following: (1) highly variable kappa from 2.7 to 11 in Allende Ca-Al-rich inclusions and a value of 3.6 in the Orgueil CI1 chondrite; (2) a range from 2.71 to 6.63 for 7 L-type chondrites and a range from 2.7 to 4.4 for 6 L, H, and LL chondrites. A further investigation of this subject matter is presented.
A description of sleep behaviour in healthy late pregnancy, and the accuracy of self-reports.
McIntyre, Jordan P R; Ingham, Cayley M; Hutchinson, B Lynne; Thompson, John M D; McCowan, Lesley M; Stone, Peter R; Veale, Andrew G; Cronin, Robin; Stewart, Alistair W; Ellyett, Kevin M; Mitchell, Edwin A
2016-05-18
The importance of maternal sleep and its contribution to maternal and fetal health during pregnancy is increasingly being recognised. However, the ability to accurately recall sleep practices during pregnancy has been questioned. The aim of this study is to test the accuracy of recall of normal sleep practices in late pregnancy. Thirty healthy women between 35 and 38 weeks of gestation underwent level III respiratory polysomnography (PSG) with infrared digital video recordings in their own homes. Data regarding sleep positions, number of times getting out of bed during the night and respiratory measures were collected. A sleep questionnaire was administered the morning after the recorded sleep. Continuous data were assessed using Spearman's Rho and Bland-Altman. Cohen's Kappa was used to assess recall in the categorical variables. Two-thirds of participants went to sleep on their left side. There was good agreement in sleep onset position between video and questionnaire data (Kappa 0.52), however the there was poor agreement on position on wakening (Kappa 0.24). The number of times getting out of bed during the night was accurately recalled (Kappa 0.65). Twenty five out of 30 participants snored as recorded by PSG. Questionnaire data was inaccurate for this measure. Bland-Altman plots demonstrated acceptable agreement between video and questionnaire data for estimated sleep duration, but not the time taken to fall asleep (sleep latency). One participant had mild obstructive sleep apnoea and another probable high upper airways resistance. Sleep onset position, sleep duration and the number of times getting out of bed during the night were accurately recalled, but sleep latency and sleep position on waking were not. This study identifies the sleep variables that can be accurately obtained by questionnaire and those that cannot.
Capellades, J; Teixidor, P; Villalba, G; Hostalot, C; Plans, G; Armengol, R; Medrano, S; Estival, A; Luque, R; Gonzalez, S; Gil-Gil, M; Villa, S; Sepulveda, J; García-Mosquera, J J; Balana, C
2017-06-01
We assessed agreement among neurosurgeons on surgical approaches to individual glioblastoma patients and between their approach and those recommended by the topographical staging system described by Shinoda. Five neurosurgeons were provided with pre-surgical MRIs of 76 patients. They selected the surgical approach [biopsy, partial resection, or gross total resection (GTR)] that they would recommend for each patient. They were blinded to each other's response and they were told that patients were younger than 50 years old and without symptoms. Three neuroradiologists classified each case according to the Shinoda staging system. Biopsy was recommended in 35.5-82.9%, partial resection in 6.6-32.9%, and GTR in 3.9-31.6% of cases. Agreement among their responses was fair (global kappa = 0.28). Nineteen patients were classified as stage I, 14 as stage II, and 43 as stage III. Agreement between the neurosurgeons and the recommendations of the staging system was poor for stage I (kappa = 0.14) and stage II (kappa = 0.02) and fair for stage III patients (kappa = 0.29). An individual analysis revealed that in contrast to the Shinoda system, neurosurgeons took into account T2/FLAIR sequences and gave greater weight to the involvement of eloquent areas. The surgical approach to glioblastoma is highly variable. A staging system could be used to examine the impact of extent of resection, monitor post-operative complications, and stratify patients in clinical trials. Our findings suggest that the Shinoda staging system could be improved by including T2/FLAIR sequences and a more adequate weighting of eloquent areas.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hayakawa, Kunihiro; Hiramatsu, Nobuhiko; Okamura, Maro
2008-01-04
Geranylgeranylacetone (GGA), an anti-ulcer agent, has anti-inflammatory potential against experimental colitis and ischemia-induced renal inflammation. However, molecular mechanisms involved in its anti-inflammatory effects are largely unknown. We found that, in glomerular mesangial cells, GGA blocked activation of nuclear factor-{kappa}B and consequent induction of monocyte chemoattractant protein 1 (MCP-1) by inflammatory cytokines. It was inversely correlated with induction of unfolded protein response (UPR) evidenced by expression of 78 kDa glucose-regulated protein (GRP78) and suppression of endoplasmic reticulum stress-responsive alkaline phosphatase. Various inducers of UPR including tunicamycin, thapsigargin, A23187, 2-deoxyglucose, dithiothreitol, and AB{sub 5} subtilase cytotoxin reproduced the suppressive effects of GGA.more » Furthermore, attenuation of UPR by stable transfection with GRP78 diminished the anti-inflammatory effects of GGA. These results disclosed a novel, UPR-dependent mechanism underlying the anti-inflammatory potential of GGA.« less
VISA is an adapter protein required for virus-triggered IFN-beta signaling.
Xu, Liang-Guo; Wang, Yan-Yi; Han, Ke-Jun; Li, Lian-Yun; Zhai, Zhonghe; Shu, Hong-Bing
2005-09-16
Viral infection or stimulation of TLR3 triggers signaling cascades, leading to activation of the transcription factors IRF-3 and NF-kappaB, which collaborate to induce transcription of type I interferon (IFN) genes. In this study, we identified a protein termed VISA (for virus-induced signaling adaptor) as a critical component in the IFN-beta signaling pathways. VISA recruits IRF-3 to the cytoplasmic viral dsRNA sensor RIG-I. Depletion of VISA inhibits virus-triggered and RIG-I-mediated activation of IRF-3, NF-kappaB, and the IFN-beta promoter, suggesting that VISA plays a central role in virus-triggered TLR3-independent IFN-beta signaling. Our data also indicate that VISA interacts with TRIF and TRAF6 and mediates bifurcation of the TLR3-triggered NF-kappaB and IRF-3 activation pathways. These findings suggest that VISA is critically involved in both virus-triggered TLR3-independent and TLR3-mediated antiviral IFN signaling.
Generation and analysis of the improved human HAL9/10 antibody phage display libraries.
Kügler, Jonas; Wilke, Sonja; Meier, Doris; Tomszak, Florian; Frenzel, André; Schirrmann, Thomas; Dübel, Stefan; Garritsen, Henk; Hock, Björn; Toleikis, Lars; Schütte, Mark; Hust, Michael
2015-02-19
Antibody phage display is a proven key technology that allows the generation of human antibodies for diagnostics and therapy. From naive antibody gene libraries - in theory - antibodies against any target can be selected. Here we describe the design, construction and characterization of an optimized antibody phage display library. The naive antibody gene libraries HAL9 and HAL10, with a combined theoretical diversity of 1.5×10(10) independent clones, were constructed from 98 healthy donors using improved phage display vectors. In detail, most common phagemids employed for antibody phage display are using a combined His/Myc tag for detection and purification. We show that changing the tag order to Myc/His improved the production of soluble antibodies, but did not affect antibody phage display. For several published antibody libraries, the selected number of kappa scFvs were lower compared to lambda scFvs, probably due to a lower kappa scFv or Fab expression rate. Deletion of a phenylalanine at the end of the CL linker sequence in our new phagemid design increased scFv production rate and frequency of selected kappa antibodies significantly. The HAL libraries and 834 antibodies selected against 121 targets were analyzed regarding the used germline V-genes, used V-gene combinations and CDR-H3/-L3 length and composition. The amino acid diversity and distribution in the CDR-H3 of the initial library was retrieved in the CDR-H3 of selected antibodies showing that all CDR-H3 amino acids occurring in the human antibody repertoire can be functionally used and is not biased by E. coli expression or phage selection. Further, the data underline the importance of CDR length variations. The highly diverse universal antibody gene libraries HAL9/10 were constructed using an optimized scFv phagemid vector design. Analysis of selected antibodies revealed that the complete amino acid diversity in the CDR-H3 was also found in selected scFvs showing the functionality of the naive CDR-H3 diversity.
Manual and automatic locomotion scoring systems in dairy cows: a review.
Schlageter-Tello, Andrés; Bokkers, Eddie A M; Koerkamp, Peter W G Groot; Van Hertem, Tom; Viazzi, Stefano; Romanini, Carlos E B; Halachmi, Ilan; Bahr, Claudia; Berckmans, Daniël; Lokhorst, Kees
2014-09-01
The objective of this review was to describe, compare and evaluate agreement, reliability, and validity of manual and automatic locomotion scoring systems (MLSSs and ALSSs, respectively) used in dairy cattle lameness research. There are many different types of MLSSs and ALSSs. Twenty-five MLSSs were found in 244 articles. MLSSs use different types of scale (ordinal or continuous) and different gait and posture traits need to be observed. The most used MLSS (used in 28% of the references) is based on asymmetric gait, reluctance to bear weight, and arched back, and is scored on a five-level scale. Fifteen ALSSs were found that could be categorized according to three approaches: (a) the kinetic approach measures forces involved in locomotion, (b) the kinematic approach measures time and distance of variables associated to limb movement and some specific posture variables, and (c) the indirect approach uses behavioural variables or production variables as indicators for impaired locomotion. Agreement and reliability estimates were scarcely reported in articles related to MLSSs. When reported, inappropriate statistical methods such as PABAK and Pearson and Spearman correlation coefficients were commonly used. Some of the most frequently used MLSSs were poorly evaluated for agreement and reliability. Agreement and reliability estimates for the original four-, five- or nine-level MLSS, expressed in percentage of agreement, kappa and weighted kappa, showed large ranges among and sometimes also within articles. After the transformation into a two-level scale, agreement and reliability estimates showed acceptable estimates (percentage of agreement ≥ 75%; kappa and weighted kappa ≥ 0.6), but still estimates showed a large variation between articles. Agreement and reliability estimates for ALSSs were not reported in any article. Several ALSSs use MLSSs as a reference for model calibration and validation. However, varying agreement and reliability estimates of MLSSs make a clear definition of a lameness case difficult, and thus affect the validity of ALSSs. MLSSs and ALSSs showed limited validity for hoof lesion detection and pain assessment. The utilization of MLSSs and ALSSs should aim to the prevention and efficient management of conditions that induce impaired locomotion. Long-term studies comparing MLSSs and ALSSs while applying various strategies to detect and control unfavourable conditions leading to impaired locomotion are required to determine the usefulness of MLSSs and ALSSs for securing optimal production and animal welfare in practice. Copyright © 2014 Elsevier B.V. All rights reserved.
Zitman-Gal, Tali; Green, Janice; Pasmanik-Chor, Metsada; Oron-Karni, Varda; Bernheim, Jacques
2010-07-01
BACKGROUND. High blood and tissue concentrations of glucose and advanced glycation end-products (AGEs) are thought to play an important role in the development of vascular diabetic complications. Therefore, the impact of extracellular AGEs and different glucose concentrations was evaluated by studying the gene expressions and the underlying cellular pathways involved in the development of inflammatory pro-atherosclerotic processes observed in cultured endothelial cells. METHODS. Fresh human umbilical vein cord endothelial cells (HUVEC) were treated in the presence of elevated extracellular glucose concentrations (5.5-28 mmol/l) with and without AGE-human serum albumin (HSA). Affymetrix GeneChip(R) Human Gene 1.0 ST arrays were used for gene expression analysis (total 20 chips). Genes of interest were further validated using real-time PCR and western blot techniques. RESULTS. Microarray analysis revealed significant changes in some gene expressions in the presence of the different stimuli, suggesting that different pathways are involved. Six genes were selected for validation as follows: thioredoxin-interacting protein (TXNIP), thioredoxin (TXN), nuclear factor of kappa B (NF-kappaB), interleukin 6 (IL6), interleukin 8 (IL8) and receptor of advanced glycation end-products (RAGE). Interestingly, it was found that the association of AGEs together with the highest pathophysiological concentration of glucose (28 mmol/l) diminished the expression of these specific genes, excluding TXN. CONCLUSIONS. In the present model that mimics a diabetic environment, the relatively short-term experimental conditions used showed an unexpected blunting action of AGEs in the presence of the highest glucose concentration (28 mmol/l). The interactive cellular pathways involved in these processes should be further investigated.
Edmead, C E; Patel, Y I; Wilson, A; Boulougouris, G; Hall, N D; Ward, S G; Sansom, D M
1996-10-15
A major obstacle in understanding the signaling events that follow CD28 receptor ligation arises from the fact that CD28 acts as a costimulus to TCR engagement, making it difficult to assess the relative contribution of CD28 signals as distinct from those of the TCR. To overcome this problem, we have exploited the observation that activated human T cell blasts can be stimulated via the CD28 surface molecule in the absence of antigenic challenge; thus, we have been able to observe the response of normal T cells to CD28 activation in isolation. Using this system, we observed that CD28 stimulation by B7-transfected CHO cells induced a proliferative response in T cells that was not accompanied by measurable IL-2 production. However, subsequent analysis of transcription factor generation revealed that B7 stimulation induced both activator protein-1 (AP-1) and nuclear factor-kappaB (NF-kappaB) complexes, but not NF-AT. In contrast, engagement of the TCR by class II MHC/superantigen, either with or without CD28 ligation, resulted in the induction of NF-AT, AP-1, and NF-kappaB as well as IL-2 production. Using selective inhibitors, we investigated the signaling pathways involved in the CD28-mediated induction of AP-1 and NF-kappaB. This revealed that NF-kappaB generation was sensitive to chloroquine, an inhibitor of acidic sphingomyelinase, but not to the phosphatidylinositol 3-kinase inhibitor, wortmannin. In contrast, AP-1 generation was inhibited by wortmannin and was also variably sensitive to chloroquine. These data suggest that in activated normal T cells, CD28-derived signals can stimulate proliferation at least in part via NF-kappaB and AP-1 generation, and that this response uses both acidic sphingomyelinase and phosphatidylinositol 3-kinase-linked pathways.
Park, Se-Jeong; Lee, Mi-Young; Son, Bu-Soon; Youn, Hyung-Sun
2009-07-01
Toll-like receptors (TLRs) are primary sensors that detect a wide variety of microbial components involving induction of innate immune responses. After recognition of microbial components, TLRs trigger the activation of myeloid differential factor 88 (MyD88) and Toll-interleukin-1 (IL-1) receptor domain-containing adapter inducing interferon-beta (TRIF)-dependent downstream signaling pathways. 6-Shoagol, an active ingredient of ginger, inhibits the MyD88-dependent signaling pathway by inhibiting inhibitor-kappaB kinase activity. Inhibitor-kappaB kinase is a key kinase in nuclear factor kappaB (NF-kappaB) activation. However, it is not known whether 6-shogaol inhibits the TRIF-dependent signaling pathway. Our goal was to identify the molecular target of 6-shogaol in the TRIF-dependent pathway of TLRs. 6-Shogaol inhibited the activation of interferon-regulatory factor 3 (IRF3) induced by lipopolysaccharide (LPS) and by polyriboinosinic polyribocytidylic acid (poly[I:C]), overexpression of TRIF, TANK-binding kinase1 (TBK1), and IRF3. Furthermore, 6-shogaol inhibited TBK1 activity in vitro. Together, these results suggest that 6-shogaol inhibits the TRIF-dependent signaling pathway of TLRs by targeting TBK1, and, they imply that 6-shogaol can modulate TLR-derived immune/inflammatory target gene expression induced by microbial infection.
Upper and lower bounds of ground-motion variabilities: implication for source properties
NASA Astrophysics Data System (ADS)
Cotton, Fabrice; Reddy-Kotha, Sreeram; Bora, Sanjay; Bindi, Dino
2017-04-01
One of the key challenges of seismology is to be able to analyse the physical factors that control earthquakes and ground-motion variabilities. Such analysis is particularly important to calibrate physics-based simulations and seismic hazard estimations at high frequencies. Within the framework of the development of ground-motion prediction equation (GMPE) developments, ground-motions residuals (differences between recorded ground motions and the values predicted by a GMPE) are computed. The exponential growth of seismological near-source records and modern GMPE analysis technics allow to partition these residuals into between- and a within-event components. In particular, the between-event term quantifies all those repeatable source effects (e.g. related to stress-drop or kappa-source variability) which have not been accounted by the magnitude-dependent term of the model. In this presentation, we first discuss the between-event variabilities computed both in the Fourier and Response Spectra domains, using recent high-quality global accelerometric datasets (e.g. NGA-west2, Resorce, Kiknet). These analysis lead to the assessment of upper bounds for the ground-motion variability. Then, we compare these upper bounds with lower bounds estimated by analysing seismic sequences which occurred on specific fault systems (e.g., located in Central Italy or in Japan). We show that the lower bounds of between-event variabilities are surprisingly large which indicates a large variability of earthquake dynamic properties even within the same fault system. Finally, these upper and lower bounds of ground-shaking variability are discussed in term of variability of earthquake physical properties (e.g., stress-drop and kappa_source).
VizieR Online Data Catalog: Type II Cepheid and RR Lyrae variables (Feast+, 2008)
NASA Astrophysics Data System (ADS)
Feast, M. W.; Laney, C. D.; Kinman, T. D.; van Leeuwen, F.; Whitelock, P. A.
2008-10-01
Infrared and optical absolute magnitudes are derived for the type II Cepheids kappa Pav and VY Pyx using revised Hipparcos parallaxes and for kappa Pav, V553 Cen and SW Tau from pulsational parallaxes. Revised Hipparcos and HST parallaxes for RR Lyrae agree satisfactorily and are combined in deriving absolute magnitudes. Phase-corrected J, H and Ks mags are given for 142 Hipparcos RR Lyraes based on Two-Micron All-Sky Survey observations. Pulsation and trigonometrical parallaxes for classical Cepheids are compared to establish the best value for the projection factor (p) used in pulsational analyses. (3 data files).
Polymorphism in ovine ANXA9 gene and physic-chemical properties and the fraction of protein in milk.
Pecka-Kiełb, Ewa; Czerniawska-Piątkowska, Ewa; Kowalewska-Łuczak, Inga; Vasil, Milan
2018-04-16
Annexin A9 (ANXA9) is a specific fatty acid transport protein. ANXA9 gene is expressed in various tissues, including secretory tissue and mammary glands. The association between three SNPs of the ANXA9 gene and sheep's milk compositions was assessed. Genotype analysis was performed with the use of PCR-RFLP method. The studied ANXA9 polymorphisms had the following MAF (Major Allele Frequency): SNP1: allele G 0,66; SNP2: allele G 0,54; SNP3: allele C 0,57. The study found the most desired profile of protein fractions, namely an increased kappa-casein fractions and a decreased level of whey protein in sheep's milk for SNP1 and SNP3 polymorphisms. Sheep with the SNP1 GA genotype had the highest (P <0.05) content of fat and dry matter in milk. AXNA9 gene polymorphism did not influence the levels of protein, lactose or urea in sheep's milk. The information contained in this study may be useful for determining the impact of the ANXA9 gene on sheep's milk. The ANXA9 SNP1 and SNP3 polymorphisms results could be included in the breeding programs to select the sheep with the genotypes ensuring the highest kappa-casein levels in milk. However, it is worth conducting further research on ANXA9 and milk composition in larger herds of animals and various breeds of sheep. This article is protected by copyright. All rights reserved.
High Agreement and High Prevalence: The Paradox of Cohen's Kappa.
Zec, Slavica; Soriani, Nicola; Comoretto, Rosanna; Baldi, Ileana
2017-01-01
Cohen's Kappa is the most used agreement statistic in literature. However, under certain conditions, it is affected by a paradox which returns biased estimates of the statistic itself. The aim of the study is to provide sufficient information which allows the reader to make an informed choice of the correct agreement measure, by underlining some optimal properties of Gwet's AC1 in comparison to Cohen's Kappa, using a real data example. During the process of literature review, we have asked a panel of three evaluators to come up with a judgment on the quality of 57 randomized controlled trials assigning a score to each trial using the Jadad scale. The quality was evaluated according to the following dimensions: adopted design, randomization unit, type of primary endpoint. With respect to each of the above described features, the agreement between the three evaluators has been calculated using Cohen's Kappa statistic and Gwet's AC1 statistic and, finally, the values have been compared with the observed agreement. The values of the Cohen's Kappa statistic would lead to believe that the agreement levels for the variables Unit, Design and Primary Endpoints are totally unsatisfactory. The AC1 statistic, on the contrary, shows plausible values which are in line with the respective values of the observed concordance. We conclude that it would always be appropriate to adopt the AC1 statistic, thus bypassing any risk of incurring the paradox and drawing wrong conclusions about the results of agreement analysis.
Evaluation of viral and mammalian promoters for driving transgene expression in mouse liver
DOE Office of Scientific and Technical Information (OSTI.GOV)
Al-Dosari, Mohammed; Zhang Guisheng; Knapp, Joseph E.
2006-01-13
Fifteen luciferase plasmid constructs driven by various promoters including cytomegalovirus (CMV), Rous sarcoma virus (RSV), human serum albumin (SA), {alpha}-1 antitrypsin (AAT), cytochrome P450 CYP1A2, CYP2C9, CYP2C18, CYP2D6, CYP3A4, mouse CYP2b10, human amyloid precursor protein (APP), chicken {beta} actin (ACT), nuclear factor {kappa} B (NF{kappa}B), and heat shock protein 70 (HS) promoters were hydrodynamically introduced into mouse hepatocytes, and the level and persistence of luciferase gene expression were examined. Eight hours post-gene transfer, the CMV and AAT promoters showed the highest activity, followed by the CYP2D6, HS, and RSV promoters which were slightly less active. The human serum albumin promotermore » exhibited the lowest activity among the promoters examined. The time course of gene expression showed a two-phase decline in luciferase activity with a rapid phase within First 5-7 days and a slower decline thereafter. Results from Southern and Northern blot analyses revealed a good correlation between the decline of luciferase activity and the decrease in mRNA level, suggesting promoter silencing as the possible mechanism for the observed transient luciferase gene expression. Inclusion of EBN1 and oriP sequences of Epstein-Barr virus into the plasmid extended the period of active transcription for about one week. These results provide important information concerning the role of promoters in regulating transgene expression and for the proper design of plasmids for gene expression and gene therapy.« less
Inhibition of inflammatory cytokine-induced response in human islet cells by withaferin A.
Peng, H; Olsen, G; Tamura, Y; Noguchi, H; Matsumoto, S; Levy, M F; Naziruddin, B
2010-01-01
After islet cell transplantation, a substantial mass of islets are lost owing to nonspecific inflammatory reactions. Cytokine exposure before or after transplantation can upregulate expression of proinflammatory genes via the nuclear factor-kappaB signaling pathway, eventually resulting in islet loss. To test the effects of a naturally occurring nuclear factor-kappaB inhibitor, withaferin A, on regulation of inflammatory genes in human islets. Human pancreatic islets were isolated using a modified Ricordi protocol. Purified islets were cultured for 2 days. The effect of withaferin A treatment on islet cell viability was examined using the fluorescein diacetate-propidium iodide dye exclusion test, and on function using a static glucose stimulation assay. Islet cells were treated with a cytokine mixture (50 U/mL of interleukin-1beta, 1000 U/mL of tumor necrosis factor-alpha, and 1000 U/mL of interferon-gamma) for 48 hours with or without withaferin A, 1 microg/mL. Treated islets were used for real-time polymerase chain reaction (PCR) array analysis for expression of inflammatory genes, and expression of other selected genes was analyzed using real-time PCR with single primers. Glucose stimulation and viability assays demonstrated that withaferin A was not toxic to islet cells. Of 84 inflammation-related genes examined using real-time PCR array analysis, 9 were significantly upregulated by cytokine treatment compared with the control group. However, addition of withaferin A to the culture significantly inhibited expression of all genes. Withaferin A significantly inhibits the inflammatory response of islet cells with cytokine exposure. Copyright 2010 Elsevier Inc. All rights reserved.
Bell, Rebecca C; Yager, Phoebe H; Clark, Maureen E; Roumiantsev, Serguei; Venancio, Heather L; Chipman, Daniel W; Kacmarek, Robert M; Noviski, Natan N
2016-02-01
Mechanical ventilation is one of the most important therapeutic interventions in neonatal and pediatric ICUs. Telemedicine has been shown to reliably extend pediatric intensivist expertise to facilities where expertise is limited. If reliable, telemedicine may extend the reach of pediatric respiratory therapists (RTs) to facilities where expertise does not exist or free up existing RT resources for important face-to-face activities in facilities where expertise is limited. The aim of this study was to determine how well respiratory assessments for ventilated neonates and children correlated when performed simultaneously by 2 RTs face-to-face and via telemedicine. We conducted a pilot study including 40 assessments by 16 RTs on 11 subjects (5 neonatal ICU; 6 pediatric ICU). Anonymously completed intake forms by 2 different RTs concurrently assessing 14 ventilator-derived and patient-based respiratory variables were used to determine correlations. Forty paired assessments were performed. Median telemedicine assessment time was 8 min. The Pearson correlation coefficient (r) was used to determine agreement between continuous data, and the Cohen kappa statistics were used for binary variables. Pressure control, PEEP, breathing frequency, and FIO2 perfectly correlated (r = 1, all P < .001) as did the presence of a CO2 monitor and need for increased ventilatory support (kappa = 1). The Pearson correlation coefficient for VT, minute ventilation, mean airway pressure, and oxygen saturation ranged from 0.84 to 0.97 (all P < .001). kappa = 0.41 (95% CI 0.02-0.80) for patient-triggered breaths, and kappa = 0.57 (95% CI 0.19-0.94) for breathing frequency higher than set frequency. kappa = -0.25 (95% CI -0.46 to -0.04) for need for suctioning. Telemedicine technology was acceptable to RTs. Telemedicine evaluations highly correlated with face-to-face for 10 of 14 aspects of standard bedside respiratory assessment. Poor correlation was noted for more complex, patient-generated parameters, highlighting the importance of further investigation incorporating a virtual stethoscope. Copyright © 2016 by Daedalus Enterprises.
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
2013-10-01
experiments, a statistically significant data is not yet available. Additional experiments are needed for us to be able to draw conclu comb Figure...well-defined stress pathways, UPR and autophagy, are involved breast involution regulation. Using published gene expression array datasets from...performed involution time-course experiments using both low-dose drug interventions and an autophagy-related gene 7 (ATG7) deletion mouse model
Ergo, Alex; Ritter, Julie; Gwatkin, Davidson R; Binkin, Nancy
2016-03-01
Equitable access to programs and health services is essential to achieving national and international health goals, but it is rarely assessed because of perceived measurement challenges. One of these challenges concerns the complexities of collecting the data needed to construct asset or wealth indices, which can involve asking as many as 40 survey questions, many with multiple responses. To determine whether the number of variables and questions could be reduced to a level low enough for more routine inclusion in evaluations and research without compromising programmatic conclusions, we used data from a program evaluation in Honduras that compared a pro-poor intervention with government clinic performance as well as data from a results-based financing project in Senegal. In both, the full Demographic and Health Survey (DHS) asset questionnaires had been used as part of the evaluations. Using the full DHS results as the "gold standard," we examined the effect of retaining successively smaller numbers of variables on the classification of the program clients in wealth quintiles. Principal components analysis was used to identify those variables in each country that demonstrated minimal absolute factor loading values for 8 different thresholds, ranging from 0.05 to 0.70. Cohen's kappa statistic was used to assess correlation. We found that the 111 asset variables and 41 questions in the Honduras DHS could be reduced to 9 variables, captured by only 8 survey questions (kappa statistic, 0.634), without substantially altering the wealth quintile distributions for either the pro-poor program or the government clinics or changing the resulting policy conclusions. In Senegal, the 103 asset variables and 36 questions could be reduced to 32 variables and 20 questions (kappa statistic, 0.882) while maintaining a consistent mix of users in each of the 2 lowest quintiles. Less than 60% of the asset variables in the 2 countries' full DHS asset indices overlapped, and in none of the 8 simplified asset index iterations did this proportion exceed 50%. We conclude that substantially reducing the number of variables and questions used to assess equity is feasible, producing valid results and providing a less burdensome way for program implementers or researchers to evaluate whether their interventions are pro-poor. Developing a standardized, simplified asset questionnaire that could be used across countries may prove difficult, however, given that the variables that contribute the most to the asset index are largely country-specific. © Ergo et al.
Ergo, Alex; Ritter, Julie; Gwatkin, Davidson R; Binkin, Nancy
2016-01-01
ABSTRACT Equitable access to programs and health services is essential to achieving national and international health goals, but it is rarely assessed because of perceived measurement challenges. One of these challenges concerns the complexities of collecting the data needed to construct asset or wealth indices, which can involve asking as many as 40 survey questions, many with multiple responses. To determine whether the number of variables and questions could be reduced to a level low enough for more routine inclusion in evaluations and research without compromising programmatic conclusions, we used data from a program evaluation in Honduras that compared a pro-poor intervention with government clinic performance as well as data from a results-based financing project in Senegal. In both, the full Demographic and Health Survey (DHS) asset questionnaires had been used as part of the evaluations. Using the full DHS results as the “gold standard,” we examined the effect of retaining successively smaller numbers of variables on the classification of the program clients in wealth quintiles. Principal components analysis was used to identify those variables in each country that demonstrated minimal absolute factor loading values for 8 different thresholds, ranging from 0.05 to 0.70. Cohen’s kappa statistic was used to assess correlation. We found that the 111 asset variables and 41 questions in the Honduras DHS could be reduced to 9 variables, captured by only 8 survey questions (kappa statistic, 0.634), without substantially altering the wealth quintile distributions for either the pro-poor program or the government clinics or changing the resulting policy conclusions. In Senegal, the 103 asset variables and 36 questions could be reduced to 32 variables and 20 questions (kappa statistic, 0.882) while maintaining a consistent mix of users in each of the 2 lowest quintiles. Less than 60% of the asset variables in the 2 countries’ full DHS asset indices overlapped, and in none of the 8 simplified asset index iterations did this proportion exceed 50%. We conclude that substantially reducing the number of variables and questions used to assess equity is feasible, producing valid results and providing a less burdensome way for program implementers or researchers to evaluate whether their interventions are pro-poor. Developing a standardized, simplified asset questionnaire that could be used across countries may prove difficult, however, given that the variables that contribute the most to the asset index are largely country-specific. PMID:27016551
Inter-rater reliability of select physical examination procedures in patients with neck pain.
Hanney, William J; George, Steven Z; Kolber, Morey J; Young, Ian; Salamh, Paul A; Cleland, Joshua A
2014-07-01
This study evaluated the inter-rater reliability of select examination procedures in patients with neck pain (NP) conducted over a 24- to 48-h period. Twenty-two patients with mechanical NP participated in a standardized examination. One examiner performed standardized examination procedures and a second blinded examiner repeated the procedures 24-48 h later with no treatment administered between examinations. Inter-rater reliability was calculated with the Cohen Kappa and weighted Kappa for ordinal data while continuous level data were calculated using an intraclass correlation coefficient model 2,1 (ICC2,1). Coefficients for categorical variables ranged from poor to moderate agreement (-0.22 to 0.70 Kappa) and coefficients for continuous data ranged from slight to moderate (ICC2,1 0.28-0.74). The standard error of measurement for cervical range of motion ranged from 5.3° to 9.9° while the minimal detectable change ranged from 12.5° to 23.1°. This study is the first to report inter-rater reliability values for select components of the cervical examination in those patients with NP performed 24-48 h after the initial examination. There was considerably less reliability when compared to previous studies, thus clinicians should consider how the passage of time may influence variability in examination findings over a 24- to 48-h period.
The ICI classification for calcaneal injuries: a validation study.
Frima, Herman; Eshuis, Rienk; Mulder, Paul; Leenen, Luke
2012-06-01
The integral classification of injuries (ICI), by Zwipp et al. has been developed as a classification system for injuries of the bones, joints, cartilage and ligaments of the foot. It follows the principles of the comprehensive classification of fractures by Müller et al. The ICI was developed for 'everyday use' and scientific purposes. Our aim was to perform a validation study for this classification system applied to the calcaneal injuries. A panel of five experienced trauma and orthopaedic surgeons evaluated the ICI score in 20 calcaneal injuries. After 2 months, a second classification was performed in a different order. Inter- and intra-observer variability were evaluated by kappa statistics. Panel members were not able to evaluate capsule and ligamental injuries based on X-ray and computed tomography (CT) films. Two injuries were excluded for logistical reasons. The inter-observer agreement based on 18 injuries of bone and joints was slight; kappa 0.14 (90% confidence interval (CI): 0.05-0.22). The intra-observer agreement was fair; kappa 0.31 (90% CI: 0.22-0.41). Overall, the panel rated the system as very complicated and not practical. The ICI is a complicated classification system with slight to fair inter- and intra-observer variabilities. It might not be a practical classification system for calcaneal injuries in 'everyday use' or scientific purposes. Copyright © 2011 Elsevier Ltd. All rights reserved.
Oh, Jung Hwa; Lee, Tae-Jin; Park, Jong-Wook; Kwon, Taeg Kyu
2008-12-03
Induction of inducible nitric oxide synthase (iNOS) expression and nitric oxide (NO) production is thought to have beneficial immunomodulatory effects in acute and chronic inflammatory disorders. In Raw 264.7 cells stimulated with lipopolysaccharide (LPS) to mimic inflammation, withaferin A inhibited LPS-induced expression of both iNOS protein and mRNA in a dose-dependent manner. To investigate the mechanism by which withaferin A inhibits iNOS gene expression, we examined activation of mitogen-activated protein kinases (MAPKs) and Akt in Raw 264.7 cells. We did not observe any significant changes in the phosphorylation of p38 MAPK in cells treated with LPS alone or LPS plus withaferin A. However, LPS-induced Akt phosphorylation was markedly inhibited by withaferin A, while the phosphorylation of p42/p44 extracellular signal-regulated kinases (ERKs) was slightly inhibited by withaferin A treatment. Withaferin A prevented IkappaB phosphorylation, blocking the subsequent nuclear translocation of nuclear factor-kappaB (NF-kappaB) and inhibiting its DNA binding activity. LPS-induced p65 phosphorylation, which is mediated by extracellular signal-regulated kinase (ERK) and Akt pathways, was attenuated by withaferin A treatment. Moreover, LPS-induced NO production and NF-kappaB activation were inhibited by SH-6, a specific inhibitor of Akt. Taken together, these results suggest that withaferin A inhibits inflammation through inhibition of NO production and iNOS expression, at least in part, by blocking Akt and subsequently down-regulating NF-kappaB activity.
Thapa, Dinesh; Lee, Jong Suk; Park, Su-Young; Bae, Yun-Hee; Bae, Soo-Kyung; Kwon, Jun Bum; Kim, Kyoung-Jin; Kwak, Mi-Kyoung; Park, Young-Joon; Choi, Han Gon; Kim, Jung-Ae
2008-11-01
Increased interleukin (IL)-8 plays an important role not only in activation and recruitment of neutrophils but also in inducing exaggerated angiogenesis at the inflamed site. In the present study, we investigated the fact that clotrimazole (CLT) inhibits intestinal inflammation, and the inhibitory action is mediated through suppression of IL-8 expression. In the trinitrobenzene sulfonic acid (TNBS)-induced rat colitis model, CLT dose-dependently protected from the TNBS-induced weight loss, colon ulceration, and myeloperoxidase activity increase. In the lesion site, CLT also suppressed the TNBS-induced angiogenesis, IL-8 expression, and nuclear factor (NF)-kappaB activation. In a cellular model of colitis using tumor necrosis factor (TNF)-alpha-stimulated HT29 colon epithelial cells, treatment with CLT significantly suppressed TNF-alpha-mediated IL-8 induction and NF-kappaB transcriptional activity revealed by a luciferase reporter gene assay. Furthermore, cotreatment with CLT and pyrrolidine dithiocarbamate, a NF-kappaB inhibitor, synergistically reduced the NF-kappaB transcriptional activity as well as IL-8 expression. In an in vitro angiogenesis assay, CLT suppressed IL-8-induced proliferation, tube formation, and invasion of human umbilical vein endothelial cells. The in vivo angiogenesis assay using chick chorioallantoic membrane also showed that CLT significantly inhibited the IL-8-induced formation of new blood vessels. Taken together, these results suggest that CLT may prevent the progression of intestinal inflammation by not only down-regulating IL-8 expression but also inhibiting the action of IL-8 in both colon epithelial and vascular endothelial cells during pathogenesis of intestinal inflammation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liao, B.-C.; Hsieh, C.-W.; Liu, Y.-C.
The production of adhesion molecules and subsequent attachment of leukocytes to endothelial cells (ECs) are critical early events in atherogenesis. These adhesion molecules thus play an important role in the development of this disease. Recent studies have highlighted the chemoprotective and anti-inflammatory effects of cinnamaldehyde, a Cinnamomum cassia Presl-specific diterpene. In our current study, we have examined the effects of both cinnamaldehyde and extracts of C. cassia on cytokine-induced monocyte/human endothelial cell interactions. We find that these compounds inhibit the adhesion of TNF{alpha}-induced monocytes to endothelial cells and suppress the expression of the cell adhesion molecules, VCAM-1 and ICAM-1, atmore » the transcriptional level. Moreover, in TNF{alpha}-treated ECs, the principal downstream signal of VCAM-1 and ICAM-1, NF-{kappa}B, was also found to be abolished in a time-dependent manner. Interestingly, cinnamaldehyde exerts its anti-inflammatory effects by blocking the degradation of the inhibitory protein I{kappa}B-{alpha}, but only in short term pretreatments, whereas it does so via the induction of Nrf2-related genes, including heme-oxygenase-1 (HO-1), over long term pretreatments. Treating ECs with zinc protoporphyrin, a HO-1 inhibitor, partially blocks the anti-inflammatory effects of cinnamaldehyde. Elevated HO-1 protein levels were associated with the inhibition of TNF{alpha}-induced ICAM-1 expression. In addition to HO-1, we also found that cinnamaldehyde can upregulate Nrf2 in nuclear extracts, and can increase ARE-luciferase activity and upregulate thioredoxin reductase-1, another Nrf2-related gene. Moreover, cinnamaldehyde exposure rapidly reduces the cellular GSH levels in ECs over short term treatments but increases these levels after 9 h exposure. Hence, our present findings indicate that cinnamaldehyde suppresses TNF-induced singling pathways via two distinct mechanisms that are activated by different pretreatment periods.« less
Bonavida, Benjamin; Baritaki, Stavroula; Huerta-Yepez, Sara; Vega, Mario I; Chatterjee, Devasis; Yeung, Kam
2008-09-01
The treatment of primary tumors results in an initial response to approved conventional therapeutics. However, recurrences and malignancies develop as a result of tumors' acquisition of anti-apoptotic mechanisms of resistance. Hence, there is an urgent need of novel therapeutics that can reverse resistance. One approach of interest is the inhibition of cell survival and anti-apoptotic pathways by sensitizing agents that can render resistant tumor cells sensitive to respond to various cytotoxic therapies. We have found that nitric oxide donors, similar to DETANONOate, inhibit cell survival anti-apoptotic pathways, such as the constitutively activated NF-kappaB and sensitize drug-resistant tumor cells to apoptosis by both chemotherapy and immunotherapy. Sensitization by DETANONOate was shown to inhibit the transcription repressor Yin Yang1 (YY1) shown to regulate resistance to both Fas ligand and TRAIL. In addition, DETANONOate-induced inhibition of NF-kappaB results downstream in the inhibition of several anti-apoptotic gene products, thus facilitating the activation of the apoptotic pathways with both chemotherapy and immunotherapy. In addition, DETANONOate induces the expression of the metastatic tumor suppressor gene product, Raf-1 Kinase Inhibitor Protein (RKIP), which inhibits the survival pathways induced by NF-kappaB and Raf-1/MEK which also contributes to the sensitizing activity. This indicates a novel finding that RKIP may also play an important role in the prevention of metastasis. Inhibition of NF-kappaB activation by DETANONOate results downstream in the inhibition of the RKIP transcription repressor Snail, resulting in upregulation of RKIP. Inhibition of Snail results in downstream inhibition of the metastatic cascade initiated by the epithelial-mesenchymal transition (EMT). Thus, nitric oxide donors have the dual functions of both sensitizing tumor cells to chemotherapy and immunotherapy and are also involved in the regulation and inhibition of metastasis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wisutsitthiwong, Chonnaree; Buranaruk, Chayanit; Pudhom, Khanitha
Highlights: Black-Right-Pointing-Pointer A gedunin type limonoid from seeds of mangroves, 7-oxo-7-deacetoxygedunin, exhibits strong anti-osteoclastogenic activity. Black-Right-Pointing-Pointer Treatment with this limonoid results in significant decrease in expression of NFATc1 and osteoclast-related genes. Black-Right-Pointing-Pointer The mode of action of this limonoid is by inhibiting activation of the NF-{kappa}B and MAPK pathways which are activated by RANKL. -- Abstract: Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. Aberrations in osteoclast differentiation and activity contribute to osteopenic disease. Osteoclasts differentiate from monocyte/macrophage progenitors, a process that is initiated by the interaction between receptor activator of NF-{kappa}B (RANK) and its ligand, RANKL. Inmore » this study, we identified 7-oxo-7-deacetoxygedunin (7-OG), a gedunin type limonoid from seeds of the mangrove Xylocarpus moluccensis, as a potent inhibitor of osteoclastogenesis. Additionally, 7-OG showed strong anti-osteoclastogenic activity with low cytotoxicity against the monocyte/macrophage progenitor cell line, RAW264.7. The IC50 for anti-osteoclastogenic activity was 4.14 {mu}M. Treatment with 7-OG completely abolished the appearance of multinucleated giant cells with tartrate-resistant acid phosphatase activity in RAW264.7 cells stimulated with RANKL. When the expression of genes related to osteoclastogenesis was investigated, a complete downregulation of NFATc1 and cathepsin K and a delayed downregulation of irf8 were observed upon 7-OG treatment in the presence of RANKL. Furthermore, treatment with this limonoid suppressed RANKL-induced activation of p38, MAPK and Erk and nuclear localization of NF-{kappa}B p65. Taken together, we present evidence indicating a plant limonoid as a novel osteoclastogenic inhibitor that could be used for osteoporosis and related conditions.« less
Millikan, Amy M; Weber, Natalya S; Niebuhr, David W; Torrey, E Fuller; Cowan, David N; Li, Yuanzhang; Kaminski, Brenda
2007-10-01
We are studying associations between selected biomarkers and schizophrenia or bipolar disorder among military personnel. To assess potential diagnostic misclassification and to estimate the date of illness onset, we reviewed medical records for a subset of cases. Two psychiatrists independently reviewed 182 service medical records retrieved from the Department of Veterans Affairs. Data were evaluated for diagnostic concordance between database diagnoses and reviewers. Interreviewer variability was measured by using proportion of agreement and the kappa statistic. Data were abstracted to estimate date of onset. High levels of agreement existed between database diagnoses and reviewers (proportion, 94.7%; kappa = 0.88) and between reviewers (proportion, 92.3%; kappa = 0.87). The median time between illness onset and initiation of medical discharge was 1.6 and 1.1 years for schizophrenia and bipolar disorder, respectively. High levels of agreement between investigators and database diagnoses indicate that diagnostic misclassification is unlikely. Discharge procedure initiation date provides a suitable surrogate for disease onset.
ERIC Educational Resources Information Center
Schorer, Jorg; Weiss, Christel
2007-01-01
Many methods for the identification of key variables in movement patterns have the problem that direct transferability back to coaches or players is not easy; this is because the variables used are not presented in the language of most sport participants. Using a research strategy--from the coaches back to the coaches--proposed by Roth (1996),…
Huerta-Yepez, Sara; Vega, Mario; Jazirehi, Ali; Garban, Hermes; Hongo, Fumiya; Cheng, Genhong; Bonavida, Benjamin
2004-06-24
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) has been shown to be selective in the induction of apoptosis in cancer cells with minimal toxicity to normal tissues and this prompted its potential therapeutic application in cancer. However, not all cancers are sensitive to TRAIL-mediated apoptosis and, therefore, TRAIL-resistant cancer cells must be sensitized first to become sensitive to TRAIL. Treatment of prostate cancer (CaP) cell lines (DU145, PC-3, CL-1, and LNCaP) with nitric oxide donors (e.g. (Z)-1-[2-(2-aminoethyl)-N-(2-ammonio-ethyl)amino]diazen-1-ium-1, 2-diolate (DETANONOate)) sensitized CaP cells to TRAIL-induced apoptosis and synergy was achieved. The mechanism by which DETANONOate mediated the sensitization was examined. DETANONOate inhibited the constitutive NF-kappa B activity as assessed by EMSA. Also, p50 was S-nitrosylated by DETANONOate resulting in inhibition of NF-kappa B. Inhibition of NF-kappa B activity by the chemical inhibitor Bay 11-7085, like DETANONOate, sensitized CaP to TRAIL apoptosis. In addition, DETANONOate downregulated the expression of Bcl-2 related gene (Bcl-(xL)) which is under the transcriptional regulation of NF-kappa B. The regulation of NF-kappa B and Bcl-(xL) by DETANONOate was corroborated by the use of Bcl-(xL) and Bcl-x kappa B reporter systems. DETANONOate inhibited luciferase activity in the wild type and had no effect on the mutant cells. Inhibition of NF-kappa B resulted in downregulation of Bcl-(xL) expression and sensitized CaP to TRAIL-induced apoptosis. The role of Bcl-(xL) in the regulation of TRAIL apoptosis was corroborated by inhibiting Bcl-(xL) function by the chemical inhibitor 2-methoxyantimycin A(3) and this resulted in sensitization of the cells to TRAIL apoptosis. Signaling by DETANONOate and TRAIL for apoptosis was examined. DETANONOate altered the mitochondria by inducing membrane depolarization and releasing modest amounts of cytochrome c and Smac/DIABLO in the absence of downstream activation of caspases 9 and 3. However, the combination of DETANONOate and TRAIL resulted in activation of the mitochondrial pathway and activation of caspases 9 and 3, and induction of apoptosis. These findings demonstrate that DETANONOate-mediated sensitization of CaP to TRAIL-induced apoptosis is via inhibition of constitutive NF-kappa B activity and Bcl-(xL) expression.
Lambron, Julien; Rakotonjanahary, Josué; Loisel, Didier; Frampas, Eric; De Carli, Emilie; Delion, Matthieu; Rialland, Xavier; Toulgoat, Frédérique
2016-02-01
Magnetic resonance (MR) images from children with optic pathway glioma (OPG) are complex. We initiated this study to evaluate the accuracy of MR imaging (MRI) interpretation and to propose a simple and reproducible imaging classification for MRI. We randomly selected 140 MRIs from among 510 MRIs performed on 104 children diagnosed with OPG in France from 1990 to 2004. These images were reviewed independently by three radiologists (F.T., 15 years of experience in neuroradiology; D.L., 25 years of experience in pediatric radiology; and J.L., 3 years of experience in radiology) using a classification derived from the Dodge and modified Dodge classifications. Intra- and interobserver reliabilities were assessed using the Bland-Altman method and the kappa coefficient. These reviews allowed the definition of reliable criteria for MRI interpretation. The reviews showed intraobserver variability and large discrepancies among the three radiologists (kappa coefficient varying from 0.11 to 1). These variabilities were too large for the interpretation to be considered reproducible over time or among observers. A consensual analysis, taking into account all observed variabilities, allowed the development of a definitive interpretation protocol. Using this revised protocol, we observed consistent intra- and interobserver results (kappa coefficient varying from 0.56 to 1). The mean interobserver difference for the solid portion of the tumor with contrast enhancement was 0.8 cm(3) (limits of agreement = -16 to 17). We propose simple and precise rules for improving the accuracy and reliability of MRI interpretation for children with OPG. Further studies will be necessary to investigate the possible prognostic value of this approach.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reed, S.A.; Senf, S.M.; Cornwell, E.W.
Research highlights: {yields} Independent inhibition of Foxo, IKK{alpha} and IKK{beta} activities does not alter muscle fiber size in weight bearing muscles. {yields} Inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities increases muscle fiber size. {yields} Independent inhibition of Foxo and IKK{beta} activities attenuates cast immobilization-induced muscle fiber atrophy. {yields} Disuse muscle fiber atrophy is abolished by inhibition of Foxo activity plus IKK{alpha} or IKK{beta} activities. -- Abstract: Two transcription factor families that are activated during multiple conditions of skeletal muscle wasting are nuclear factor {kappa}B (NF-{kappa}B) and forkhead box O (Foxo). There is clear evidence that both NF-{kappa}B andmore » Foxo activation are sufficient to cause muscle fiber atrophy and they are individually required for at least half of the fiber atrophy during muscle disuse, but there is no work determining the combined effect of inhibiting these factors during a physiological condition of muscle atrophy. Here, we determined whether inhibition of Foxo activation plus inhibition of NF-{kappa}B activation, the latter by blocking the upstream inhibitor of kappaB kinases (IKK{alpha} and IKK{beta}), would prevent muscle atrophy induced by 7 days of cast immobilization. Results were based on measurements of mean fiber cross-sectional area (CSA) from 72 muscles transfected with 5 different mutant expression plasmids or plasmid combinations. Immobilization caused a 47% decrease in fiber CSA in muscles injected with control plasmids. Fibers from immobilized muscles transfected with dominant negative (d.n.) IKK{alpha}-EGFP, d.n. IKK{beta}-EGFP or d.n. Foxo-DsRed showed a 22%, 57%, and 76% inhibition of atrophy, respectively. Co-expression of d.n. IKK{alpha}-EGFP and d.n. Foxo-DsRed significantly inhibited 89% of the immobilization-induced fiber atrophy. Similarly, co-expression of d.n. IKK{beta}-EGFP and d.n. Foxo-DsRed inhibited the immobilization-induced fiber atrophy by 95%. These findings demonstrate that the combined effects of inhibiting immobilization-induced NF-{kappa}B and Foxo transcriptional activity has an additive effect on preventing immobilization-induced atrophy, indicating that NF-{kappa}B and Foxo have a cumulative effect on atrophy signaling and/or atrophy gene expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeda-Watanabe, Ai; Kitada, Munehiro; Kanasaki, Keizo
Highlights: Black-Right-Pointing-Pointer SIRT1 inactivation decreases autophagy in THP-1 cell. Black-Right-Pointing-Pointer Inhibition of autophagy induces inflammation. Black-Right-Pointing-Pointer SIRT1 inactivation induces inflammation through NF-{kappa}B activation. Black-Right-Pointing-Pointer The p62/Sqstm1 accumulation by impairment of autophagy is related to NF-{kappa}B activation. Black-Right-Pointing-Pointer SIRT1 inactivation is involved in the activation of mTOR and decreased AMPK activation. -- Abstract: Inflammation plays a crucial role in atherosclerosis. Monocytes/macrophages are some of the cells involved in the inflammatory process in atherogenesis. Autophagy exerts a protective effect against cellular stresses like inflammation, and it is regulated by nutrient-sensing pathways. The nutrient-sensing pathway includes SIRT1, a NAD{sup +}-dependent histone deacetylase, whichmore » is implicated in the regulation of a variety of cellular processes including inflammation and autophagy. The mechanism through which the dysfunction of SIRT1 contributes to the regulation of inflammation in relation to autophagy in monocytes/macrophages is unclear. In the present study, we demonstrate that treatment with 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide (Sirtinol), a chemical inhibitor of SIRT1, induces the overexpression of inflammation-related genes such as tumor necrosis factor (TNF)-{alpha} and interleukin (IL)-6 through nuclear factor (NF)-{kappa}B signaling activation, which is associated with autophagy dysfunction, as shown through p62/Sqstm1 accumulation and decreased expression of light chain (LC) 3 II in THP-1 cells. The autophagy inhibitor, 3-methyladenine, also induces inflammation-related NF-{kappa}B activation. In p62/Sqstm1 knockdown cells, Sirtinol-induced inflammation through NF-{kappa}B activation is blocked. In addition, inhibition of SIRT1 is involved in the activation of the mammalian target of rapamycin (mTOR) pathway and is implicated in decreased 5 Prime -AMP activated kinase (AMPK) activation, leading to the impairment of autophagy. The mTOR inhibitor, rapamycin, abolishes Sirtinol-induced inflammation and NF-{kappa}B activation associated with p62/Sqstm1 accumulation. In summary, SIRT1 inactivation induces inflammation through NF-{kappa}B activation and dysregulates autophagy via nutrient-sensing pathways such as the mTOR and AMPK pathways, in THP-1 cells.« less
Costantini, Massimo; Sciallero, Stefania; Giannini, Augusto; Gatteschi, Beatrice; Rinaldi, Paolo; Lanzanova, Giuseppe; Bonelli, Luigina; Casetti, Tino; Bertinelli, Elisabetta; Giuliani, Orietta; Castiglione, Guido; Mantellini, Paola; Naldoni, Carlo; Bruzzi, Paolo
2003-03-01
Current clinical practice guidelines for patients with colorectal polyps are mainly based on the histologic characteristics of their lesions. However, interobserver variability in the assessment of specific polyp characteristics was evaluated in very few studies. The purpose of this study was to evaluate the interobserver agreement of four pathologists in the diagnosis of histologic type of colorectal polyps and in the degree of dysplasia and of infiltrating carcinoma in adenomas. A stratified random sample of 100 polyps was obtained from the 4,889 polyps resected within the Multicentre Adenoma Colorectal Study (SMAC), and the slides were blindly reviewed by the four pathologists. Agreement was analyzed using kappa statistics. A median kappa of 0.89 (range 0.79-1.0) was estimated for the interobserver agreement for the diagnosis of hyperplastic polyp vs. adenoma. The agreement in the diagnosis of tubular, tubulovillous, and villous type, was given by median kappa values of 0.50, 0.15, and 0.36, respectively. The median kappa for the diagnosis of infiltrating carcinoma was 0.78 (range 0.73-0.84). Agreement on diagnosis of adenoma histologic subtypes, degrees of dysplasia, or infiltrating carcinoma in adenoma was moderate. A simpler classifications might help to better identify patients at different risk of colorectal cancer.
1990-01-01
Lipopolysaccharide (LPS) potently stimulates human immunodeficiency virus type 1-long terminal repeat (HIV-1-LTR) CAT constructs transfected into monocyte/macrophage-like cell lines but not a T cell line. This effect appears to be mediated through the induction of nuclear factor kappa B (NF-kappa B). Electrophoretic mobility shift assays demonstrate that LPS induces a DNA binding activity indistinguishable from NF-kappa B in U937 and THP-1 cells. LPS is also shown to dramatically increase HIV-1 production from a chronically infected monocyte/macrophage-like cloned cell line, U1, which produces very low levels of HIV-1 at baseline. The stimulation of viral production from this cell line occurs only if these cells are treated with granulocyte/macrophage colony-stimulating factor (GM-CSF) before treatment with LPS. This stimulation of HIV-1 production is correlated with an increase in the level of HIV-1 RNA and and activation of NF- kappa B. LPS is not able to induce HIV-1 production in a cloned T cell line. The effect of LPS on HIV-1 replication occurs at picogram per milliliter concentrations and may be clinically significant in understanding the variability of the natural history of HIV-1 infection. PMID:2193097
Salicylate-based anti-inflammatory drugs inhibit the early lesion of diabetic retinopathy.
Zheng, Ling; Howell, Scott J; Hatala, Denise A; Huang, Kun; Kern, Timothy S
2007-02-01
It has been previously reported that aspirin inhibited the development of diabetic retinopathy in diabetic animals, raising the possibility that anti-inflammatory drugs may have beneficial effects on diabetic retinopathy. To further explore this, we compared effects of oral consumption of three different salicylate-based drugs (aspirin, sodium salicylate, and sulfasalazine) on the development of early stages of diabetic retinopathy in rats. These three drugs differ in their ability to inhibit cyclooxygenase but share an ability to inhibit nuclear factor-kappaB (NF-kappaB). Diabetes of 9-10 months duration significantly increased the number of TUNEL (transferase-mediated dUTP nick-end labeling)-positive capillary cells and acellular (degenerate) capillaries in the retinal vasculature, and all three salicylate-based drugs inhibited this cell death and formation of acellular capillaries without altering the severity of hyperglycemia. In short-term diabetes (2-4 months), all three salicylates inhibited the diabetes-induced loss of neuronal cells from the ganglion cell layer. Oral aspirin (as a representative of the salicylate family) inhibited diabetes-induced increase in NF-kappaB DNA-binding affinity in electrophoretic mobility shift assay and transcription factor array in nuclear extract isolated from whole retina. All three salicylates inhibited the diabetes-induced translocation of p50 (a subunit of NF-kappaB) into nuclei of retinal vascular endothelial cells of the isolated retinal vasculature, as well as of p50 and p65 into nuclei of cells in the ganglion cell layer and inner nuclear layer on whole-retinal sections. Sulfasalazine (also as a representative of the salicylates) inhibited the diabetes-induced upregulation of several inflammatory gene products, which are regulated by NF-kappaB, including vascular cell adhesion molecule, intracellular adhesion molecule-1, inducible nitric oxide synthase, and cyclooxygenase-2 in whole-retinal lysate. Salicylates, in doses administrated in our experiments, inhibited NF-kappaB and perhaps other transcription factors in the retina, were well tolerated, and offered new tools to investigate and inhibit the development of diabetic retinopathy.
Lungu, Gina; Covaleda, Lina; Mendes, Odete; Martini-Stoica, Heidi; Stoica, George
2008-06-01
Matrix metalloproteinase-9 (MMP-9) plays a critical role in tumor invasion and metastasis. Here, we investigate the effect of fibroblast growth factor-1 (FGF-1) on the expression of MMP-9 in ENU1564, an ethyl-N-nitrosourea-induced rat mammary adenocarcinoma cell line. We observed that FGF-1 induces a dose-dependent increase in MMP-9 mRNA, protein, and activity in ENU1564 cells. To gain insight into the molecular mechanism of MMP-9 regulation by FGF-1, we investigated the role of components of PI3K-Akt and MEK1/2-ERK signaling pathways in our system since NF-kappaB and AP-1 transcription factor binding sites have been characterized in the upstream region of the MMP-9 gene. We demonstrated that FGF-1 increases Akt phosphorylation, triggers nuclear translocation of NF-kappaBp65, and enhances degradation of cytoplasmic IkappaBalpha. Pretreatment of cells with LY294002, a PI3K inhibitor, significantly inhibited MMP-9 protein expression in FGF-1-treated cells. Conversely, our data show that FGF-1 increases ERK phosphorylation in ENU1564 cells, increases c-jun and c-fos mRNA expression in a time-dependent manner, and triggers nuclear translocation of c-jun. Pretreatment of cells with PD98059, a MEK1/2 inhibitor significantly inhibited MMP-9 protein expression in FGF-1 treated cells. Finally, we observed increased DNA binding of NF-kappaB and AP-1 in FGF-1-treated cells and that mutation of either NF-kappaB or AP-1 response elements prevented MMP-9 promoter activation by FGF-1. Taken together, these results demonstrated that FGF-1-induced MMP-9 expression in ENU1564 cells is associated with increasing DNA binding activities of NF-kappaB and AP-1 and involve activation of a dual signaling pathway, PI3K-Akt and MEK1/2-ERK. (c) 2007 Wiley-Liss, Inc.
Fazal, Fabeha; Bijli, Kaiser M; Minhajuddin, Mohd; Rein, Theo; Finkelstein, Jacob N; Rahman, Arshad
2009-07-31
Activation of RhoA/Rho-associated kinase (ROCK) pathway and the associated changes in actin cytoskeleton induced by thrombin are crucial for activation of NF-kappaB and expression of its target gene ICAM-1 in endothelial cells. However, the events acting downstream of RhoA/ROCK to mediate these responses remain unclear. Here, we show a central role of cofilin-1, an actin-binding protein that promotes actin depolymerization, in linking RhoA/ROCK pathway to dynamic alterations in actin cytoskeleton that are necessary for activation of NF-kappaB and thereby expression of ICAM-1 in these cells. Stimulation of human umbilical vein endothelial cells with thrombin resulted in Ser(3) phosphorylation/inactivation of cofilin and formation of actin stress fibers in a ROCK-dependent manner. RNA interference knockdown of cofilin-1 stabilized the actin filaments and inhibited thrombin- and RhoA-induced NF-kappaB activity. Similarly, constitutively inactive mutant of cofilin-1 (Cof1-S3D), known to stabilize the actin cytoskeleton, inhibited NF-kappaB activity by thrombin. Overexpression of wild type cofilin-1 or constitutively active cofilin-1 mutant (Cof1-S3A), known to destabilize the actin cytoskeleton, also impaired thrombin-induced NF-kappaB activity. Additionally, depletion of cofilin-1 was associated with a marked reduction in ICAM-1 expression induced by thrombin. The effect of cofilin-1 depletion on NF-kappaB activity and ICAM-1 expression occurred downstream of IkappaBalpha degradation and was a result of impaired RelA/p65 nuclear translocation and consequently, RelA/p65 binding to DNA. Together, these data show that cofilin-1 occupies a central position in RhoA-actin pathway mediating nuclear translocation of RelA/p65 and expression of ICAM-1 in endothelial cells.
TLR3-mediated NF-{kappa}B signaling in human esophageal epithelial cells.
Lim, Diana M; Narasimhan, Sneha; Michaylira, Carmen Z; Wang, Mei-Lun
2009-12-01
Despite its position at the front line against ingested pathogens, very little is presently known about the role of the esophageal epithelium in host innate immune defense. As a key player in the innate immune response, Toll-like receptor (TLR) signaling has not been well characterized in human esophageal epithelial cells. In the present study, we investigated the inflammatory response and signaling pathways activated by TLR stimulation of human esophageal cells in vitro. Using quantitative RT-PCR, we profiled the expression pattern of human TLRs 1-10 in primary esophageal keratinocytes (EPC2), immortalized nontransformed esophageal keratinocytes (EPC2-hTERT), and normal human esophageal mucosal biopsies and found that TLRs 1, 2, 3, and 5 were expressed both in vivo and in vitro. Using the cytokine IL-8 as a physiological read out of the inflammatory response, we found that TLR3 is the most functional of the expressed TLRs in both primary and immortalized esophageal epithelial cell lines in response to its synthetic ligand polyinosinic polycytidylic acid [poly(I:C)]. Through reporter gene studies, we show that poly(I:C)-induced NF-kappaB activation is critical for the transactivation of the IL-8 promoter in vitro and that nuclear translocation of NF-kappaB occurs at an early time point following poly(I:C) stimulation of esophageal epithelial cells. Importantly, we also show that poly(I:C) stimulation induces the NF-kappaB-dependent esophageal epithelial expression of TLR2, leading to enhanced epithelial responsiveness of EPC2-hTERT cells to TLR2 ligand stimulation, suggesting an important regulatory role for TLR3-mediated NF-kappaB signaling in the innate immune response of esophageal epithelial cells. Our findings demonstrate for the first time that TLR3 is highly functional in the human esophageal epithelium and that TLR3-mediated NF-kappaB signaling may play an important regulatory role in esophageal epithelial homeostasis.
Lee, Sang Kil; Kim, Youn Wha; Chi, Sung-Gil; Joo, Yeong-Shil; Kim, Hyo Jong
2009-02-01
Saccharomyces boulardii (S. boulardii) has beneficial effects in the treatment of intestinal inflammation; however, little is known about the mechanisms by which these effects occur. We investigated the effects of S. boulardii on the expression of peroxisome proliferator-activated receptor-gamma (PPAR-gamma) and interleukin-8 (IL-8), using human HT-29 colonocytes and a rat model of trinitrobenzene sulfonic acid (TNBS)-induced colitis. The effect of S. boulardii on gene expression was assessed by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), and Northern blot and Western blot assays. Pharmacological inhibitors for various signaling pathways were used to determine the signaling pathways implicated in the S. boulardii regulation of PPAR-gamma and IL-8. We found that S. boulardii up-regulated and down-regulated PPAR-gamma and IL-8 expression at the transcription level, both in vitro and in vivo (P < 0.05, respectively). Saccharomyces boulardii blocked tumor necrosis factor-alpha (TNF-alpha) regulation of PPAR-gamma and IL-8 through disruption of TNF-alpha-mediated nuclear factor kappa B (NF-kappaB) activation. Furthermore, S. boulardii suppressed colitis and expression of pro-inflammatory cytokine genes in vivo (P < 0.05, respectively). Our study demonstrated that S. boulardii reduces colonic inflammation and regulates inflammatory gene expression.
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-07-14
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
Perez, J R; Higgins-Sochaski, K A; Maltese, J Y; Narayanan, R
1994-01-01
The NF-kappa B transcription factor is a pleiotropic activator that participates in the induction of a wide variety of cellular genes. Antisense oligomer inhibition of the RelA subunit of NF-kappa B results in a block of cellular adhesion and inhibition of tumor cell growth. Investigation of the molecular basis for these effects showed that in vitro inhibition of the growth of transformed fibroblasts by relA antisense oligonucleotides can be reversed by the parental-cell-conditioned medium. Cytokine profile analysis of these cells treated with relA antisense oligonucleotides revealed inhibition of transforming growth factor beta 1 (TGF-beta 1 to the transformed fibroblasts reversed the inhibitory effects of relA antisense oligomers on soft agar colony formation and cell adhesion to the substratum. Direct inhibition of TGF-beta 1 expression by antisense phosphorothioates to TGF-beta 1 mimicked the in vitro effects of blocking cell adhesion that are elicited by antisense relA oligomers. These results may explain the in vitro effects of relA antisense oligomers on fibrosarcoma cell growth and adhesion. Images PMID:8035811
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Yongmin; IgE Therapeutics, Inc., San Diego, CA 92121-2233; Barankiewicz, Teresa J.
2007-07-27
Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes onmore » either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.« less
Anti-inflammatory effects of the roots of Alpinia pricei Hayata and its phenolic compounds.
Yu, Yu-Shan; Hsu, Chin-Lin; Yen, Gow-Chin
2009-09-09
Alpinia pricei Hayata is cultivated throughout Asia and is an endemic plant in Taiwan. The leaf and root of this plant are used for traditional wrapping of food and as a cooking substitute for fresh ginger. The aim of this work was to study the in vitro anti-inflammatory effects of ethanol extracts from A. pricei Hayata (EEAP) and its phenolic compounds. High-performance liquid chromatography (HPLC) profiling indicated that EEAP contained caffeic acid, chlorogenic acid, ferulic acid, p-hydroxybenzoic acid, rutin, apigenin, curcumin and pinocembrin. EEAP and its phenolic compounds, apigenin, curcumin, and pinocembrin, inhibited lipopolysaccharide (LPS)-stimulated nitric oxide (NO) and prostaglandin E(2) (PGE(2)) production in RAW 264.7 cells. Furthermore, EEAP, apigenin, curcumin, and pinocembrin decreased LPS-mediated induction of protein and mRNA expression of inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) in RAW 264.7 cells. In addition, EEAP and its major active compound pinocembrin inhibited LPS-induced nuclear translocation of nuclear factor-kappaB (NF-kappaB) and NF-kappaB-mediated reporter gene expression. EEAP and pinocembrin also significantly inhibited LPS-induced intracellular reactive oxygen species (ROS) production in RAW 264.7 cells. When these results are taken together, they indicate that EEAP and pinocembrin suppressed LPS-induced NO and PGE(2) production by inhibition of NF-kappaB nuclear translocation and ROS generation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, T.-L.; Chang, C.-C.; Lin, Y.-L.
2009-10-01
Ketamine may affect the host immunity. Interleukin-1{beta} (IL-1{beta}), IL-6, and tumor necrosis factor-{alpha} (TNF-{alpha}) are pivotal cytokines produced by macrophages. This study aimed to evaluate the effects of ketamine on the regulation of inflammatory cytokine gene expression, especially IL-1{beta}, in lipopolysaccharide (LPS)-activated murine macrophage-like Raw 264.7 cells and its possible signal-transducing mechanisms. Administration of Raw 264.7 cells with a therapeutic concentration of ketamine (100 {mu}M), LPS, or a combination of ketamine and LPS for 1, 6, and 24 h was not cytotoxic to macrophages. Exposure to 100 {mu}M ketamine decreased the binding affinity of LPS and LPS-binding protein but didmore » not affect LPS-induced RNA and protein synthesis of TLR4. Treatment with LPS significantly increased IL-1{beta}, IL-6, and TNF-{alpha} gene expressions in Raw 264.7 cells. Ketamine at a clinically relevant concentration did not affect the synthesis of these inflammatory cytokines, but significantly decreased LPS-caused increases in these cytokines. Immunoblot analyses, an electrophoretic mobility shift assay, and a reporter luciferase activity assay revealed that ketamine significantly decreased LPS-induced translocation and DNA binding activity of nuclear factor-kappa B (NF{kappa}B). Administration of LPS sequentially increased the phosphorylations of Ras, Raf, MEK1/2, ERK1/2, and IKK. However, a therapeutic concentration of ketamine alleviated such augmentations. Application of toll-like receptor 4 (TLR4) small interfering (si)RNA reduced cellular TLR4 amounts and ameliorated LPS-induced RAS activation and IL-1{beta} synthesis. Co-treatment with ketamine and TLR4 siRNA synergistically ameliorated LPS-caused enhancement of IL-1{beta} production. Results of this study show that a therapeutic concentration of ketamine can inhibit gene expression of IL-1{beta} possibly through suppressing TLR4-mediated signal-transducing phosphorylations of Ras, Raf, MEK1/2, ERK1/2, and IKK and subsequent translocation and transactivation of NF{kappa}B.« less
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee
2006-12-08
Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPKmore » signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.« less
Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P
1989-01-01
UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547
Dong, Shan-Shan; Liu, Xiao-Gang; Chen, Yuan; Guo, Yan; Wang, Liang; Zhao, Jian; Xiong, Dong-Hai; Xu, Xiang-Hong; Recker, Robert R; Deng, Hong-Wen
2009-08-01
Femoral neck compression strength index (fCSI), a novel phenotypic parameter that integrates bone density, bone size, and body size, has significant potential to improve hip fracture risk assessment. The genetic factors underlying variations in fCSI, however, remain largely unknown. Given the important roles of the receptor activator of the nuclear factor-kappaB ligand/receptor activator of the nuclear factor-kappaB/osteoprotegerin (RANKL/RANK/OPG) pathway in the regulation of bone remodeling, we tested the associations between RANKL/RANK/OPG polymorphisms and variations in fCSI as well as its components (femoral neck bone mineral density [fBMD], femoral neck width [FNW], and weight). This was accomplished with a sample comprising 1873 subjects from 405 Caucasian nuclear families. Of the 37 total SNPs studied in these three genes, 3 SNPs, namely, rs12585014, rs7988338, and rs2148073, of RANKL were significantly associated with fCSI (P = 0.0007, 0.0007, and 0.0005, respectively) after conservative Bonferroni correction. Moreover, the three SNPs were approximately in complete linkage disequilibrium. Haplotype-based association tests corroborated the single-SNP results since haplotype 1 of block 1 of the RANKL gene achieved an even more significant association with fCSI (P = 0.0003) than any of the individual SNPs. However, we did not detect any significant associations of these genes with fBMD, FNW, or weight. In summary, our findings suggest that the RANKL gene may play an important role in variation in fCSI, independent of fBMD and non-fBMD components.
Marui, N; Offermann, M K; Swerlick, R; Kunsch, C; Rosen, C A; Ahmad, M; Alexander, R W; Medford, R M
1993-01-01
Oxidative stress and expression of the vascular cell adhesion molecule-1 (VCAM-1) on vascular endothelial cells are early features in the pathogenesis of atherosclerosis and other inflammatory diseases. Regulation of VCAM-1 gene expression may be coupled to oxidative stress through specific reduction-oxidation (redox) sensitive transcriptional or posttranscriptional regulatory factors. In cultured human umbilical vein endothelial (HUVE) cells, the cytokine interleukin 1 beta (IL-1 beta) activated VCAM-1 gene expression through a mechanism that was repressed approximately 90% by the antioxidants pyrrolidine dithiocarbamate (PDTC) and N-acetylcysteine (NAC). Furthermore, PDTC selectively inhibited the induction of VCAM-1, but not intercellular adhesion molecule-1 (ICAM-1), mRNA and protein accumulation by the cytokine tumor necrosis factor-alpha (TNF alpha) as well as the noncytokines bacterial endotoxin lipopolysaccharide (LPS) and double-stranded RNA, poly(I:C) (PIC). PDTC also markedly attenuated TNF alpha induction of VCAM-1-mediated cellular adhesion. In a distinct pattern, PDTC partially inhibited E-selectin gene expression in response to TNF alpha but not to LPS, IL-1 beta, or PIC. TNF alpha and LPS-mediated transcriptional activation of the human VCAM-1 promoter through NF-kappa B-like DNA enhancer elements and associated NF-kappa B-like DNA binding proteins was inhibited by PDTC. These studies suggest a molecular linkage between an antioxidant sensitive transcriptional regulatory mechanism and VCAM-1 gene expression that expands on the notion of oxidative stress as an important regulatory signal in the pathogenesis of atherosclerosis. Images PMID:7691889
Bai, Xiang-jun; Li, Bo; Wang, Hai-ping; Yang, Zhao-hui; Li, Si-qi
2007-01-01
To investigate the mechanism of the action of glucocorticoid induced leucine zipper (GILZ) in inflammatory reaction. Human monocyte cell line THP-1 cells were divided into two groups and cultured in non-serum RPMI1640 medium.In one group the cells were treated with dexamethasone (DEX). Twelve hours later total RNA and total protein were abstracted in both two groups. The mRNA encoding for expression of GILZ was semiquantitatively detected by reserve transcriptase-polymerase chain reaction (RT-PCR). Protein expression of nuclear factor-KappaB (NF-KappaB) p65 and activator protein-1 (AP-1) were assessed by Western blotting. Peripheral blood of 10 trauma patients [injury severity score (ISS) >or=16 scores] were collected and the leukocytes were isolated within 24 hours after trauma. The leukocytes were divided into two groups and cultured in non-serum medium. In one group the cells were treated with DEX. Twelve hours later total RNA and total protein were abstracted in both two groups. The mRNA encoding for expression of GILZ was semiquantitatively detected by RT-PCR. Protein expression of NF-KappaB p65 and AP-1 were assessed by Western blotting. Stimulated by DEX, the expression of GILZ mRNA was increased both in THP-1 cells and the leukocytes of trauma patients compared with those of control groups (both P<0.01). Whereas, protein expressions of NF-KappaB p65 and AP-1 of THP-1 cells and leukocytes in peripheral blood of trauma patients were decreased in the stimulation groups compared with those of control groups (all P<0.01). The expression of GILZ gene is up-regulated by glucocorticoid. Overexpression of GILZ inhibits NF-KappaB and AP-1 activities, suggesting that GILZ possesses anti-inflammatory function.
Sahingur, S E; Xia, X-J; Alamgir, S; Honma, K; Sharma, A; Schenkein, H A
2010-04-01
Toll-like receptor 9 (TLR9) expression is increased in periodontally diseased tissues compared with healthy sites indicating a possible role of TLR9 and its ligand, bacterial DNA (bDNA), in periodontal disease pathology. Here, we determine the immunostimulatory effects of periodontal bDNA in human monocytic cells (THP-1). THP-1 cells were stimulated with DNA of two putative periodontal pathogens: Porphyromonas gingivalis and Tannerella forsythia. The role of TLR9 in periodontal bDNA-initiated cytokine production was determined either by blocking TLR9 signaling in THP-1 cells with chloroquine or by measuring IL-8 production and nuclear factor-kappaB (NF-kappaB) activation in HEK293 cells stably transfected with human TLR9. Cytokine production (IL-1beta, IL-6, and TNF-alpha) was increased significantly in bDNA-stimulated cells compared with controls. Chloroquine treatment of THP-1 cells decreased cytokine production, suggesting that TLR9-mediated signaling pathways are operant in the recognition of DNA from periodontal pathogens. Compared with native HEK293 cells, TLR9-transfected cells demonstrated significantly increased IL-8 production (P < 0.001) and NF-kappaB activation in response to bDNA, further confirming the role of TLR9 in periodontal bDNA recognition. The results of PCR arrays demonstrated upregulation of proinflammatory cytokine and NF-kappaB genes in response to periodontal bDNA in THP-1 cells, suggesting that cytokine induction is through NF-kappaB activation. Hence, immune responses triggered by periodontal bacterial nucleic acids may contribute to periodontal disease pathology by inducing proinflammatory cytokine production through the TLR9 signaling pathway.
Tsapakidis, Konstantinos; Vlachostergios, Panagiotis J; Voutsadakis, Ioannis A; Befani, Christina D; Patrikidou, Anna; Hatzidaki, Eleana; Daliani, Danai D; Moutzouris, George; Liakos, Panagiotis; Papandreou, Christos N
2012-06-01
Neuropeptides are important signal initiators in advanced prostate cancer, partially acting through activation of nuclear factor kappa B. Central to nuclear factor kappa B regulation is the ubiquitin-proteasome system, pharmacological inhibition of which has been proposed as an anticancer strategy. We investigated the putative role of the proteasome inhibitor bortezomib in neuropeptides signaling effects on prostate cancer cells. Human prostate cancer cell lines, LNCaP and PC-3, were used to examine cell proliferation, levels of proapoptotic (caspase-3, Bad) and cell cycle regulatory proteins (p53, p27, p21), as well as total and phosphorylated Akt and p44/42 mitogen-activated protein kinase proteins. Furthermore, 20S proteasome activity, subcellular localization of nuclear factor kappa B and transcription of nuclear factor kappa B target genes, interleukin-8 and vascular endothelial growth factor, were assessed. Neuropeptides (endothelin-1, bombesin) increased cell proliferation, whereas bortezomib decreased proliferation and induced apoptosis, an effect maintained after cotreatment with neuropeptides. Bad, p53, p21 and p27 were downregulated by neuropeptides in PC-3, and these effects were reversed with the addition of bortezomib. Neuropeptides increased proteasomal activity and nuclear factor kappa B levels in PC-3, and these effects were prevented by bortezomib. Interleukin-8 and vascular endothelial growth factor transcripts were induced after neuropeptides treatment, but downregulated by bortezomib. These results coincided with the ability of bortezomib to reduce mitogen-activated protein kinase signaling in both cell lines. These findings are consistent with bortezomib-mediated abrogation of neuropeptides-induced proliferative and antiapoptotic signaling. Thus, the effect of the drug on the neuropeptides axis needs to be further investigated, as neuropeptide action in prostate cancer might entail involvement of the proteasome. © 2012 The Japanese Urological Association.
Dutta, Jui; Fan, Gaofeng; Gélinas, Céline
2008-11-01
The Rel/NF-kappaB transcription factors are constitutively activated in many human cancers. The Rel proteins in this family are implicated in leukemia/lymphomagenesis, but the mechanism is not completely understood. Previous studies showed that the transcription activation domains (TADs) of the viral oncoprotein v-Rel and its cellular Rel/NF-kappaB homologues c-Rel and RelA are key determinants of their different transforming activities in primary lymphocytes. Substitution of a Rel TAD for that of RelA conferred a strong transforming phenotype upon RelA, which otherwise failed to transform cells. To gain insights into protein interactions that influence cell transformation by the Rel TADs, we identified factors that interact with the TAD of v-Rel, the most oncogenic member of the Rel/NF-kappaB family. We report that the coactivator for transcription factors AP-1 and estrogen receptors, CAPERalpha, interacts with the v-Rel TAD and potently synergizes v-Rel-mediated transactivation. Importantly, coexpression of CAPERalpha markedly reduced and delayed v-Rel's transforming activity in primary lymphocytes, whereas a dominant-negative mutant enhanced the kinetics of v-Rel-mediated transformation. Furthermore, small interfering RNA-mediated knockdown of CAPERalpha in v-Rel-transformed lymphocytes significantly enhanced colony formation in soft agar. Since the potency of Rel-mediated transactivation is an important determinant of lymphocyte transformation, as is Rel's ability to induce transcriptional repression, these data suggest that CAPERalpha's interaction with the Rel TAD could modulate Rel/NF-kappaB's transforming activity by facilitating expression or dampening repression of specific gene subsets important for oncogenesis. Overall, this study identifies CAPERalpha as a new transcriptional coregulator for v-Rel and reveals an important role in modulating Rel's oncogenic activity.
Application of the kappa-omega Turbulence Model to Quasi-Three-Dimensional Turbomachinery Flows
NASA Technical Reports Server (NTRS)
Chima, Rodrick V.
1996-01-01
Many computational fluid dynamics codes for turbomachinery use the Baldwin-Lomax (B-L) turbulence model. It is easy to implement in two dimensions and works well for predicting overall turbomachinery performance. However, it is awkward to implement in three dimensions, often has difficulty finding the length scale, has a crude transition model, and neglects freestream turbulence, surface roughness, and mass injection. The kappa-omega model developed by Wilcox is an appealing alternative for several reasons. First, it is the only two-equation model that can be integrated to the wall without requiring damping functions or the distance to the wall, and hence, should behave well numerically. Second, the effects of freestream turbulence, surface roughness, and mass injection are easily included in the model. Finally, transition can be simulated using the low Reynolds number version of the model. Menter applied the kappa-model to external flows and showed very good results for flows with adverse pressure gradients. Liu and Zheng described their implementation of the kappa-model in a cascade code that included an area change term to account for endwall convergence. They validated the model for a flat plate, and compared the B-L and kappa-models to measured surface pressures for a low-pressure turbine cascade. Since they did not use the low Reynolds number version of the model, their results showed problems resulting from early transition. In this Note the low Reynolds number kappa-model was incorporated in the author's quasi-three-dimensional turbomachinery analysis code. The code includes the effects of rotation, radius change, and stream-surface thickness variation, and also includes the B-L turbulence model. The kappa-omega model was implemented using many of Menter's recommendations and an implicit approximate-factorization scheme described by Baldwin and Barth. The model was tested for a transonic compressor with rotation and variable stream-surface radius and height, and for a transonic turbine vane with transition and heat transfer. Results were compared to the B-L model and to experimental data.
Harris, Katherine E; Aldred, Shelley Force; Davison, Laura M; Ogana, Heather Anne N; Boudreau, Andrew; Brüggemann, Marianne; Osborn, Michael; Ma, Biao; Buelow, Benjamin; Clarke, Starlynn C; Dang, Kevin H; Iyer, Suhasini; Jorgensen, Brett; Pham, Duy T; Pratap, Payal P; Rangaswamy, Udaya S; Schellenberger, Ute; van Schooten, Wim C; Ugamraj, Harshad S; Vafa, Omid; Buelow, Roland; Trinklein, Nathan D
2018-01-01
We created a novel transgenic rat that expresses human antibodies comprising a diverse repertoire of heavy chains with a single common rearranged kappa light chain (IgKV3-15-JK1). This fixed light chain animal, called OmniFlic, presents a unique system for human therapeutic antibody discovery and a model to study heavy chain repertoire diversity in the context of a constant light chain. The purpose of this study was to analyze heavy chain variable gene usage, clonotype diversity, and to describe the sequence characteristics of antigen-specific monoclonal antibodies (mAbs) isolated from immunized OmniFlic animals. Using next-generation sequencing antibody repertoire analysis, we measured heavy chain variable gene usage and the diversity of clonotypes present in the lymph node germinal centers of 75 OmniFlic rats immunized with 9 different protein antigens. Furthermore, we expressed 2,560 unique heavy chain sequences sampled from a diverse set of clonotypes as fixed light chain antibody proteins and measured their binding to antigen by ELISA. Finally, we measured patterns and overall levels of somatic hypermutation in the full B-cell repertoire and in the 2,560 mAbs tested for binding. The results demonstrate that OmniFlic animals produce an abundance of antigen-specific antibodies with heavy chain clonotype diversity that is similar to what has been described with unrestricted light chain use in mammals. In addition, we show that sequence-based discovery is a highly effective and efficient way to identify a large number of diverse monoclonal antibodies to a protein target of interest.
Reliability of Soft Tissue Model Based Implant Surgical Guides; A Methodological Mistake.
Sabour, Siamak; Dastjerdi, Elahe Vahid
2012-08-20
Abstract We were interested to read the paper by Maney P and colleagues published in the July 2012 issue of J Oral Implantol. The authors aimed to assess the reliability of soft tissue model based implant surgical guides reported that the accuracy was evaluated using software. 1 I found the manuscript title of Maney P, et al. incorrect and misleading. Moreover, they reported twenty-two sites (46.81%) were considered accurate (13 of 24 maxillary and 9 of 23 mandibular sites). As the authors point out in their conclusion, Soft tissue models do not always provide sufficient accuracy for implant surgical guide fabrication.Reliability (precision) and validity (accuracy) are two different methodological issues in researches. Sensitivity, specificity, PPV, NPV, likelihood ratio positive (true positive/false negative) and likelihood ratio negative (false positive/ true negative) as well as odds ratio (true results\\false results - preferably more than 50) are among the tests to evaluate the validity (accuracy) of a single test compared to a gold standard.2-4 It is not clear that the reported twenty-two sites (46.81%) which were considered accurate related to which of the above mentioned estimates for validity analysis. Reliability (repeatability or reproducibility) is being assessed by different statistical tests such as Pearson r, least square and paired t.test which all of them are among common mistakes in reliability analysis 5. Briefly, for quantitative variable Intra Class Correlation Coefficient (ICC) and for qualitative variables weighted kappa should be used with caution because kappa has its own limitation too. Regarding reliability or agreement, it is good to know that for computing kappa value, just concordant cells are being considered, whereas discordant cells should also be taking into account in order to reach a correct estimation of agreement (Weighted kappa).2-4 As a take home message, for reliability and validity analysis, appropriate tests should be applied.
Leiro, J; García, D; Arranz, J A; Delgado, R; Sanmartín, M L; Orallo, F
2004-08-01
This study investigated the effects of an aqueous extract of the stem bark of Mangifera indica L. (Anacardiaceae; Vimang), which contains a defined mixture of components including polyphenols (principally mangiferin, MA), triterpenes, phytosteroids, fatty acids and microelements, on expression of inflammation mediators in inflammatory murine macrophages after stimulation in vitro with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma). In vitro treatment with Vimang at 4 microg/ml reduced levels of NOS-2 mRNA and NOS-2, while treatment at 40 microg/ml also reduced levels of COX-2 mRNA, COX-2, and prostaglandin E2 (PGE2). Results suggested that MA is involved in these effects. In vitro treatment with Vimang at 40 microg/ml also inhibited mRNA levels of the proinflammatory cytokines interleukin 1beta (IL-1beta), tumor necrosis factor alpha (TNF-alpha) and colony-stimulating factor (GM-CSF), but did not affect mRNA levels of IL-6 or tumor growth factor-beta (TGF-beta). Extracellular release of TNF-alpha by inflammatory macrophages was inhibited by in vitro treatment with Vimang at the same concentrations that showed inhibition of TNF-alpha mRNA levels. The inhibition of TNF-alpha production appears to be at least partially attributable to MA. Vimang at 4 microg/ml decreased mRNA levels of nuclear factor-kappaB (NF-kappaB) but did not affect expression of the NF-kappaB inhibitor (IkappaB). These data indicate that the potent anti-inflammatory effects of Vimang are due to selective modulation of the expression of inflammation-related genes, leading to attenuation of macrophage activation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakao, Atsunori; Thomas E Starzl Transplantation Institute, University of Pittsburgh Medical Center, Pittsburgh, PA 15213; Kaczorowski, David J.
2008-03-14
Galantamine, a reversible inhibitor of acetylcholine esterase (AChE), is a novel drug treatment for mild to moderate Alzheimer's disease and vascular dementia. Interestingly, it has been suggested that galantamine treatment is associated with more clinical benefit in patients with mild-to-moderate Alzheimer disease compared to other AChE inhibitors. We hypothesized that the protective effects of galantamine would involve induction of the protective gene, heme oxygenase-1 (HO-1), in addition to enhancement of the cholinergic system. Brain microvascular endothelial cells (mvECs) were isolated from spontaneous hypertensive rats. Galantamine significantly reduced H{sub 2}O{sub 2}-induced cell death of mvECs in association with HO-1 induction. Thesemore » protective effects were completely reversed by nuclear factor-{kappa}B (NF-{kappa}B) inhibition or HO inhibition. Furthermore, galantamine failed to induce HO-1 in mvECs which lack inducible nitric oxide synthase (iNOS), supplementation of a nitric oxide (NO) donor or iNOS gene transfection on iNOS-deficient mvECs resulted in HO-1 induction with galantamine. These data suggest that the protective effects of galantamine require NF-{kappa}B activation and iNOS expression, in addition to HO-1. Likewise, carbon monoxide (CO), one of the byproducts of HO, up-regulated HO-1 and protected mvECs from oxidative stress in a similar manner. Our data demonstrate that galantamine mediates cytoprotective effects on mvECs through induction HO-1. This pharmacological action of galantamine may, at least in part, account for the superior clinical efficacy of galantamine in vascular dementia and Alzheimer disease.« less
Watanabe, N; Sakakibara, J; Hovanessian, A G; Taniguchi, T; Fujita, T
1991-01-01
Expression of the Type I IFN (i.e., IFN-alpha s and IFN-beta) genes is efficiently induced by viruses at the transcriptional level. This induction is mediated by at least two types of positive regulatory elements located in the human IFN-beta gene promoter: (1) the repeated elements which bind both the transcriptional activator IRF-1 and the repressor IRF-2 (IRF-elements; IRF-Es), and (2) the kappa B element (kappa B-E), which binds NF kappa B and is located between the IRF-Es and the TATA box. In this study we demonstrate that a promoter containing synthetic IRF-E, which displays high affinity for the IRFs can be efficiently activated by Newcastle disease virus (NDV). In contrast, such activation was either very weak or nil when cells were treated by IFN-beta or tumor necrosis factor-alpha (TNF-alpha), despite the fact they both efficiently induce de novo synthesis of the short-lived IRF-1 in L929 cells. In fact, efficient activation of the IRF-E apparently requires an event in addition to de novo IRF-1 induction, which can be elicited by NDV even in the presence of protein synthesis inhibitor, cycloheximide. Moreover, efficient activation of the IRF-E by NDV is specifically inhibited by the protein kinase inhibitor, Staurosporin. Hence our results suggest the importance of IRF-1 synthesis and post-translational modification event(s), possibly phosphorylation for the efficient activation of IRF-Es, which are otherwise under negative regulation by IRF-2. Images PMID:1886766
Lefèvre, Christophe M; Sharp, Julie A; Nicholas, Kevin R
2009-01-01
Using a milk-cell cDNA sequencing approach we characterised milk-protein sequences from two monotreme species, platypus (Ornithorhynchus anatinus) and echidna (Tachyglossus aculeatus) and found a full set of caseins and casein variants. The genomic organisation of the platypus casein locus is compared with other mammalian genomes, including the marsupial opossum and several eutherians. Physical linkage of casein genes has been seen in the casein loci of all mammalian genomes examined and we confirm that this is also observed in platypus. However, we show that a recent duplication of beta-casein occurred in the monotreme lineage, as opposed to more ancient duplications of alpha-casein in the eutherian lineage, while marsupials possess only single copies of alpha- and beta-caseins. Despite this variability, the close proximity of the main alpha- and beta-casein genes in an inverted tail-tail orientation and the relative orientation of the more distant kappa-casein genes are similar in all mammalian genome sequences so far available. Overall, the conservation of the genomic organisation of the caseins indicates the early, pre-monotreme development of the fundamental role of caseins during lactation. In contrast, the lineage-specific gene duplications that have occurred within the casein locus of monotremes and eutherians but not marsupials, which may have lost part of the ancestral casein locus, emphasises the independent selection on milk provision strategies to the young, most likely linked to different developmental strategies. The monotremes therefore provide insight into the ancestral drivers for lactation and how these have adapted in different lineages.
1998-01-01
the conduct of research involving hazardous organisms, the investigator(s) adhered to the CDC-NIH Guide for Biosafetv in Microbiological and...Misinterpretation and misuse of the kappa statistic. American Journal of Epidemiology, 1987. 126: p. 161-169. 23. Soeken. K.L. and P.A. Prescott
Davis, Chester L; Pierce, John R; Henderson, William; Spencer, C David; Tyler, Christine; Langberg, Robert; Swafford, Jennan; Felan, Gladys S; Kearns, Martha A; Booker, Brigitte
2007-04-01
The Office of the Medical Inspector of the Department of Veterans Affairs (VA) studied the reliability of data collected by the VA's National Surgical Quality Improvement Program (NSQIP). The study focused on case selection bias, accuracy of reports on patients who died, and interrater reliability measurements of patient risk variables and outcomes. Surgical data from a sample of 15 VA medical centers were analyzed. For case selection bias, reviewers applied NSQIP criteria to include or exclude 2,460 patients from the database, comparing their results with those of NSQIP staff. For accurate reporting of patients who died, reviewers compared Social Security numbers of 10,444 NSQIP records with those found in the VA Beneficiary Identification and Records Locator Subsystem, VA Patient Treatment Files, and Social Security Administration death files. For measurement of interrater reliability, reviewers reabstracted 59 variables in each of 550 patient medical records that also were recorded in the NSQIP database. On case selection bias, the reviewers agreed with NSQIP decisions on 2,418 (98%) of the 2,460 cases. Computer record matching identified 4 more deaths than the NSQIP total of 198, a difference of about 2%. For 52 of the categorical variables, agreement, uncorrected for chance, was 96%. For 48 of 52 categorical variables, kappas ranged from 0.61 to 1.0 (substantial to almost perfect agreement); none of the variables had kappas of less than 0.20 (slight to poor agreement). This sample of medical centers shows adherence to criteria in selecting cases for the NSQIP database, for reporting deaths, and for collecting patient risk variables.
Comparison modeling for alpine vegetation distribution in an arid area.
Zhou, Jihua; Lai, Liming; Guan, Tianyu; Cai, Wetao; Gao, Nannan; Zhang, Xiaolong; Yang, Dawen; Cong, Zhentao; Zheng, Yuanrun
2016-07-01
Mapping and modeling vegetation distribution are fundamental topics in vegetation ecology. With the rise of powerful new statistical techniques and GIS tools, the development of predictive vegetation distribution models has increased rapidly. However, modeling alpine vegetation with high accuracy in arid areas is still a challenge because of the complexity and heterogeneity of the environment. Here, we used a set of 70 variables from ASTER GDEM, WorldClim, and Landsat-8 OLI (land surface albedo and spectral vegetation indices) data with decision tree (DT), maximum likelihood classification (MLC), and random forest (RF) models to discriminate the eight vegetation groups and 19 vegetation formations in the upper reaches of the Heihe River Basin in the Qilian Mountains, northwest China. The combination of variables clearly discriminated vegetation groups but failed to discriminate vegetation formations. Different variable combinations performed differently in each type of model, but the most consistently important parameter in alpine vegetation modeling was elevation. The best RF model was more accurate for vegetation modeling compared with the DT and MLC models for this alpine region, with an overall accuracy of 75 % and a kappa coefficient of 0.64 verified against field point data and an overall accuracy of 65 % and a kappa of 0.52 verified against vegetation map data. The accuracy of regional vegetation modeling differed depending on the variable combinations and models, resulting in different classifications for specific vegetation groups.
Varga, Zsuzsanna; Cassoly, Estelle; Li, Qiyu; Oehlschlegel, Christian; Tapia, Coya; Lehr, Hans Anton; Klingbiel, Dirk; Thürlimann, Beat; Ruhstaller, Thomas
2015-01-01
Background Proliferative activity (Ki-67 Labelling Index) in breast cancer increasingly serves as an additional tool in the decision for or against adjuvant chemotherapy in midrange hormone receptor positive breast cancer. Ki-67 Index has been previously shown to suffer from high inter-observer variability especially in midrange (G2) breast carcinomas. In this study we conducted a systematic approach using different Ki-67 assessments on large tissue sections in order to identify the method with the highest reliability and the lowest variability. Materials and Methods Five breast pathologists retrospectively analyzed proliferative activity of 50 G2 invasive breast carcinomas using large tissue sections by assessing Ki-67 immunohistochemistry. Ki-67-assessments were done on light microscopy and on digital images following these methods: 1) assessing five regions, 2) assessing only darkly stained nuclei and 3) considering only condensed proliferative areas (‘hotspots’). An individual review (the first described assessment from 2008) was also performed. The assessments on light microscopy were done by estimating. All measurements were performed three times. Inter-observer and intra-observer reliabilities were calculated using the approach proposed by Eliasziw et al. Clinical cutoffs (14% and 20%) were tested using Fleiss’ Kappa. Results There was a good intra-observer reliability in 5 of 7 methods (ICC: 0.76–0.89). The two highest inter-observer reliability was fair to moderate (ICC: 0.71 and 0.74) in 2 methods (region-analysis and individual-review) on light microscopy. Fleiss’-kappa-values (14% cut-off) were the highest (moderate) using the original recommendation on light-microscope (Kappa 0.58). Fleiss’ kappa values (20% cut-off) were the highest (Kappa 0.48 each) in analyzing hotspots on light-microscopy and digital-analysis. No methodologies using digital-analysis were superior to the methods on light microscope. Conclusion Our results show that all methods on light-microscopy for Ki-67 assessment in large tissue sections resulted in a good intra-observer reliability. Region analysis and individual review (the original recommendation) on light-microscopy yielded the highest inter-observer reliability. These results show slight improvement to previously published data on poor-reproducibility and thus might be a practical-pragmatic way for routine assessment of Ki-67 Index in G2 breast carcinomas. PMID:25885288
The discovery of thienopyridine analogues as potent IkappaB kinase beta inhibitors. Part II.
Wu, Jiang-Ping; Fleck, Roman; Brickwood, Janice; Capolino, Alison; Catron, Katrina; Chen, Zhidong; Cywin, Charles; Emeigh, Jonathan; Foerst, Melissa; Ginn, John; Hrapchak, Matt; Hickey, Eugene; Hao, Ming-Hong; Kashem, Mohammed; Li, Jun; Liu, Weimin; Morwick, Tina; Nelson, Richard; Marshall, Daniel; Martin, Leslie; Nemoto, Peter; Potocki, Ian; Liuzzi, Michel; Peet, Gregory W; Scouten, Erika; Stefany, David; Turner, Michael; Weldon, Steve; Zimmitti, Clare; Spero, Denise; Kelly, Terence A
2009-10-01
An SAR study that identified a series of thienopyridine-based potent IkappaB Kinase beta (IKKbeta) inhibitors is described. With focuses on the structural optimization at C4 and C6 of structure 1 (Fig. 1), the study reveals that small alkyl and certain aromatic groups are preferred at C4, whereas polar groups with proper orientation at C6 efficiently enhance compound potency. The most potent analogues inhibit IKKbeta with IC50s as low as 40 nM, suppress LPS-induced TNF-alpha production in vitro and in vivo, display good kinase selectivity profiles, and are active in a HeLa cell NF-kappaB reporter gene assay, demonstrating that they directly interfere with the NF-kappaB signaling pathway.
Munarriz, Pablo M; Paredes, Igor; Alén, José F; Castaño-Leon, Ana M; Cepeda, Santiago; Hernandez-Lain, Aurelio; Lagares, Alfonso
The use of histological degeneration scores in surgically-treated herniated lumbar discs is not common in clinical practice and its use has been primarily restricted to research. The objective of this study is to evaluate if there is an association between a higher grade of histological degeneration when compared with clinical or radiological parameters. Retrospective consecutive analysis of 122 patients who underwent single-segment lumbar disc herniation surgery. Clinical information was available on all patients, while the histological study and preoperative magnetic resonance imaging were also retrieved for 75 patients. Clinical variables included age, duration of symptoms, neurological deficits, or affected deep tendon reflex. The preoperative magnetic resonance imaging was evaluated using Modic and Pfirrmann scores for the affected segment by 2 independent observers. Histological degeneration was evaluated using Weiler's score; the presence of inflammatory infiltrates and neovascularization, not included in the score, were also studied. Correlation and chi-square tests were used to assess the association between histological variables and clinical or radiological variables. Interobserver agreement was also evaluated for the MRI variables using weighted kappa. No statistically significant correlation was found between histological variables (histological degeneration score, inflammatory infiltrates or neovascularization) and clinical or radiological variables. Interobserver agreement for radiological scores resulted in a kappa of 0.79 for the Pfirrmann scale and 0.65 for the Modic scale, both statistically significant. In our series of patients, we could not demonstrate any correlation between the degree of histological degeneration or the presence of inflammatory infiltrates when compared with radiological degeneration scales or clinical variables such as the patient's age or duration of symptoms. Copyright © 2017 Sociedad Española de Neurocirugía. Publicado por Elsevier España, S.L.U. All rights reserved.
Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír
2016-01-01
We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.
Lovelock, Caroline E; Anslow, Philip; Molyneux, Andrew J; Byrne, James V; Kuker, Wilhelm; Pretorius, Pieter M; Coull, Andrew; Rothwell, Peter M
2009-12-01
CT remains the most commonly used imaging technique in acute stroke but is often delayed after minor stroke. Interobserver reliability in distinguishing hemorrhagic transformation of infarction from intracerebral hemorrhage may depend on delays to CT but has not been reported previously despite the clinical importance of this distinction. Initial CT scans with intraparenchymal hematoma from the first 1000 patients with stroke in the Oxford Vascular Study were independently categorized as intracerebral hemorrhage or hemorrhagic transformation of infarction by 5 neuroradiologists, both blinded and unblinded to clinical history. Thirty scans were reviewed twice. Agreement was quantified by the kappa statistic. Seventy-eight scans showed intraparenchymal hematoma. Blinded pairwise interrater agreements for a diagnosis of intracerebral hemorrhage ranged from kappa=0.15 to 0.48 with poor overall agreement (kappa=0.35; 95% CI, 0.15 to 0.54) even after unblinding (kappa=0.41; 0.21 to 0.60). Blinded intrarater agreements ranged from kappa=0.21 to 0.92. Lack of consensus after unblinding was greatest in patients scanned >or=24 hours after stroke onset (67% versus 25%, P=0.001) and in minor stroke (National Institutes of Health Stroke Scale
Chapman, Cary B; Herrera, Mauricio F; Binenbaum, Gil; Schweppe, Michael; Staron, Ronald B; Feldman, Frieda; Rosenwasser, Melvin P
2003-09-01
The purpose of this prospective study was to determine the level of interobserver and intraobserver agreement among orthopedic surgeons and radiologists when computed tomography (CT) scans are used with plain radiographs to evaluate intertrochanteric fractures. In addition, the prognostic value of current classifications systems concerning quality of life was evaluated. Sixty-one patients who presented with intertrochanteric fractures received open reduction and internal fixation with compression hip screw. Three orthopedic surgeons and 2 radiologists independently classified the fractures according to 2 systems: Evans-Jensen and AO (Arbeitsgemeinschaft für Osteo-synthesefragen). Fractures were initially graded with plain radiographs and then again in conjunction with CT. Results were analyzed using the (kappa) kappa coefficient. The 36-item Short-Form Health Survey was administered at baseline, 3 months, and 1 year, and results were correlated with fracture grade. Mean kappa coefficients when comparing radiography alone with radiography and CT scan were 0.63 for the AO system and 0.59 for the Evans-Jensen system. Both represent "fair" agreements. Mean overall interobserver kappa coefficients were 0.67 for radiologists and 0.57 for orthopedic surgeons. Radiologists also had higher intraobserver kappa coefficients. No significant relationships were found between follow-up Short Form Health Survey results and intraoperative grading of fractures. When these classification schemes are compared, interobserver agreement does not appear to change dramatically when information from CT scans is added. This may suggest that (1) more data have been provided by CT with greater possibilities for misinterpretation and (2) these classification schemes may not be comprehensive in describing fracture pattern and displacement. Finally, both systems failed to provide any prognostic value.
Fazal, Fabeha; Minhajuddin, Mohd; Bijli, Kaiser M; McGrath, James L; Rahman, Arshad
2007-02-09
Activation of the transcription factor NF-kappaB involves its release from the inhibitory protein IkappaBalpha in the cytoplasm and subsequently, its translocation to the nucleus. Whereas the events responsible for its release have been elucidated, mechanisms regulating the nuclear transport of NF-kappaB remain elusive. We now provide evidence for actin cytoskeleton-dependent and -independent mechanisms of RelA/p65 nuclear transport using the proinflammatory mediators, thrombin and tumor necrosis factor alpha, respectively. We demonstrate that thrombin alters the actin cytoskeleton in endothelial cells and interfering with these alterations, whether by stabilizing or destabilizing the actin filaments, prevents thrombin-induced NF-kappaB activation and consequently, expression of its target gene, ICAM-1. The blockade of NF-kappaB activation occurs downstream of IkappaBalpha degradation and is associated with impaired RelA/p65 nuclear translocation. Importantly, thrombin induces association of RelA/p65 with actin and this interaction is sensitive to stabilization/destabilization of the actin filaments. In parallel studies, stabilizing or destabilizing the actin filaments fails to inhibit RelA/p65 nuclear accumulation and ICAM-1 expression by tumor necrosis factor alpha, consistent with its inability to induce actin filament formation comparable with thrombin. Thus, these studies reveal the existence of actin cytoskeleton-dependent and -independent pathways that may be engaged in a stimulus-specific manner to facilitate RelA/p65 nuclear import and thereby ICAM-1 expression in endothelial cells.
Binocular lens tilt and decentration measurements in healthy subjects with phakic eyes.
Schaeffel, Frank
2008-05-01
Tilt and decentration of the natural crystalline lens affect optical quality of the foveal image. However, little is known about the distributions of these variables in healthy subjects with phakic eyes and about their correlations in both eyes. A simple, portable, easy-to-use, and partially automated device was developed to study lens tilt and decentration in both eyes of 11 healthy subjects with phakic eyes. The first, third, and fourth Purkinje images (P1, P3, P4) were visualized using a single infrared (IR) light-emitting diode (LED), a planar lens (F = 85 mm; f/number of 1.4), and an infrared sensitive analog video camera. Software was developed to mark pupil edges and positions of P1, P4, and P3 with the cursor of the computer mouse, for three different gaze positions, and an automated regression analysis determined the gaze position that superimposed the third and fourth Purkinje images, the gaze direction for which the lens was oriented perpendicularly to the axis of the IR LED. In this position, lens decentration was determined as the linear distance of the superimposed P3/P4 positions from the pupil center. Contrary to previous approaches, a short initial fixation of a green LED with known angular position calibrated the device as a gaze tracker, and no further positional information was necessary on fixation targets. Horizontal and vertical kappa, horizontal and vertical lens tilt, and vertical lens decentration were highly correlated in both eyes of the subjects, whereas horizontal decentration of the lens was not. There was a large variability of kappa (average horizontal kappa -1.63 degrees +/- 1.77 degrees [left eyes] and +2.07 degrees +/- 2.68 degrees [right eyes]; average vertical kappa +2.52 degrees +/- 1.30 degrees [left eyes] and +2.77 degrees +/- 1.65 degrees [right eyes]). Standard deviation from three repeated measurements ranged from 0.28 degrees to 0.51 degrees for kappa, 0.36 degrees to 0.91 degrees for horizontal lens tilt, and 0.36 degrees to 0.48 degrees for vertical lens tilt. Decentration was measured with standard deviations ranging from 0.02 mm to 0.05 mm. All lenses were found tilted to the temporal side with respect to the fixation axis (on average by 4.6 degrees ). They were also decentered downward with respect to the pupil center by approximately 0.3 mm. Lens tilts and positions could be conveniently measured with the described portable device, a video camera with a large lens. That the lenses were tilted to the temporal side in both eyes, even if corrected for kappa, was unexpected. That they were displaced downward with respect to the pupil center could be related to gravity.
Wang, Weijing; Jiang, Wenjie; Hou, Lin; Duan, Haiping; Wu, Yili; Xu, Chunsheng; Tan, Qihua; Li, Shuxia; Zhang, Dongfeng
2017-11-13
The therapeutic management of obesity is challenging, hence further elucidating the underlying mechanisms of obesity development and identifying new diagnostic biomarkers and therapeutic targets are urgent and necessary. Here, we performed differential gene expression analysis and weighted gene co-expression network analysis (WGCNA) to identify significant genes and specific modules related to BMI based on gene expression profile data of 7 discordant monozygotic twins. In the differential gene expression analysis, it appeared that 32 differentially expressed genes (DEGs) were with a trend of up-regulation in twins with higher BMI when compared to their siblings. Categories of positive regulation of nitric-oxide synthase biosynthetic process, positive regulation of NF-kappa B import into nucleus, and peroxidase activity were significantly enriched within GO database and NF-kappa B signaling pathway within KEGG database. DEGs of NAMPT, TLR9, PTGS2, HBD, and PCSK1N might be associated with obesity. In the WGCNA, among the total 20 distinct co-expression modules identified, coral1 module (68 genes) had the strongest positive correlation with BMI (r = 0.56, P = 0.04) and disease status (r = 0.56, P = 0.04). Categories of positive regulation of phospholipase activity, high-density lipoprotein particle clearance, chylomicron remnant clearance, reverse cholesterol transport, intermediate-density lipoprotein particle, chylomicron, low-density lipoprotein particle, very-low-density lipoprotein particle, voltage-gated potassium channel complex, cholesterol transporter activity, and neuropeptide hormone activity were significantly enriched within GO database for this module. And alcoholism and cell adhesion molecules pathways were significantly enriched within KEGG database. Several hub genes, such as GAL, ASB9, NPPB, TBX2, IL17C, APOE, ABCG4, and APOC2 were also identified. The module eigengene of saddlebrown module (212 genes) was also significantly correlated with BMI (r = 0.56, P = 0.04), and hub genes of KCNN1 and AQP10 were differentially expressed. We identified significant genes and specific modules potentially related to BMI based on the gene expression profile data of monozygotic twins. The findings may help further elucidate the underlying mechanisms of obesity development and provide novel insights to research potential gene biomarkers and signaling pathways for obesity treatment. Further analysis and validation of the findings reported here are important and necessary when more sample size is acquired.
Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias.
Hozyasz, Kamil Konrad; Mostowska, Adrianna; Kowal, Andrzej; Mydlak, Dariusz; Tsibulski, Alexander; Jagodzinski, Pawel P
2018-02-18
Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an independent sample of the Polish population. Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched controls without congenital anomalies. Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in the Polish population. These results were statistically significant, even after applying the Bonferroni correction for multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations associated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-rs4554617 were statistically significant, even after the permutation test correction. Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes and hypospadias susceptibility.
Schaeffer, Elizabeth; López-Bayghen, Bruno; Neumann, Adina; Porchia, Leonardo M; Camacho, Rafael; Garrido, Efraín; Gómez, Rocío; Camargo, Felipe; López-Bayghen, Esther
2017-01-01
Our objective was to determine if whole genome amplification (WGA) provides suitable DNA for qPCR-based genotyping for human embryos. Single blastomeres (Day 3) or trophoblastic cells (Day 5) were isolated from 342 embryos for WGA. Comparative Genomic Hybridization determined embryo sex as well as Trisomy 18 or Trisomy 21. To determine the embryo's sex, qPCR melting curve analysis for SRY and DYS14 was used. Logistic regression indicated a 4.4%, 57.1%, or 98.8% probability of a male embryo when neither gene, SRY only, or both genes were detected, respectively (accuracy = 94.1%, kappa = 0.882, and p < 0.001). Fluorescent Capillary Electrophoresis for the amelogenin genes (AMEL) was also used to determine sex. AMELY peak's height was higher and this peak's presence was highly predictive of male embryos (AUC = 0.93, accuracy = 81.7%, kappa = 0.974, and p < 0.001). Trisomy 18 and Trisomy 21 were determined using the threshold cycle difference for RPL17 and TTC3, respectively, which were significantly lower in the corresponding embryos. The Ct difference for TTC3 specifically determined Trisomy 21 (AUC = 0.89) and RPL17 for Trisomy 18 (AUC = 0.94). Here, WGA provides adequate DNA for PCR-based techniques for preimplantation genotyping.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rho, Mun-Chual; Ah Lee, Kyeong; Mi Kim, Sun
2007-05-01
Saturated free fatty acids (FFAs), including palmitate, can activate the intrinsic death pathway in cells. However, the relationship between FFAs and receptor-mediated death pathway is still unknown. In this study, we have investigated whether FFAs are able to trigger receptor-mediated death. In addition, to clarify the mechanisms responsible for the activation, we examined the biochemical changes in dying vascular smooth muscle cell (VSMC) and the effects of various molecules to the receptor-mediated VSMC death. Tumor necrosis factor (TNF)-{alpha}-mediated VSMC death occurred in the presence of sub-cytotoxic concentration of palmitate as determined by assessing viability and DNA degradation, while the cytokinemore » did not influence VSMC viability in the presence of oleate. The VSMC death was inhibited by the gene transfer of a dominant-negative Fas-associated death domain-containing protein and the baculovirus p35, but not by the bcl-xL or the c-Jun N-terminal kinase (JNK) binding domain of JNK-interacting protein-1, in tests utilizing recombinant adenoviruses. The VSMC death was also inhibited by a neutralizing anti-TNF receptor 1 antibody, the caspase inhibitor z-VAD, and the cathepsin B inhibitor CA074, a finding indicative of the role of both caspases and cathepsin B in this process. Consistent with this finding, caspase-3 activation and an increase in cytosolic cathepsin B activity were detected in the dying VSMC. Palmitate inhibited an increase of TNF-{alpha}-mediated nuclear factor kappa B (NF-{kappa}B) activity, the survival pathway activated by the cytokine, by hindering the translocation of the NF-{kappa}B subunit of p65 from the cytosol into the nucleus. The gene transfer of inhibitor of NF-{kappa}B predisposed VSMC to palmitate-induced cell death. To the best of our knowledge, this study is the first report to demonstrate the activation of TNF-{alpha}-mediated cell death in the presence of palmitate. The current study proposes that FFAs would take part in deleterious vascular consequences of such patients with elevated levels of FFAs as diabetics and obese individuals via the triggering of receptor-mediated death pathways of VSMC.« less
Evaluation of the analgesic and anti-inflammatory effects of a Brazilian green propolis.
Paulino, Niraldo; Teixeira, Cristiane; Martins, Regiane; Scremin, Amarilis; Dirsch, Verena M; Vollmar, Angelika M; Abreu, Sheila R; de Castro, Solange L; Marcucci, Maria Cristina
2006-08-01
Phamacological activities of a standard ethanol extract G1 from Brazilian green propolis, typified as BRP1, was evaluated in mouse models of pain and inflammation. Intraperitoneal injection ( I. P.) of G1 inhibited acetic acid-induced abdominal constrictions with an ID (50) = 0.75 +/- 0.05 mg/kg, and in the formalin test the ID (50) values were 0.85 +/- 0.07 mg/kg and 13.88 +/- 1.12 mg/kg, respectively, for the neurogenic and inflammatory phases. The extract was ineffective when assessed in the hot-plate assay. In serotonin-induced paw edema, G1 led to a maximal inhibition (MI) of 51.6 % after 120 min when administered I. P. and of 36 % after 15 min by the oral route ( O. R.). When the inflammatory agent was complete Freund's adjuvant, inhibition of paw edema was also observed after administration of the extract by both routes. In the capsaicin-induced ear edema the ID (50) values were 1.09 +/- 0.08 mg/kg ( I. P.) and 10.00 +/- 0.90 mg/kg ( O. R.). In the acute carrageenan-induced inflammatory reaction induced by carrageenan, G1 reduced the number of neutrophils in the peritoneal cavity with IC (50) values of 0.72 +/- 0.08 mg/kg and 4.17 +/- 0.50 mg/kg, by I. P. or O. R. administration, with a preferential migration of polymorphonuclear neutrophils. IN VITRO, G1 decreased nitric oxide production in LPS-stimulated RAW 264.7 cells (IC (50) = 41.60 microg/mL), and also the luciferase activity in TNF-alpha-stimulated HEK 293 cells transfected with NF-kappaB-luciferase reporter gene driven by the nuclear factor kappaB (NF-kappaB) (IC (50) = 200 microg/mL). This extract, which at low concentrations induces anti-inflammatory and analgesic effects in mouse models, presents a high content of flavonoids, known to inhibit inducible NOS (iNOS) activity. These data taken together led us to reinforce the hypothesis in the literature that the anti-inflammatory effect of propolis may be a due to inhibition of iNOS gene expression, through interference with NF-kappaB sites in the iNOS promoter.
Panchani, Sunil; Reading, Jonathan; Mehta, Jaysheel
2016-06-01
The position of the lateral sesamoid on standard dorso-plantar weight bearing radiographs, with respect to the lateral cortex of the first metatarsal, has been shown to correlate well with the degree of the hallux valgus angle. This study aimed to assess the inter- and intra-observer error of this new classification system. Five orthopaedic consultants and five trainee orthopaedic surgeons were recruited to assess and document the degree of displacement of the lateral sesamoid on 144 weight-bearing dorso-plantar radiographs on two separate occasions. The severity of hallux valgus was defined as normal (0%), mild (≤50%), moderate (51-≤99%) or severe (≥100%) depending on the percentage displacement of the lateral sesamoid body from the lateral cortical border of the first metatarsal. Consultant intra-observer variability showed good agreement between repeated assessment of the radiographs (mean Kappa=0.75). Intra-observer variability for trainee orthopaedic surgeons also showed good agreement with a mean Kappa=0.73. Intraclass correlations for consultants and trainee surgeons was also high. The new classification system of assessing the severity of hallux valgus shows high inter- and intra-observer variability with good agreement and reproducibility between surgeons of consultant and trainee grades. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Railo, Antti; Nagy, Irina I.; Kilpelaeinen, Pekka
The Wnt family of glycoprotein growth factors controls a number of central cellular processes such as proliferation, differentiation and ageing. All the Wnt proteins analyzed so far either activate or inhibit the canonical {beta}-catenin signaling pathway that regulates transcription of the target genes. In addition, some of them activate noncanonical signaling pathways that involve components such as the JNK, heterotrimeric G proteins, protein kinase C, and calmodulin-dependent protein kinase II, although the precise signaling mechanisms are only just beginning to be revealed. We demonstrate here that Wnt-11 signaling is sufficient to inhibit not only the canonical {beta}-catenin mediated Wnt signalingmore » but also JNK/AP-1 and NF-{kappa}B signaling in the CHO cells, thus serving as a noncanonical Wnt ligand in this system. Inhibition of the JNK/AP-1 pathway is mediated in part by the MAPK kinase MKK4 and Akt. Moreover, protein kinase C is involved in the regulation of JNK/AP-1 by Wnt-11, but not of the NF-{kappa}B pathway. Consistent with the central role of Akt, JNK and NF-{kappa}B in cell survival and stress responses, Wnt-11 signaling promotes cell viability. Hence Wnt-11 is involved in coordination of key signaling pathways.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, Hyeok-Ran; Lee, Ki Won; Dong, Zigang
2010-01-01
T-lymphokine-activated killer cell-originated protein kinase (TOPK) appears to be highly expressed in various cancer cells and to play an important role in maintaining proliferation of cancer cells. However, the underlying mechanism by which TOPK regulates growth of cancer cells remains elusive. Here we report that upregulated endogenous TOPK augments resistance of cancer cells to apoptosis induced by tumor necrosis factor-related apoptosis inducing ligand (TRAIL). Stable knocking down of TOPK markedly increased TRAIL-mediated apoptosis of human HeLa cervical cancer cells, as compared with control cells. Caspase 8 or caspase 3 activities in response to TRAIL were greatly incremented in TOPK-depleted cells.more » Ablation of TOPK negatively regulated TRAIL-mediated NF-{kappa}B activity. Furthermore, expression of NF-{kappa}B-dependent genes, FLICE-inhibitory protein (FLIP), inhibitor of apoptosis protein 1 (c-IAP1), or X-linked inhibitor of apoptosis protein (XIAP) was reduced in TOPK-depleted cells. Collectively, these findings demonstrated that TOPK contributed to TRAIL resistance of cancer cells via NF-{kappa}B activity, suggesting that TOPK might be a potential molecular target for successful cancer therapy using TRAIL.« less
Kunz, Alexander; Abe, Takato; Hochrainer, Karin; Shimamura, Munehisa; Anrather, Josef; Racchumi, Gianfranco; Zhou, Ping; Iadecola, Costantino
2008-02-13
CD36, a class-B scavenger receptor involved in multiple functions, including inflammatory signaling, may also contribute to ischemic brain injury through yet unidentified mechanisms. We investigated whether CD36 participates in the molecular events underlying the inflammatory reaction that accompanies cerebral ischemia and may contribute to the tissue damage. We found that activation of nuclear factor-kappaB, a transcription factor that coordinates postischemic gene expression, is attenuated in CD36-null mice subjected to middle cerebral artery occlusion. The infiltration of neutrophils and the glial reaction induced by cerebral ischemia were suppressed. Treatment with an inhibitor of inducible nitric oxide synthase, an enzyme that contributes to the tissue damage, reduced ischemic brain injury in wild-type mice, but not in CD36 nulls. In contrast to cerebral ischemia, the molecular and cellular inflammatory changes induced by intracerebroventricular injection of interleukin-1beta were not attenuated in CD36-null mice. The findings unveil a novel role of CD36 in early molecular events leading to nuclear factor-kappaB activation and postischemic inflammation. Inhibition of CD36 signaling may be a valuable therapeutic approach to counteract the deleterious effects of postischemic inflammation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuncharin, Yanin; Sangphech, Naunpun; Kueanjinda, Patipark
The Notch signaling pathway plays important roles in tumorigenesis in a context-dependent manner. In human cervical cancer, alterations in Notch signaling have been reported, and both tumor-suppressing and tumor-promoting roles of Notch signaling have been proposed; however, the precise molecular mechanisms governing these roles in cervical cancer remain controversial. MAML is a transcriptional co-activator originally identified by its role in Notch signaling. Recent evidence suggests that it also plays a role in other signaling pathways, such as the p53 and {beta}-catenin pathways. MAML is required for stable formation of Notch transcriptional complexes at the promoters of Notch target genes. Chromosomalmore » translocations affecting MAML have been shown to promote tumorigenesis. In this study, we used a truncated dominant-negative MAML1 (DN-MAML) to investigate the role of MAML in HPV-positive cervical cancer cell lines. Three human cervical cancer cell lines (HeLa, SiHa and CaSki) expressed all Notch receptors and the Notch target genes Hes1 and MAML1. Among these 3 cell lines, constitutive appearance of cleaved Notch1 was found only in CaSki cells, which suggests that Notch1 is constitutively activated in this cell line. Gamma secretase inhibitor (GSI) treatment, which suppresses Notch receptor activation, completely abrogated this form of Notch1 but had no effect on cell viability. Overexpression of DN-MAML by retroviral transduction in CaSki cells resulted in significant decreases in the mRNA levels of Hes1 and Notch1 but had no effects on the levels of MAML1, p53 or HPV E6/E7. DN-MAML expression induced increased viability of CaSki cells without any effect on cell cycle progression or cell proliferation. In addition, clonogenic assay experiments revealed that overexpression of DN-MAML resulted in increased colony formation compared to the overexpression of the control vector. When the status of the NF-{kappa}B pathway was investigated, CaSki cells overexpressing DN-MAML exhibited loss of phospho-I{kappa}B{alpha}, decreased total I{kappa}B{alpha} and nuclear localization of NF-{kappa}B p65, which suggests that the NF-{kappa}B pathway is hyperactivated. Furthermore, increased level of cleaved Notch1 was detected when DN-MAML was expressed. When DN-MAML-overexpressing cells were treated with GSI, significantly decreased cell viability was observed, indicating that inhibition of Notch signaling using GSI treatment and DN-MAML expression negatively affects cell viability. Taken together, targeting Notch signaling using DN-MAML and GSI treatment may present a novel method to control cell viability in cervical cancer cells.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Hong; The Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital, Shandong University, 107, Wenhua Xi Road, Jinan 250012; Wu, Xinyi, E-mail: xywu8868@163.com
2012-04-13
Highlights: Black-Right-Pointing-Pointer Hypoxia attenuates Acanthamoeba-induced the production of IL-8 and IFN-{beta}. Black-Right-Pointing-Pointer Hypoxia inhibits TLR4 expression in a time-dependent manner in HCECs. Black-Right-Pointing-Pointer Hypoxia inhibits Acanthamoeba-induced the activation of NF-{kappa}B and ERK1/2 in HCECs. Black-Right-Pointing-Pointer Hypoxia decreases Acanthamoeba-induced inflammatory response via TLR4 signaling. Black-Right-Pointing-Pointer LPS-induced the secretion of IL-6 and IL-8 is abated by hypoxia via TLR4 signaling. -- Abstract: Acanthamoeba keratitis (AK) is a vision-threatening corneal infection that is intimately associated with contact lens use which leads to hypoxic conditions on the corneal surface. However, the effect of hypoxia on the Acanthamoeba-induced host inflammatory response of corneal epithelial cellsmore » has not been studied. In the present study, we investigated the effect of hypoxia on the Acanthamoeba-induced production of inflammatory mediators interleukin-8 (IL-8) and interferon-{beta} (IFN-{beta}) in human corneal epithelial cells and then evaluated its effects on the Toll-like receptor 4 (TLR4) signaling, including TLR4 and myeloid differentiation primary response gene (88) (MyD88) expression as well as the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-{kappa}B) and extracellular signal-regulated kinases 1/2 (ERK1/2). We then studied the effect of hypoxia on a TLR4-specific inflammatory response triggered by the TLR4 ligand lipopolysaccharide (LPS). Our data showed that hypoxia significantly decreased the production of IL-8 and IFN-{beta}. Furthermore, hypoxia attenuated Acanthamoeba-triggered TLR4 expression as well as the activation of NF-{kappa}B and ERK1/2, indicating that hypoxia abated Acanthamoeba-induced inflammatory responses by affecting TLR4 signaling. Hypoxia also inhibited LPS-induced IL-6 and IL-8 secretion, myeloid differentiation primary response gene (88) MyD88 expression and NF-{kappa}B activation, confirming that hypoxia suppressed the LPS-induced inflammatory response by affecting TLR4 signaling. In conclusion, our results demonstrated that hypoxia attenuated the host immune and inflammatory response against Acanthamoeba infection by suppressing TLR4 signaling, indicating that hypoxia might impair the host cell's ability to eliminate the Acanthamoeba invasion and that hypoxia could enhance cell susceptibility to Acanthamoeba infection. These results may explain why contact lens use is one of the most prominent risk factors for AK.« less
Flavonoids inhibit cytokine-induced endothelial cell adhesion protein gene expression.
Gerritsen, M. E.; Carley, W. W.; Ranges, G. E.; Shen, C. P.; Phan, S. A.; Ligon, G. F.; Perry, C. A.
1995-01-01
Treatment of human endothelial cells with cytokines such as interleukin-1, tumor necrosis factor-alpha (TNF-alpha) or interferon-gamma induces the expression of specific leukocyte adhesion molecules on the endothelial cell surface. Interfering with either leukocyte adhesion or adhesion protein upregulation is an important therapeutic target as evidenced by the potent anti-inflammatory actions of neutralizing antibodies to these ligands in various animal models and in patients. In the present study we report that cotreatment of human endothelial cells with certain hydroxyflavones and flavanols blocks cytokine-induced ICAM-1, VCAM-1, and E-selectin expression on human endothelial cells. One of the most potent flavones, apigenin, exhibited a dose- and time-dependent, reversible effect on adhesion protein expression as well as inhibiting adhesion protein upregulation at the transcriptional level. Apigenin also inhibited IL-1 alpha-induced prostaglandin synthesis and TNF-alpha-induced IL-6 and IL-8 production, suggesting that the hydroxyflavones may act as general inhibitors of cytokine-induced gene expression. Although apigenin did not inhibit TNF-alpha-induced nuclear translocation of NF-kappa B(p50(NFKB1)/p65(RelA)) we found this flavonoid did inhibit TNF-alpha induced beta-galactosidase activity in SW480 cells stably transfected with a beta-galactosidase reporter construct driven by four NF-kappa B elements, suggesting an action on NF-kappa B transcriptional activation. Adhesion of leukocytes to cytokine-treated endothelial cells was blocked in endothelial cells cotreated with apigenin. Finally, apigenin demonstrated potent anti-inflammatory activity in carrageenan induced rat paw edema and delayed type hypersensitivity in the mouse. We conclude that flavonoids offer important therapeutic potential for the treatment of a variety of inflammatory diseases involving an increase in leukocyte adhesion and trafficking. Images Figure 7 Figure 8 Figure 11 PMID:7543732
Sury, Matthias D; Frese-Schaper, Manuela; Mühlemann, Miranda K; Schulthess, Fabienne T; Blasig, Ingolf E; Täuber, Martin G; Shaw, Sidney G; Christen, Stephan
2006-11-01
N-acetylcysteine (NAC) is neuroprotective in animal models of acute brain injury such as caused by bacterial meningitis. However, the mechanism(s) by which NAC exerts neuroprotection is unclear. Gene expression of endothelin-1 (ET-1), which contributes to cerebral blood flow decline in acute brain injury, is partially regulated by reactive oxygen species, and thus a potential target of NAC. We therefore examined the effect of NAC on tumor necrosis factor (TNF)-alpha-induced ET-1 production in cerebrovascular endothelial cells. NAC dose dependently inhibited TNF-alpha-induced preproET-1 mRNA upregulation and ET-1 protein secretion, while upregulation of inducible nitric oxide synthase (iNOS) was unaffected. Intriguingly, NAC had no effect on the initial activation (i.e., IkappaB degradation, nuclear p65 translocation, and Ser536 phosphorylation) of NF-kappaB by TNF-alpha. However, transient inhibition of NF-kappaB DNA binding suggested that NAC may inhibit ET-1 upregulation by inhibiting (a) parallel pathway(s) necessary for full transcriptional activation of NF-kappaB-mediated ET-1 gene expression. Similar to NAC, the MEK1/2 inhibitor U0126, the p38 inhibitor SB203580, and the protein kinase inhibitor H-89 selectively inhibited ET-1 upregulation without affecting nuclear p65 translocation, suggesting that NAC inhibits ET-1 upregulation via inhibition of mitogen- and stress-activated protein kinase (MSK). Supporting this notion, cotreatment with NAC inhibited the TNF-alpha-induced rise in MSK1 and MSK2 kinase activity, while siRNA knock-down experiments showed that MSK2 is the predominant isoform involved in TNF-alpha-induced ET-1 upregulation.
Zalcman, Gisela; Federman, Noel; de la Fuente, Verónica; Romano, Arturo
2015-03-01
Long-term memory formation requires gene expression after acquisition of new information. The first step in the regulation of gene expression is the participation of transcription factors (TFs) such as nuclear factor kappa B (NF-кB), which are present before the neuronal activity induced by training. It was proposed that the activation of these types of TFs allows a second step in gene regulation by induction of immediate-early genes (IEGs) whose protein products are, in turn, TFs. Between these IEGs, zif268 has been found to play a critical role in long-term memory formation and reprocessing after retrieval. Here we found in mice hippocampus that, on one hand, NF-кB was activated 45 min after training in a novel object recognition (NOR) task and that inhibiting NF-кB immediately after training by intrahippocampal administration of NF-кB Decoy DNA impaired NOR memory consolidation. On the other hand, Zif268 protein expression was induced 45 min after NOR training and the administration of DNA antisense to its mRNA post-training impaired recognition memory. Finally, we found that the inhibition of NF-кB by NF-кB Decoy DNA reduced significantly the training-induced Zif268 increment, indicating that NF-кB is involved in the regulation of Zif268 expression. Thus, the present results support the involvement of NF-кB activity-dependent Zif268 expression in the hippocampus during recognition memory consolidation. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Fei, E-mail: zhufei@zju.edu.cn; Yue, Wanfu; Wang, Yongxia
Nuclear factor kappa B (NF-κB) is a ubiquitous transcription factor which controls the expression of various genes involved in immune responses. However, it is not clear whether NF-κB activation is critical for phagocytosis when Staphylococcus aureus is the pathogen. Using oligonucleotide microarrays, we investigated whether NF-κB cascade genes are altered in a mouse leukemic monocyte macrophage cell line (RAW 264.7) when the cells were stimulated to activate a host innate immune response against live S. aureus or heat-inactivated S. aureus (HISA). NF-κB cascade genes such as Nfκb1, Nfκbiz, Nfκbie, Rel, Traf1 and Tnfaip3 were up-regulated by all treatments at onemore » hour after incubation. NF-κB play an important role in activating phagocytosis in RAW 264.7 cells infected with S. aureus. Inhibition of NF-κB significantly blocked phagocytosis of fluorescently labeled S. aureus and decreased the expression of NFκB1, IL1α, IL1β and TLR2 in this cell line. Our results demonstrate that S. aureus may activate the NF-κB pathway and that NF-κB activation is required for phagocytosis of S. aureus by macrophages. - Highlights: • NF-κB cascade genes such as Nfκb1 and Traf1 were up-regulated by heat-inactivated S. aureus. • Inhibition of NF-κB significantly blocked phagocytosis of fluorescently labeled S. aureus. • NF-κB activation is required for phagocytosis of S. aureus by macrophages.« less
Patterns of Gene Expression Associated with Recovery and Injury in Heat-stressed Rats
2014-12-03
Schultz CR, Golembieski WA, King DA, Brown SL, Brodie C, Rempel SA: Inhibition of HSP27 alone or in combination with pAKT inhibition as therapeutic...Extracellular HSP27 acts as a signaling molecule to activate NF-kappaB in macrophages. Cell Stress Chaperones 2013, 18(1):53–63. 68. Thompson MR, Xu D
TGF-β-induced IκB-ζ controls Foxp3 gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
MaruYama, Takashi, E-mail: ta-maru@umin.ac.jp; School of Medicine, Gifu University, Gifu 501-1194
2015-08-21
Inhibitor of kappa B (IκB)-ζ, a member of the nuclear IκB family of proteins, is induced by the transforming growth factor (TGF)-β signaling pathway and plays a pivotal role in maintaining the balance of T helper (Th) cell subsets. IκB-ζ deficiency results in reduced percentages of Th17 cells and increased percentages of Th1 cells. In this study, the effects of IκB-ζ deficiency on T-cell subsets were examined further. The data showed that IκB-ζ-deficient T cells had a high capacity for generation of regulatory T cells (Tregs) when T cells were cultured under TGF-β stimulation in the presence of cytokine-neutralizing antibodies.more » Mechanistically, IκB-ζ itself negatively regulated activation of the Foxp3 promoter in a nuclear factor of kappaB-dependent manner. Thus, this study showed that IκB-ζ controlled Treg differentiation. - Highlights: • IκB-ζ-deficient T cells exhibited increased generation of Foxp3{sup +} Tregs. • IκB-ζ played a key role in Foxp3 gene expression. • Retroviral overexpression of IκB-ζ was achieved in T cells.« less
Wang, Xianmiao; Li, Ying; Mao, Aiping; Li, Chao; Li, Yongkui; Tien, Po
2010-09-01
Viral RNAs produced during viral infection are recognized by the cytoplasmic RNA helicases retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5). A central adapter protein downstream of RIG-I and MDA5 is the mitochondrial membrane protein virus-induced signaling adaptor (VISA), which mediates the induction of type I interferons (IFNs) through the activation of transcription factors such as nuclear factor-kappaB (NF-kappaB) and IFN-regulatory factor-3 (IRF3). Here we found that hepatitis B virus (HBV)-encoded X protein (HBx) acts as an inhibitor of virus-triggered IRF3 activation and IFN-beta induction. Reporter and plaque assays indicate that HBx inhibits signaling by components upstream but not downstream of VISA. Immunoprecipitation experiments indicate that HBx interacts with VISA and disrupts the association of VISA with its upstream and downstream components. These findings suggest that HBx acts as a suppressor of virus-triggered induction of type I IFNs, which explains the observation that HBV causes transient and chronic infection in hepatocytes but fails to activate the pattern recognition receptor-mediated IFN induction pathways.
Danker-Hopfe, Heidi; Anderer, Peter; Zeitlhofer, Josef; Boeck, Marion; Dorn, Hans; Gruber, Georg; Heller, Esther; Loretz, Erna; Moser, Doris; Parapatics, Silvia; Saletu, Bernd; Schmidt, Andrea; Dorffner, Georg
2009-03-01
Interrater variability of sleep stage scorings has an essential impact not only on the reading of polysomnographic sleep studies (PSGs) for clinical trials but also on the evaluation of patients' sleep. With the introduction of a new standard for sleep stage scorings (AASM standard) there is a need for studies on interrater reliability (IRR). The SIESTA database resulting from an EU-funded project provides a large number of studies (n = 72; 56 healthy controls and 16 subjects with different sleep disorders, mean age +/- SD: 57.7 +/- 18.7, 34 females) for which scorings according to both standards (AASM and R&K) were done. Differences in IRR were analysed at two levels: (1) based on quantitative sleep parameter by means of intraclass correlations; and (2) based on an epoch-by-epoch comparison by means of Cohen's kappa and Fleiss' kappa. The overall agreement was for the AASM standard 82.0% (Cohen's kappa = 0.76) and for the R&K standard 80.6% (Cohen's kappa = 0.68). Agreements increased from R&K to AASM for all sleep stages, except N2. The results of this study underline that the modification of the scoring rules improve IRR as a result of the integration of occipital, central and frontal leads on the one hand, but decline IRR on the other hand specifically for N2, due to the new rule that cortical arousals with or without concurrent increase in submental electromyogram are critical events for the end of N2.
Mechanism of UV-related carcinogenesis and its contribution to nevi/melanoma
Anna, Brozyna; Blazej, Zbytek; Jacqueline, Granese; Andrew, Carlson J.; Jeffrey, Ross; Andrzej, Slominski
2008-01-01
Summary Melanoma consists 4–5 % of all skin cancers, but it contributes to 71–80 % of skin cancers deaths. UV light affects cell and tissue homeostasis due to its damaging effects on DNA integrity and modification of expression of a plethora of genes. DNA repair systems protect cells from UV-induced lesions. Several animal models of melanoma have been developed (Xiphophorus, Opossum Monodelphis domestica, mouse models and human skin engrafts into other animals). This review discusses possible links between UV and genes significantly related to melanoma but does not discuss melanoma genetics. These include oncogenes, tumor suppressor genes, genes related to melanocyte-keratinocyte and melanocyte-matrix interaction, growth factors and their receptors, CRH, ACTH, α-MSH, glucocorticoids, ID1, NF-kappaB and vitamin D3. PMID:18846265
Characterization of casein gene complex and genetic diversity analysis in Indian goats.
Rout, P K; Kumar, A; Mandal, A; Laloe, D; Singh, S K; Roy, R
2010-04-01
Milk protein polymorphism plays an important role in genetic diversity analysis, phylogenetic studies, establishing geographical diversity, conservation decision, and improving breeding goals. Milk protein polymorphism in Indian goat breeds has not been well studied; therefore, an investigation was carried out to analyze the genetic structure of the casein gene and milk protein diversity at six milk protein loci in nine Indian goat breeds/genetic groups from varied agro-climatic zones. Milk protein genotyping was carried out in 1098 individual milk samples by SDS-PAGE at alphaS1-CN (CSN1S1), beta-CN (CSN2), alphaS2-CN (CSN1S2), kappa-CN (CSN3), beta-LG, and alpha-LA loci. Indian goats exhibited alphaS1-casein A allele in higher frequency in the majority of breeds except Ganjam and local goats. The alphaS1-casein A allele frequencies varied from 0.45 to 0.77. A total of 16 casein haplotypes were observed in seven breeds and breed specific haplotypes were observed with respect to geographic region. The average number of alleles was lowest in Ganjam (1.66 +/- 0.81) and highest in Sirohi goats (2.50 +/- 1.05). Expected heterozygosity at six different loci demonstrated genetic diversity and breed fragmentation. Neighbor-Joining tree was built basing on Nei's distance. There was about 16.95% variability due to differences between breeds, indicating a strong subdivision. Principal component analysis was carried out to highlight the relationship among breeds. The variability among goat breeds was contributed by alphaS2-CN, beta-LG and alphaS1-CN. The Indian goats exhibited alphaS1-CN (CSN1S1) A allele in higher frequency in all the breeds indicating the higher casein yield in their milk.
Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters.
Gagniuc, Paul; Ionescu-Tirgoviste, Constantin
2012-09-28
The main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species? In order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three different databases and a new computer model whose core is using Kappa index of coincidence. To fully understand the connections between gene promoters and gene expression, we analyzed thousands of promoter sequences using our Kappa Index of Coincidence method and a specialized Optical Character Recognition (OCR) neural network. Under our criteria, 10 classes of promoters were detected. In addition, the existence of "transitional" promoters suggests that there is an evolutionary weighted continuum between classes, depending perhaps upon changes in their gene products.
Cho, Dong-Im; Koo, Na-Youn; Chung, Woon Jae; Kim, Tae-Sung; Ryu, Shi Yong; Im, Suhn Young; Kim, Kyeong-Man
2002-09-13
NF-kappaB that plays an important role in iNOS expression is one of the targets of various potential anti-inflammatory agents including resveratrol. Resveratrol contains a structural similarity with estrogen, and there has been speculation about resveratrol as estrogen agonist. In this study, the mechanism and structural requirements of resveratrol and related hydroxystilbenes for the inhibition of LPS-induced nitric oxide production were studied in macrophage cells (RAW 264.7 and J774) by comparing its effect on LPS-induced NF-kappaB translocation and nitric oxide production, and by considering the possibility of involvement of an estrogen receptor. LPS-induced nitric oxide production was inhibited only when cells were treated with resveratrol prior to stimulation with LPS, suggesting that resveratrol does not affect the enzyme itself. A higher concentration of resveratrol than needed for the inhibition of nitric oxide production was required for the inhibition of NF-kappaB mobilization or iNOS expression. Estrogen and diethylstilbesterol, an estrogen agonist, caused only weak inhibition of nitric oxide production, and the effects of resveratrol were not noticeably blocked by ICI-182780, an estrogen antagonist. Structure-activity analysis of resveratrol and nine hydroxystilbenes suggests that the structural balance between oxygen functional groups on the benzene rings is important for their activity. Our results suggest that resveratrol might act on other cellular targets as well as NF-kappaB at the initial stage of gene expression. Unique structural features of hydroxystilbenes are needed for suppression of nitric oxide production and it is unlikely that estrogen receptor is involved in it.
Kim, Jung-Hee; Jeong, Ji-Hye; Jeon, Sung-Tak; Kim, Ho; Ock, Jiyeon; Suk, Kyoungho; Kim, Sang-In; Song, Kyung-Sik; Lee, Won-Ha
2006-06-01
In the course of screening inhibitors of matrix metalloproteinase (MMP)-9 induction in macrophages, we isolated decursin, a coumarin compound, from the roots of Angelicae gigas. As a marker for the screening and isolation, we tested expression of MMP-9 in RAW264.7 cells and THP-1 cells after treatment with bacterial lipopolysaccharide (LPS), the TLR-4 ligand. Decursin suppressed MMP-9 expression in cells stimulated by LPS in a dose-dependent manner at concentrations below 60 microM with no sign of cytotoxicity. The suppressive effect of decursin was observed not only in cells stimulated with ligands for TLR4, TLR2, TLR3, and TLR9 but also in cells stimulated with interleukin (IL)-1beta, and tumor necrosis factor (TNF)-alpha, indicating that the molecular target of decursin is common signaling molecules induced by these stimulants. In addition to the suppression of MMP-9 expression, decursin blocked nitric oxide production and cytokine (IL-8, MCP-1, IL-1beta, and TNF-alpha) secretion induced by LPS. To find out the molecular mechanism responsible for the suppressive effect of decursin, we analyzed signaling molecules involved in the TLR-mediated activation of MMP-9 and cytokines. Decursin blocked phosphorylation of IkappaB and nuclear translocation of NF-kappaB in THP-1 cells activated with LPS. Furthermore, expression of a luciferase reporter gene under the promoter containing NF-kappaB binding sites was blocked by decursin. These data indicate that decursin is a novel inhibitor of NF-kappaB activation in signaling induced by TLR ligands and cytokines.
Yao, Chenjuan; Purwanti, Nunuk; Karabasil, Mileva Ratko; Azlina, Ahmad; Javkhlan, Purevjav; Hasegawa, Takahiro; Akamatsu, Tetsuya; Hosoi, Toru; Ozawa, Koichiro; Hosoi, Kazuo
2010-08-01
The mRNA and protein levels of aquaporin (AQP)5 in the parotid gland were found to be potentially decreased by lipopolysaccharide (LPS) in vivo in C3H/HeN mice, but only weakly in C3H/HeJ, a TLR4 mutant mouse strain. In the LPS-injected mice, pilocarpine-stimulated saliva production was reduced by more than 50%. In a tissue culture system, the LPS-induced decrease in the AQP5 mRNA level was blocked completely by pyrrolidine dithiocarbamate, MG132, tyrphostin AG126, SP600125, and partially by SB203580, which are inhibitors for IkappaB kinase, 26S proteasome, ERK1/2, JNK, and p38 MAPK, respectively. In contrast, the expression of AQP1 mRNA was down-regulated by LPS and such down-regulation was blocked only by SP600125. The transcription factors NF-kappaB (p65 subunit), p-c-Jun, and c-Fos were increased by LPS given in vivo, whereas the protein-binding activities of the parotid gland extract toward the sequences for NF-kappaB but not AP-1-responsive elements present at the promoter region of the AQP5 gene were increased by LPS injection. Co-immunoprecipitation by using antibody columns suggested the physical association of the three transcription factors. These results suggest that LPS-induced potential down-regulation of expression of AQP5 mRNA in the parotid gland is mediated via a complex(es) of these two classes of transcription factors, NF-kappaB and p-c-Jun/c-Fos.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seong, Ah-Reum; Yoo, Jung-Yoon; Choi, KyungChul
Highlights: {yields} Delphinidin is a novel inhibitor of p300/CBP histone acetyltransferase. {yields} Delphinidin prevents the hyperacetylation of p65 by inhibiting the HAT activity of p300/CBP. {yields} Delphinidin efficiently suppresses the expression of inflammatory cytokines in MH7A cells via hypoacetylation of NF-{kappa}B. {yields} Delphinidin inhibits cytokine release in the Jurkat T lymphocyte cell line. -- Abstract: Histone acetyltransferase (HAT) inhibitors (HATi) isolated from dietary compounds have been shown to suppress inflammatory signaling, which contributes to rheumatoid arthritis. Here, we identified a novel HATi in Punica granatum L. known as delphinidin (DP). DP did not affect the activity of other epigenetic enzymesmore » (histone deacetylase, histone methyltransferase, or sirtuin1). DP specifically inhibited the HAT activities of p300/CBP. It also inhibited p65 acetylation in MH7A cells, a human rheumatoid arthritis synovial cell line. DP-induced hypoacetylation was accompanied by cytosolic accumulation of p65 and nuclear localization of IKB{alpha}. Accordingly, DP treatment inhibited TNF{alpha}-stimulated increases in NF-{kappa}B function and expression of NF-{kappa}B target genes in these cells. Importantly, DP suppressed lipopolysaccharide-induced pro-inflammatory cytokine expression in Jurkat T lymphocytes, demonstrating that HATi efficiently suppresses cytokine-mediated immune responses. Together, these results show that the HATi activity of DP counters anti-inflammatory signaling by blocking p65 acetylation and that this compound may be useful in preventing inflammatory arthritis.« less
Lai, Ching-Shu; Li, Shiming; Chai, Chee-Yin; Lo, Chih-Yu; Dushenkov, Slavik; Ho, Chi-Tang; Pan, Min-Hsiung; Wang, Ying-Jan
2008-12-01
We reported previously that 3',4'-didemethylnobiletin (DDMN) is the major metabolite of nobiletin in mouse urine. In this study, we examined DDMN's molecular mechanism of action and its anti-inflammatory and antitumor properties. We demonstrated that topical application of DDMN effectively inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-stimulated transcription of inducible nitric oxide synthase (iNOS), cyclooxygenase (COX)-2 and ornithine decarboxylase (ODC) messenger RNA and protein expression in mouse skin. Pretreatment with DDMN has resulted in the reduction of TPA-induced nuclear translocation of the nuclear factor-kappa B (NF-kappaB) subunit. DDMN also reduced DNA binding by blocking phosphorylation of inhibitor kappaB (IkappaB) alpha and p65 and caused subsequent degradation of IkappaBalpha. DDMN inhibited TPA-induced phosphorylation and nuclear translocation of the signal transducer and activator of transcription 3. Moreover, DDMN suppressed TPA-induced activation of extracellular signal-regulated kinase 1/2, p38 mitogen-activated protein kinase, phosphatidylinositol 3-kinase/Akt and protein kinase C that are upstream of NF-kappaB and activator protien-1. We also found that DDMN significantly inhibited TPA-induced mouse skin inflammation by decreasing inflammatory parameters. Furthermore, DDMN significantly inhibited 7,12-dimethylbenz[a]anthracene/TPA-induced skin tumor formation measured by the tumor multiplicity of papillomas at 20 weeks. Presented data for the first time reveal that DDMN is an effective antitumor agent that functions by downregulating inflammatory iNOS, COX-2 and ODC gene expression in mouse skin. It is suggested that DDMN is a novel functional agent capable of preventing inflammation-associated tumorigenesis.
Ahn, Soomin; Hong, Mineui; Van Vrancken, Michael; Lyou, You Jeong; Kim, Seung Tae; Park, Se Hoon; Kang, Won Ki; Park, Young Suk; Jung, Sin-Ho; Woo, Minah; Lee, Jeeyun; Kim, Kyoung-Mee
2016-08-01
Screening amplified genes for targeted therapy with high-throughput technology is very important. The NanoString nCounter system allows multiplexed digital quantification of target molecules through the use of color-coded barcodes with the great advantage that formalin-fixed, paraffin-embedded (FFPE) tissue can be utilized. We tested nCounter custom copy number variation (CNV) panels in 220 gastric cancer samples and evaluated the utility of this method as a screening tool for the detection of CNV using HER2. For the validation of results, we compared the nCounter results with immunohistochemistry (IHC), and we further performed in situ hybridization (ISH) in discrepant cases. The average HER2 gene copy numbers (CNs) by nCounter were 17.25, 2.0 and 2.61 for the HER2 IHC positive (3+), equivocal (2+), and negative cases, respectively. Out of the 16 IHC 3+ cases, 13 (81.3 %) were reported as HER2 CN gain (≥4). Gastric cancers with homogeneous HER2 overexpression or high tumor purity showed HER2 CN ≥10. Among the 192 cases with HER2 IHC negative and without HER2 gene amplification, 29 showed a HER2 CN ≥4 with the nCounter assay. The nCounter assay had a concordance rate of 83.4 % (kappa value, 0.35), a sensitivity of 66.7 %, a specificity of 85.2 %, a negative predictive value of 96 %, and a positive predictive value of 32.6 % compared with HER2 IHC/ISH results. Fresh frozen (FF) samples revealed a higher concordance rate (91.5 %, kappa value, 0.59) than FFPE samples (78.5 %, kappa value 0.27) and showed a high specificity (97.2 %). The nCounter CNV assay is a reliable and practical method to detect high CN variations. Given the intra-tumoral HER2 heterogeneity and normal cell contamination, additional IHC and/or FISH is necessary and needs caution in interpretation, especially in FFPE tissue samples.
Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.
2014-01-01
The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using the standard culture method. PMID:24849624
Velasco, Valeria; Sherwood, Julie S; Rojas-García, Pedro P; Logue, Catherine M
2014-01-01
The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement) and 0.29-0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using the standard culture method.
Efficacy and mechanism of action of turmeric supplements in the treatment of experimental arthritis.
Funk, Janet L; Frye, Jennifer B; Oyarzo, Janice N; Kuscuoglu, Nesrin; Wilson, Jonathan; McCaffrey, Gwen; Stafford, Gregory; Chen, Guanjie; Lantz, R Clark; Jolad, Shivanand D; Sólyom, Aniko M; Kiela, Pawel R; Timmermann, Barbara N
2006-11-01
Scientific evidence is lacking for the antiarthritic efficacy of turmeric dietary supplements that are being promoted for arthritis treatment. Therefore, we undertook studies to determine the antiarthritic efficacy and mechanism of action of a well-characterized turmeric extract using an animal model of rheumatoid arthritis (RA). The composition of commercial turmeric dietary supplements was determined by high-performance liquid chromatography. A curcuminoid-containing turmeric extract similar in composition to these supplements was isolated and administered intraperitoneally to female Lewis rats prior to or after the onset of streptococcal cell wall-induced arthritis. Efficacy in preventing joint swelling and destruction was determined clinically, histologically, and by measurement of bone mineral density. Mechanism of action was elucidated by analysis of turmeric's effect on articular transcription factor activation, microarray analysis of articular gene expression, and verification of the physiologic effects of alterations in gene expression. A turmeric fraction depleted of essential oils profoundly inhibited joint inflammation and periarticular joint destruction in a dose-dependent manner. In vivo treatment prevented local activation of NF-kappaB and the subsequent expression of NF-kappaB-regulated genes mediating joint inflammation and destruction, including chemokines, cyclooxygenase 2, and RANKL. Consistent with these findings, inflammatory cell influx, joint levels of prostaglandin E(2), and periarticular osteoclast formation were inhibited by turmeric extract treatment. These translational studies demonstrate in vivo efficacy and identify a mechanism of action for a well-characterized turmeric extract that supports further clinical evaluation of turmeric dietary supplements in the treatment of RA.
Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco Javier
2009-11-01
The genetic basis for the predisposition to alcoholic liver cirrhosis (ALC) remains unknown. Increasing evidence supports a role for the nuclear factor (NF)-kappaB, the NF-kappaB inhibitor alpha (NFKBIA), and the peroxisome proliferator-activated receptor (PPAR)-gamma in the pathogenesis of alcoholic liver disease, raising the possibility that common polymorphisms in genes encoding these molecules may confer susceptibility to ALC. The objective of this study was to analyze the relationship between common polymorphisms in NFKB1, NFKBIA, and PPARG2 genes and the presence of ALC. A total of 258 male alcoholics (161 without liver disease and 97 with ALC) and 101 healthy controls were genotyped for the -94ins/delATTG NFKB1, 3'-UTR+126G>A NFKBIA, and 34C>G PPARG2 polymorphisms. The association of these genetic variants with ALC was tested in alcoholic patients with alcohol abuse and alcohol dependence. A logistic regression analysis was further performed to analyze the model of inheritance. We found an association between the presence of the deletion allele in NFKB1 polymorphism and ALC in patients with alcohol dependence. We found no association between NFKBIA and PPARG2 polymorphisms and the presence of ALC. The deletion allele of the -94ins/del NFKB1 polymorphism could be associated with a higher risk of developing ALC through an increase in inflammation, as supported by previous data.
Curcumin blocks RON tyrosine kinase-mediated invasion of breast carcinoma cells.
Narasimhan, Madhusudhanan; Ammanamanchi, Sudhakar
2008-07-01
We have recently shown that macrophage-stimulating protein (MSP) promotes the invasion of recepteur d'origine nantais (RON), a tyrosine kinase receptor-positive MDA-MB-231, MDA-MB-468 breast cancer cells, and also identified the regulatory elements required for RON gene expression. In this report, we have analyzed the efficacy of a chemopreventive agent, curcumin, in blocking RON tyrosine kinase-mediated invasion of breast cancer cells. Reverse transcription-PCR and Western analysis indicated the down-regulation of the RON message and protein, respectively, in MDA-MB-231 and MDA-MB-468 cells. Significantly, curcumin-mediated inhibition of RON expression resulted in the blockade of RON ligand, MSP-induced invasion of breast cancer cells. We have identified two putative nuclear factor-kappaB p65 subunit binding sites on the RON promoter. Using chromatin immunoprecipitation analysis and site-directed mutagenesis of the RON promoter, we have confirmed the binding of p65 to the RON promoter. Our data show that curcumin reduces RON expression by affecting p65 protein expression and transcriptional activity. Treatment of MDA-MB-231 cells with pyrrolidine dithiocarbamate, an inhibitor of p65, or small interfering RNA knockdown of p65, blocked RON gene expression and MSP-mediated invasion of MDA-MB-231 cells. This is the first report showing the regulation of human RON gene expression by nuclear factor-kappaB and suggests a potential therapeutic role for curcumin in blocking RON tyrosine kinase-mediated invasion of carcinoma cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Umikawa, Masato, E-mail: umikawa@med.u-ryukyu.ac.jp; Umikawa, Asako; Asato, Tsuyoshi
Monocytes and macrophages are important effectors and regulators of inflammation, and both their differentiation and activation are regulated strictly in response to environmental cues. Angiopoietin-like protein 2 (Angptl2) is a multifaceted protein, displaying many physiological and pathological functions in inflammation, angiogenesis, hematopoiesis, and tumor development. Although recent studies implicate Angptl2 in chronic inflammation, the mechanisms of inflammation caused by Angptl2 remain unclear. The purpose of the present study was to elucidate the role of Angptl2 in inflammation by understanding the effects of Angptl2 on monocytes/macrophages. We showed that Angptl2 directly activates resident murine peritoneal monocytes and macrophages and induces amore » drastic upregulation of the transcription of several inflammatory genes including nitric oxide synthase 2 and prostaglandin-endoperoxide synthase 2, and several proinflammatory cytokine genes such as interleukin (IL)-1β, IL-6, TNFα, and CSF2, along with activation of ERK, JNK, p38, and nuclear factor kappa B signaling pathways. Concordantly, proinflammatory cytokines IL-1β, IL-6, TNFα, and GM-CSF, were rapidly elevated from murine peritoneal monocytes and macrophages. These results demonstrate a novel role for Angptl2 in inflammation via the direct activation of peritoneal monocytes and macrophages. - Highlights: • Angptl2 directly activates resident murine peritoneal monocytes and macrophages. • Angptl2 induces a drastic upregulation of expression of inflammatory genes. • Angptl2 induces activation of ERK, JNK, p38, and nuclear factor kappa B signaling pathways. • Angptl2 does not activate bone marrow derived macrophages or macrophage cell lines.« less
Inter-observer variability within BI-RADS and RANZCR mammographic density assessment schemes
NASA Astrophysics Data System (ADS)
Damases, Christine N.; Mello-Thoms, Claudia; McEntee, Mark F.
2016-03-01
This study compares variability associated with two visual mammographic density (MD) assessment methods using two separate samples of radiologists. The image test-set comprised of images obtained from 20 women (age 42-89 years). The images were assessed for their MD by twenty American Board of Radiology (ABR) examiners and twenty-six radiologists registered with the Royal Australian and New Zealand College of Radiologists (RANZCR). Images were assessed using the same technology and conditions, however the ABR radiologists used the BI-RADS and the RANZCR radiologists used the RANZCR breast density synoptic. Both scales use a 4-point assessment. The images were then grouped as low- and high-density; low including BIRADS 1 and 2 or RANZCR 1 and 2 and high including BI-RADS 3 and 4 or RANZCR 3 and 4. Four-point BI-RADS and RANZCR showed no or negligible correlation (ρ=-0.029 p<0.859). The average inter-observer agreement on the BI-RADS scale had a Kappa of 0.565; [95% CI = 0.519 - 0.610], and ranged between 0.328-0.669 while the inter-observer agreement using the RANZCR scale had a Kappa of 0.360; [95% CI = 0.308 - 0.412] and a range of 0.078-0.499. Our findings show a wider range of inter-observer variability among RANZCR registered radiologists than the ABR examiners.
Joo, Ji Hyeon; Cho, Byung Chul; Jeong, Chi Young; Park, Won; Kim, Hak Jae; Yoon, Won Sup; Yoon, Mee Sun; Kim, Ji-Yoon; Choi, Jin Hwa; Choi, Youngmin; Kim, Joo-Young
2017-01-01
Purpose To determine inter-observer variability in target volume definition of cervical cancer in radical and adjuvant radiotherapy (RT) settings. Methods Eight physicians contoured CTVs of 2 patients underwent definitive and postoperative RT. Each volume was analyzed using the individual/median volume ratio and generalized conformity index (CIgen). And center of mass (COM) of each contour was calculated. Expert agreement was quantified using an expectation maximization algorithm for Simultaneous Truth and Performance Level Estimation (STAPLE). Results For definitive RT, the individual/median volume ratio ranged from 0.51 to 1.41, and CIgen was 0.531. Mean 3-dimensional distances of average to each COM were 7.8 mm. For postoperative RT setting, corresponding values were 0.65–1.38, 0.563, and 5.3 mm. Kappa value of expert agreement was 0.65 and 0.67, respectively. STAPLE estimates of the sensitivity, specificity, and kappa measures of inter-physician agreement were 0.73, 0.98, and 0.65 for the definitive and 0.75, 0.98, and 0.67 for the adjuvant radiotherapy setting. The largest difference was observed in the superior-inferior direction, particularly in the upper vagina and the common iliac area. Conclusion As there was still some variability in target delineation, more detailed guidelines for target volume delineation and continuing education would help to reduce this uncertainty. PMID:28301492
Lambda light chain revision in the human intestinal IgA response.
Su, Wen; Gordon, John N; Barone, Francesca; Boursier, Laurent; Turnbull, Wayne; Mendis, Surangi; Dunn-Walters, Deborah K; Spencer, Jo
2008-07-15
Revision of Ab L chains by secondary rearrangement in mature B cells has the potential to change the specific target of the immune response. In this study, we show for the first time that L chain revision is normal and widespread in the largest Ab producing population in man: intestinal IgA plasma cells (PC). Biases in the productive and non-productive repertoire of lambda L chains, identification of the circular products of rearrangement that have the characteristic biases of revision, and identification of RAG genes and protein all reflect revision during normal intestinal IgA PC development. We saw no evidence of IgH revision, probably due to inappropriately orientated recombination signal sequences, and little evidence of kappa-chain revision, probably due to locus inactivation by the kappa-deleting element. We propose that the lambda L chain locus is available and a principal modifier and diversifier of Ab specificity in intestinal IgA PCs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Kyoung-Hee; Lee, Choon-Taek; Kim, Young Whan
2005-07-01
Heat shock (HS) treatment has been previously shown to suppress the I{kappa}B/nuclear factor-{kappa}B (NF-{kappa}B) cascade by denaturing, and thus inactivating I{kappa}B kinase (IKK). HS is characterized by the induction of a group of heat shock proteins (HSPs). However, their role in the HS-induced suppression of the I{kappa}B/NF-{kappa}B cascade is unclear. Adenovirus-mediated HSP70 overexpression was found not to suppress the TNF-{alpha}-induced activation of the I{kappa}B/NF-{kappa}B pathway, thus suggesting that HSP70 is unlikely to suppress this pathway. When TNF-{alpha}-induced activation of the I{kappa}B/NF-{kappa}B pathway was regained 24 h after HS, HSP70 was found to be highly up-regulated. Moreover, blocking HSP70 induction delayedmore » TNF-{alpha}-induced I{kappa}B{alpha} degradation and the resolubilization of IKK. In addition, HSP70 associated physically with IKK, suggesting that HSP70 is involved in the recovery process via molecular chaperone effect. Adenovirus-mediated HSP70 overexpression prior to HS blocked the I{kappa}B{alpha} stabilizing effect of HS by suppressing IKK insolubilization. Moreover, the up-regulation of endogenous HSP70 by preheating, suppressed this subsequent HS-induced IKK insolubilization, and this effect was abrogated by blocking HSP70 induction. These findings indicate that HSP70 accumulates during HS and negatively regulates the HS-induced suppression of the I{kappa}B/NF-{kappa}B cascade by facilitating the renaturation of IKK and blocking its further denaturation.« less
Franca, Carolina da; Colares, Viviane
2010-06-01
The objective of this article is to translate, to adapt and to validate the National College Health Risk Behavior Survey to apply at Brazilian college students. 208 college students from the Federal University of Pernambuco (UFPE) and University of Pernambuco (UPE) participated in the study. The validation was carried through in five stages: (1) translation; (2) retrotranslation; (3) correction and semantic adaptation (cultural adaptation); (4) face validation; (5) test-retest. Adaptations were done to deal with any semantic disagreements found between translation and retrotranslation. After face validation, the questionnaire was reduced from 96 to 52 questions. From the 11 items analyzed, the majority presented good and perfect Kappa: security and violence (Kappa=0.89); suicide (Kappa=1.00); use of the tobacco (Kappa=0.90); drinking consumption (Kappa=0.78); cocaine and other drugs consumption (Kappa=0.70); sexual behavior (Kappa=0,88) and corporal weight (Kappa=0.89). Only the item about feeding presented weak Inter-examiner Kappa (Kappa = 0.26) and the topic on health information presented moderate Kappa (Kappa=0.56). The average Kappa for all items was good (0.76). The instrument may be considered validated in the Portuguese language in Brazil with acceptable reproducibility.
Pak, Jhang Ho; Shin, Jimin; Song, In-Sung; Shim, Sungbo; Jang, Sung-Wuk
2017-01-01
Matrix metalloproteinase-9 plays an important role in the invasion and metastasis of various types of cancer cells. We have previously reported that excretory-secretory products from Clonorchis sinensis increases matrix metalloproteinase-9 expression. However, the regulatory mechanisms through which matrix metalloproteinase-9 expression affects cholangiocarcinoma development remain unclear. In the current study, we examined the potential role of excretory-secretory products in regulating the migration and invasion of various cholangiocarcinoma cell lines. We demonstrated that excretory-secretory products significantly induced matrix metalloproteinase-9 expression and activity in a concentration-dependent manner. Reporter gene and chromatin immunoprecipitation assays showed that excretory-secretory products induced matrix metalloproteinase-9 expression by enhancing the activity of nuclear factor-kappa B. Moreover, excretory-secretory products induced the degradation and phosphorylation of IκBα and stimulated nuclear factor-kappa B p65 nuclear translocation, which was regulated by extracellular signal-regulated kinase 1/2. Taken together, our findings indicated that the excretory-secretory product-dependent enhancement of matrix metalloproteinase-9 activity and subsequent induction of IκBα and nuclear factor-kappa B activities may contribute to the progression of cholangiocarcinoma. Copyright © 2016 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.
Scale covariant gravitation. V - Kinetic theory. VI - Stellar structure and evolution
NASA Technical Reports Server (NTRS)
Hsieh, S.-H.; Canuto, V. M.
1981-01-01
A scale covariant kinetic theory for particles and photons is developed. The mathematical framework of the theory is given by the tangent bundle of a Weyl manifold. The Liouville equation is derived, and solutions to corresponding equilibrium distributions are presented and shown to yield thermodynamic results identical to the ones obtained previously. The scale covariant theory is then used to derive results of interest to stellar structure and evolution. A radiative transfer equation is derived that can be used to study stellar evolution with a variable gravitational constant. In addition, it is shown that the sun's absolute luminosity scales as L approximately equal to GM/kappa, where kappa is the stellar opacity. Finally, a formula is derived for the age of globular clusters as a function of the gravitational constant using a previously derived expression for the absolute luminosity.
Synthesis, structural studies and reactivity of vanadium complexes with tridentate (OSO) ligand.
Janas, Zofia; Wiśniewska, Dorota; Jerzykiewicz, Lucjan B; Sobota, Piotr; Drabent, Krzysztof; Szczegot, Krzysztof
2007-05-28
The direct reaction between [VCl(3)(thf)3] or [VO(OEt)3] and 2,2'-thiobis{4-(1,1,3,3-tetramethyl-butyl)phenol (tbopH(2)) leads to the formation of [V(2)(micro-tbop-kappa(3)O,S,O)2Cl(2)(CH(3)CN)(2)] (1).4CH(3)CN or [V(2)(micro-OEt)2(O)2(tbop-kappa(3)O,S,O)2] (2), respectively, in high yield. Compounds 1 and 2 were characterized by chemical and physical techniques including X-ray crystallography and variable temperature magnetic susceptibility studies (J = -29.1 cm(-1)) for 1. Complexes 1 and 2 were supported on MgCl2 and when activated with aluminium alkyls, were found to effectively polymerize ethene to produce polyethylene with a narrow molecular weight distribution M(w)/M(n) approximately 3.
Huang, Y; Ohtani, K; Iwanaga, R; Matsumura, Y; Nakamura, M
2001-03-01
Cyclins are one of the pivotal determinants regulating cell cycle progression. We previously reported that the trans-activator Tax of human T-cell leukemia virus type I (HTLV-I) induces endogenous cyclin D2 expression along with cell cycle progression in a resting human T-cell line, Kit 225, suggesting a role of cyclin D2 in Tax-mediated cell cycle progression. The cyclin D2 gene has a typical E2F binding element, raising the possibility that induction of cyclin D2 expression is a consequence of cell cycle progression. In this study, we examined the role and molecular mechanism of induction of the endogenous human cyclin D2 gene by Tax. Introduction of p19(INK4d), a cyclin dependent kinase (CDK) inhibitor of the INK4 family specific for D-type CDK, inhibited Tax-mediated activation of E2F, indicating requirement of D-type CDK in Tax-mediated activation of E2F. Previously indicated E2F binding element and two NF-kappaB-like binding elements in the 1.6 kbp cyclin D2 promoter fragment had little, if any, effect on responsiveness to Tax. We found that trans-activation of the cyclin D2 promoter by Tax was mainly mediated by a newly identified NF-kappaB-like element with auxiliary contribution of a CRE-like element residing in sequences downstream of -444 which were by themselves sufficient for trans-activation by Tax. These results indicate that Tax directly trans-activates the cyclin D2 gene, resulting in growth promotion and perhaps leukemogenesis through activation of D-type CDK.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zukin, R.S.; Eghbali, M.; Olive, D.
{kappa} opioid receptors ({kappa} receptors) have been characterized in homogenates of guinea pig and rat brain under in vitro binding conditions. {kappa} receptors were labeled by using the tritiated prototypic {kappa} opioid ethylketocyclazocine under conditions in which {mu} and {delta} opioid binding was suppressed. In the case of guinea pig brain membranes, a single population of high-affinity {kappa} opioid receptor sites was observed. In contrast, in the case of rat brain, two populations of {kappa} sites were observed. To test the hypothesis that the high- and low-affinity {kappa} sites represent two distinct {kappa} receptor subtypes, a series of opioids weremore » tested for their abilities to compete for binding to the two sites. U-69,593 and Cambridge 20 selectively displaced the high-affinity {kappa} site in both guinea pig and rat tissue, but were inactive at the rat-brain low-affinity site. Other {kappa} opioid drugs competed for binding to both sites, but with different rank orders of potency. Quantitative light microscopy in vitro autoradiography was used to visualize the neuroanatomical pattern of {kappa} receptors in rat and guinea pig brain. The distribution patterns of the two {kappa} receptor subtypes of rat brain were clearly different. Collectively, these data provide direct evidence for the presence of two {kappa} receptor subtypes; the U-69,593-sensitive, high-affinity {kappa}{sub 1} site predominates in guinea pig brain, and the U-69,593-insensitive, low-affinity {kappa}{sub 2} site predominates in rat brain.« less
Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun
2010-02-05
Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pappas, D; Reis, S; Ali, A
Purpose To determine how consistent the results of different raters are when reviewing the same cases within the Radiation Oncology Incident Learning System (ROILS). Methods Three second-year medical physics graduate students filled out incident reports in spreadsheets set up to mimic ROILS. All students studied the same 33 cases and independently entered their assessments, for a total of 99 reviewed cases. The narratives for these cases were obtained from a published International Commission on Radiological Protection (ICRP) report which included shorter narratives selected from the Radiation Oncology Safety Information System (ROSIS) database. Each category of questions was reviewed to seemore » how consistent the results were by utilizing free-marginal multirater kappa analysis. The percentage of cases where all raters shared full agreement or full disagreement was recorded to show which questions were answered consistently by multiple raters for a given case. The consistency among the raters was analyzed between ICRP and ROSIS cases to see if either group led to more reliable results. Results The categories where all raters agreed 100 percent in their choices were the event type (93.94 percent of cases 0.946 kappa) and the likelihood of the event being harmful to the patient (42.42 percent of cases 0.409 kappa). The categories where all raters disagreed 100 percent in their choices were the dosimetric severity scale (39.39 percent of cases 0.139 kappa) and the potential future toxicity (48.48 percent of cases 0.205 kappa). ROSIS had more cases where all raters disagreed than ICRP (23.06 percent of cases compared to 15.58 percent, respectively). Conclusion Despite reviewing the same cases, the results among the three raters was widespread. ROSIS narratives were shorter than ICRP, which suggests that longer narratives lead to more consistent results. This study shows that the incident reporting system can be optimized to yield more consistent results.« less
Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír
2016-01-01
Objectives We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. Methods We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Results Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Conclusions Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance. PMID:27846293
Elizabeth A. Freeman; Gretchen G. Moisen
2008-01-01
Modelling techniques used in binary classification problems often result in a predicted probability surface, which is then translated into a presence - absence classification map. However, this translation requires a (possibly subjective) choice of threshold above which the variable of interest is predicted to be present. The selection of this threshold value can have...
Verma, Nupur; Hippe, Daniel S; Robinson, Jeffrey D
2016-12-01
Peer review is an important and necessary part of radiology. There are several options to perform the peer review process. This study examines the reproducibility of peer review by comparing two scoring systems. American Board of Radiology-certified radiologists from various practice environments and subspecialties were recruited to score deidentified examinations on a web-based PACS with two scoring systems, RADPEER and Cleareview. Quantitative analysis of the scores was performed for interrater agreement. Interobserver variability was high for both the RADPEER and Cleareview scoring systems. The interobserver correlations (kappa values) were 0.17-0.23 for RADPEER and 0.10-0.16 for Cleareview. Interrater correlation was not statistically significantly different when comparing the RADPEER and Cleareview systems (p = 0.07-0.27). The kappa values were low for the Cleareview subscores when we evaluated for missed findings (0.26), satisfaction of search (0.17), and inadequate interpretation of findings (0.12). Our study confirms the previous report of low interobserver correlation when using the peer review process. There was low interobserver agreement seen when using both the RADPEER and the Cleareview scoring systems.
Quantifying expert diagnosis variability when grading tumor-infiltrating lymphocytes
NASA Astrophysics Data System (ADS)
Toro, Paula; Corredor, Germán.; Wang, Xiangxue; Arias, Viviana; Velcheti, Vamsidhar; Madabhushi, Anant; Romero, Eduardo
2017-11-01
Tumor-infiltrating lymphocytes (TILs) have proved to play an important role in predicting prognosis, survival, and response to treatment in patients with a variety of solid tumors. Unfortunately, currently, there are not a standardized methodology to quantify the infiltration grade. The aim of this work is to evaluate variability among the reports of TILs given by a group of pathologists who examined a set of digitized Non-Small Cell Lung Cancer samples (n=60). 28 pathologists answered a different number of histopathological images. The agreement among pathologists was evaluated by computing the Kappa index coefficient and the standard deviation of their estimations. Furthermore, TILs reports were correlated with patient's prognosis and survival using the Pearson's correlation coefficient. General results show that the agreement among experts grading TILs in the dataset is low since Kappa values remain below 0.4 and the standard deviation values demonstrate that in none of the images there was a full consensus. Finally, the correlation coefficient for each pathologist also reveals a low association between the pathologists' predictions and the prognosis/survival data. Results suggest the need of defining standardized, objective, and effective strategies to evaluate TILs, so they could be used as a biomarker in the daily routine.
Cienfuegos, Astrid V.; Rosero, Doris A.; Naranjo, Nelson; Luckhart, Shirley; Conn, Jan E.; Correa, Margarita M.
2011-01-01
Anopheles mosquitoes are routinely identified using morphological characters of the female that often lead to misidentification due to interspecies similarity and intraspecies variability. The aim of this work was to evaluate the applicability of a previously developed PCR-RFLP-ITS2 assay for accurate discrimination of anophelines in twelve localities spanning three Colombian malaria epidemiological regions: Atlantic Coast, Pacific Coast, and Uraba-Bajo Cauca-Alto Sinu Region. The evaluation of the stability of the PCR-RFLP patterns is required since variability of the ITS2 has been documented and may produce discrepancies in the patterns previously reported. The assay was used to evaluate species assignation of 939 mosquitoes identified by morphology. Strong agreement between the morphological and molecular identification was found for species An. albimanus, An. aquasalis, An. darlingi and An. triannulatus s.l. (p ≥ 0.05, kappa=1). However, disagreement was found for species An. nuneztovari s.l., An. neomaculipalpus, An. apicimacula and An. punctimacula (p ≤ 0.05; kappa ranging from 0.33–0.80). The ITS2-PCR-RFLP assay proved valuable for discriminating anopheline species of northern and western Colombia, especially those with overlapping morphology in the Oswaldoi Group. PMID:21345325
Interobserver variability in recognizing arousal in respiratory sleep disorders.
Drinnan, M J; Murray, A; Griffiths, C J; Gibson, G J
1998-08-01
Daytime sleepiness is a common consequence of repeated arousal in obstructive sleep apnea (OSA). Arousal indices are sometimes used to make decisions on treatment, but there is no evidence that arousals are detected similarly even by experienced observers. Using the American Sleep Disorders Association (ASDA) definition of arousal in terms of the accompanying electroencephalogram (EEG) changes, we have quantified interobserver agreement for arousal scoring and identified factors affecting it. Ten patients with suspected OSA were studied; three representative EEG events during each of light, slow-wave, and rapid-eye-movement (REM) sleep were extracted from each record (90 events total) and evaluated by experts in 14 sleep laboratories. Observers differed (ANOVA, p < 0.001) in the number of events scored as arousal (totals ranged from 23 to 53 of the 90 events). Overall agreement was moderate (kappa = 0.47), but it was best for events during slow-wave sleep, moderate for REM, and poor for light sleep (kappa = 0.60, 0.52, and 0.28, respectively). Agreement was unrelated to arousal duration. We conclude that the ASDA definition of arousal is only moderately repeatable. Account should be taken of this variability when results from different centers are compared.
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Donath, Bernadette; Fischer, Claudia; Page, Sharon; Prebeck, Sigrid; Jilg, Nikolaus; Weber, Marion; da Costa, Clarissa; Neumeier, Dieter; Miethke, Thomas; Brand, Korbinian
2002-11-01
Chlamydia pneumoniae may be involved in atherosclerosis by inducing inflammation as well as LDL oxidation. The transcription factor NF-kappa B is found in an active state in atherosclerotic lesions. This study examined the effect of C. pneumoniae exposure on the NF-kappa B system in human monocytic lineage cells. Short exposure to C. pneumoniae as well as chlamydial heat shock protein 60 activated NF-kappa B, accompanied by increased cytokine production. Incubation with C. pneumoniae-induced depletion of I kappa B-alpha and later I kappa B-epsilon which was preceded by I kappa B kinase complex activation. 4-Hydroxynonenal, an aldehyde LDL oxidation product, was shown to inhibit C. pneumoniae induced NF-kappa B activation by preventing I kappa B phosphorylation/proteolysis. During long-term incubation with C. pneumoniae I kappa B-alpha returned to baseline, whereas the levels of I kappa B-epsilon and p65 were upregulated. Interestingly, long-term preincubation with C. pneumoniae selectively prevented restimulation by this microorganism, which appears to be at least partly facilitated by inhibition of I kappa B proteolysis. C. pneumoniae-induced NF-kappa B activation as well as the inhibition of that effect under certain conditions may contribute to chronic inflammation with potential relevance to vascular disease.
Amit, Sharon; Ben-Neriah, Yinon
2003-02-01
Nuclear factor-kappa B (NF-kappaB) activation relies primarily on ubiquitin-mediated degradation of its inhibitor IkappaB. NF-kappaB plays an important role in many aspects of tumor development, progression, and therapy. Some types of cancer are characterized by constitutive NF-kappaB activity, whereas in others such activity is induced following chemotherapy. NF-kappaB-harboring tumors are generally resistant to chemotherapy and their eradication requires NF-kappaB inhibition. Here we describe the mechanisms of NF-kappaB activation in normal and tumor cells, review prevalent notions regarding the factor's contribution to tumorigenicity and discuss present and future options for NF-kappaB inhibition in cancer. The ubiquitination-mediated activation of NF-kappaB is intersected by another cancer-associated protein, beta-catenin. We, therefore, compare the related activation pathways and discuss the possibility of differential targeting of the involved ubiquitination machinery. Copyright 2002 Elsevier Science Ltd.
Giesemann, Anja M; Raab, Peter; Lyutenski, Stefan; Dettmer, Sabine; Bültmann, Eva; Frömke, Cornelia; Lenarz, Thomas; Lanfermann, Heinrich; Goetz, Friedrich
2014-03-01
Magnetic resonance imaging of the temporal bone has an important role in decision making with regard to cochlea implantation, especially in children with cochlear nerve deficiency. The purpose of this study was to evaluate the usefulness of the combination of an advanced high-resolution T2-weighted sequence with a surface coil in a 3-Tesla magnetic resonance imaging scanner in cases of suspected cochlear nerve aplasia. Prospective study. Seven patients with cochlear nerve hypoplasia or aplasia were prospectively examined using a high-resolution three-dimensional variable flip-angle turbo spin-echo sequence using a surface coil, and the images were compared with the same sequence in standard resolution using a standard head coil. Three neuroradiologists evaluated the magnetic resonance images independently, rating the visibility of the nerves in diagnosing hypoplasia or aplasia. Eight ears in seven patients with hypoplasia or aplasia of the cochlear nerve were examined. The average age was 2.7 years (range, 9 months-5 years). Seven ears had accompanying malformations. The inter-rater reliability in diagnosing hypoplasia or aplasia was greater using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence (fixed-marginal kappa: 0.64) than with the same sequence in lower resolution (fixed-marginal kappa: 0.06). Examining cases of suspected cochlear nerve aplasia using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence in combination with a surface coil shows significant improvement over standard methods. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.
NASA Astrophysics Data System (ADS)
Rodriguez-Galiano, Victor; Aragones, David; Caparros-Santiago, Jose A.; Navarro-Cerrillo, Rafael M.
2017-10-01
Land surface phenology (LSP) can improve the characterisation of forest areas and their change processes. The aim of this work was: i) to characterise the temporal dynamics in Mediterranean Pinus forests, and ii) to evaluate the potential of LSP for species discrimination. The different experiments were based on 679 mono-specific plots for the 5 native species on the Iberian Peninsula: P. sylvestris, P. pinea, P. halepensis, P. nigra and P. pinaster. The entire MODIS NDVI time series (2000-2016) of the MOD13Q1 product was used to characterise phenology. The following phenological parameters were extracted: the start, end and median days of the season, and the length of the season in days, as well as the base value, maximum value, amplitude and integrated value. Multi-temporal metrics were calculated to synthesise the inter-annual variability of the phenological parameters. The species were discriminated by the application of Random Forest (RF) classifiers from different subsets of variables: model 1) NDVI-smoothed time series, model 2) multi-temporal metrics of the phenological parameters, and model 3) multi-temporal metrics and the auxiliary physical variables (altitude, slope, aspect and distance to the coastline). Model 3 was the best, with an overall accuracy of 82%, a kappa coefficient of 0.77 and whose most important variables were: elevation, coast distance, and the end and start days of the growing season. The species that presented the largest errors was P. nigra, (kappa= 0.45), having locations with a similar behaviour to P. sylvestris or P. pinaster.
Ruperto, Nicolino; Pistorio, Angela; Ravelli, Angelo; Rider, Lisa G.; Pilkington, Clarissa; Oliveira, Sheila; Wulffraat, Nico; Espada, Graciela; Garay, Stella; Cuttica, Ruben; Hofer, Michael; Quartier, Pierre; Melo-Gomes, Jose; Reed, Ann M.; Wierzbowska, Malgorzata; Feldman, Brian M.; Harjacek, Miroslav; Huppertz, Hans-Iko; Nielsen, Susan; Flato, Berit; Lahdenne, Pekka; Michels, Harmut; Murray, Kevin J.; Punaro, Lynn; Rennebohm, Robert; Russo, Ricardo; Balogh, Zsolt; Rooney, Madeleine; Pachman, Lauren M.; Wallace, Carol; Hashkes, Philip; Lovell, Daniel J.; Giannini, Edward H.; Martini, Alberto
2010-01-01
Objective To develop a provisional definition for the evaluation of response to therapy in juvenile dermatomyositis (JDM) based on the PRINTO JDM core set of variables. Methods Thirty-seven experienced pediatric rheumatologists from 27 countries, achieved consensus on 128 difficult patient profiles as clinically improved or not improved using a stepwise approach (patients rating, statistical analysis, definition selection). Using the physicians’ consensus ratings as the “gold-standard measure”, chi-square, sensitivity, specificity, false positive and negative rate, area under the ROC, and kappa agreement for candidate definitions of improvement were calculated. Definitions with kappa >0.8 were multiplied with the face validity score to select the top definitions. Results The top definition of improvement was: at least 20% improvement from baseline in 3/6 core set variables with no more than 1 of the remaining worsening by more than 30%, which cannot be muscle strength. The second highest scoring definition was at least 20% improvement from baseline in 3/6 core set variables with no more than 2 of the remaining worsening by more than 25%, which cannot be muscle strength which is definition P1 selected by the IMACS group. The third is similar to the second with the maximum amount of worsening set to 30%. This indicates convergent validity of the process. Conclusion we proposes a provisional data driven definition of improvement that reflects well the consensus rating of experienced clinicians, which incorporates clinically meaningful change in core set variables in a composite endpoint for the evaluation of global response to therapy in JDM. PMID:20583105
The Nuclear Death Domain Protein p84N5; A Candidate Breast Cancer Susceptibility Gene
2007-05-01
hallmarks of cancer. Cell 100, 57-70, 2000. 35. Karin M, Cao Y, Greten FR, Li ZW. NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev...D., and Weinberg, R. A. (2000) Cell 100, 57-70 46. Karin, M., Cao, Y., Greten , F. R., and Li, Z. W. (2002) Nat Rev Cancer 2, 301-310 47. Cogswell, P
Gupta, Sanjay K.; Dahiya, Saurabh; Lundy, Robert F.; Kumar, Ashok
2010-01-01
Background Skeletal muscle wasting is a debilitating consequence of large number of disease states and conditions. Tumor necrosis factor-α (TNF-α) is one of the most important muscle-wasting cytokine, elevated levels of which cause significant muscular abnormalities. However, the underpinning molecular mechanisms by which TNF-α causes skeletal muscle wasting are less well-understood. Methodology/Principal Findings We have used microarray, quantitative real-time PCR (QRT-PCR), Western blot, and bioinformatics tools to study the effects of TNF-α on various molecular pathways and gene networks in C2C12 cells (a mouse myoblastic cell line). Microarray analyses of C2C12 myotubes treated with TNF-α (10 ng/ml) for 18h showed differential expression of a number of genes involved in distinct molecular pathways. The genes involved in nuclear factor-kappa B (NF-kappaB) signaling, 26s proteasome pathway, Notch1 signaling, and chemokine networks are the most important ones affected by TNF-α. The expression of some of the genes in microarray dataset showed good correlation in independent QRT-PCR and Western blot assays. Analysis of TNF-treated myotubes showed that TNF-α augments the activity of both canonical and alternative NF-κB signaling pathways in myotubes. Bioinformatics analyses of microarray dataset revealed that TNF-α affects the activity of several important pathways including those involved in oxidative stress, hepatic fibrosis, mitochondrial dysfunction, cholesterol biosynthesis, and TGF-β signaling. Furthermore, TNF-α was found to affect the gene networks related to drug metabolism, cell cycle, cancer, neurological disease, organismal injury, and abnormalities in myotubes. Conclusions TNF-α regulates the expression of multiple genes involved in various toxic pathways which may be responsible for TNF-induced muscle loss in catabolic conditions. Our study suggests that TNF-α activates both canonical and alternative NF-κB signaling pathways in a time-dependent manner in skeletal muscle cells. The study provides novel insight into the mechanisms of action of TNF-α in skeletal muscle cells. PMID:20967264
Lee, Jongkyu; Tae, Nara; Lee, Jung Joon; Kim, Taeho; Lee, Jeong-Hyung
2010-06-25
Inula britannica is a traditional medicinal plant used to treat bronchitis, digestive disorders, and inflammation in Eastern Asia. Here, we identified eupatolide, a sesquiterpene lactone from I. britannica, as an inhibitor of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) expression. Eupatolide inhibited the production of nitric oxide (NO) and prostaglandin E(2) (PGE(2)) as well as iNOS and COX-2 protein expression in lipopolysaccharide (LPS)-stimulated RAW264.7 cells. Eupatolide dose-dependently decreased the mRNA levels and the promoter activities of COX-2 and iNOS in LPS-stimulated RAW264.7 cells. Moreover, eupatolide significantly suppressed the LPS-induced expression of nuclear factor-kappa B (NF-kappaB) and activator protein-1 (AP-1) reporter genes. Pretreatment of eupatolide inhibited LPS-induced phosphorylation and degradation of I kappaB alpha, and phosphorylation of RelA/p65 on Ser-536 as well as the activation of mitogen-activated protein kinases (MAPKs) and Akt in LPS-stimulated RAW264.7 cells. Eupatolide induced proteasomal degradation of tumor necrosis factor receptor-associated factor-6 (TRAF6), and subsequently inhibited LPS-induced TRAF6 polyubiquitination. These results suggest that eupatolide blocks LPS-induced COX-2 and iNOS expression at the transcriptional level through inhibiting the signaling pathways such as NF-kappaB and MAPKs via proteasomal degradation of TRAF6. Taken together, eupatolide may be a novel anti-inflammatory agent that induces proteasomal degradation of TRAF6, and a valuable compound for modulating inflammatory conditions. (c) 2010 Elsevier B.V. All rights reserved.
Li, S; Korkmaz-Icöz, S; Radovits, T; Ruppert, M; Spindler, R; Loganathan, S; Hegedűs, P; Brlecic, P; Theisinger, B; Theisinger, S; Höger, S; Brune, M; Lasitschka, F; Karck, M; Yard, B; Szabó, G
2017-07-01
Heart transplantation is the therapy of choice for end-stage heart failure. However, hemodynamic instability, which has been demonstrated in brain-dead donors (BDD), could also affect the posttransplant graft function. We tested the hypothesis that treatment of the BDD with the dopamine derivate n-octanoyl-dopamine (NOD) improves donor cardiac and graft function after transplantation. Donor rats were given a continuous intravenous infusion of either NOD (0.882 mg/kg/h, BDD+NOD, n = 6) or a physiological saline vehicle (BDD, n = 9) for 5 h after the induction of brain death by inflation of a subdural balloon catheter. Controls were sham-operated (n = 9). In BDD, decreased left-ventricular contractility (ejection fraction; maximum rate of rise of left-ventricular pressure; preload recruitable stroke work), relaxation (maximum rate of fall of left-ventricular pressure; Tau), and increased end-diastolic stiffness were significantly improved after the NOD treatment. Following the transplantation, the NOD-treatment of BDD improved impaired systolic function and ventricular relaxation. Additionally, after transplantation increased interleukin-6, tumor necrosis factor TNF-α, NF-kappaB-p65, and nuclear factor (NF)-kappaB-p105 gene expression, and increased caspase-3, TNF-α and NF-kappaB protein expression could be significantly downregulated by the NOD treatment compared to BDD. BDD postconditioning with NOD through downregulation of the pro-apoptotic factor caspase-3, pro-inflammatory cytokines, and NF-kappaB may protect the heart against the myocardial injuries associated with brain death and ischemia/reperfusion. © 2017 The American Society of Transplantation and the American Society of Transplant Surgeons.
Li, Jingxia; Zhang, Dongyun; Stoner, Gary D; Huang, Chuanshu
2008-04-01
The chemopreventive properties of edible berries have been demonstrated both in vitro and in vivo, however, the specific molecular mechanisms underlying their anti-cancer effects are largely unknown. Our previous studies have shown that a methanol extract fraction of freeze-dried black raspberries inhibits benzoapyrene (BaP)-induced transformation of Syrian hamster embryo cells. This fraction also blocks activation of activator protein-1 (AP-1) and nuclear factor kappaB (NF-kappaB) induced by benzoapyrene diol-epoxide (BaPDE) in mouse epidermal JB6 Cl 41 cells. To determine if different berry types exhibit specific mechanisms for their anti-cancer effects, we compared the effects of extract fractions from both black raspberries and strawberries on BaPDE-induced activation of various signaling pathways in Cl 41 cells. Black raspberry fractions inhibited the activation of AP-1, NF-kappaB, and nuclear factor of activated T cells (NFAT) by BaPDE as well as their upstream PI-3K/Akt-p70(S6K) and mitogen-activated protein kinase pathways. In contrast, strawberry fractions inhibited NFAT activation, but did not inhibit the activation of AP-1, NF-kappaB or the PI-3K/Akt-p70(S6K) and mitogen-activated protein kinase pathways. Consistent with the effects on NFAT activation, tumor necrosis factor-alpha (TNF-alpha) induction by BaPDE was blocked by extract fractions of both black raspberries and strawberries, whereas vascular endothelial growth factor (VEGF) expression, which depends on AP-1 activation, was suppressed by black raspberry fractions but not strawberry fractions. These results suggest that black raspberry and strawberry components may target different signaling pathways in exerting their anti-carcinogenic effects. (c) 2007 Wiley-Liss, Inc.
Dagia, Nilesh M; Agarwal, Gautam; Kamath, Divya V; Chetrapal-Kunwar, Anshu; Gupte, Ravindra D; Jadhav, Mahesh G; Dadarkar, Shruta S; Trivedi, Jacqueline; Kulkarni-Almeida, Asha A; Kharas, Firuza; Fonseca, Lyle C; Kumar, Sanjay; Bhonde, Mandar R
2010-04-01
A promising therapeutic approach to diminish pathological inflammation is to inhibit the increased production and/or biological activity of proinflammatory cytokines (e.g., TNF-alpha, IL-6). The production of proinflammatory cytokines is controlled at the gene level by the activity of transcription factors, such as NF-kappaB. Phosphatidylinositol 3-kinase (PI3K), a lipid kinase, is known to induce the activation of NF-kappaB. Given this, we hypothesized that inhibitors of PI3K activation would demonstrate anti-inflammatory potential. Accordingly, we studied the effects of a preferential p110alpha/gamma PI3K inhibitor (compound 8C; PIK-75) in inflammation-based assays. Mechanism-based assays utilizing human cells revealed that PIK-75-mediated inhibition of PI3K activation is associated with dramatic suppression of downstream signaling events, including AKT phosphorylation, IKK activation, and NF-kappaB transcription. Cell-based assays revealed that PIK-75 potently and dose dependently inhibits in vitro and in vivo production of TNF-alpha and IL-6, diminishes the induced expression of human endothelial cell adhesion molecules (E-selectin, ICAM-1, and VCAM-1), and blocks human monocyte-endothelial cell adhesion. Most importantly, PIK-75, when administered orally in a therapeutic regimen, significantly suppresses the macroscopic and histological abnormalities associated with dextran sulfate sodium-induced murine colitis. The efficacy of PIK-75 in attenuating experimental inflammation is mediated, at least in part, due to the downregulation of pertinent inflammatory mediators in the colon. Collectively, these results provide first evidence that PIK-75 possesses anti-inflammatory potential. Given that PIK-75 is known to exhibit anti-cancer activity, the findings from this study thus reinforce the cross-therapeutic functionality of potential drugs.
Lim, Sheri; MacIntyre, David A.; Lee, Yun S.; Khanjani, Shirin; Terzidou, Vasso; Teoh, T. G.; Bennett, Phillip R.
2012-01-01
Background Prior to the onset of human labour there is an increase in the synthesis of prostaglandins, cytokines and chemokines in the fetal membranes, particular the amnion. This is associated with activation of the transcription factor nuclear factor kappa B (NFκB). In this study we characterised the level of NFκB activity in amnion epithelial cells as a measure of amnion activation in samples collected from women undergoing caesarean section at 39 weeks gestation prior to the onset of labour. Methodology/Principal Findings We found that a proportion of women exhibit low or moderate NFκB activity while other women exhibit high levels of NFκB activity (n = 12). This activation process does not appear to involve classical pathways of NFκB activation but rather is correlated with an increase in nuclear p65-Rel-B dimers. To identify the full range of genes upregulated in association with amnion activation, microarray analysis was performed on carefully characterised non-activated amnion (n = 3) samples and compared to activated samples (n = 3). A total of 919 genes were upregulated in response to amnion activation including numerous inflammatory genes such cyclooxygenase-2 (COX-2, 44-fold), interleukin 8 (IL-8, 6-fold), IL-1 receptor accessory protein (IL-1RAP, 4.5-fold), thrombospondin 1 (TSP-1, 3-fold) and, unexpectedly, oxytocin receptor (OTR, 24-fold). Ingenuity Pathway Analysis of the microarray data reveal the two main gene networks activated concurrently with amnion activation are i) cell death, cancer and morphology and ii) cell cycle, embryonic development and tissue development. Conclusions/Significance Our results indicate that assessment of amnion NFκB activation is critical for accurate sample classification and subsequent interpretation of data. Collectively, our data suggest amnion activation is largely an inflammatory event that occurs in the amnion epithelial layer as a prelude to the onset of labour. PMID:22485186
Elevated toll-like receptor 4 expression and signaling in muscle from insulin-resistant subjects.
Reyna, Sara M; Ghosh, Sangeeta; Tantiwong, Puntip; Meka, C S Reddy; Eagan, Phyllis; Jenkinson, Christopher P; Cersosimo, Eugenio; Defronzo, Ralph A; Coletta, Dawn K; Sriwijitkamol, Apiradee; Musi, Nicolas
2008-10-01
OBJECTIVE- Tall-like receptor (TLR)4 has been implicated in the pathogenesis of free fatty acid (FFA)-induced insulin resistance by activating inflammatory pathways, including inhibitor of kappaB (IkappaB)/nuclear factor kappaB (NFkappaB). However, it is not known whether insulin-resistant subjects have abnormal TLR4 signaling. We examined whether insulin-resistant subjects have abnormal TLR4 expression and TLR4-driven (IkappaB/NFkappaB) signaling in skeletal muscle. RESEARCH DESIGN AND METHODS- TLR4 gene expression and protein content were measured in muscle biopsies in 7 lean, 8 obese, and 14 type 2 diabetic subjects. A primary human myotube culture system was used to examine whether FFAs stimulate IkappaB/NFkappaB via TLR4 and whether FFAs increase TLR4 expression/content in muscle. RESULTS- Obese and type 2 diabetic subjects had significantly elevated TLR4 gene expression and protein content in muscle. TLR4 muscle protein content correlated with the severity of insulin resistance. Obese and type 2 diabetic subjects also had lower IkappaBalpha content, an indication of elevated IkappaB/NFkappaB signaling. The increase in TLR4 and NFkappaB signaling was accompanied by elevated expression of the NFkappaB-regulated genes interleukin (IL)-6 and superoxide dismutase (SOD)2. In primary human myotubes, acute palmitate treatment stimulated IkappaB/NFkappaB, and blockade of TLR4 prevented the ability of palmitate to stimulate the IkappaB/NFkappaB pathway. Increased TLR4 content and gene expression observed in muscle from insulin-resistant subjects were reproduced by treating myotubes from lean, normal-glucose-tolerant subjects with palmitate. Palmitate also increased IL-6 and SOD2 gene expression, and this effect was prevented by inhibiting NFkappaB. CONCLUSIONS- Abnormal TLR4 expression and signaling, possibly caused by elevated plasma FFA levels, may contribute to the pathogenesis of insulin resistance in humans.
Radiation-induced Epstein-Barr virus reactivation in gastric cancer cells with latent EBV infection.
Nandakumar, Athira; Uwatoko, Futoshi; Yamamoto, Megumi; Tomita, Kazuo; Majima, Hideyuki J; Akiba, Suminori; Koriyama, Chihaya
2017-07-01
Epstein-Barr virus, a ubiquitous human herpes virus with oncogenic activity, can be found in 6%-16% of gastric carcinomas worldwide. In Epstein-Barr virus-associated gastric carcinoma, only a few latent genes of the virus are expressed. Ionizing irradiation was shown to induce lytic Epstein-Barr virus infection in lymphoblastoid cell lines with latent Epstein-Barr virus infection. In this study, we examined the effect of ionizing radiation on the Epstein-Barr virus reactivation in a gastric epithelial cancer cell line (SNU-719, an Epstein-Barr virus-associated gastric carcinoma cell line). Irradiation with X-ray (dose = 5 and 10 Gy; dose rate = 0.5398 Gy/min) killed approximately 25% and 50% of cultured SNU-719 cells, respectively, in 48 h. Ionizing radiation increased the messenger RNA expression of immediate early Epstein-Barr virus lytic genes (BZLF1 and BRLF1), determined by real-time reverse transcription polymerase chain reaction, in a dose-dependent manner at 48 h and, to a slightly lesser extent, at 72 h after irradiation. Similar findings were observed for other Epstein-Barr virus lytic genes (BMRF1, BLLF1, and BcLF1). After radiation, the expression of transforming growth factor beta 1 messenger RNA increased and reached a peak in 12-24 h, and the high-level expression of the Epstein-Barr virus immediate early genes can convert latent Epstein-Barr virus infection into the lytic form and result in the release of infectious Epstein-Barr virus. To conclude, Ionizing radiation activates lytic Epstein-Barr virus gene expression in the SNU-719 cell line mainly through nuclear factor kappaB activation. We made a brief review of literature to explore underlying mechanism involved in transforming growth factor beta-induced Epstein-Barr virus reactivation. A possible involvement of nuclear factor kappaB was hypothesized.
Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E
2012-10-01
The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.
Bruna-Larenas, Tamara; Gómez-Jeria, Juan S
2012-01-01
We report the results of a search for model-based relationships between mu, delta, and kappa opioid receptor binding affinity and molecular structure for a group of molecules having in common a morphine structural core. The wave functions and local reactivity indices were obtained at the ZINDO/1 and B3LYP/6-31G(∗∗) levels of theory for comparison. New developments in the expression for the drug-receptor interaction energy expression allowed several local atomic reactivity indices to be included, such as local electronic chemical potential, local hardness, and local electrophilicity. These indices, together with a new proposal for the ordering of the independent variables, were incorporated in the statistical study. We found and discussed several statistically significant relationships for mu, delta, and kappa opioid receptor binding affinity at both levels of theory. Some of the new local reactivity indices incorporated in the theory appear in several equations for the first time in the history of model-based equations. Interaction pharmacophores were generated for mu, delta, and kappa receptors. We discuss possible differences regulating binding and selectivity in opioid receptor subtypes. This study, contrarily to the statistically backed ones, is able to provide a microscopic insight of the mechanisms involved in the binding process.
Grayson-Sneed, Katelyn A; Smith, Robert C
2018-04-01
Develop a reliable coding method of a Behavioral Health Treatment Model for patients with Medically Unexplained Symptoms (BHTM-MUS). Two undergraduates trained for 30h coded videotaped interviews from 161 resident-simulated patient (SP) interactions. Trained on 45 videotapes, coders coded 33 (20%) of 161 study set tapes for the BHTM-MUS. Guetzkow's U, Cohen's Kappa, and percent of agreement were used to measure coders' reliability in unitizing and coding residents' skills for eliciting: education and informing (4 yes/no items), motivating (2), treatment statements (5), commitment and goals (2), negotiates plan (8), non-emotion patient-centered skills (4), and patient-centered emotional skills (8). 60 items were dichotomized a priori from analysis of the BHTM-MUS and were reduced to 33 during training. Guetzkow's U ranged from .00 to .082. Kappa ranged from 0.76 to 0.97 for the 7 variables and 33 individual items. The overall kappa was 0.87, and percent of agreement was 95.7%. Percent of agreement by item ranged from 85 to 100%. A highly reliable coding method is recommended to evaluate medical clinicians' behavioral care skills in patients with unexplained symptoms. A way to rate behavioral care in patients with unexplained symptoms. Copyright © 2017 Elsevier B.V. All rights reserved.
Modification of kindled amygdaloid seizures by opiate agonists and antagonists.
Albertson, T E; Joy, R M; Stark, L G
1984-03-01
The effects of 19 opiate agonists and antagonists on kindled amygdaloid seizures in the rat were studied. The mu agonists tended to reduce the length of elicited afterdischarges and behavioral ranks, while markedly increasing postictal electroencephalogram spikes and behavioral arrest time. These effects were reversed by naloxone. The kappa agonists reduced behavioral rank and variably reduced afterdischarge length with a concomitant lengthening of postictal behavioral arrest time and number of electroencephalogram spikes. The putative sigma agonist, SKF 10,047, reduced afterdischarge durations only at the higher doses tested. The decreases found after the sigma agonists in postictal electroencephalogram spiking and time of behavioral arrest were not reversed by naloxone. Only the lower doses of normeperidine were found to decrease seizure thresholds. The mixed agonist/antagonists (MAA) cyclazocine and cyclorphan markedly increased seizure threshold and reduced afterdischarge duration and behavioral rank. Only the MAA pentazocine tended to increase threshold but not suprathreshold afterdischarge durations. The order of ability to modify the ictal events was MAA (selected) greater than kappa agonists greater than mu agonists greater than sigma agonists. The increase in postictal events (behavior arrest and spikes) was caused most effectively by pretreatment with mu agonist greater than kappa agonist greater than selected MAA greater than sigma agonists.(ABSTRACT TRUNCATED AT 250 WORDS)
A research coding method for the basic patient-centered interview.
Grayson-Sneed, Katelyn A; Smith, Sandi W; Smith, Robert C
2017-03-01
To develop a more reliable coding method of medical interviewing focused on data-gathering and emotion-handling. Two trained (30h) undergraduates rated videotaped interviews from 127 resident-simulated patient (SP) interactions. Trained on 45 videotapes, raters coded 25 of 127 study set tapes for patient-centeredness. Guetzkow's U, Cohen's Kappa, and percent of agreement were used to measure raters' reliability in unitizing and coding residents' skills for eliciting: agenda (3 yes/no items), physical story (2), personal story (6), emotional story (15), using indirect skills (4), and general patient-centeredness (3). 45 items were dichotomized from the earlier, Likert scale-based method and were reduced to 33 during training. Guetzkow's U ranged from 0.00 to 0.087. Kappa ranged from 0.86 to 1.00 for the 6 variables and 33 individual items. The overall kappa was 0.90, and percent of agreement was 97.5%. Percent of agreement by item ranged from 84 to 100%. A simple, highly reliable coding method, weighted (by no. of items) to highlight personal elements of an interview, was developed and is recommended as a criterion standard research coding method. An easily conducted, reliable coding procedure can be the basis for everyday questionnaires like patient satisfaction with patient-centeredness. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Forest tree species discrimination in western Himalaya using EO-1 Hyperion
NASA Astrophysics Data System (ADS)
George, Rajee; Padalia, Hitendra; Kushwaha, S. P. S.
2014-05-01
The information acquired in the narrow bands of hyperspectral remote sensing data has potential to capture plant species spectral variability, thereby improving forest tree species mapping. This study assessed the utility of spaceborne EO-1 Hyperion data in discrimination and classification of broadleaved evergreen and conifer forest tree species in western Himalaya. The pre-processing of 242 bands of Hyperion data resulted into 160 noise-free and vertical stripe corrected reflectance bands. Of these, 29 bands were selected through step-wise exclusion of bands (Wilk's Lambda). Spectral Angle Mapper (SAM) and Support Vector Machine (SVM) algorithms were applied to the selected bands to assess their effectiveness in classification. SVM was also applied to broadband data (Landsat TM) to compare the variation in classification accuracy. All commonly occurring six gregarious tree species, viz., white oak, brown oak, chir pine, blue pine, cedar and fir in western Himalaya could be effectively discriminated. SVM produced a better species classification (overall accuracy 82.27%, kappa statistic 0.79) than SAM (overall accuracy 74.68%, kappa statistic 0.70). It was noticed that classification accuracy achieved with Hyperion bands was significantly higher than Landsat TM bands (overall accuracy 69.62%, kappa statistic 0.65). Study demonstrated the potential utility of narrow spectral bands of Hyperion data in discriminating tree species in a hilly terrain.
Hand assessment in older adults with musculoskeletal hand problems: a reliability study.
Myers, Helen L; Thomas, Elaine; Hay, Elaine M; Dziedzic, Krysia S
2011-01-07
Musculoskeletal hand pain is common in the general population. This study aims to investigate the inter- and intra-observer reliability of two trained observers conducting a simple clinical interview and physical examination for hand problems in older adults. The reliability of applying the American College of Rheumatology (ACR) criteria for hand osteoarthritis to community-dwelling older adults will also be investigated. Fifty-five participants aged 50 years and over with a current self-reported hand problem and registered with one general practice were recruited from a previous health questionnaire study. Participants underwent a standardised, structured clinical interview and physical examination by two independent trained observers and again by one of these observers a month later. Agreement beyond chance was summarised using Kappa statistics and intra-class correlation coefficients. Median values for inter- and intra-observer reliability for clinical interview questions were found to be "substantial" and "moderate" respectively [median agreement beyond chance (Kappa) was 0.75 (range: -0.03, 0.93) for inter-observer ratings and 0.57 (range: -0.02, 1.00) for intra-observer ratings]. Inter- and intra-observer reliability for physical examination items was variable, with good reliability observed for some items, such as grip and pinch strength, and poor reliability observed for others, notably assessment of altered sensation, pain on resisted movement and judgements based on observation and palpation of individual features at single joints, such as bony enlargement, nodes and swelling. Moderate agreement was observed both between and within observers when applying the ACR criteria for hand osteoarthritis. Standardised, structured clinical interview is reliable for taking a history in community-dwelling older adults with self reported hand problems. Agreement between and within observers for physical examination items is variable. Low Kappa values may have resulted, in part, from a low prevalence of clinical signs and symptoms in the study participants. The decision to use clinical interview and hand assessment variables in clinical practice or further research in primary care should include consideration of clinical applicability and training alongside reliability. Further investigation is required to determine the relationship between these clinical questions and assessments and the clinical course of hand pain and hand problems in community-dwelling older adults.
2008 Niday Perinatal Database quality audit: report of a quality assurance project.
Dunn, S; Bottomley, J; Ali, A; Walker, M
2011-12-01
This quality assurance project was designed to determine the reliability, completeness and comprehensiveness of the data entered into Niday Perinatal Database. Quality of the data was measured by comparing data re-abstracted from the patient record to the original data entered into the Niday Perinatal Database. A representative sample of hospitals in Ontario was selected and a random sample of 100 linked mother and newborn charts were audited for each site. A subset of 33 variables (representing 96 data fields) from the Niday dataset was chosen for re-abstraction. Of the data fields for which Cohen's kappa statistic or intraclass correlation coefficient (ICC) was calculated, 44% showed substantial or almost perfect agreement (beyond chance). However, about 17% showed less than 95% agreement and a kappa or ICC value of less than 60% indicating only slight, fair or moderate agreement (beyond chance). Recommendations to improve the quality of these data fields are presented.
Experimental study of two separating turbulent boundary layers
NASA Technical Reports Server (NTRS)
Nagabushana, K. A.; Simpson, R. L.; Agarwal, N. K.
1987-01-01
A detailed study of two strong adverse pressure gradient flows, one with a free-stream velocity of 35 m/sec, at throat (producing a Re sub theta of 27000 at detachment) and another with free-stream velocity of 22 m/sec, at throat (producing a Re sub theta of 19000 at detachment) is presented. In these examples flows separate slowly and reattach very rapidly over a very short distance in a streamwise direction. In the backflow region, there appears to be a semi-logarithmically flat region in the streamwise fluctuating velocity component, u', which spreads over a definite range of y/delta. In power spectra, the flow variables phi sub upsilon upsilon (kappa sub 1 delta)/ -uv bar sub max vs. kappa sub 1 delta forms a unique set of scaling parameters for adverse pressure gradient flows. Experimental results show good agreement with previous studies.
Liu, D; Liao, M; Zuo, J; Henner, W D; Fan, F
2001-03-01
To investigate mechanisms of rat glutathione S-transferase P1 gene (rGSTP1) expression regulation during chemical carcinogenesis. we studied enhancer elements located in the region between -2.5 kb to -2.2 kb. The region was upstream from the start site of transcription and was divided into two major fragments, GPEI and GPEII. The GPEII fragment was further divided into two smaller fragments, GPEII- I and GPEII-2. Using a luciferase reporter system, we identified a strong enhancer of GPEI and a weak enhancer of GPEII in HeLa and a rat hepatoma cell line CBRH79 19 cell. The enhancer of GPEII was located within the GPEII-I region. Chemical stimulation by glycidyl methatylate (GMA) and phorbol 12-o-tetradecanoate 13-acetate (TPA) analysis revealed that induction of rGSTP1 expression was mainly through GPEI. Although H2O2 could enhance GPEII enhancer activity, the enhancement is not mediated by the NF-kappaB factor that bound the NF-kappaB site in GPEII. Using electrophoretic mobility shift assays (EMSA) and the UV cross-linking assays, we found that HeLa and CBRH7919 cells had proteins that specifically bound GPEI core sequence and a 64 kDa protein that interacted with GPEII-1. The cells from normal rat liver did not express the binding proteins. Therefore, the trans-acting factors seem to be closely related to GPEI, GPEII enhancer activities and may play an important role in high expression of rGSTPI gene.
Molecular Mechanisms of Bcl10-Mediated NF-kappaB Signal Transduction
2004-04-04
recombinant expressed protein, used for detection with specific anti -FLAG antibodies GFP (green fluorescent protein): a variant of the gene first...influenza virus hemagglutin tag added to a recombinant expressed protein, used for detection with specific anti -HA antibodies HEK-293T cell: an SV40...proteins by size SH3 (Src homology 3): conserved amino acid domain, consisting to two anti -parallel β sheets, that mediates interactions between
Uptake and cytotoxic effects of multi-walled carbon nanotubes in human bronchial epithelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirano, Seishiro, E-mail: seishiro@nies.go.j; Fujitani, Yuji; Furuyama, Akiko
Carbon nanotubes (CNT) are cytotoxic to several cell types. However, the mechanism of CNT toxicity has not been fully studied, and dosimetric analyses of CNT in the cell culture system are lacking. Here, we describe a novel, high throughput method to measure cellular uptake of CNT using turbimetry. BEAS-2B, a human bronchial epithelial cell line, was used to investigate cellular uptake, cytotoxicity, and inflammatory effects of multi-walled CNT (MWCNT). The cytotoxicity of MWCNT was higher than that of crocidolite asbestos in BEAS-2B cells. The IC{sub 50} of MWCNT was 12 {mu}g/ml, whereas that of asbestos (crocidolite) was 678 {mu}g/ml. Overmore » the course of 5 to 8 h, BEAS-2B cells took up 17-18% of the MWCNT when they were added to the culture medium at a concentration of 10 {mu}g/ml. BEAS-2B cells were exposed to 2, 5, or 10 {mu}g/ml of MWCNT, and total RNA was extracted for cytokine cDNA primer array assays. The culture supernatant was collected for cytokine antibody array assays. Cytokines IL-6 and IL-8 increased in a dose dependent manner at both the mRNA and protein levels. Migration inhibitory factor (MIF) also increased in the culture supernatant in response to MWCNT. A phosphokinase array study using lysates from BEAS-2B cells exposed to MWCNT indicated that phosphorylation of p38, ERK1, and HSP27 increased significantly in response to MWCNT. Results from a reporter gene assays using the NF-{kappa}B or AP-1 promoter linked to the luciferase gene in transiently transfected CHO-KI cells revealed that NF-{kappa}B was activated following MWCNT exposure, while AP-1 was not changed. Collectively, MWCNT activated NF-{kappa}B, enhanced phosphorylation of MAP kinase pathway components, and increased production of proinflammatory cytokines in human bronchial epithelial cells.« less
Charbogne, Pauline; Kieffer, Brigitte L; Befort, Katia
2014-01-01
The endogenous opioid system is expressed throughout the brain reinforcement circuitry, and plays a major role in reward processing, mood control and the development of addiction. This neuromodulator system is composed of three receptors, mu, delta and kappa, interacting with a family of opioid peptides derived from POMC (β-endorphin), preproenkephalin (pEnk) and preprodynorphin (pDyn) precursors. Knockout mice targeting each gene of the opioid system have been created almost two decades ago. Extending classical pharmacology, these mutant mice represent unique tools to tease apart the specific role of each opioid receptor and peptide in vivo, and a powerful approach to understand how the opioid system modulates behavioral effects of drugs of abuse. The present review summarizes these studies, with a focus on major drugs of abuse including morphine/heroin, cannabinoids, psychostimulants, nicotine or alcohol. Genetic data, altogether, set the mu receptor as the primary target for morphine and heroin. In addition, this receptor is essential to mediate rewarding properties of non-opioid drugs of abuse, with a demonstrated implication of β-endorphin for cocaine and nicotine. Delta receptor activity reduces levels of anxiety and depressive-like behaviors, and facilitates morphine-context association. pEnk is involved in these processes and delta/pEnk signaling likely regulates alcohol intake. The kappa receptor mainly interacts with pDyn peptides to limit drug reward, and mediate dysphoric effects of cannabinoids and nicotine. Kappa/dynorphin activity also increases sensitivity to cocaine reward under stressful conditions. The opioid system remains a prime candidate to develop successful therapies in addicted individuals, and understanding opioid-mediated processes at systems level, through emerging genetic and imaging technologies, represents the next challenging goal and a promising avenue in addiction research. This article is part of a Special Issue entitled 'NIDA 40th Anniversary Issue'. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Dang; Fang, Liurong; Luo, Rui
2010-08-13
Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reductionmore » of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.« less
Rasheed, Zafar; Anbazhagan, Arivarasu N; Akhtar, Nahid; Ramamurthy, Sangeetha; Voss, Frank R; Haqqi, Tariq M
2009-01-01
The major risk factor for osteoarthritis (OA) is aging, but the mechanisms underlying this risk are only partly understood. Age-related accumulation of advanced glycation end products (AGEs) can activate chondrocytes and induce the production of proinflammatory cytokines and matrix metalloproteinases (MMPs). In the present study, we examined the effect of epigallocatechin-3-gallate (EGCG) on AGE-modified-BSA (AGE-BSA)-induced activation and production of TNFalpha and MMP-13 in human OA chondrocytes. Human chondrocytes were derived from OA cartilage by enzymatic digestion and stimulated with in vitro-generated AGE-BSA. Gene expression of TNFalpha and MMP-13 was measured by quantitative RT-PCR. TNFalpha protein in culture medium was determined using cytokine-specific ELISA. Western immunoblotting was used to analyze the MMP-13 production in the culture medium, phosphorylation of mitogen-activated protein kinases (MAPKs), and the activation of NF-kappaB. DNA binding activity of NF-kappaB p65 was determined using a highly sensitive and specific ELISA. IkappaB kinase (IKK) activity was determined using an in vitro kinase activity assay. MMP-13 activity in the culture medium was assayed by gelatin zymography. EGCG significantly decreased AGE-stimulated gene expression and production of TNFalpha and MMP-13 in human chondrocytes. The inhibitory effect of EGCG on the AGE-BSA-induced expression of TNFalpha and MMP-13 was mediated at least in part via suppression of p38-MAPK and JNK activation. In addition, EGCG inhibited the phosphorylating activity of IKKbeta kinase in an in vitro activity assay and EGCG inhibited the AGE-mediated activation and DNA binding activity of NF-kappaB by suppressing the degradation of its inhibitory protein IkappaBalpha in the cytoplasm. These novel pharmacological actions of EGCG on AGE-BSA-stimulated human OA chondrocytes provide new suggestions that EGCG or EGCG-derived compounds may inhibit cartilage degradation by suppressing AGE-mediated activation and the catabolic response in human chondrocytes.
Cho, Hyun-Ji; Jeong, Yun-Jeong; Park, Kwan-Kyu; Park, Yoon-Yub; Chung, Il-Kyung; Lee, Kwang-Gill; Yeo, Joo-Hong; Han, Sang-Mi; Bae, Young-Seuk; Chang, Young-Chae
2010-02-17
Bee venom has been used for the treatment of inflammatory diseases such as rheumatoid arthritis and for the relief of pain in traditional oriental medicine. The purpose of this study is to elucidate the effects of bee venom on MMP-9 expression and determine possible mechanisms by which bee venom relieves or prevents the expression of MMP-9 during invasion and metastasis of breast cancer cells. We examined the expression and activity of MMP-9 and possible signaling pathway affected in PMA-induced MCF-7 cells. Bee venom was obtained from the National Institute of Agricultural Science and Technology of Korea. Matrigel invasion assay, wound-healing assay, zymography assay, western blot assay, electrophoretic mobility shift assay and luciferase gene assay were used for assessment. Bee venom inhibited cell invasion and migration, and also suppressed MMP-9 activity and expression, processes related to tumor invasion and metastasis, in PMA-induced MCF-7 cells. Bee venom specifically suppressed the phosphorylation of p38/JNK and at the same time, suppressed the protein expression, DNA binding and promoter activity of NF-kappaB. The levels of phosphorylated ERK1/2 and c-Jun did not change. We also investigated MMP-9 inhibition by melittin, apamin and PLA(2), representative single component of bee venom. We confirmed that PMA-induced MMP-9 activity was significantly decreased by melittin, but not by apamin and phospholipase A(2). These data demonstrated that the expression of MMP-9 was abolished by melittin, the main component of bee venom. Bee venom inhibits PMA-induced MMP-9 expression and activity by inhibition of NF-kappaB via p38 MAPK and JNK signaling pathways in MCF-7 cells. These results indicate that bee venom can be a potential anti-metastatic and anti-invasive agent. This useful effect may lead to future clinical research on the anti-cancer properties of bee venom. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Yu; Wang, Wenhui; Wang, Qi
Highlights: Black-Right-Pointing-Pointer 5-LOX is able to upregulate expression of NF-{kappa}B p65. Black-Right-Pointing-Pointer 5-LOX enhances nuclear translocation of NF-{kappa}B p65 via increasing p-I{kappa}B-{alpha} level. Black-Right-Pointing-Pointer 5-LOX stimulates transcriptional activity of NF-{kappa}B in hepatoma cells. Black-Right-Pointing-Pointer LTB4 activates transcriptional activity of NF-{kappa}B in hepatoma cells. -- Abstract: The issue that lipid metabolism enzyme and its metabolites regulate transcription factors in cancer cell is not fully understood. In this study, we first report that the lipid metabolism enzyme 5-Lipoxygenase (5-LOX) and its metabolite leukotriene B4 (LTB4) are capable of activating nuclear factor-{kappa}B (NF-{kappa}B) in hepatoma cells. We found that the treatment of MK886more » (an inhibitor of 5-LOX) or knockdown of 5-LOX was able to downregulate the expression of NF-{kappa}B p65 at the mRNA level and decreased the phosphorylation level of inhibitor {kappa}B{alpha} (I{kappa}B{alpha}) in the cytoplasm of hepatoma HepG2 or H7402 cells, which resulted in the decrease of the level of nuclear NF-{kappa}B p65. These were confirmed by immunofluorescence staining in HepG2 cell. Moreover, the above treatments were able to decrease the transcriptional activity of NF-{kappa}B in the cells. The LTB4, one of metabolites of 5-LOX, is responsible for 5-LOX-activated NF-{kappa}B in a dose-dependent manner. Thus, we conclude that the lipid metabolism enzyme 5-LOX and its metabolite LTB4 are capable of activating transcription factor NF-{kappa}B in hepatoma cells. Our finding provides new insight into the significance of lipid metabolism in activation of transcription factors in cancer.« less
Generation of Kappa Distributions in Solar Wind at 1 au
NASA Astrophysics Data System (ADS)
Livadiotis, G.; Desai, M. I.; Wilson, L. B., III
2018-02-01
We examine the generation of kappa distributions in the solar wind plasma near 1 au. Several mechanisms are mentioned in the literature, each characterized by a specific relationship between the solar wind plasma features, the interplanetary magnetic field (IMF), and the kappa index—the parameter that governs the kappa distributions. This relationship serves as a signature condition that helps the identification of the mechanism in the plasma. In general, a mechanism that generates kappa distributions involves a single or a series of stochastic or physical processes that induces local correlations among particles. We identify three fundamental solar wind plasma conditions that can generate kappa distributions, noted as (i) Debye shielding, (ii) frozen IMF, and (iii) temperature fluctuations, each one prevailing in different scales of solar wind plasma and magnetic field properties. Moreover, our findings show that the kappa distributions, and thus, their generating mechanisms, vary significantly with solar wind features: (i) the kappa index has different dependence on the solar wind speed for slow and fast modes, i.e., slow wind is characterized by a quasi-constant kappa index, κ ≈ 4.3 ± 0.7, while fast wind exhibits kappa indices that increase with bulk speed; (ii) the dispersion of magnetosonic waves is more effective for lower kappa indices (i.e., further from thermal equilibrium); and (iii) the kappa and polytropic indices are positively correlated, as it was anticipated by the theory.
Romañach, Stephanie; Watling, James I.; Fletcher, Robert J.; Speroterra, Carolina; Bucklin, David N.; Brandt, Laura A.; Pearlstine, Leonard G.; Escribano, Yesenia; Mazzotti, Frank J.
2014-01-01
Climate change poses new challenges for natural resource managers. Predictive modeling of species–environment relationships using climate envelope models can enhance our understanding of climate change effects on biodiversity, assist in assessment of invasion risk by exotic organisms, and inform life-history understanding of individual species. While increasing interest has focused on the role of uncertainty in future conditions on model predictions, models also may be sensitive to the initial conditions on which they are trained. Although climate envelope models are usually trained using data on contemporary climate, we lack systematic comparisons of model performance and predictions across alternative climate data sets available for model training. Here, we seek to fill that gap by comparing variability in predictions between two contemporary climate data sets to variability in spatial predictions among three alternative projections of future climate. Overall, correlations between monthly temperature and precipitation variables were very high for both contemporary and future data. Model performance varied across algorithms, but not between two alternative contemporary climate data sets. Spatial predictions varied more among alternative general-circulation models describing future climate conditions than between contemporary climate data sets. However, we did find that climate envelope models with low Cohen's kappa scores made more discrepant spatial predictions between climate data sets for the contemporary period than did models with high Cohen's kappa scores. We suggest conservation planners evaluate multiple performance metrics and be aware of the importance of differences in initial conditions for spatial predictions from climate envelope models.
40 CFR 721.10033 - Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Zinc, [ethanedioato(2-)-. kappa. O1... Specific Chemical Substances § 721.10033 Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as zinc...
40 CFR 721.10033 - Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Zinc, [ethanedioato(2-)-. kappa. O1... Specific Chemical Substances § 721.10033 Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as zinc...
Czodrowski, Paul
2014-11-01
In the 1960s, the kappa statistic was introduced for the estimation of chance agreement in inter- and intra-rater reliability studies. The kappa statistic was strongly pushed by the medical field where it could be successfully applied via analyzing diagnoses of identical patient groups. Kappa is well suited for classification tasks where ranking is not considered. The main advantage of kappa is its simplicity and the general applicability to multi-class problems which is the major difference to receiver operating characteristic area under the curve. In this manuscript, I will outline the usage of kappa for classification tasks, and I will evaluate the role and uses of kappa in specifically machine learning and cheminformatics.
New sesquiterpene lactones from Arnica tincture prepared from fresh flowerheads of Arnica montana.
Kos, Olha; Lindenmeyer, Maja T; Tubaro, Aurelia; Sosa, Silvio; Merfort, Irmgard
2005-11-01
Investigation of an ethanolic extract prepared from fresh Arnica montana flowers afforded three new 1,5- trans-guaianolides, of which 11alpha,13-dihydro-2-O-tigloylflorilenalin and the respective 2-O-isovaleryl derivative are reported for the first time. Additionally, three new and one known 2beta-ethoxy-2,3-dihydrohelenalin esters were isolated. GC/MS studies of the extract after a two year storage at 4 degrees C demonstrated that the latter were artefacts that had been formed by addition of ethanol to the cyclopentenone structure of helenalin. Formation of these adducts gave compounds possessing an inhibitory activity comparable to that of 11alpha,13-dihydrohelenalin derivatives in the NF-kappaB EMSA and the IL-8 ELISA in vitro assays as well as in the in vivo croton oil-induced mouse ear edema test for one adduct, namely 2beta-ethoxy-6-O-acetyl-2,3-dihydrohelenalin. As expected, 6-O-(2-methylbutyryl)- and 6-O-methacryloyl-helenalin exhibited a stronger activity in the NF-kappaB EMSA and IL-8 ELISA. Sesquiterpene lactones seem to be the most important NF-kappaB inhibiting compounds in the Arnica extract. Bioguided fractionation using the luciferase reporter gene assay resulted in the isolation of only moderately active compounds, such as 6-acetoxy-2,2-dimethylchroman-4-one and 10-acetoxy-8,9-epoxythymol isobutyrate.
Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K
2000-06-02
Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner.
Smith, M R; Greene, W C
1991-01-01
The Tax oncoprotein of the type I human T cell leukemia virus (HTLV-I) activates transcription of cellular and viral genes through at least two different transcription factor pathways. Tax activates transcription of the c-fos proto-oncogene by a mechanism that appears to involve members of the cAMP response element binding protein (CREB) and activating transcription factor (ATF) family of DNA-binding proteins. Tax also induces the nuclear expression of the NF-kappa B family of rel oncogene-related enhancer-binding proteins. We have investigated the potential role of these CREB/ATF and NF-kappa B/Rel transcription factors in Tax-mediated transformation by analyzing the oncogenic potential of Tax mutants that functionally segregate these two pathways of transactivation. Rat fibroblasts (Rat2) stably expressing either the wild-type Tax protein or a Tax mutant selectively deficient in the ability to induce NF-kappa B/Rel demonstrated marked changes in morphology and growth characteristics including the ability to form tumors in athymic mice. In contrast, Rat2 cells stably expressing a Tax mutant selectively deficient in the ability to activate transcription through CREB/ATF demonstrated no detectable changes in morphology or growth characteristics. These results suggest that transcriptional activation through the CREB/ATF pathway may play an important role in Tax-mediated cellular transformation. Images PMID:1832173
NASA Astrophysics Data System (ADS)
Chen, X.; Abercrombie, R. E.; Pennington, C.
2017-12-01
Recorded seismic waveforms include contributions from earthquake source properties and propagation effects, leading to long-standing trade-off problems between site/path effects and source effects. With near-field recordings, the path effect is relatively small, so the trade-off problem can be simplified to between source and site effects (commonly referred as "kappa value"). This problem is especially significant for small earthquakes where the corner frequencies are within similar ranges of kappa values, so direct spectrum fitting often leads to systematic biases due to corner frequency and magnitude. In response to the significantly increased seismicity rate in Oklahoma, several local networks have been deployed following major earthquakes: the Prague, Pawnee and Fairview earthquakes. Each network provides dense observations within 20 km surrounding the fault zone, recording tens of thousands of aftershocks between M1 to M3. Using near-field recordings in the Prague area, we apply a stacking approach to separate path/site and source effects. The resulting source parameters are consistent with parameters derived from ground motion and spectral ratio methods from other studies; they exhibit spatial coherence within the fault zone for different fault patches. We apply these source parameter constraints in an analysis of kappa values for stations within 20 km of the fault zone. The resulting kappa values show significantly reduced variability compared to those from direct spectral fitting without constraints on the source spectrum; they are not biased by earthquake magnitudes. With these improvements, we plan to apply the stacking analysis to other local arrays to analyze source properties and site characteristics. For selected individual earthquakes, we will also use individual-pair empirical Green's function (EGF) analysis to validate the source parameter estimations.
Gkika, E; Tanadini-Lang, S; Kirste, S; Holzner, P A; Neeff, H P; Rischke, H C; Reese, T; Lohaus, F; Duma, M N; Dieckmann, K; Semrau, R; Stockinger, M; Imhoff, D; Kremers, N; Häfner, M F; Andratschke, N; Nestle, U; Grosu, A L; Guckenberger, M; Brunner, T B
2017-10-01
Definition of gross tumor volume (GTV) in hepatocellular carcinoma (HCC) requires dedicated imaging in multiple contrast medium phases. The aim of this study was to evaluate the interobserver agreement (IOA) in gross tumor delineation of HCC in a multicenter panel. The analysis was performed within the "Stereotactic Radiotherapy" working group of the German Society for Radiation Oncology (DEGRO). The GTVs of three anonymized HCC cases were delineated by 16 physicians from nine centers using multiphasic CT scans. In the first case the tumor was well defined. The second patient had multifocal HCC (one conglomerate and one peripheral tumor) and was previously treated with transarterial chemoembolization (TACE). The peripheral lesion was adjacent to the previous TACE site. The last patient had an extensive HCC with a portal vein thrombosis (PVT) and an inhomogeneous liver parenchyma due to cirrhosis. The IOA was evaluated according to Landis and Koch. The IOA for the first case was excellent (kappa: 0.85); for the second case moderate (kappa: 0.48) for the peripheral tumor and substantial (kappa: 0.73) for the conglomerate. In the case of the peripheral tumor the inconsistency is most likely explained by the necrotic tumor cavity after TACE caudal to the viable tumor. In the last case the IOA was fair, with a kappa of 0.34, with significant heterogeneity concerning the borders of the tumor and the PVT. The IOA was very good among the cases were the tumor was well defined. In complex cases, where the tumor did not show the typical characteristics, or in cases with Lipiodol (Guerbet, Paris, France) deposits, IOA agreement was compromised.
Oncoprotein p28 GANK binds to RelA and retains NF-kappaB in the cytoplasm through nuclear export.
Chen, Yao; Li, Hong Hai; Fu, Jing; Wang, Xue Feng; Ren, Yi Bin; Dong, Li Wei; Tang, Shan Hua; Liu, Shu Qing; Wu, Meng Chao; Wang, Hong Yang
2007-12-01
p28(GANK) (also known as PSMD10, p28 and gankyrin) is an ankyrin repeat anti-apoptotic oncoprotein that is commonly overexpressed in hepatocellular carcinomas and increases the degradation of p53 and Rb. NF-kappaB (nuclear factor-kappaB) is known to be sequestered in the cytoplasm by I kappaB (inhibitor of NF-kappaB) proteins, but much less is known about the cytoplasmic retention of NF-kappaB by other cellular proteins. Here we show that p28(GANK) inhibits NF-kappaB activity. As a nuclear-cytoplasmic shuttling protein, p28(GANK) directly binds to NF-kappaB/RelA and exports RelA from nucleus through a chromosomal region maintenance-1 (CRM-1) dependent pathway, which results in the cytoplasmic retention of NF-kappaB/RelA. We demonstrate that all the ankyrin repeats of p28(GANK) are required for the interaction with RelA and that the N terminus of p28(GANK), which contains the nuclear export sequence (NES), is responsible for suppressing NF-kappaB/RelA nuclear translocation. These results suggest that overexpression of p28(GANK) prevents the nuclear localization and inhibits the activity of NF-kappaB/RelA.
Zhao, Lan-Juan; Guo, Yan-Fang; Xiong, Dong-Hai; Xiao, Peng; Recker, Robert R; Deng, Hong-Wen
2006-11-01
In light of findings that osteoporosis and obesity may share some common genetic determination and previous reports that RANK (receptor activator of nuclear factor-kappaB) is expressed in skeletal muscles which are important for energy metabolism, we hypothesize that RANK, a gene essential for osteoclastogenesis, is also important for obesity. In order to test the hypothesis with solid data we first performed a linkage analysis around the RANK gene in 4,102 Caucasian subjects from 434 pedigrees, then we genotyped 19 SNPs in or around the RANK gene. A family-based association test (FBAT) was performed with both a quantitative measure of obesity [fat mass, lean mass, body mass index (BMI), and percentage fat mass (PFM)] and a dichotomously defined obesity phenotype-OB (OB if BMI > or = 30 kg/m(2)). In the linkage analysis, an empirical P = 0.004 was achieved at the location of the RANK gene for BMI. Family-based association analysis revealed significant associations of eight SNPs with at least one obesity-related phenotype (P < 0.05). Evidence of association was obtained at SNP10 (P = 0.002) and SNP16 (P = 0.001) with OB; SNP1 with fat mass (P = 0.003); SNP1 (P = 0.003) and SNP7 (P = 0.003) with lean mass; SNP1 (P = 0.002) and SNP7 (P = 0.002) with BMI; SNP1 (P = 0.003), SNP4 (P = 0.007), and SNP7 (P = 0.002) with PFM. In order to deal with the complex multiple testing issues, we performed FBAT multi-marker test (FBAT-MM) to evaluate the association between all the 18 SNPs and each obesity phenotype. The P value is 0.126 for OB, 0.033 for fat mass, 0.021 for lean mass, 0.016 for BMI, and 0.006 for PFM. The haplotype data analyses provide further association evidence. In conclusion, for the first time, our results suggest that RANK is a novel candidate for determination of obesity.
Origins and properties of kappa distributions in space plasmas
NASA Astrophysics Data System (ADS)
Livadiotis, George
2016-07-01
Classical particle systems reside at thermal equilibrium with their velocity distribution function stabilized into a Maxwell distribution. On the contrary, collisionless and correlated particle systems, such as the space and astrophysical plasmas, are characterized by a non-Maxwellian behavior, typically described by the so-called kappa distributions. Empirical kappa distributions have become increasingly widespread across space and plasma physics. However, a breakthrough in the field came with the connection of kappa distributions to the solid statistical framework of Tsallis non-extensive statistical mechanics. Understanding the statistical origin of kappa distributions was the cornerstone of further theoretical developments and applications, some of which will be presented in this talk: (i) The physical meaning of thermal parameters, e.g., temperature and kappa index; (ii) the multi-particle description of kappa distributions; (iii) the phase-space kappa distribution of a Hamiltonian with non-zero potential; (iv) the Sackur-Tetrode entropy for kappa distributions, and (v) the new quantization constant, h _{*}˜10 ^{-22} Js.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.
1997-05-01
Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less
Opioid system genes in alcoholism: a case-control study in Croatian population.
Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J
2013-10-01
Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.
Jang, Pil-Geum; Namkoong, Cherl; Kang, Gil Myoung; Hur, Man-Wook; Kim, Seung-Whan; Kim, Geun Hyang; Kang, Yeoungsup; Jeon, Min-Jae; Kim, Eun Hee; Lee, Myung-Shik; Karin, Michael; Baik, Ja-Hyun; Park, Joong-Yeol; Lee, Ki-Up; Kim, Young-Bum; Kim, Min-Seon
2010-03-26
Anorexia and weight loss are prevalent in infectious diseases. To investigate the molecular mechanisms underlying these phenomena, we established animal models of infection-associated anorexia by administrating bacterial and viral products, lipopolysaccharide (LPS) and human immunodeficiency virus-1 transactivator protein (Tat). In these models, we found that the nuclear factor-kappaB (NF-kappaB), a pivotal transcription factor for inflammation-related proteins, was activated in the hypothalamus. In parallel, administration of LPS and Tat increased hypothalamic pro-inflammatory cytokine production, which was abrogated by inhibition of hypothalamic NF-kappaB. In vitro, NF-kappaB activation directly stimulated the transcriptional activity of pro-opiomelanocortin (POMC), a precursor of anorexigenic melanocortin, and mediated the stimulatory effects of LPS, Tat, and pro-inflammatory cytokines on POMC transcription, implying the involvement of NF-kappaB in controlling feeding behavior. Consistently, hypothalamic injection of LPS and Tat caused a significant reduction in food intake and body weight, which was prevented by blockade of NF-kappaB and melanocortin. Furthermore, disruption of I kappaB kinase-beta, an upstream kinase of NF-kappaB, in POMC neurons attenuated LPS- and Tat-induced anorexia. These findings suggest that infection-associated anorexia and weight loss are mediated via NF-kappaB activation in hypothalamic POMC neurons. In addition, hypothalamic NF-kappaB was activated by leptin, an important anorexigenic hormone, and mediates leptin-stimulated POMC transcription, indicating that hypothalamic NF-kappaB also serves as a downstream signaling pathway of leptin.
Ruperto, Nicolino; Pistorio, Angela; Ravelli, Angelo; Rider, Lisa G; Pilkington, Clarissa; Oliveira, Sheila; Wulffraat, Nico; Espada, Graciela; Garay, Stella; Cuttica, Ruben; Hofer, Michael; Quartier, Pierre; Melo-Gomes, Jose; Reed, Ann M; Wierzbowska, Malgorzata; Feldman, Brian M; Harjacek, Miroslav; Huppertz, Hans-Iko; Nielsen, Susan; Flato, Berit; Lahdenne, Pekka; Michels, Harmut; Murray, Kevin J; Punaro, Lynn; Rennebohm, Robert; Russo, Ricardo; Balogh, Zsolt; Rooney, Madeleine; Pachman, Lauren M; Wallace, Carol; Hashkes, Philip; Lovell, Daniel J; Giannini, Edward H; Gare, Boel Andersson; Martini, Alberto
2010-11-01
To develop a provisional definition for the evaluation of response to therapy in juvenile dermatomyositis (DM) based on the Paediatric Rheumatology International Trials Organisation juvenile DM core set of variables. Thirty-seven experienced pediatric rheumatologists from 27 countries achieved consensus on 128 difficult patient profiles as clinically improved or not improved using a stepwise approach (patient's rating, statistical analysis, definition selection). Using the physicians' consensus ratings as the "gold standard measure," chi-square, sensitivity, specificity, false-positive and-negative rates, area under the receiver operating characteristic curve, and kappa agreement for candidate definitions of improvement were calculated. Definitions with kappa values >0.8 were multiplied by the face validity score to select the top definitions. The top definition of improvement was at least 20% improvement from baseline in 3 of 6 core set variables with no more than 1 of the remaining worsening by more than 30%, which cannot be muscle strength. The second-highest scoring definition was at least 20% improvement from baseline in 3 of 6 core set variables with no more than 2 of the remaining worsening by more than 25%, which cannot be muscle strength (definition P1 selected by the International Myositis Assessment and Clinical Studies group). The third is similar to the second with the maximum amount of worsening set to 30%. This indicates convergent validity of the process. We propose a provisional data-driven definition of improvement that reflects well the consensus rating of experienced clinicians, which incorporates clinically meaningful change in core set variables in a composite end point for the evaluation of global response to therapy in juvenile DM. Copyright © 2010 by the American College of Rheumatology.
Cytokine polymorphisms are associated with fatigue in adults living with HIV/AIDS
Lee, Kathryn A.; Gay, Caryl L.; Lerdal, Anners; Pullinger, Clive R.; Aouizerat, Bradley E.
2014-01-01
Fatigue has been associated with inflammation and cytokine activity among adults, but this relationship has not been evaluated among adults living with HIV. Diurnal patterns of fatigue have been previously identified in adults with HIV/AIDS. Thus, the purpose of this study was to describe these fatigue patterns in relation to cytokine plasma concentrations and gene polymorphisms. A convenience sample of 317 adults living with HIV/AIDS completed a measure of fatigue in the morning and evening for three consecutive days; participants reporting low levels of both morning and evening fatigue (n=110) or high levels of fatigue in the morning and evening (n=114) were included in the analysis, resulting in a final sample of 224 adults (151 men, 55 women, and 18 transgender). Plasma cytokines were analyzed, and genotyping was conducted for 15 candidate genes involved in cytokine signaling: interferon-gamma (IFNG), IFNG receptor 1 (IFNGR1), interleukins (IL), nuclear factor of kappa light polypeptide gene enhancer in B cells (NFKB-1 and -2), and tumor necrosis factor alpha (TNFA). Demographic and clinical variables were evaluated as potential covariates. Controlling for genomic estimates of ancestry and self-reported race/ethnicity and gender, the high fatigue pattern was associated with five single nucleotide polymorphisms (SNPs): IL1B rs1071676 and rs1143627, IL4 rs2243274, and TNFA rs1800683 and rs1041981. The IL1B and TNFA polymorphisms were not associated with plasma levels of IL-1β or TNFα, respectively. This study strengthens the evidence for an association between inflammation and fatigue. In this chronic illness population, the cytokine polymorphisms associated with high levels of morning and evening fatigue provide direction for future personalized medicine intervention research. PMID:24632226
Srinivasan, Balasubramanian; Johnson, Thomas E; Lad, Rahul; Xing, Chengguo
2009-11-26
Chalcone is a privileged structure, demonstrating promising anti-inflammatory and anticancer activities. One potential mechanism is to suppress nuclear factor kappa B (NF-kappaB) activation. The structures of chalcone-based NF-kappaB inhibitors vary significantly that there is minimum information about their structure-activity relationships (SAR). This study aims to establish SAR of chalcone-based compounds to NF-kappaB inhibition, to explore the feasibility of developing simple chalcone-based potent NF-kappaB inhibitors, and to evaluate their anticancer activities. Three series of chalcones were synthesized in one to three steps with the key step being aldol condensation. These candidates demonstrated a wide range of NF-kappaB inhibitory activities, some of low micromolar potency, establishing that structural complexity is not required for NF-kappaB inhibition. Lead compounds also demonstrate potent cytotoxicity against lung cancer cells. Their cytotoxicities correlate moderately well with their NF-kappaB inhibitory activities, suggesting that suppressing NF-kappaB activation is likely responsible for at least some of the cytotoxicities. One lead compound effectively inhibits lung tumor growth with no signs of adverse side effects.
The kappa statistic in rehabilitation research: an examination.
Tooth, Leigh R; Ottenbacher, Kenneth J
2004-08-01
The number and sophistication of statistical procedures reported in medical rehabilitation research is increasing. Application of the principles and methods associated with evidence-based practice has contributed to the need for rehabilitation practitioners to understand quantitative methods in published articles. Outcomes measurement and determination of reliability are areas that have experienced rapid change during the past decade. In this study, distinctions between reliability and agreement are examined. Information is presented on analytical approaches for addressing reliability and agreement with the focus on the application of the kappa statistic. The following assumptions are discussed: (1) kappa should be used with data measured on a categorical scale, (2) the patients or objects categorized should be independent, and (3) the observers or raters must make their measurement decisions and judgments independently. Several issues related to using kappa in measurement studies are described, including use of weighted kappa, methods of reporting kappa, the effect of bias and prevalence on kappa, and sample size and power requirements for kappa. The kappa statistic is useful for assessing agreement among raters, and it is being used more frequently in rehabilitation research. Correct interpretation of the kappa statistic depends on meeting the required assumptions and accurate reporting.
Rotundo, Roberto; Nieri, Michele; Bonaccini, Daniele; Mori, Massimiliano; Lamberti, Elena; Massironi, Domenico; Giachetti, Luca; Franchi, Lorenzo; Venezia, Piero; Cavalcanti, Raffaele; Bondi, Elena; Farneti, Mauro; Pinchi, Vilma; Buti, Jacopo
2015-01-01
To propose a method to measure the esthetics of the smile and to report its validation by means of an intra-rater and inter-rater agreement analysis. Ten variables were chosen as determinants for the esthetics of a smile: smile line and facial midline, tooth alignment, tooth deformity, tooth dischromy, gingival dischromy, gingival recession, gingival excess, gingival scars and diastema/missing papillae. One examiner consecutively selected seventy smile pictures, which were in the frontal view. Ten examiners, with different levels of clinical experience and specialties, applied the proposed assessment method twice on the selected pictures, independently and blindly. Intraclass correlation coefficient (ICC) and Fleiss' kappa) statistics were performed to analyse the intra-rater and inter-rater agreement. Considering the cumulative assessment of the Smile Esthetic Index (SEI), the ICC value for the inter-rater agreement of the 10 examiners was 0.62 (95% CI: 0.51 to 0.72), representing a substantial agreement. Intra-rater agreement ranged from 0.86 to 0.99. Inter-rater agreement (Fleiss' kappa statistics) calculated for each variable ranged from 0.17 to 0.75. The SEI was a reproducible method, to assess the esthetic component of the smile, useful for the diagnostic phase and for setting appropriate treatment plans.
Development and reliability testing of a food store observation form.
Rimkus, Leah; Powell, Lisa M; Zenk, Shannon N; Han, Euna; Ohri-Vachaspati, Punam; Pugach, Oksana; Barker, Dianne C; Resnick, Elissa A; Quinn, Christopher M; Myllyluoma, Jaana; Chaloupka, Frank J
2013-01-01
To develop a reliable food store observational data collection instrument to be used for measuring product availability, pricing, and promotion. Observational data collection. A total of 120 food stores (26 supermarkets, 34 grocery stores, 54 gas/convenience stores, and 6 mass merchandise stores) in the Chicago metropolitan statistical area. Inter-rater reliability for product availability, pricing, and promotion measures on a food store observational data collection instrument. Cohen's kappa coefficient and proportion of overall agreement for dichotomous variables and intra-class correlation coefficient for continuous variables. Inter-rater reliability, as measured by average kappa coefficient, was 0.84 for food and beverage product availability measures, 0.80 for interior store characteristics, and 0.70 for exterior store characteristics. For continuous measures, average intra-class correlation coefficient was 0.82 for product pricing measures; 0.90 for counts of fresh, frozen, and canned fruit and vegetable options; and 0.85 for counts of advertisements on the store exterior and property. The vast majority of measures demonstrated substantial or almost perfect agreement. Although some items may require revision, results suggest that the instrument may be used to reliably measure the food store environment. Copyright © 2013 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.
McLane, K E; Weaver, W R; Lei, S; Chiappinelli, V A; Conti-Tronconi, B M
1993-07-13
kappa-Flavotoxin (kappa-FTX), a snake neurotoxin that is a selective antagonist of certain neuronal nicotinic acetylcholine receptors (AChRs), has recently been isolated and characterized [Grant, G. A., Frazier, M. W., & Chiappinelli, V. A. (1988) Biochemistry 27, 1532-1537]. Like the related snake toxin kappa-bungarotoxin (kappa-BTX), kappa-FTX binds with high affinity to alpha 3 subtypes of neuronal AChRs, even though there are distinct sequence differences between the two toxins. To further characterize the sequence regions of the neuronal AChR alpha 3 subunit involved in formation of the binding site for this family of kappa-neurotoxins, we investigated kappa-FTX binding to overlapping synthetic peptides screening the alpha 3 subunit sequence. A sequence region forming a "prototope" for kappa-FTX was identified within residues alpha 3 (51-70), confirming the suggestions of previous studies on the binding of kappa-BTX to the alpha 3 subunit [McLane, K. E., Tang, F., & Conti-Tronconi, B. M. (1990) J. Biol. Chem. 265, 1537-1544] and alpha-bungarotoxin to the Torpedo AChR alpha subunit [Conti-Tronconi, B. M., Tang, F., Diethelm, B. M., Spencer, S. R., Reinhardt-Maelicke, S., & Maelicke, A. (1990) Biochemistry 29, 6221-6230] that this sequence region is involved in formation of a cholinergic site. Single residue substituted analogues, where each residue of the sequence alpha 3 (51-70) was sequentially replaced by a glycine, were used to identify the amino acid side chains involved in the interaction of this prototope with kappa-FTX.(ABSTRACT TRUNCATED AT 250 WORDS)
Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef
2003-09-17
The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.
Direct covalent modification as a strategy to inhibit nuclear factor-kappa B.
Pande, Vineet; Sousa, Sérgio F; Ramos, Maria João
2009-01-01
Nuclear Factor-KkappaB (NF-kappaB) is a transcription factor whose inappropriate activation may result in the development of a number of diseases including cancer, inflammation, neurodegeneration and AIDS. Recent studies on NF-kappaB mediated pathologies, made therapeutic interventions leading to its inhibition an emerging theme in pharmaceutical research. NF-kappaB resides in the cytoplasm and is activated by several time-dependent factors, leading to proteasome-dependent degradation of its inhibitory protein (IkappaB), resulting in free NF-kappaB (p50 and p65 subunits, involved in disease states), which binds to target DNA sites, further resulting in enhanced transcription of several disease associated proteins. The complex pathway of NF-kappaB, finally leading to its DNA binding, has attracted several approaches interfering with this pathway. One such approach is that of a direct covalent modification of NF-kappaB. In this article, we present a critical review on the pharmacological agents that have been studied as inhibitors of NF-kappaB by covalently modifying redox-regulated cysteine residues in its subunits, ultimately resulting in the inhibition of kappaB DNA recognition and binding. Beginning with a general overview of NF-kappaB pathway and several possibilities of chemical interventions, the significance of redox-regulation in NF-kappaB activation and DNA binding is presented. Further, protein S-thiolation, S-nitrosylation and irreversible covalent modification are described as regular biochemical events in the cell, having provided a guideline for the development of NF-kappaB inhibitors discussed further. Although just a handful of inhibitors, with most of them being alkylating agents have been studied in the present context, this approach presents potential for the development of a new class of NF-kappaB-inhibitors.
Alexander, George; Carlsen, Harald; Blomhoff, Rune
2006-04-01
To determine the dynamics of Nuclear Factor-kappaB (NF-kappaB) in murine corneal pathology and the role of NF-kappaB in maintaining corneal clarity after ultraviolet B radiation insult, transgenic mice containing NF-kappaB-luciferase reporter were exposed to LPS (bacterial lipopolysaccharide), TNF-alpha (Tumor Necrosis Factor-alpha) or 4 kJ m(-2) UV-B radiation. NF-kappaB decoy oligonucleotides were also administered in some of the UV-B experiments. Following various exposure times, the mice were sacrificed and whole eyes or corneal tissues were obtained. Whole eyes were examined for scattering using a point-source optical imaging technique. Tissue homogenates were examined for luciferase activity using a luminometer. TNF-alpha and LPS-injected NF-kappaB-luciferase transgenic mice demonstrated 3-10-fold increases in cornea NF-kappaB with peak activities at 4 and 6 hr post-injection, respectively. Mice exposed to 4 kJ m(-2) UV-B exhibited a 3-fold increase in NF-kappaB activity 4 hr post-exposure. The administration of NF-kappaB-decoy oligonucleotides to mice had the effect of reducing UV-B-induced NF-kappaB activity in the cornea and significantly increasing the amount of light scattering in UV-B exposed corneas 7 days post-UV-B exposure when compared to sham injected mice. These results indicate that NF-kappaB is activated in cornea in pathologies that involves increased plasma levels of LPS and TNF-alpha, as well as direct UV-B exposure, and suggest that NF-kappaB activation play an essential part in the corneal healing process.
Kappa angles in different positions in patients with myopia during LASIK
Qi, Hui; Jiang, Jing-Jing; Jiang, Yan-Ming; Wang, Li-Qiang; Huang, Yi-Fei
2016-01-01
AIM To investigate the difference in kappa angle between sitting and supine positions during laser-assisted in situ keratomileusis (LASIK). METHODS A retrospective study was performed on 395 eyes from 215 patients with myopia that received LASIK. Low, moderate, and high myopia groups were assigned according to diopters. The horizontal and vertical components of kappa angle in sitting position were measured before the operation, and in supine position during the operation. The data from the two positions were compared and the relationship between kappa angle and diopters were analyzed. RESULTS Two hundred and twenty-three eyes (56.5%) in sitting position and 343 eyes (86.8%) in supine position had positive kappa angles. There were no significant differences in horizontal and vertical components of kappa angle in the sitting position or horizontal components of kappa angle in the supine position between the three groups (P>0.05). A significant difference in the vertical components of kappa angle in the supine position was seen in the three groups (P<0.01). Differences in both horizontal and vertical components of kappa angles were significant between the sitting and supine positions. Positive correlations in both horizontal and vertical components of kappa angles (P<0.05) were found and vertical components of kappa angle in sitting and supine positions were negatively correlated with the degree of myopia (sitting position: r=-0.109; supine position: r=-0.172; P<0.05). CONCLUSION There is a correlation in horizontal and vertical components of kappa angle in sitting and supine positions. Positive correlations in both horizontal and vertical components of kappa angle in sitting and supine positions till the end of the results. This result still needs further observation. Clinicians should take into account different postures when excimer laser surgery needs to be performed. PMID:27162734
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.
The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Stephanie; Munz, Barbara, E-mail: barbara.munz@charite.de
2010-01-01
Receptor interacting protein 4 (RIP4) is an important regulator of epidermal morphogenesis during embryonic development. We could previously show that expression of the rip4 gene is strongly downregulated in cutaneous wound repair, which might be initiated by a broad variety of growth factors and cytokines. Here, we demonstrate that in keratinocytes, rip4 expression is controlled by a multitude of different signal transduction pathways, such as the p38 mitogen-activated protein kinase (MAPK) and the nuclear factor kappa B (NF-{kappa}B) cascade, in a unique and specific manner. Furthermore, we show that the steroid dexamethasone abolishes the physiological rip4 downregulation after injury andmore » might thus contribute to the phenotype of reduced and delayed wound reepithelialization seen in glucocorticoid-treated patients. As a whole, our data indicate that rip4 expression is regulated in a complex manner, which might have therapeutic implications.« less
Birrell, M A; McCluskie, K; Wong, S; Donnelly, L E; Barnes, P J; Belvisi, M G
2005-05-01
Consumption of a naturally occurring polyphenol, resveratrol, in particular through drinking moderate amounts of red wine, has been suggested to be beneficial to health. A plethora of in vitro studies published demonstrate various anti-inflammatory actions of resveratrol. The aim of this research was to determine whether any of these anti-inflammatory effects translate in vivo in a rodent model of LPS induced airway inflammation. Resveratrol reduced lung tissue neutrophilia to a similar magnitude as that achieved by treatment with budesonide. This was associated with a reduction in pro-inflammatory cytokines and prostanoid levels. Interestingly, the reduction did not appear to be due to an impact on NF-kappaB activation or the expression of the respective genes as suggested by various in vitro publications. These results suggest that resveratrol may possess anti-inflammatory properties via a novel mechanism. Elucidation of this mechanism may lead to potential new therapies for the treatment of chronic inflammation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spilsbury, Alison; Vauzour, David; Spencer, Jeremy P.E.
Highlights: Black-Right-Pointing-Pointer We tested the hypothesis that low concentrations of flavonoids inhibit NF-{kappa}B in astrocytes. Black-Right-Pointing-Pointer Primary cultured astrocytes possess a functional {kappa}B-system, measured using luciferase assays. Black-Right-Pointing-Pointer Seven flavonoids (100 nM-1 {mu}M) failed to reduce NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer Four flavonoids (100 nM-1 {mu}M) failed to reduce TNFa-stimulated NF-{kappa}B activity in astrocytes. Black-Right-Pointing-Pointer (-)-Epicatechin did not regulate nuclear translocation of the NF-{kappa}B subunit, p65. -- Abstract: Neuroinflammation plays an important role in the progression of neurodegenerative disorders such as Alzheimer's disease and Parkinson's disease. Sustained activation of nuclear transcription factor {kappa}B (NF-{kappa}B) is thought to play an importantmore » role in the pathogenesis of neurodegenerative disorders. Flavonoids have been shown to possess antioxidant and anti-inflammatory properties and we investigated whether flavonoids, at submicromolar concentrations relevant to their bioavailability from the diet, were able to modulate NF-{kappa}B signalling in astrocytes. Using luciferase reporter assays, we found that tumour necrosis factor (TNF{alpha}, 150 ng/ml) increased NF-{kappa}B-mediated transcription in primary cultures of mouse cortical astrocytes, which was abolished on co-transfection of a dominant-negative I{kappa}B{alpha} construct. In addition, TNF{alpha} increased nuclear localisation of p65 as shown by immunocytochemistry. To investigate potential flavonoid modulation of NF-{kappa}B activity, astrocytes were treated with flavonoids from different classes; flavan-3-ols ((-)-epicatechin and (+)-catechin), flavones (luteolin and chrysin), a flavonol (kaempferol) or the flavanones (naringenin and hesperetin) at dietary-relevant concentrations (0.1-1 {mu}M) for 18 h. None of the flavonoids modulated constitutive or TNF{alpha}-induced NF-{kappa}B activity. Therefore, we conclude that NF-{kappa}B signalling in astrocytes is not a major target for flavonoids.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Young-Rae; Kweon, Suc-Hyun; Kwon, Kang-Beom
The IL-1{beta}-NF-{kappa}B axis is a key pathway in the pathogenesis of rheumatoid arthritis (RA) and is central in the production of proinflammatory mediators in the inflamed synovium. Therefore, we examined whether fibroblast-like synoviocytes (FLS) could be spared from IL-1{beta}-induced toxicity by an overexpressing I{kappa}B super-repressor. Infection of FLS with Ad-I{kappa}B{alpha} (S32A, S36A), an adenovirus-containing mutant I{kappa}B{alpha}, inhibited IL-1{beta}-induced nuclear translocation and DNA binding of NF-{kappa}B. In addition, Ad-I{kappa}B{alpha} (S32A, S36A) prevented IL-1{beta}-induced inflammatory responses; namely, the production of chemokines, such as ENA-78 and RANTES, and activation of MMP-1 and MMP-3. Finally, increased cellular proliferation of FLS after IL-1{beta} treatment wasmore » significantly reduced by Ad-I{kappa}B{alpha} (S32A, S36A). However, Ad-I{kappa}B{beta} (S19A, S23A), the I{kappa}B{beta} mutant, was not effective in preventing IL-1{beta} toxicity. These results suggest that inhibition of I{kappa}B{alpha} degradation is a potential target for the prevention of joint destruction in patients with RA.« less
2008-11-01
was purified from natural racemic gossypol. Briefly, racemic gossypol was reacted with L - phenylalanine methyl ester hydrochloride overnight at room...solution of the resolved (F)-gossypol- phenylalanine methyl ester Schiff’s base was hydrolyzed by a mixture of tetrahydro- furan, glacial acetic acid...suppression of NF-kappaB-regulated antiapoptotic and metastatic gene products. Mol Pharmacol 2007; 71: 209-19. [136]Wang L , Du F, Wang X. TNF- alpha induces
Small interfering RNA targeting nuclear factor kappa B to prevent vein graft stenosis in rat models.
Meng, X B; Bi, X L; Zhao, H L; Feng, J B; Zhang, J P; Song, G M; Sun, W Y; Bi, Y W
2013-01-01
Intimal hyperplasia plays an important role in vein graft stenosis. Inflammatory injury, especially nuclear factor kappaB (NF-κB) gene activation, is highly involved in stenosis progression. We examined whether neointimal hyperplasia and vein graft stenosis could be inhibited by silencing the NF-κB gene with small interference RNA (siRNA). Sixty adult male Sprague-Dawley rats were randomly divided into a normal vein group, a vein graft group, a scrambled siRNA group, and an NF-κB siRNA group. We performed reverse interpositional grafting of the autologous external jugular vein to the abdominal aorta. Vein grafts were treated with liposome and gel complexes containing NF-κB siRNA or scrambled siRNA. The levels of monocyte chemoattractant protein -1, tumor necrosis factor-α, and NF-κB p65 in vessel tissues were evaluated after surgery for content of proliferating cell nuclear antigen (PCNA) and vascular wall thickness. NF-κB siRNA treated vein graft showed less neointimal formation and fewer positive PCNA cells (P < .05). In addition there were lower levels of, NF-κB p65 protein and of inflammatory mediators (P < .05) compared with the vein graft group. Our study suggested that siRNA transfection suppressed NF-κB expression, reduced inflammatory factors, lessened neointimal proliferation, and suppressed PCNA. Copyright © 2013 Elsevier Inc. All rights reserved.
Ghosh, Mithun; Kim, In Sook; Lee, Young Min; Hong, Seong Min; Lee, Taek Hwan; Lim, Ji Hong; Debnath, Trishna; Lim, Beong Ou
2018-03-08
This study aimed to determine the anti-osteoclastogenic effects of extracts from Aronia melanocarpa 'Viking' (AM) and identify the underlying mechanisms in vitro. Reactive oxygen species (ROS) are signal mediators in osteoclast differentiation. AM extracts inhibited ROS production in RAW 264.7 cells in a dose-dependent manner and exhibited strong radical scavenging activity. The extracts also attenuated the number of tartrate-resistant acid phosphatase (TRAP)-positive multinucleated osteoclasts. To attain molecular insights, the effect of the extracts on the signaling pathways induced by receptor activator of nuclear factor kappa B ligand (RANKL) were also investigated. RANKL triggers many transcription factors through the activation of mitogen-activated protein kinase (MAPK) and ROS, leading to the induction of osteoclast-specific genes. The extracts significantly suppressed RANKL-induced activation of MAPKs, such as extracellular signal-regulated kinase (ERK), c-Jun- N -terminal kinase (JNK) and p38 and consequently led to the downregulation of c-Fos and nuclear factor of activated T cells 1 (NFATc1) protein expression which ultimately suppress the activation of the osteoclast-specific genes, cathepsin K, TRAP, calcitonin receptor and integrin β₃. In conclusion, our findings suggest that AM extracts inhibited RANKL-induced osteoclast differentiation by downregulating ROS generation and inactivating JNK/ERK/p38, nuclear factor kappa B (NF-κB)-mediated c-Fos and NFATc1 signaling pathway.
Statistical mechanics in the context of special relativity.
Kaniadakis, G
2002-11-01
In Ref. [Physica A 296, 405 (2001)], starting from the one parameter deformation of the exponential function exp(kappa)(x)=(sqrt[1+kappa(2)x(2)]+kappax)(1/kappa), a statistical mechanics has been constructed which reduces to the ordinary Boltzmann-Gibbs statistical mechanics as the deformation parameter kappa approaches to zero. The distribution f=exp(kappa)(-beta E+betamu) obtained within this statistical mechanics shows a power law tail and depends on the nonspecified parameter beta, containing all the information about the temperature of the system. On the other hand, the entropic form S(kappa)= integral d(3)p(c(kappa) f(1+kappa)+c(-kappa) f(1-kappa)), which after maximization produces the distribution f and reduces to the standard Boltzmann-Shannon entropy S0 as kappa-->0, contains the coefficient c(kappa) whose expression involves, beside the Boltzmann constant, another nonspecified parameter alpha. In the present effort we show that S(kappa) is the unique existing entropy obtained by a continuous deformation of S0 and preserving unaltered its fundamental properties of concavity, additivity, and extensivity. These properties of S(kappa) permit to determine unequivocally the values of the above mentioned parameters beta and alpha. Subsequently, we explain the origin of the deformation mechanism introduced by kappa and show that this deformation emerges naturally within the Einstein special relativity. Furthermore, we extend the theory in order to treat statistical systems in a time dependent and relativistic context. Then, we show that it is possible to determine in a self consistent scheme within the special relativity the values of the free parameter kappa which results to depend on the light speed c and reduces to zero as c--> infinity recovering in this way the ordinary statistical mechanics and thermodynamics. The statistical mechanics here presented, does not contain free parameters, preserves unaltered the mathematical and epistemological structure of the ordinary statistical mechanics and is suitable to describe a very large class of experimentally observed phenomena in low and high energy physics and in natural, economic, and social sciences. Finally, in order to test the correctness and predictability of the theory, as working example we consider the cosmic rays spectrum, which spans 13 decades in energy and 33 decades in flux, finding a high quality agreement between our predictions and observed data.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Byung Hak; Lee, Jun-Young; Seo, Jee Hee
Nuclear factor (NF)-{kappa}B regulates a central common signaling for immunity and cell survival. Artemisolide (ATM) was previously isolated as a NF-{kappa}B inhibitor from a plant of Artemisia asiatica. However, molecular basis of ATM on NF-{kappa}B activation remains to be defined. Here, we demonstrate that ATM is a typical inhibitor of I{kappa}B kinase {beta} (IKK{beta}), resulting in inhibition of lipopolysaccharide (LPS)-induced NF-{kappa}B activation in RAW 264.7 macrophages. ATM inhibited the kinase activity of highly purified IKK{beta} and also LPS-induced IKK activity in the cells. Moreover, the effect of ATM on IKK{beta} activity was completely abolished by substitution of Cys-179 residue ofmore » IKK{beta} to Ala residue, indicating direct targeting site of ATM. ATM could inhibit I{kappa}B{alpha} phosphorylation in LPS-activated RAW 264.7 cells and subsequently prevent NF-{kappa}B activation. Further, we demonstrate that ATM down-regulates NF-{kappa}B-dependent TNF-{alpha} expression. Taken together, this study provides a pharmacological potential of ATM in NF-{kappa}B-dependent inflammatory disorders.« less
Lehmann, Andreas; Wixted, Josephine H F; Shapovalov, Maxim V; Roder, Heinrich; Dunbrack, Roland L; Robinson, Matthew K
2015-01-01
Phage-display technology facilitates rapid selection of antigen-specific single-chain variable fragment (scFv) antibodies from large recombinant libraries. ScFv antibodies, composed of a VH and VL domain, are readily engineered into multimeric formats for the development of diagnostics and targeted therapies. However, the recombinant nature of the selection strategy can result in VH and VL domains with sub-optimal biophysical properties, such as reduced thermodynamic stability and enhanced aggregation propensity, which lead to poor production and limited application. We found that the C10 anti-epidermal growth factor receptor (EGFR) scFv, and its affinity mutant, P2224, exhibit weak production from E. coli. Interestingly, these scFv contain a fusion of lambda3 and lambda1 V-region (LV3 and LV1) genes, most likely the result of a PCR aberration during library construction. To enhance the biophysical properties of these scFvs, we utilized a structure-based approach to replace and redesign the pre-existing framework of the VL domain to one that best pairs with the existing VH. We describe a method to exchange lambda sequences with a more stable kappa3 framework (KV3) within the VL domain that incorporates the original lambda DE-loop. The resulting scFvs, C10KV3_LV1DE and P2224KV3_LV1DE, are more thermodynamically stable and easier to produce from bacterial culture. Additionally, C10KV3_LV1DE and P2224KV3_LV1DE retain binding affinity to EGFR, suggesting that such a dramatic framework swap does not significantly affect scFv binding. We provide here a novel strategy for redesigning the light chain of problematic scFvs to enhance their stability and therapeutic applicability.
The disagreeable behaviour of the kappa statistic.
Flight, Laura; Julious, Steven A
2015-01-01
It is often of interest to measure the agreement between a number of raters when an outcome is nominal or ordinal. The kappa statistic is used as a measure of agreement. The statistic is highly sensitive to the distribution of the marginal totals and can produce unreliable results. Other statistics such as the proportion of concordance, maximum attainable kappa and prevalence and bias adjusted kappa should be considered to indicate how well the kappa statistic represents agreement in the data. Each kappa should be considered and interpreted based on the context of the data being analysed. Copyright © 2014 John Wiley & Sons, Ltd.
NF-{kappa}B inhibition is involved in tobacco smoke-induced apoptosis in the lungs of rats
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhong Caiyun; Zhou Yamei; Pinkerton, Kent E.
2008-07-15
Apoptosis is a vital mechanism for the regulation of cell turnover and plays a critical role in tissue homeostasis and development of many disease processes. Previous studies have demonstrated the apoptotic effect of tobacco smoke; however, the molecular mechanisms by which tobacco smoke triggers apoptosis remain unclear. In the present study we investigated the effects of tobacco smoke on the induction of apoptosis in the lungs of rats and modulation of nuclear factor-kappa B (NF-{kappa}B) in this process. Exposure of rats to 80 mg/m{sup 3} tobacco smoke significantly induced apoptosis in the lungs. Tobacco smoke resulted in inhibition of NF-{kappa}Bmore » activity, noted by suppression of inhibitor of {kappa}B (I{kappa}B) kinase (IKK), accumulation of I{kappa}B{alpha}, decrease of NF-{kappa}B DNA binding activity, and downregulation of NF-{kappa}B-dependent anti-apoptotic proteins, including Bcl-2, Bcl-xl, and inhibitors of apoptosis. Initiator caspases for the death receptor pathway (caspase 8) and the mitochondrial pathway (caspase 9) as well as effector caspase 3 were activated following tobacco smoke exposure. Tobacco smoke exposure did not alter the levels of p53 and Bax proteins. These findings suggest the role of NF-{kappa}B pathway in tobacco smoke-induced apoptosis.« less
Ion-cyclotron instability in plasmas described by product-bi-kappa distributions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santos, M. S. dos; Ziebell, L. F., E-mail: luiz.ziebell@ufrgs.br; Gaelzer, R., E-mail: rudi.gaelzer@ufrgs.br
The dispersion relation for parallel propagating waves in the ion-cyclotron branch is investigated numerically by considering that the velocity distribution of the ion population is a function of type product-bi-kappa. We investigate the effects of the non-thermal features and of the anisotropy associated with this type of distribution on the ion-cyclotron instability, as well as the influence of different forms of the electron distribution, by considering Maxwellian distributions, bi-kappa distributions, and product-bi-kappa distributions. The cases of ions described by either Maxwellian or bi-kappa distributions are also considered, for comparison. The results of the numerical analysis show that the increase inmore » the non-thermal character associated with the anisotropic kappa distributions for ions contributes to enhance the instability as compared to that obtained in the Maxwellian case, in magnitude and in wave number range, with more significant enhancement for the case of ion product-bi-kappa distributions than for the case of ion bi-kappa distributions. It is also shown that the ion-cyclotron instability is decreased if the electrons are described by product-bi-kappa distributions, while electrons described by bi-kappa distributions lead to growth rates which are very similar to those obtained considering a Maxwellian distribution for the electron population.« less
Guardado, Pedro; Olivera, Anlys; Rusch, Heather L; Roy, Michael; Martin, Christiana; Lejbman, Natasha; Lee, Hwyunhwa; Gill, Jessica M
2016-03-01
Whole transcriptome analysis provides an unbiased examination of biological activity, and likely, unique insight into the mechanisms underlying posttraumatic stress disorder (PTSD) and comorbid depression and traumatic brain injury. This study compared gene-expression profiles in military personnel with PTSD (n=28) and matched controls without PTSD (n=27) using HG-U133 Plus 2.0 microarrays (Affymetrix), which contain 54,675 probe sets representing more than 38,500 genes. Analysis of expression profiles revealed 203 differentially expressed genes in PTSD, of which 72% were upregulated. Using Partek Genomics Suite 6.6, differentially expressed transcription clusters were filtered based on a selection criterion of ≥1.5 relative fold change at a false discovery rate of ≤5%. Ingenuity Pathway Analysis (Qiagen) of the differentially expressed genes indicated a dysregulation of genes associated with the innate immune, neuroendocrine, and NF-κB systems. These findings provide novel insights that may lead to new pharmaceutical agents for PTSD treatments and help mitigate mental and physical comorbidity risk. Copyright © 2016. Published by Elsevier Ltd.
Hernández-Gutierrez, S; García-Peláez, I; Zentella-Dehesa, A; Ramos-Kuri, M; Hernández-Franco, P; Hernández-Sánchez, F; Rojas, E
2006-07-01
Nuclear factor kappaB (NF-kappaB) is a pleiotropic transcription factor implicated in the regulation of diverse morphologic cardiac alterations, for which the p50 and p65 subunits form the most prevalent dimeric form in the heart. NF-kappaB is inactivated by proteins of the IkappaB family, which trap it in the cytoplasm. It is not known whether NF-kappaB influences cardiac development. Here we investigated the role of NF-kappaB in regulating transcription in chicken heart morphogenesis. Specifically, we tested whether NF-kappaB activation is required for normal formation of the outflow tract (OFT) during a critical stage of heart development. We designed a reporter vector with kappaB binding sites for Rel family members in the promoter, upstream from the cDNA of Green Fluorescent Protein (GFP). This construct was injected directly into the developing heart of chicken embryos. NF-kappaB activation was subsequently inhibited by administration of the specific pharmacological agent Bay 11-7085. We found that forced NF-kappaB expression was associated with multiple congenital cardiac alterations of the OFT (mainly IVC, DORV and great arteries stenosis). These findings indicate that blockade of NF-kappaB induces apoptosis and is an important factor in the development of OFT during cardiogenesis. However, it remains unknown which members of the Rel family are relevant in this process.
Wen, Yangming; Lan, Kaijian; Wang, Junjie; Yu, Jingyi; Qu, Yarong; Zhao, Wei; Zhang, Fuchun; Tan, Wanlong; Cao, Hong; Zhou, Chen
2013-06-01
To construct dengue virus-specific full-length fully human antibody libraries using mammalian cell surface display technique. Total RNA was extracted from peripheral blood mononuclear cells (PBMCs) from convalescent patients with dengue fever. The reservoirs of the light chain and heavy chain variable regions (LCκ and VH) of the antibody genes were amplified by RT-PCR and inserted into the vector pDGB-HC-TM separately to construct the light chain and heavy chain libraries. The library DNAs were transfected into CHO cells and the expression of full-length fully human antibodies on the surface of CHO cells was analyzed by flow cytometry. Using 1.2 µg of the total RNA isolated from the PBMCs as the template, the LCκ and VH were amplified and the full-length fully human antibody mammalian display libraries were constructed. The kappa light chain gene library had a size of 1.45×10(4) and the heavy chain gene library had a size of 1.8×10(5). Sequence analysis showed that 8 out of the 10 light chain clones and 7 out of the 10 heavy chain clones randomly picked up from the constructed libraries contained correct open reading frames. FACS analysis demonstrated that all the 15 clones with correct open reading frames expressed full-length antibodies, which could be detected on CHO cell surfaces. After co-transfection of the heavy chain and light chain gene libraries into CHO cells, the expression of full-length antibodies on CHO cell surfaces could be detected by FACS analysis with an expressible diversity of the antibody library reaching 1.46×10(9) [(1.45×10(4)×80%)×(1.8×10(5)×70%)]. Using 1.2 µg of total RNA as template, the LCκ and VH full-length fully human antibody libraries against dengue virus have been successfully constructed with an expressible diversity of 10(9).
Ghalichi, Leila; Mohammad, Kazem; Majdzadeh, Reza; Hoseini, Mostafa; Pournik, Omid; Nedjat, Saharnaz
2012-01-01
Background: Residence characteristics can affect health of residents. This paper reports the development of an instrument assessing these aspects of neighborhoods. Materials and Methods: Literature search and focus group discussions with residents were carried out and relevant items were extracted. Five experts reviewed and commented on the items. An observation instrument with 54 items was composed and completed by two independent observers in 20 randomly selected locations. Due to lack of acceptable reliability in some items, the checklist was revised. The new 22-items checklist in four categories (general characteristics, public green area characteristics, access to services and undesirable features) was completed by two independent trained observers in 28 randomly selected locations. Results: The items in the final checklist had kappa statistics ranging from 0.63 to 1, with an exception of the item assessing “presence of beggars, homeless or working/street children”, with kappa as low as 0.27 due to variability of their presence in different times. Average Kappa statistics was 0.78 for general characteristics, 0.79 for public green area characteristics, 0.84 for access to services, and 0.54 for undesirable features. Conclusion: Neighborhood and health observation instrument seems to have good reliability in city of Tehran. It can probably be used in other large cities of Iran and similar cities elsewhere. PMID:23626633
The accuracy of symptom recall in eating disorders.
Peterson, Carol B; Miller, Kathryn B; Johnson-Lind, Joy; Crow, Scott J; Thuras, Paul
2007-01-01
The purpose of this study was to assess how accurately patients with eating disorders recall their symptoms after 6 to 12 months, to evaluate whether more recent symptoms are remembered more accurately, and to determine the extent to which the accuracy of recall impacts diagnostic classification. Seventy women who were enrolled in a longitudinal study of eating disorder symptoms were asked to recall their eating patterns, behaviors, and attitudes from 6 or 12 months earlier using semistructured interviews (Eating Disorders Examination and McKnight Longitudinal Follow-up Interview for Eating Disorders). Results indicated that correlations between the original and recalled data for frequency of objective binge eating episodes and vomiting ranged from r = .534 to .898 (average, r = .772), with lower correlations for subjective binge eating episodes (average, r = .335). Attitudes toward shape and weight were recalled more accurately at 6 months (average, r = .907) than 12 months (average, r = .620). kappa Coefficients were higher for eating disorder diagnoses using broad than narrow definitions, with no differences between 6- and 12-month recall. Overall, agreement for depression recall was low but better at 6 months (kappa = .423) than 12 months (kappa = .296). These findings suggest that patients with eating disorders are at least moderately accurate when recalling most symptoms from 6 to 12 months earlier. Although broadly defined eating disorder diagnoses remained consistent, depression and narrower eating disorder diagnostic classifications showed more variability.
2016-01-01
OBJECTIVES: The tuberculin skin test (TST) and the QuantiFERON-TB Gold test (QFT) are used to identify latent tuberculosis infections (LTBIs). The aim of this study was to determine the agreement between these two tests among health care workers in Iran. METHODS: This cross-sectional study included 177 tuberculosis (TB) laboratory staff and 67 non-TB staff. TST indurations of 10 mm or more were considered positive. The Student’s t-test and the chi-square test were used to compare the mean score and proportion of variables between the TB laboratory staff and the non-TB laboratory staff. Kappa statistics were used to evaluate the agreement between these tests, and logistic regression was used to assess the risk factors associated with positive results for each test. RESULTS: The prevalence of LTBIs according to both the QFT and the TST was 17% (95% confidence interval [CI], 12% to 21%) and 16% (95% CI, 11% to 21%), respectively. The agreement between the QFT and the TST was 77.46%, with a kappa of 0.19 (95% CI, 0.04 to 0.34). CONCLUSIONS: Although the prevalence of LTBI based on the QFT and the TST was not significantly different, the kappa statistic was low between these two tests for the detection of LTBIs. PMID:27457062
An evaluation of non-metric cranial traits used to estimate ancestry in a South African sample.
L'Abbé, E N; Van Rooyen, C; Nawrocki, S P; Becker, P J
2011-06-15
Establishing ancestry from a skeleton for forensic purposes has been shown to be difficult. The purpose of this paper is to address the application of thirteen non-metric traits to estimate ancestry in three South African groups, namely White, Black and "Coloured". In doing so, the frequency distribution of thirteen non-metric traits among South Africans are presented; the relationship of these non-metric traits with ancestry, sex, age at death are evaluated; and Kappa statistics are utilized to assess the inter and intra-rater reliability. Crania of 520 known individuals were obtained from four skeletal samples in South Africa: the Pretoria Bone Collection, the Raymond A. Dart Collection, the Kirsten Collection and the Student Bone Collection from the University of the Free State. Average age at death was 51, with an age range between 18 and 90. Thirteen commonly used non-metric traits from the face and jaw were scored; definition and illustrations were taken from Hefner, Bass and Hauser and De Stephano. Frequency distributions, ordinal regression and Cohen's Kappa statistics were performed as a means to assess population variation and repeatability. Frequency distributions were highly variable among South Africans. Twelve of the 13 variables had a statistically significant relationship with ancestry. Sex significantly affected only one variable, inter-orbital breadth, and age at death affected two (anterior nasal spine and alveolar prognathism). The interaction of ancestry and sex independently affected three variables (nasal bone contour, nasal breadth, and interorbital breadth). Seven traits had moderate to excellent repeatability, while poor scoring consistency was noted for six variables. Difficulties in repeating several of the trait scores may require either a need for refinement of the definitions, or these character states may not adequately describe the observable morphology in the population. The application of the traditional experience-based approach for estimating ancestry in forensic case work is problematic. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Levendowski, Daniel J.; Ferini-Strambi, Luigi; Gamaldo, Charlene; Cetel, Mindy; Rosenberg, Robert; Westbrook, Philip R.
2017-01-01
Study Objectives: To assess the validity of sleep architecture and sleep continuity biomarkers obtained from a portable, multichannel forehead electroencephalography (EEG) recorder. Methods: Forty-seven subjects simultaneously underwent polysomnography (PSG) while wearing a multichannel frontopolar EEG recording device (Sleep Profiler). The PSG recordings independently staged by 5 registered polysomnographic technologists were compared for agreement with the autoscored sleep EEG before and after expert review. To assess the night-to-night variability and first night bias, 2 nights of self-applied, in-home EEG recordings obtained from a clinical cohort of 63 patients were used (41% with a diagnosis of insomnia/depression, 35% with insomnia/obstructive sleep apnea, and 17.5% with all three). The between-night stability of abnormal sleep biomarkers was determined by comparing each night's data to normative reference values. Results: The mean overall interscorer agreements between the 5 technologists were 75.9%, and the mean kappa score was 0.70. After visual review, the mean kappa score between the autostaging and five raters was 0.67, and staging agreed with a majority of scorers in at least 80% of the epochs for all stages except stage N1. Sleep spindles, autonomic activation, and stage N3 exhibited the least between-night variability (P < .0001) and strongest between-night stability. Antihypertensive medications were found to have a significant effect on sleep quality biomarkers (P < .02). Conclusions: A strong agreement was observed between the automated sleep staging and human-scored PSG. One night's recording appeared sufficient to characterize abnormal slow wave sleep, sleep spindle activity, and heart rate variability in patients, but a 2-night average improved the assessment of all other sleep biomarkers. Commentary: Two commentaries on this article appear in this issue on pages 771 and 773. Citation: Levendowski DJ, Ferini-Strambi L, Gamaldo C, Cetel M, Rosenberg R, Westbrook PR. The accuracy, night-to-night variability, and stability of frontopolar sleep electroencephalography biomarkers. J Clin Sleep Med. 2017;13(6):791–803. PMID:28454598
Whitfield, Richard H; Newcombe, Robert G; Woollard, Malcolm
2003-12-01
The introduction of the European Resuscitation Guidelines (2000) for cardiopulmonary resuscitation (CPR) and automated external defibrillation (AED) prompted the development of an up-to-date and reliable method of assessing the quality of performance of CPR in combination with the use of an AED. The Cardiff Test of basic life support (BLS) and AED version 3.1 was developed to meet this need and uses standardised checklists to retrospectively evaluate performance from analyses of video recordings and data drawn from a laptop computer attached to a training manikin. This paper reports the inter- and intra-observer reliability of this test. Data used to assess reliability were obtained from an investigation of CPR and AED skill acquisition in a lay responder AED training programme. Six observers were recruited to evaluate performance in 33 data sets, repeating their evaluation after a minimum interval of 3 weeks. More than 70% of the 42 variables considered in this study had a kappa score of 0.70 or above for inter-observer reliability or were drawn from computer data and therefore not subject to evaluator variability. 85% of the 42 variables had kappa scores for intra-observer reliability of 0.70 or above or were drawn from computer data. The standard deviations for inter- and intra-observer measures of time to first shock were 11.6 and 7.7 s, respectively. The inter- and intra-observer reliability for the majority of the variables in the Cardiff Test of BLS and AED version 3.1 is satisfactory. However, reliability is less acceptable with respect to shaking when checking for responsiveness, initial check/clearing of the airway, checks for signs of circulation, time to first shock and performance of interventions in the correct sequence. Further research is required to determine if modifications to the method of assessing these variables can increase reliability.
Automated EEG sleep staging in the term-age baby using a generative modelling approach.
Pillay, Kirubin; Dereymaeker, Anneleen; Jansen, Katrien; Naulaers, Gunnar; Van Huffel, Sabine; De Vos, Maarten
2018-06-01
We develop a method for automated four-state sleep classification of preterm and term-born babies at term-age of 38-40 weeks postmenstrual age (the age since the last menstrual cycle of the mother) using multichannel electroencephalogram (EEG) recordings. At this critical age, EEG differentiates from broader quiet sleep (QS) and active sleep (AS) stages to four, more complex states, and the quality and timing of this differentiation is indicative of the level of brain development. However, existing methods for automated sleep classification remain focussed only on QS and AS sleep classification. EEG features were calculated from 16 EEG recordings, in 30 s epochs, and personalized feature scaling used to correct for some of the inter-recording variability, by standardizing each recording's feature data using its mean and standard deviation. Hidden Markov models (HMMs) and Gaussian mixture models (GMMs) were trained, with the HMM incorporating knowledge of the sleep state transition probabilities. Performance of the GMM and HMM (with and without scaling) were compared, and Cohen's kappa agreement calculated between the estimates and clinicians' visual labels. For four-state classification, the HMM proved superior to the GMM. With the inclusion of personalized feature scaling, mean kappa (±standard deviation) was 0.62 (±0.16) compared to the GMM value of 0.55 (±0.15). Without feature scaling, kappas for the HMM and GMM dropped to 0.56 (±0.18) and 0.51 (±0.15), respectively. This is the first study to present a successful method for the automated staging of four states in term-age sleep using multichannel EEG. Results suggested a benefit in incorporating transition information using an HMM, and correcting for inter-recording variability through personalized feature scaling. Determining the timing and quality of these states are indicative of developmental delays in both preterm and term-born babies that may lead to learning problems by school age.
Inter-rater reliability of surgical reviews for AREN03B2: a COG renal tumor committee study.
Hamilton, Thomas E; Barnhart, Douglas; Gow, Kenneth; Ferrer, Fernando; Kandel, Jessica; Glick, Richard; Dasgupta, Roshni; Naranjo, Arlene; He, Ying; Gratias, Eric; Geller, James; Mullen, Elizabeth; Ehrlich, Peter
2014-01-01
The Children's Oncology Group (COG) renal tumor study (AREN03B2) requires real-time central review of radiology, pathology, and the surgical procedure to determine appropriate risk-based therapy. The purpose of this study was to determine the inter-rater reliability of the surgical reviews. Of the first 3200 enrolled AREN03B2 patients, a sample of 100 enriched for blood vessel involvement, spill, rupture, and lymph node involvement was selected for analysis. The surgical assessment was then performed independently by two blinded surgical reviewers and compared to the original assessment, which had been completed by another of the committee surgeons. Variables assessed included surgeon-determined local tumor stage, overall disease stage, type of renal procedure performed, presence of tumor rupture, occurrence of intraoperative tumor spill, blood vessel involvement, presence of peritoneal implants, and interpretation of residual disease. Inter-rater reliability was measured using the Fleiss' Kappa statistic two-sided hypothesis tests (Kappa, p-value). Local tumor stage correlated in all 3 reviews except in one case (Kappa=0.9775, p<0.001). Similarly, overall disease stage had excellent correlation (0.9422, p<0.001). There was strong correlation for type of renal procedure (0.8357, p<0.001), presence of tumor rupture (0.6858, p<0.001), intraoperative tumor spill (0.6493, p<0.001), and blood vessel involvement (0.6470, p<0.001). Variables that had lower correlation were determination of the presence of peritoneal implants (0.2753, p<0.001) and interpretation of residual disease status (0.5310, p<0.001). The inter-rater reliability of the surgical review is high based on the great consistency in the 3 independent review results. This analysis provides validation and establishes precedent for real-time central surgical review to determine treatment assignment in a risk-based stratagem for multimodal cancer therapy. © 2014.
Automated EEG sleep staging in the term-age baby using a generative modelling approach
NASA Astrophysics Data System (ADS)
Pillay, Kirubin; Dereymaeker, Anneleen; Jansen, Katrien; Naulaers, Gunnar; Van Huffel, Sabine; De Vos, Maarten
2018-06-01
Objective. We develop a method for automated four-state sleep classification of preterm and term-born babies at term-age of 38-40 weeks postmenstrual age (the age since the last menstrual cycle of the mother) using multichannel electroencephalogram (EEG) recordings. At this critical age, EEG differentiates from broader quiet sleep (QS) and active sleep (AS) stages to four, more complex states, and the quality and timing of this differentiation is indicative of the level of brain development. However, existing methods for automated sleep classification remain focussed only on QS and AS sleep classification. Approach. EEG features were calculated from 16 EEG recordings, in 30 s epochs, and personalized feature scaling used to correct for some of the inter-recording variability, by standardizing each recording’s feature data using its mean and standard deviation. Hidden Markov models (HMMs) and Gaussian mixture models (GMMs) were trained, with the HMM incorporating knowledge of the sleep state transition probabilities. Performance of the GMM and HMM (with and without scaling) were compared, and Cohen’s kappa agreement calculated between the estimates and clinicians’ visual labels. Main results. For four-state classification, the HMM proved superior to the GMM. With the inclusion of personalized feature scaling, mean kappa (±standard deviation) was 0.62 (±0.16) compared to the GMM value of 0.55 (±0.15). Without feature scaling, kappas for the HMM and GMM dropped to 0.56 (±0.18) and 0.51 (±0.15), respectively. Significance. This is the first study to present a successful method for the automated staging of four states in term-age sleep using multichannel EEG. Results suggested a benefit in incorporating transition information using an HMM, and correcting for inter-recording variability through personalized feature scaling. Determining the timing and quality of these states are indicative of developmental delays in both preterm and term-born babies that may lead to learning problems by school age.
Lee, Kathryn A; Gay, Caryl; Pullinger, Clive R; Hennessy, Mary Dawn; Zak, Rochelle S; Aouizerat, Bradley E
2014-03-01
Cytokine activity and polymorphisms have been associated with sleep outcomes in prior animal and human research. The purpose of this study was to determine whether circulating plasma cytokines and cytokine polymorphisms are associated with the poor sleep maintenance commonly experienced by adults living with human immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS). Cross-sectional descriptive study. HIV clinics and community sites in the San Francisco Bay area. A convenience sample of 289 adults (193 men, 73 women, and 23 transgender) living with HIV/AIDS. None. A wrist actigraph was worn for 72 h to estimate the percentage of wake after sleep onset (WASO%) and total sleep time (TST), plasma cytokines were analyzed, and genotyping was conducted for 15 candidate genes involved in cytokine signaling: interferon-gamma (IFNG), IFNG receptor 1 (IFNGR1), interleukins (IL1B, IL1R2, IL1R2, IL2, IL4, IL6, IL8, IL10, IL13, IL17A), nuclear factor of kappa light polypeptide gene enhancer in B cells (NFKB1 and NFKB2), and tumor necrosis factor-alpha (TNFA). Controlling for demographic variables such as race and sex, and clinical variables such as CD4+ count and medications, higher WASO% was associated with single nucleotide polymorphisms (SNPs) of IL1R2 rs11674595 and TNFA rs1041981 and less WASO% was associated with IL2 rs2069776. IL1R2 rs11674595 and TNFA rs1041981 were also associated with short sleep duration. This study strengthens the evidence for an association between inflammation and sleep maintenance problems. In this chronic illness population, cytokine polymorphisms associated with wake after sleep onset provide direction for intervention research aimed at comparing anti-inflammatory mechanisms with hypnotic agents for improving sleep maintenance and total sleep time.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saji, Chiaki; Higashi, Chizuka; Niinaka, Yasufumi
Highlights: Black-Right-Pointing-Pointer Constitutive NF-{kappa}B signaling is essential for the survival and growth of PEL cells. Black-Right-Pointing-Pointer NF-{kappa}B signaling is upregulated by the proteasome-dependent degradation of I{kappa}B{alpha}. Black-Right-Pointing-Pointer Proteasome inhibitors suppress NF-{kappa}B signaling and induce apoptosis in PEL cells through stabilization of I{kappa}B{alpha}. Black-Right-Pointing-Pointer Proteasome inhibitors suppress viral replication in PEL cells during lytic KSHV infection. -- Abstract: Primary effusion lymphoma (PEL) is an aggressive neoplasm caused by Kaposi's sarcoma-associated herpesvirus (KSHV). This study provides evidence that proteasomal activity is required for both survival of PEL cells stably harboring the KSHV genome and viral replication of KSHV. We evaluated the cytotoxicmore » effects of proteasome inhibitors on PEL cells. The proteasome inhibitors MG132, lactacystin, and proteasome inhibitor I dramatically inhibited cell proliferation and induced apoptosis of PEL cells through the accumulation of p21 and p27. Furthermore, proteasome inhibitors induced the stabilization of NF-{kappa}B inhibitory molecule (I{kappa}B{alpha}) and suppressed the transcriptional activity of NF-{kappa}B in PEL cells. The NF-{kappa}B specific inhibitor BAY11-7082 also induced apoptosis in PEL cells. The constitutive activation of NF-{kappa}B signaling is essential for the survival and growth of B cell lymphoma cells, including PEL cells. NF-{kappa}B signaling is upregulated by proteasome-dependent degradation of I{kappa}B{alpha}. The suppression of NF-{kappa}B signaling by proteasome inhibitors may contribute to the induction of apoptosis in PEL cells. In addition, proteasome activity is required for KSHV replication in KSHV latently infected PEL cells. MG132 reduced the production of progeny virus from PEL cells at low concentrations, which do not affect PEL cell growth. These findings suggest that proteasome inhibitors may represent a novel strategy for the treatment of KSHV infection and KSHV-associated lymphomas.« less
Shi, Ju; Johansson, Jenny; Woodling, Nathaniel S; Wang, Qian; Montine, Thomas J; Andreasson, Katrin
2010-06-15
Peripheral inflammation leads to immune responses in brain characterized by microglial activation, elaboration of proinflammatory cytokines and reactive oxygen species, and secondary neuronal injury. The inducible cyclooxygenase (COX), COX-2, mediates a significant component of this response in brain via downstream proinflammatory PG signaling. In this study, we investigated the function of the PGE2 E-prostanoid (EP) 4 receptor in the CNS innate immune response to the bacterial endotoxin LPS. We report that PGE2 EP4 signaling mediates an anti-inflammatory effect in brain by blocking LPS-induced proinflammatory gene expression in mice. This was associated in cultured murine microglial cells with decreased Akt and I-kappaB kinase phosphorylation and decreased nuclear translocation of p65 and p50 NF-kappaB subunits. In vivo, conditional deletion of EP4 in macrophages and microglia increased lipid peroxidation and proinflammatory gene expression in brain and in isolated adult microglia following peripheral LPS administration. Conversely, EP4 selective agonist decreased LPS-induced proinflammatory gene expression in hippocampus and in isolated adult microglia. In plasma, EP4 agonist significantly reduced levels of proinflammatory cytokines and chemokines, indicating that peripheral EP4 activation protects the brain from systemic inflammation. The innate immune response is an important component of disease progression in a number of neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. In addition, recent studies demonstrated adverse vascular effects with chronic administration of COX-2 inhibitors, indicating that specific PG signaling pathways may be protective in vascular function. This study supports an analogous and beneficial effect of PGE2 EP4 receptor signaling in suppressing brain inflammation.
He, Hongliang; Yuan, Quan; Bie, Jinghua; Wallace, Ryan L; Yannie, Paul J; Wang, Jing; Lancina, Michael G; Zolotarskaya, Olga Yu; Korzun, William; Yang, Hu; Ghosh, Shobha
2018-03-01
Dysfunctional macrophages underlie the development of several diseases including atherosclerosis where accumulation of cholesteryl esters and persistent inflammation are 2 of the critical macrophage processes that regulate the progression as well as stability of atherosclerotic plaques. Ligand-dependent activation of liver-x-receptor (LXR) not only enhances mobilization of stored cholesteryl ester but also exerts anti-inflammatory effects mediated via trans-repression of proinflammatory transcription factor nuclear factor kappa B. However, increased hepatic lipogenesis by systemic administration of LXR ligands (LXR-L) has precluded their therapeutic use. The objective of the present study was to devise a strategy to selectively deliver LXR-L to atherosclerotic plaque-associated macrophages while limiting hepatic uptake. Mannose-functionalized dendrimeric nanoparticles (mDNP) were synthesized to facilitate active uptake via the mannose receptor expressed exclusively by macrophages using polyamidoamine dendrimer. Terminal amine groups were used to conjugate mannose and LXR-L T091317 via polyethylene glycol spacers. mDNP-LXR-L was effectively taken up by macrophages (and not by hepatocytes), increased expression of LXR target genes (ABCA1/ABCG1), and enhanced cholesterol efflux. When administered intravenously to LDLR-/- mice with established plaques, significant accumulation of fluorescently labeled mDNP-LXR-L was seen in atherosclerotic plaque-associated macrophages. Four weekly injections of mDNP-LXR-L led to significant reduction in atherosclerotic plaque progression, plaque necrosis, and plaque inflammation as assessed by expression of nuclear factor kappa B target gene matrix metalloproteinase 9; no increase in hepatic lipogenic genes or plasma lipids was observed. These studies validate the development of a macrophage-specific delivery platform for the delivery of anti-atherosclerotic agents directly to the plaque-associated macrophages to attenuate plaque burden. Copyright © 2017 Elsevier Inc. All rights reserved.
Shibata, Yasuko; Araki, Hidefumi; Oshitani, Toshiyuki; Imaoka, Asayo; Matsui, Masaru; Miyazawa, Keiji; Abiko, Yoshimitsu
2009-03-03
Although recent clinical studies have shown that laser therapy acts as an anti-inflammatory effector in the treatment of some diseases, little is known about the mechanism by which it acts in rheumatoid arthritis (RA) patients. The purpose of our work was to examine how irradiation with linear polarized infrared light (LPIL) suppresses inflammatory responses in the MH7A rheumatoid fibroblast-like synoviocyte cell line. We initially confirmed the effects of two disease-modifying anti-rheumatic treatments, LPIL irradiation and dexamethasone (Dex) administration, under experimental inflammatory conditions using gene chip technology. We found that LPIL exerted a smaller effect on gene transcription than Dex; however, IL-1beta-inducible target genes such as the CXCL type chemokines IL-8, IL-1beta and IL-6 were all clearly suppressed by LPIL to the same degree as by Dex. We also found that IL-1beta-induced release of IL-8 from MH7A cells was completely blocked by pretreatment with the (IL-8) inhibitor Bay11-7085, indicating that activation of NF-kappaB signaling plays an important role in the secretion of IL-8. Although the levels of NFKB1 and RELA transcription were unaffected by IL-1beta stimulation, phosphorylation of RelA S276 was suppressed by both LPIL and Dex. Thus LPIL likely exerts its anti-inflammatory effects by inhibiting the release of the inflammatory chemokine IL-8. A fuller understanding of the anti-inflammatory mechanism of LPIL in rheumatoid synoviocytes could serve as the basis for improved treatment of RA patients in the future.
Taylor, J P; Pomerantz, R; Bagasra, O; Chowdhury, M; Rappaport, J; Khalili, K; Amini, S
1992-01-01
The Tat protein of human immunodeficiency virus type 1 (HIV-1) is essential for productive infection and is a potential target for antiviral therapy. Tat, a potent activator of HIV-1 gene expression, serves to greatly increase the rate of transcription directed by the viral promoter. This induction, which seems to be an important component in the progression of acquired immune deficiency syndrome (AIDS), may be due to increased transcriptional initiation, increased transcriptional elongation, or a combination of these processes. Much attention has been focused on the interaction of Tat with a specific RNA target termed TAR (transactivation responsive) which is present in the leader sequence of all HIV-1 mRNAs. This interaction is believed to be an important component of the mechanism of transactivation. In this report we demonstrate that in certain CNS-derived cells Tat is capable of activating HIV-1 through a TAR-independent pathway. A Tat-responsive element is found upstream within the viral promoter that in glial-derived cell lines allows transactivation in the absence of TAR. Deletion mapping and hybrid promoter constructs demonstrate that the newly identified Tat-responsive element corresponds to a sequence within the viral long terminal repeat (LTR) previously identified as the HIV-1 enhancer, or NF-kappa B domain. DNA band-shift analysis reveals NF-kappa B binding activity in glial cells that differs from that present in T lymphoid cells. Further, we observe that TAR-deleted mutants of HIV-1 demonstrate normal late gene expression in glial cells as evidenced by syncytia formation and production of viral p24 antigen.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1505523
Li, Xiao-Hong; McGrath, Kristine C-Y; Nammi, Srinivas; Heather, Alison K; Roufogalis, Basil D
2012-03-01
The aim of this study was to investigate whether treatment with a ginger (Zingiber officinale) extract of high-fat diet (HFD)-fed rats suppresses Nuclear factor-kappa B (NF-κB)-driven hepatic inflammation and to subsequently explore the molecular mechanisms in vitro. Adult male Sprague-Dawley rats were treated with an ethanolic extract of Zingiber officinale (400 mg/kg) along with a HFD for 6 weeks. Hepatic cytokine mRNA levels, cytokine protein levels and NF-κB activation were measured by real-time PCR, Western blot and an NF-κB nuclear translocation assay, respectively. In vitro, cell culture studies were carried out in human hepatocyte (HuH-7) cells by treatment with Zingiber officinale (100 μg/mL) for 24 hr prior to interleukin-1β (IL-1β, 8 ng/mL)-induced inflammation. We showed that Zingiber officinale treatment decreased cytokine gene TNFα and IL-6 expression in HFD-fed rats, which was associated with suppression of NF-κB activation. In vitro, Zingiber officinale treatment decreased NF-κB-target inflammatory gene expression of IL-6, IL-8 and serum amyloid A1 (SAA1), while it suppressed NF-κB activity, IκBα degradation and IκB kinase (IKK) activity. In conclusion, Zingiber officinale suppressed markers of hepatic inflammation in HFD-fed rats, as demonstrated by decreased hepatic cytokine gene expression and decreased NF-κB activation. The study demonstrates that the anti-inflammatory effect of Zingiber officinale occurs at least in part through the NF-κB signalling pathway. © 2011 The Authors. Basic & Clinical Pharmacology & Toxicology © 2011 Nordic Pharmacological Society.
Resampling probability values for weighted kappa with multiple raters.
Mielke, Paul W; Berry, Kenneth J; Johnston, Janis E
2008-04-01
A new procedure to compute weighted kappa with multiple raters is described. A resampling procedure to compute approximate probability values for weighted kappa with multiple raters is presented. Applications of weighted kappa are illustrated with an example analysis of classifications by three independent raters.
Mathy-Hartert, M; Hogge, L; Sanchez, C; Deby-Dupont, G; Crielaard, J M; Henrotin, Y
2008-07-01
Beside matrix metalloproteinases, reactive oxygen species (ROS) are the main biochemical factors of cartilage degradation. To prevent ROS toxicity, chondrocytes possess a well-coordinated enzymatic antioxidant system formed principally by superoxide dismutases (SODs), catalase (CAT) and glutathione peroxidase (GPX). This work was designed to assess the effects of interleukin (IL)-1beta and IL-6 on the enzymatic activity and gene expression of SODs, CAT and GPX in bovine chondrocytes. Bovine chondrocytes were cultured in monolayer for 4-96 h in the absence or in the presence of IL-1beta (0.018-1.8ng/ml) or IL-6 (10-100 ng/ml). To study signal transduction pathway, inhibitors of mitogen-activated protein kinases (MAPK) (PD98059, SB203580 and SP600125) (5-20 microM) and nuclear factor (NF)-kappaB inhibitors [BAY11-7082 (1-10 microM) and MG132 (0.1-10 microM)] were used. SODs, CAT and GPX enzymatic activities were evaluated in cellular extract by using colorimetric enzymatic assays. Mn SODs, Cu/Zn SOD, extracellular SOD (EC SOD), CAT and GPX gene expressions were quantified by real-time and quantitative polymerase chain reaction (PCR). Mn SOD and GPX activities were dose and time-dependently increased by IL-1beta. In parallel, IL-1beta markedly enhanced Mn SOD and GPX gene expressions, but decreased Cu/Zn SOD, EC SOD and CAT gene expressions. Induction of SOD enzymatic activity and Mn SOD mRNA expression were inhibited by NF-kappaB inhibitors but not by MAPK inhibitors. IL-6 effects were similar but weaker than those of IL-1beta. In conclusion, IL-1beta, and to a lesser extend IL-6, dysregulates enzymatic antioxidant defenses in chondrocyte. These changes could lead to a transient accumulation of H(2)O(2) in mitochondria, and consequently to mitochondria damage. These changes contribute to explain the mitochondrial dysfunction observed in osteoarthritis chondrocytes.
Zach, Frank; Mueller, Alexandra; Gessner, André
2015-01-01
In vitro differentiation into functional osteoclasts is routinely achieved by incubation of embryonic stem cells, induced pluripotent stem cells, or primary as well as cryopreserved spleen and bone marrow-derived cells with soluble receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor. Additionally, osteoclasts can be derived from co-cultures with osteoblasts or by direct administration of soluble receptor activator of nuclear factor kappa-B ligand to RAW 264.7 macrophage lineage cells. However, despite their benefits for osteoclast-associated research, these different methods have several drawbacks with respect to differentiation yields, time and animal consumption, storage life of progenitor cells or the limited potential for genetic manipulation of osteoclast precursors. In the present study, we therefore established a novel protocol for the differentiation of osteoclasts from murine ER-Hoxb8-immortalized myeloid stem cells. We isolated and immortalized bone marrow cells from wild type and genetically manipulated mouse lines, optimized protocols for osteoclast differentiation and compared these cells to osteoclasts derived from conventional sources. In vitro generated ER-Hoxb8 osteoclasts displayed typical osteoclast characteristics such as multi-nucleation, tartrate-resistant acid phosphatase staining of supernatants and cells, F-actin ring formation and bone resorption activity. Furthermore, the osteoclast differentiation time course was traced on a gene expression level. Increased expression of osteoclast-specific genes and decreased expression of stem cell marker genes during differentiation of osteoclasts from ER-Hoxb8-immortalized myeloid progenitor cells were detected by gene array and confirmed by semi-quantitative and quantitative RT-PCR approaches. In summary, we established a novel method for the quantitative production of murine bona fide osteoclasts from ER-Hoxb8 stem cells generated from wild type or genetically manipulated mouse lines. These cells represent a standardized and theoretically unlimited source for osteoclast-associated research projects.
Voisard, R; Huber, N; Baur, R; Susa, M; Ickrath, O; Both, A; Koenig, W; Hombach, V
2001-01-01
Activation of nuclear factor-kappaB (NF-kappaB) is one of the key events in early atherosclerosis and restenosis. We hypothesized that tumor necrosis factor-alpha (TNF-alpha) induced and NF-kappaB mediated expression of intercellular adhesion molecule-1 (ICAM-1) can be inhibited by antisense RelA p65 and NF-kappaB1 p50 oligonucleotides (RelA p65 and NF-kappaB1 p50). Smooth muscle cells (SMC) from human coronary plaque material (HCPSMC, plaque material of 52 patients), SMC from the human coronary media (HCMSMC), human endothelial cells (EC) from umbilical veins (HUVEC), and human coronary EC (HCAEC) were successfully isolated (HCPSMC, HUVEC), identified and cultured (HCPSMC, HCMSMC, HUVEC, HCAEC). 12 hrs prior to TNF-alpha stimulus (20 ng/mL, 6 hrs) RelA p65 and NF-kappaB1 p50 (1, 2, 4, 10, 20, and 30 microM) and controls were added for a period of 18 hrs. In HUVEC and HCAEC there was a dose dependent inhibition of ICAM-1 expression after adding of both RelA p65 and NF-kappaB1 p50. No inhibitory effect was seen after incubation of HCMSMC with RelA p65 and NF-kappaB1 p50. A moderate inhibition of ICAM-1 expression was found after simultaneous addition of RelA p65 and NF-kappaB1 p50 to HCPSMC, no inhibitory effect was detected after individual addition of RelA p65 and NF-kappaB1 p50. The data point out that differences exist in the NF-kappaB mediated expression of ICAM-1 between EC and SMC. Experimental antisense strategies directed against RelA p65 and NF-kappaB1 p50 in early atherosclerosis and restenosis are promising in HCAEC but will be confronted with redundant pathways in HCMSMC and HCPSMC.
Measurement of Angle Kappa Using Ultrasound Biomicroscopy and Corneal Topography.
Yeo, Joon Hyung; Moon, Nam Ju; Lee, Jeong Kyu
2017-06-01
To introduce a new convenient and accurate method to measure the angle kappa using ultrasound biomicroscopy (UBM) and corneal topography. Data from 42 eyes (13 males and 29 females) were analyzed in this study. The angle kappa was measured using Orbscan II and calculated with UBM and corneal topography. The angle kappa of the dominant eye was compared with measurements by Orbscan II. The mean patient age was 36.4 ± 13.8 years. The average angle kappa measured by Orbscan II was 3.98° ± 1.12°, while the average angle kappa calculated with UBM and corneal topography was 3.19° ± 1.15°. The difference in angle kappa measured by the two methods was statistically significant (p < 0.001). The two methods showed good reliability (intraclass correlation coefficient, 0.671; p < 0.001). Bland-Altman plots were used to demonstrate the agreement between the two methods. We designed a new method using UBM and corneal topography to calculate the angle kappa. This method is convenient to use and allows for measurement of the angle kappa without an expensive device. © 2017 The Korean Ophthalmological Society
Measurement of Angle Kappa Using Ultrasound Biomicroscopy and Corneal Topography
Yeo, Joon Hyung; Moon, Nam Ju
2017-01-01
Purpose To introduce a new convenient and accurate method to measure the angle kappa using ultrasound biomicroscopy (UBM) and corneal topography. Methods Data from 42 eyes (13 males and 29 females) were analyzed in this study. The angle kappa was measured using Orbscan II and calculated with UBM and corneal topography. The angle kappa of the dominant eye was compared with measurements by Orbscan II. Results The mean patient age was 36.4 ± 13.8 years. The average angle kappa measured by Orbscan II was 3.98° ± 1.12°, while the average angle kappa calculated with UBM and corneal topography was 3.19° ± 1.15°. The difference in angle kappa measured by the two methods was statistically significant (p < 0.001). The two methods showed good reliability (intraclass correlation coefficient, 0.671; p < 0.001). Bland-Altman plots were used to demonstrate the agreement between the two methods. Conclusions We designed a new method using UBM and corneal topography to calculate the angle kappa. This method is convenient to use and allows for measurement of the angle kappa without an expensive device. PMID:28471103
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wei Li; Kwang, Jimmy; Wang Jin
The transcription factor NF-{kappa}B is commonly activated upon virus infection and a key player in the induction and regulation of the host immune response. The present study demonstrated for the first time that porcine circovirus type 2 (PCV2), which is the primary causative agent of an emerging swine disease, postweaning multisystemic wasting syndrome, can activate NF-{kappa}B in PCV2-infected PK15 cells. In PCV2-infected cells, NF-{kappa}B was activated concomitantly with viral replication, which was characterized by increased DNA binding activity, translocation of NF-{kappa}B p65 from the cytoplasm to the nucleus, as well as degradation and phosphorylation of I{kappa}B{alpha} protein. We further demonstratedmore » PCV2-induced activation of NF-{kappa}B and colocalization of p65 nuclear translocation with virus replication in cultured cells. Treatment of cells with CAPE, a selective inhibitor of NF-{kappa}B activation, reduced virus protein expression and progeny production followed by decreasing PCV2-induced apoptotic caspase activity, indicating the involvement of this transcription factor in induction of cell death. Taken together, these data suggest that NF-{kappa}B activation is important for PCV2 replication and contributes to virus-mediated changes in host cells. The results presented here provide a basis for understanding molecular mechanism of PCV2 infection.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ji, Guoping; Liu, Dongxu; Liu, Jing
2010-01-01
p38 MAPK and nuclear factor-B (NF-B) signaling pathways play an indispensable role in the control of skeletal myogenesis. The specific contribution of these signaling pathways to the response of myoblast to the mechanical stimulation and the molecular mechanisms underlying this response remain unresolved. Using an established in vitro model, we now show that p38 MAP kinase activity regulates the transcriptional activation of NF-{kappa}B in response to mechanical stimulation of myoblasts. Furthermore, SB203580 blocked stretch-induced NF-{kappa}B activation during myogenesis, not through down-regulation of degradation of I{kappa}B-{alpha}, and consequent translocation of the p65 subunit of NF-{kappa}B to the nucleus. It is likelymore » that stretch-induced NF-{kappa}B activation by phosphorylation of p65 NF-{kappa}B. Moreover, depletion of p38{alpha} using siRNA significantly reduces stretch-induced phosphorylation of RelA and NF-{kappa}B activity. These results provides the first evidence of a cross-talk between p38 MAPK and NF-{kappa}B signaling pathways during stretch-induced myogenesis, with phosphorylation of RelA being one of the effectors of this promyogenic mechanism. The {alpha} isoform of p38MAP kinase regulates the transcriptional activation of NF-{kappa}B following stimulation with cyclic stretch.« less
TRIM45 negatively regulates NF-{kappa}B-mediated transcription and suppresses cell proliferation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shibata, Mio; Sato, Tomonobu; Department of Pediatrics, Hokkaido University Graduate School of Medicine, Sapporo, Hokkaido 060-8638
2012-06-22
Highlights: Black-Right-Pointing-Pointer NF-{kappa}B plays an important role in cell survival and carcinogenesis. Black-Right-Pointing-Pointer TRIM45 negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription. Black-Right-Pointing-Pointer TRIM45 overexpression suppresses cell growth. Black-Right-Pointing-Pointer TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth. -- Abstract: The NF-{kappa}B signaling pathway plays an important role in cell survival, immunity, inflammation, carcinogenesis, and organogenesis. Activation of NF-{kappa}B is regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. The NF-{kappa}B signaling pathway is activated by two distinct signaling mechanisms and is strictly modulated by the ubiquitin-proteasome system. It has been reported that overexpression of TRIM45, one ofmore » the TRIM family ubiquitin ligases, suppresses transcriptional activities of Elk-1 and AP-1, which are targets of the MAPK signaling pathway. In this study, we showed that TRIM45 also negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription by a luciferase reporter assay and that TRIM45 lacking a RING domain also has an activity to inhibit the NF-{kappa}B signal. Moreover, we found that TRIM45 overexpression suppresses cell growth. These findings suggest that TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth.« less
Guo, Ying; Manatunga, Amita K
2009-03-01
Assessing agreement is often of interest in clinical studies to evaluate the similarity of measurements produced by different raters or methods on the same subjects. We present a modified weighted kappa coefficient to measure agreement between bivariate discrete survival times. The proposed kappa coefficient accommodates censoring by redistributing the mass of censored observations within the grid where the unobserved events may potentially happen. A generalized modified weighted kappa is proposed for multivariate discrete survival times. We estimate the modified kappa coefficients nonparametrically through a multivariate survival function estimator. The asymptotic properties of the kappa estimators are established and the performance of the estimators are examined through simulation studies of bivariate and trivariate survival times. We illustrate the application of the modified kappa coefficient in the presence of censored observations with data from a prostate cancer study.
Loaiza, Brenda; Hernández-Gutierrez, Salomon; Montesinos, Juan Jose; Valverde, Mahara; Rojas, Emilio
2016-02-01
Nuclear transcription factor kappa B (NF-κB) is associated with many types of refractory cancer. However, despite multiple strategies to treat cancer and novel target drugs, multidrug resistance still causes relapses. The best-characterized mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein (P-gp). Because the direct inhibition of this protein is very toxic, other methods of multidrug resistance (MDR) regulation have been proposed. The MDR-1 promoter sequence contains a κB site, which is recognized by NF-κB. The aim of this work was to characterize whether NF-κB modulation changes the response of bone marrow-derived cells (BMDCs) to chemotherapy. We exposed BMDCs to etoposide and doxorubicin, two of the most used antineoplastic drugs. BMDCs presented high tolerance to these drugs, which correlated with high intrinsic P-gp activity and strong protein expression of NF-κB. To determine the mechanism behind the poor sensitivity of BMDCs to chemotherapy, we blocked the activity of the heterodimer protein NF-κB using the pharmacological inhibitor Bay 11-7085 and through the transfection of an adenovirus negative mutant of I kappa B alpha. The multidrug resistance phenotype of BMDCs was reversed by inhibiting the NF-κB pathway, and this change was accompanied by a decrease in P-gp activity. NF-κB is a possible target for improving the antineoplastic response. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.
Coll, Teresa; Alvarez-Guardia, David; Barroso, Emma; Gómez-Foix, Anna Maria; Palomer, Xavier; Laguna, Juan C; Vázquez-Carrera, Manuel
2010-04-01
Elevated plasma free fatty acids cause insulin resistance in skeletal muscle through the activation of a chronic inflammatory process. This process involves nuclear factor (NF)-kappaB activation as a result of diacylglycerol (DAG) accumulation and subsequent protein kinase Ctheta (PKCtheta) phosphorylation. At present, it is unknown whether peroxisome proliferator-activated receptor-delta (PPARdelta) activation prevents fatty acid-induced inflammation and insulin resistance in skeletal muscle cells. In C2C12 skeletal muscle cells, the PPARdelta agonist GW501516 prevented phosphorylation of insulin receptor substrate-1 at Ser(307) and the inhibition of insulin-stimulated Akt phosphorylation caused by exposure to the saturated fatty acid palmitate. This latter effect was reversed by the PPARdelta antagonist GSK0660. Treatment with the PPARdelta agonist enhanced the expression of two well known PPARdelta target genes involved in fatty acid oxidation, carnitine palmitoyltransferase-1 and pyruvate dehydrogenase kinase 4 and increased the phosphorylation of AMP-activated protein kinase, preventing the reduction in fatty acid oxidation caused by palmitate exposure. In agreement with these changes, GW501516 treatment reversed the increase in DAG and PKCtheta activation caused by palmitate. These effects were abolished in the presence of the carnitine palmitoyltransferase-1 inhibitor etomoxir, thereby indicating that increased fatty acid oxidation was involved in the changes observed. Consistent with these findings, PPARdelta activation by GW501516 blocked palmitate-induced NF-kappaB DNA-binding activity. Likewise, drug treatment inhibited the increase in IL-6 expression caused by palmitate in C2C12 and human skeletal muscle cells as well as the protein secretion of this cytokine. These findings indicate that PPARdelta attenuates fatty acid-induced NF-kappaB activation and the subsequent development of insulin resistance in skeletal muscle cells by reducing DAG accumulation. Our results point to PPARdelta activation as a pharmacological target to prevent insulin resistance.
Engidawork, E; Gulesserian, T; Seidl, R; Cairns, N; Lubec, G
2001-01-01
Down syndrome (DS) is a genetic disease that exhibits significant neuropathological parallels with Alzheimer's disease (AD). One of the features of DS, neuronal loss, has been hypothesized to occur as a result of apoptosis. An increasing number of proteins are implicated in apoptosis and several of them were shown to be altered in AD, however, the knowledge in DS is far from complete. To further substantiate the hypothesis that apoptosis is the underlying mechanism for neuronal loss and contribute towards the current knowledge of apoptosis in DS, we analyzed the expression of apoptosis related proteins in frontal cortex and cerebellum of DS by western blot and ELISA techniques. Quantitative analysis revealed a significant increase in DS frontal (P < 0.0001) and cerebellar (P < 0.05) Bim/BOD (Bcl-2 interacting mediator of cell death/Bcl-2 related ovarian death gene), cerebellar Bcl-2 (P < 0.01) as well as p21 (P < 0.05) levels compared to controls. No significant change was detected in Bax, RAIDD (receptor interacting protein (RIP)-associated ICH-1/CED-3-homologus protein with death domain), ZIP (Zipper interacting protein) kinase and NF-kappaB p65 levels in both regions, although frontal cortex levels of RAIDD, Bcl-2 and p21 levels tended to increase. In addition, a 45 kDa truncated form of NF-kappaB p65 displayed a significant elevation (P < 0.05) in DS cerebellum. No significant correlation had been obtained between postmortem interval and level of the proteins analyzed. With regard to age, it was only NF-kappaB p65 that showed significant correlation (r = -0.8964, P = 0.0155, n = 9) in frontal cortex of controls. These findings provide further evidence that apoptosis indeed accounts for the neuronal loss in DS but Bax and RAIDD do not appear to take part in this process.
Effects of temporal variability in ground data collection on classification accuracy
Hoch, G.A.; Cully, J.F.
1999-01-01
This research tested whether the timing of ground data collection can significantly impact the accuracy of land cover classification. Ft. Riley Military Reservation, Kansas, USA was used to test this hypothesis. The U.S. Army's Land Condition Trend Analysis (LCTA) data annually collected at military bases was used to ground truth disturbance patterns. Ground data collected over an entire growing season and data collected one year after the imagery had a kappa statistic of 0.33. When using ground data from only within two weeks of image acquisition the kappa statistic improved to 0.55. Potential sources of this discrepancy are identified. These data demonstrate that there can be significant amounts of land cover change within a narrow time window on military reservations. To accurately conduct land cover classification at military reservations, ground data need to be collected in as narrow a window of time as possible and be closely synchronized with the date of the satellite imagery.
The relationship between kappa and temperature in energetic ion spectra at Jupiter
NASA Technical Reports Server (NTRS)
Collier, Michael R.; Hamilton, D. C.
1995-01-01
A universal energy per charge kappa function fit is simultaneously applied to the spectra of Voyager 2 Low Energy Charged Particle (LECP) proton, helium, oxygen, sulfur, and carbon ions during 33 Jovian plasma sheet crossings from 26 to 160 R(sub J). The fits yield an approximately linear relationship between high energy spectral index, kappa, and core proton temperature of the form kappa (T(sub H)) approximately = eta dot T(sub H) + kappa(sub 0) with eta = 0.080 ke/V, kappa(sub 0) = 2.86, and T(sub H) measured in keV. Core proton temperatures range from 5 to 35 keV with spectral indices ranging from 3 to 6.
Butyrate modulating effects on pro-inflammatory pathways in human intestinal epithelial cells.
Elce, A; Amato, F; Zarrilli, F; Calignano, A; Troncone, R; Castaldo, G; Canani, R B
2017-10-13
Butyrate acts as energy source for intestinal epithelial cells and as key mediator of several immune processes, modulating gene expression mainly through histone deacetylation inhibition. Thanks to these effects, butyrate has been proposed for the treatment of many intestinal diseases. Aim of this study was to investigate the effect of butyrate on the expression of a large series of target genes encoding proteins involved in pro-inflammatory pathways. We performed quantitative real-time-PCR analysis of the expression of 86 genes encoding proteins bearing to pro-inflammatory pathways, before and after butyrate exposure, in primary epithelial cells derived from human small intestine and colon. Butyrate significantly down-regulated the expression of genes involved in inflammatory response, among which nuclear factor kappa beta, interferon-gamma, Toll like 2 receptor and tumour necrosis factor-alpha. Further confirmations of these data, including studies at protein level, would support the use of butyrate as effective therapeutic strategy in intestinal inflammatory disorders.
Addiction, Adolescence, and Innate Immune Gene Induction
Crews, Fulton T.; Vetreno, Ryan Peter
2011-01-01
Repeated drug use/abuse amplifies psychopathology, progressively reducing frontal lobe behavioral control, and cognitive flexibility while simultaneously increasing limbic temporal lobe negative emotionality. The period of adolescence is a neurodevelopmental stage characterized by poor behavioral control as well as strong limbic reward and thrill seeking. Repeated drug abuse and/or stress during this stage increase the risk of addiction and elevate activator innate immune signaling in the brain. Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) is a key glial transcription factor that regulates proinflammatory chemokines, cytokines, oxidases, proteases, and other innate immune genes. Induction of innate brain immune gene expression (e.g., NF-κB) facilitates negative affect, depression-like behaviors, and inhibits hippocampal neurogenesis. In addition, innate immune gene induction alters cortical neurotransmission consistent with loss of behavioral control. Studies with anti-oxidant, anti-inflammatory, and anti-depressant drugs as well as opiate antagonists link persistent innate immune gene expression to key behavioral components of addiction, e.g., negative affect-anxiety and loss of frontal–cortical behavioral control. This review suggests that persistent and progressive changes in innate immune gene expression contribute to the development of addiction. Innate immune genes may represent a novel new target for addiction therapy. PMID:21629837
Some Paradoxical Results for the Quadratically Weighted Kappa
ERIC Educational Resources Information Center
Warrens, Matthijs J.
2012-01-01
The quadratically weighted kappa is the most commonly used weighted kappa statistic for summarizing interrater agreement on an ordinal scale. The paper presents several properties of the quadratically weighted kappa that are paradoxical. For agreement tables with an odd number of categories "n" it is shown that if one of the raters uses the same…
40 CFR 721.10688 - Copper, chloro[tris(2-chloroethyl) phosphite-.kappa.P]-.
Code of Federal Regulations, 2014 CFR
2014-07-01
...) phosphite-.kappa.P]-. 721.10688 Section 721.10688 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Specific Chemical Substances § 721.10688 Copper, chloro[tris(2-chloroethyl) phosphite-.kappa.P]-. (a... copper, chloro[tris(2-chloroethyl) phosphite-.kappa.P]- (PMN P-13-221; CAS No. 24484-01-3) is subject to...
Predicting the Invasion Potential of a Puerto Rican Frog in Hawaii using MODIS Satellite Imagery
NASA Astrophysics Data System (ADS)
Bisrat, S. A.; White, M. A.
2008-12-01
The Puerto Rican coqui frog (Eleutherodactylus coqui, hereafter coqui), which was introduced into Hawaii accidentally via commercial nurseries, is an aggressive invasive species in Hawaii. The coqui threatens Hawaii's unique ecological communities because it predates upon endemic invertebrates, which comprise the large majority of Hawaii's endemic fauna. Coqui frogs also affect real estate valuations because of their loud mating calls. Despite this widespread problem, the potential coqui range in Hawaii is currently unknown, making control and management efforts difficult. We fitted linear discriminant analysis (LDA), logistic regression (LR) via generalized linear models (GLMs), generalized additive models (GAMs), classification trees (CTs), random forests (RF), and support vector machine (SVM) to model the species distribution and map their invasion potential. We used five MODIS satellite imagery-derived biophysical variables as explanatory variables: leaf area index (LAI), fraction of photosynthetically active radiation absorbed by vegetation (FPAR), enhanced vegetation index (EVI), normalized difference vegetation index (NDVI), and land surface temperature (LST) from three MODIS products: MOD11 (LST), MOD13 (LAI and FPAR), and MOD15 (Vegetation Index) (collection 4). We used 2000-2005 MODIS data from Aqua and Terra satellites to generate monthly climatologies for each biophysical variable. We collected presence/absence data from Puerto Rico and Hawaii using a 1 km grid overlaid over the entire islands of Puerto Rico and the Island of Hawaii by sampling every other pixel of the grid intersecting with the road network. We then used the dataset from Puerto Rico to train the six models while the Hawaii dataset was used as a test set. All six models predicted the invasion potential of coqui frogs in Hawaii with a moderate success with mean Kappa value of 0.31, mean area under the curve of receiver operating characteristics (AUC) of 0.75 and mean classification accuracy (CA) of 0.69. RF and SVM outperformed the other classifiers with Kappa value of 0.4, AUC value of 0.79 and CA of 0.71 for RF and Kappa value of 0.4, AUC value of 0.71 and CA value of 0.72 for SVM. These results suggest climate matching between the native and the introduced habitats of coqui frogs is not strong. Further, the results suggest coqui frogs in their introduced habitat are not showing strong niche conservation.
Diameter Effect Curve and Detonation Front Curvature Measurements for ANFO
NASA Astrophysics Data System (ADS)
Catanach, R. A.; Hill, L. G.
2002-07-01
Diameter effect and front curvature measurements are reported for rate stick experiments on commercially available prilled ANFO (ammonium-nitrate/fuel-oil) at ambient temperature. The shots were fired in paper tubes so as to provide minimal confinement. Diameters ranged from 77 mm (approximately failure diameter) to 205 mm, with the tube length being ten diameters in all cases. Each detonation wave shape was fit with an analytic form, from which the local normal velocity Dn, and local total curvature kappa, were generated as a function of radius R, then plotted parametrically to generate a Dn(kappa) function. The observed behavior deviates substantially from that of previous explosives, for which curves for different diameters overlay well for small kappa but diverge for large kappa, and for which kappa increases monotonically with R. For ANFO, we find that Dn(kappa) curves for individual sticks 1) show little or no overlap--with smaller sticks lying to the right of larger ones, 2) exhibit a large velocity deficit with little kappa variation, and 3) reach a peak kappa at an intermediate R.
BFV activates the NF-kappaB pathway through its transactivator (BTas) to enhance viral transcription
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Jian; Tan Juan; Zhang Xihui
2010-05-10
Multiple families of viruses have evolved sophisticated strategies to regulate nuclear factor-kappaB (NF-kappaB) signaling, which plays a pivotal role in diverse cellular events, including virus-host interactions. In this study, we report that bovine foamy virus (BFV) is able to activate the NF-kappaB pathway through the action of its transactivator, BTas. Both cellular IKKbeta and IkappaBalpha also participate in this activation. In addition, we demonstrate that BTas induces the processing of p100, which implies that BTas can activate NF-kappaB through a noncanonical pathway as well. Co-immunoprecipitation analysis shows that BTas interacts with IKK catalytic subunits (IKKalpha and IKKbeta), which may bemore » responsible for regulation of IKK kinase activity and persistent NF-kappaB activation. Furthermore, our results indicate that the level of BTas-mediated LTR transcription correlates with the activity of cellular NF-kappaB. Together, this study suggests that BFV activates the NF-kappaB pathway through BTas to enhance viral transcription.« less
Wang, Jian; Tan, Juan; Zhang, Xihui; Guo, Hongyan; Zhang, Qicheng; Guo, Tingting; Geng, Yunqi; Qiao, Wentao
2010-05-10
Multiple families of viruses have evolved sophisticated strategies to regulate nuclear factor-kappaB (NF-kappaB) signaling, which plays a pivotal role in diverse cellular events, including virus-host interactions. In this study, we report that bovine foamy virus (BFV) is able to activate the NF-kappaB pathway through the action of its transactivator, BTas. Both cellular IKKbeta and IkappaBalpha also participate in this activation. In addition, we demonstrate that BTas induces the processing of p100, which implies that BTas can activate NF-kappaB through a noncanonical pathway as well. Co-immunoprecipitation analysis shows that BTas interacts with IKK catalytic subunits (IKKalpha and IKKbeta), which may be responsible for regulation of IKK kinase activity and persistent NF-kappaB activation. Furthermore, our results indicate that the level of BTas-mediated LTR transcription correlates with the activity of cellular NF-kappaB. Together, this study suggests that BFV activates the NF-kappaB pathway through BTas to enhance viral transcription. Copyright 2010 Elsevier Inc. All rights reserved.
The PI3K p110delta is required for down-regulation of RAG expression in immature B cells.
Llorian, Miriam; Stamataki, Zania; Hill, Susan; Turner, Martin; Mårtensson, Inga-Lill
2007-02-15
At the immature B cell stage the BCR signals the down-regulation of the RAG genes and Ig L chain (LC) allelic and isotype exclusion. The signaling pathway that regulates these events is poorly characterized. We demonstrate that immature B cells from mice deficient in the PI3K catalytic subunit p110delta fail to suppress RAG expression and inappropriately recombine kappa and lambda LC loci. In addition, in the presence of the autoantigen, clonal deletion and receptor editing still takes place, demonstrating that these processes are independent of p110delta. These results demonstrate a role for p110delta in the regulation of RAG gene expression and thereby LC allelic/isotype exclusion.
Mitochondria mediate tumor necrosis factor-alpha/NF-kappaB signaling in skeletal muscle myotubes
NASA Technical Reports Server (NTRS)
Li, Y. P.; Atkins, C. M.; Sweatt, J. D.; Reid, M. B.; Hamilton, S. L. (Principal Investigator)
1999-01-01
Tumor necrosis factor-alpha (TNF-alpha) is implicated in muscle atrophy and weakness associated with a variety of chronic diseases. Recently, we reported that TNF-alpha directly induces muscle protein degradation in differentiated skeletal muscle myotubes, where it rapidly activates nuclear factor kappaB (NF-kappaB). We also have found that protein loss induced by TNF-alpha is NF-kappaB dependent. In the present study, we analyzed the signaling pathway by which TNF-alpha activates NF-kappaB in myotubes differentiated from C2C12 and rat primary myoblasts. We found that activation of NF-kappaB by TNF-alpha was blocked by rotenone or amytal, inhibitors of complex I of the mitochondrial respiratory chain. On the other hand, antimycin A, an inhibitor of complex III, enhanced TNF-alpha activation of NK-kappaB. These results suggest a key role of mitochondria-derived reactive oxygen species (ROS) in mediating NF-kappaB activation in muscle. In addition, we found that TNF-alpha stimulated protein kinase C (PKC) activity. However, other signal transduction mediators including ceramide, Ca2+, phospholipase A2 (PLA2), and nitric oxide (NO) do not appear to be involved in the activation of NF-kappaB.
Casein expression in cytotoxic T lymphocytes.
Grusby, M J; Mitchell, S C; Nabavi, N; Glimcher, L H
1990-01-01
A cDNA that expresses a mRNA restricted to cytotoxic T lymphocytes (CTL) and mammary tissue has been isolated and characterized. The deduced amino acid sequence from this cDNA shows extensive homology with the previously reported amino acid sequence for rat alpha-casein. Indeed, the presence of a six-residue-repeated motif that is specific for rodent alpha-caseins strongly supports the identification of this cDNA as mouse alpha-casein. Northern (RNA) blot analysis of many hematopoietic cell types revealed that this gene is restricted to CTL, being expressed in four of six CTL lines examined. Furthermore, CTL that express this gene were also found to express other members of the casein gene family, such as beta- and kappa-casein. These results suggest that caseins may be important in CTL function, and their potential role in CTL-mediated lysis is discussed. Images PMID:2395885
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kweon, Soo-Mi; Wang, Beinan; Rixter, Davida
2006-12-15
In review of the past studies on NF-{kappa}B regulation, most of them have focused on investigating how NF-{kappa}B is activated by a single inducer at a time. Given the fact that, in mixed bacterial infections in vivo, multiple inflammation inducers, including both nontypeable Haemophilus influenzae (NTHi) and Streptococcus pneumoniae, are present simultaneously, a key issue that has yet to be addressed is whether NTHi and S. pneumoniae simultaneously activate NF-{kappa}B and the subsequent inflammatory response in a synergistic manner. Here, we show that NTHi and S. pneumoniae synergistically induce NF-{kappa}B-dependent inflammatory response via activation of multiple signaling pathways in vitromore » and in vivo. The classical IKK{beta}-I{kappa}B{alpha} and p38 MAPK pathways are involved in synergistic activation of NF-{kappa}B via two distinct mechanisms, p65 nuclear translocation-dependent and -independent mechanisms. Moreover, casein kinase 2 (CK2) is involved in synergistic induction of NF-{kappa}B via a mechanism dependent on phosphorylation of p65 at both Ser536 and Ser276 sites. These studies bring new insights into the molecular mechanisms underlying the NF-{kappa}B-dependent inflammatory response in polymicrobial infections and may lead to development of novel therapeutic strategies for modulating inflammation in mixed infections for patients with otitis media and chronic obstructive pulmonary diseases.« less
Uffort, Deon G; Grimm, Elizabeth A; Ellerhorst, Julie A
2009-01-01
Tumor expression of inducible nitric oxide synthase (iNOS) predicts poor outcomes for melanoma patients. We have reported the regulation of melanoma iNOS by the mitogen-activated protein kinase (MAPK) pathway. In this study, we test the hypothesis that NF-kappaB mediates this regulation. Western blotting of melanoma cell lysates confirmed the constitutive expression of iNOS. Western blot detected baseline levels of activated nuclear extracellular signal-regulated kinase and NF-kappaB. Indirect immunofluorescence confirmed the presence of NF-kappaB p50 and p65 in melanoma cell nuclei, with p50 being more prevalent. Electrophoretic mobility shift assay demonstrated baseline NF-kappaB activity, the findings confirmed by supershift analysis. Treatment of melanoma cells with the MEK inhibitor U0126 decreased NF-kappaB binding to its DNA recognition sequence, implicating the MAPK pathway in NF-kappaB activation. Two specific NF-kappaB inhibitors suppressed iNOS expression, demonstrating regulation of iNOS by NF-kappaB. Several experiments indicated the presence of p50 homodimers, which lack a transactivation domain and rely on the transcriptional coactivator Bcl-3 to carry out this function. Bcl-3 was detected in melanoma cells and co-immunoprecipitated with p50. These data suggest that the constitutively activated melanoma MAPK pathway stimulates activation of NF-kappaB hetero- and homodimers, which, in turn, drive iNOS expression and support melanoma tumorigenesis.
Prospective assessment of interobserver agreement for defecography in fecal incontinence.
Dobben, Annette C; Wiersma, Tjeerd G; Janssen, Lucas W M; de Vos, Rien; Terra, Maaike P; Baeten, Cor G; Stoker, Jaap
2005-11-01
The primary aim of our study was to determine the interobserver agreement of defecography in diagnosing enterocele, anterior rectocele, intussusception, and anismus in fecal-incontinent patients. The subsidiary aim was to evaluate the influence of level of experience on interpreting defecography. Defecography was performed in 105 consecutive fecal-incontinent patients. Observers were classified by level of experience and their findings were compared with the findings of an expert radiologist. The quality of the expert radiologist's findings was evaluated by an intraobserver agreement procedure. Intraobserver agreement was good to very good except for anismus: incomplete evacuation after 30 sec (kappa, 0.55) and puborectalis impression (kappa, 0.54). Interobserver agreement for enterocele and rectocele was good (kappa, 0.66 for both) and for intussusception, fair (kappa, 0.29). Interobserver agreement for anismus: incomplete evacuation after 30 sec was moderate (kappa, 0.47), and for anismus: puborectalis impression was fair (kappa, 0.24). Agreement in grading of enterocele and rectocele was good (kappa, 0.64 and 0.72, respectively) and for intussusception, fair (kappa, 0.39). Agreement separated by experience level was very good for rectocele (kappa, 0.83) and grading of rectoceles (kappa, 0.83) and moderate for intussusception (kappa, 0.44) at the most experienced level. For enterocele and grading, experience level did not influence the reproducibility. Reproducibility for enterocele, anterior rectocele, and severity grading is good, but for intussusception is fair to moderate. For anismus, the diagnosis of incomplete evacuation after 30 sec is more reproducible than puborectalis impression. The level of experience seems to play a role in diagnosing anterior rectocele and its grading and in diagnosing intussusception.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Jae Ryoung; Huh, Jae Ho; Lee, Yoonna
2011-02-25
Research highlights: {yields} Binding assays demonstrated that secreted- and cellular-IGFBP-5 interacted with TNFR1. {yields} The interaction between IGFBP-5 and TNFR1 was inhibited by TNF-{alpha} and was blocked TNF-{alpha}-activated NF-{kappa}B activity. {yields} IGFBP-5 interacted with TNFR1 through its N- and L-domains but the binding of L-domain to TNFR1 was blocked by TNF-{alpha}. {yields} Competition between the L-domain of IGFBP-5 and TNF-{alpha} blocked TNF-{alpha}-induced NF-{kappa}B activity. {yields} This study suggests that the L-domain of IGFBP-5 is a novel TNFR1 ligand that functions as a competitive TNF-{alpha} inhibitor. -- Abstract: IGFBP-5 is known to be involved in various cell phenomena such as proliferation,more » differentiation, and apoptosis. However, the exact mechanisms by which IGFBP-5 exerts its functions are unclear. In this study, we demonstrate for the first time that IGFBP-5 is a TNFR1-interacting protein. We found that ectopic expression of IGFBP-5 induced TNFR1 gene expression, and that IGFBP-5 interacted with TNFR1 in both an in vivo and an in vitro system. Secreted IGFBP-5 interacted with GST-TNFR1 and this interaction was blocked by TNF-{alpha}, demonstrating that IGFBP-5 might be a TNFR1 ligand. Furthermore, conditioned media containing secreted IGFBP-5 inhibited PMA-induced NF-{kappa}B activity and IL-6 expression in U-937 cells. Coimmunoprecipitation assays of TNFR1 and IGFBP-5 wild-type and truncation mutants revealed that IGFBP-5 interacts with TNFR1 through its N- and L-domains. However, only the interaction between the L-domain of IGFBP-5 and TNFR1 was blocked by TNF-{alpha} in a dose-dependent manner, suggesting that the L-domain of IGFBP-5 can function as a TNFR1 ligand. Competition between the L-domain of IGFBP-5 and TNF-{alpha} resulted in inhibition of TNF-{alpha}-induced NF-{kappa}{Beta} activity. Taken together, our results suggest that the L-domain of IGFBP-5 is a novel TNFR1 ligand that functions as a competitive TNF-{alpha} inhibitor.« less
Agbottah, Emmanuel; Yeh, Wen-I; Berro, Reem; Klase, Zachary; Pedati, Caitlin; Kehn-Hall, Kyleen; Wu, Weilin; Kashanchi, Fatah
2008-06-10
Human T-cell leukemia virus type-1 (HTLV-1) induces adult T-cell leukemia/lymphoma (ATL/L), a fatal lymphoproliferative disorder, and HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), a chronic progressive disease of the central nervous system after a long period of latent infection. Although the mechanism of transformation and leukemogenesis is not fully elucidated, there is evidence to suggest that the viral oncoprotein Tax plays a crucial role in these processes through the regulation of several pathways including NF-kappaB and the cell cycle pathways. The observation that NF-kappaB, which is strongly induced by Tax, is indispensable for the maintenance of the malignant phenotype of HTLV-1 by regulating the expression of various genes involved in cell cycle regulation and inhibition of apoptosis provides a possible molecular target for these infected cells. To develop potential new therapeutic strategies for HTLV-1 infected cells, in this present study, we initially screened a battery of NF-kappaB and CDK inhibitors (total of 35 compounds) to examine their effects on the growth and survival of infected T-cell lines. Two drugs namely BMS-345541 and Purvalanol A exhibited higher levels of growth inhibition and apoptosis in infected cell as compared to uninfected cells. BMS-345541 inhibited IKKbeta kinase activity from HTLV-1 infected cells with an IC50 (the 50% of inhibitory concentration) value of 50 nM compared to 500 nM from control cells as measured by in vitro kinase assays. The effects of Purvalanol A were associated with suppression of CDK2/cyclin E complex activity as previously shown by us. Combination of both BMS-345541 and Purvalanol A showed a reduced level of HTLV-1 p19 Gag production in cell culture. The apparent apoptosis in these infected cells were associated with increased caspase-3 activity and PARP cleavage. The potent and selective apoptotic effects of these drugs suggest that both BMS-345541 and Purvalanol A, which target both NF-kappaB and CDK complex and the G1/S border, might be promising new agents in the treatment of these infected patients.
Involvement of nuclear factor {kappa}B in platelet CD40 signaling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hachem, Ahmed; Yacoub, Daniel; Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1
Highlights: Black-Right-Pointing-Pointer sCD40L induces TRAF2 association to CD40 and NF-{kappa}B activation in platelets. Black-Right-Pointing-Pointer I{kappa}B{alpha} phosphorylation downstream of CD40L/CD40 signaling is independent of p38 MAPK phosphorylation. Black-Right-Pointing-Pointer I{kappa}B{alpha} is required for sCD40L-induced platelet activation and potentiation of aggregation. -- Abstract: CD40 ligand (CD40L) is a thrombo-inflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40L (sCD40L), which has been shown to potentiate platelet activation and aggregation, in a CD40-dependent manner, via p38 mitogen activated protein kinase (MAPK) and Rac1 signaling. In many cells, the CD40L/CD40 dyad also induces activation of nuclear factor kappa B (NF-{kappa}B). Givenmore » that platelets contain NF-{kappa}B, we hypothesized that it may be involved in platelet CD40 signaling and function. In human platelets, sCD40L induces association of CD40 with its adaptor protein the tumor necrosis factor receptor associated factor 2 and triggers phosphorylation of I{kappa}B{alpha}, which are abolished by CD40L blockade. Inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced I{kappa}B{alpha} phosphorylation without affecting p38 MAPK phosphorylation. On the other hand, inhibition of p38 MAPK phosphorylation has no effect on I{kappa}B{alpha} phosphorylation, indicating a divergence in the signaling pathway originating from CD40 upon its ligation. In functional studies, inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced platelet activation and potentiation of platelet aggregation in response to a sub-threshold concentration of collagen. This study demonstrates that the sCD40L/CD40 axis triggers NF-{kappa}B activation in platelets. This signaling pathway plays a critical role in platelet activation and aggregation upon sCD40L stimulation and may represent an important target against thrombo-inflammatory disorders.« less
Kabir, S E; Alam, J; Ghosh, S; Kundu, K; Hogarth, G; Tocher, D A; Hossain, G M G; Roesky, H W
2009-06-21
Reactions of M(2)(CO)(10) (M = Re, Mn) with pyrimidine-2-thiol (pymSH) in the presence of Me(3)NO afford the tetranuclear square-type complexes [M(4)(CO)(12)(micro-kappa(3)-pymS)(4)] (, M = Re; , M = Mn). Both consist of four M(CO)(3) (M = Re, Mn) units, pairs of which are joined by tridentate pyrimidine-2-thiolate ligands. Treatment of with a variety of donor ligands results in cleavage of the square to afford mononuclear species with either a mono- or bidentate pyrimidine-2-thiolate ligand. Triphenylphosphine reacts with to give [Mn(CO)(3)(PPh(3))(kappa(2)-pymS)] () in which the pyrimidine-2-thiolate coordinates in a bidentate fashion. With diamines [M(CO)(3)(kappa(2)-L)(kappa(1)-pymS)] () (M = Re, Mn; L = 2,2'- bipy, 1,10-phen, en) result in which the pyrimidine-2-thiolate binds in a monodentate fashion through sulfur. With diphosphines, complexes with different stoichiometries and pyrimidine-2-thiolate binding modes are obtained depending on the nature of the metal and diphosphine. With dppm and dppe, gives [Re(CO)(2)(kappa(1)-pymS)(kappa(2)-dppm)] () and [Re(CO)(2)(kappa(2)-pymS)(kappa(1)-dppe)(2)] (), respectively, whereas affords [Mn(CO)(2)(kappa(2)-pymS)(kappa(1)-dppm)(2)] () and [Mn(CO)(2)(kappa(2)-pyS)(kappa(2)-dppe)] () under similar conditions. Reactions of with [Os(3)(CO)(10)(NCMe)(2)] affords mixed-metal butterfly clusters [MOs(3)(CO)(13)(micro(3)-kappa(2)-pymS)] () in which the group 7 metal occupies a wing-tip position and the pyrimidine-2-thiolate ligand caps a triangular Os(2)M face. With Ru(3)(CO)(12), carbon-sulfur bond cleavage occurs to give the tetranuclear clusters [MRu(3)(CO)(14)(micro(4)-S)(micro-kappa(1):eta(1)-pym)] () bearing both the extruded sulfur and the heterocyclic ring. The molecular structures of , and have been established by X-ray diffraction allowing the binding mode of the pyrimidine-2-thiolate ligands to be probed.
Comparison of three methods to assess individual skeletal maturity.
Pasciuti, Enzo; Franchi, Lorenzo; Baccetti, Tiziano; Milani, Silvano; Farronato, Giampietro
2013-09-01
The knowledge of facial growth and development is fundamental to determine the optimal timing for different treatment procedures in the growing patient. To analyze the reproducibility of three methods in assessing individual skeletal maturity, and to evaluate any degree of concordance among them. In all, 100 growing subjects were enrolled to test three methods: the hand-wrist, cervical vertebral maturation (CVM), and medial phalanges of the third finger method (MP3). Four operators determined the skeletal maturity of the subjects to evaluate the reproducibility of each method. After 30 days the operators repeated the analysis to assess the repeatability of each method. Finally, one operator examined all subjects' radiographs to detect any concordance among the three methods. The weighted kappa values for inter-operator variability were 0.94, 0.91, and 0.90, for the WRI, CVM, and MP3 methods, respectively. The weighted kappa values for intra-operator variability were 0.92, 0.91, and 0.92, for the WRI, CVM, and MP3 methods, respectively. The three methods revealed a high degree of repeatability and reproducibility. Complete agreement among the three methods was observed in 70% of the analyzed samples. The CVM method has the advantage of not necessitating an additional radiograph. The MP3 method is a simple and practical alternative as it requires only a standard dental x-ray device.
40 CFR 721.10033 - Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-. 721.10033 Section 721.10033 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.1003...
40 CFR 721.10033 - Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-. 721.10033 Section 721.10033 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.1003...
40 CFR 721.10033 - Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Zinc, [ethanedioato(2-)-. kappa. O1, . kappa. O2]-. 721.10033 Section 721.10033 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT SIGNIFICANT NEW USES OF CHEMICAL SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.1003...
Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls.
Baud, Véronique; Karin, Michael
2009-01-01
Nuclear factor kappaB (NF-kappaB) transcription factors have a key role in many physiological processes such as innate and adaptive immune responses, cell proliferation, cell death, and inflammation. It has become clear that aberrant regulation of NF-kappaB and the signalling pathways that control its activity are involved in cancer development and progression, as well as in resistance to chemotherapy and radiotherapy. This article discusses recent evidence from cancer genetics and cancer genome studies that support the involvement of NF-kappaB in human cancer, particularly in multiple myeloma. The therapeutic potential and benefit of targeting NF-kappaB in cancer, and the possible complications and pitfalls of such an approach, are explored.
Nonplanar ion acoustic waves with kappa-distributed electrons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, Biswajit
2011-06-15
Using the standard reductive perturbation technique, nonlinear cylindrical and spherical Kadomtsev-Petviashvili equations are derived for the propagation of ion acoustic solitary waves in an unmagnetized collisionless plasma with kappa distributed electrons and warm ions. The influence of kappa-distributed electrons and the effects caused by the transverse perturbation on cylindrical and spherical ion acoustic waves (IAWs) are investigated. It is observed that increase in the kappa distributed electrons (i.e., decreasing {kappa}) decreases the amplitude of the solitary electrostatic potential structures. The numerical results are presented to understand the formation of ion acoustic solitary waves with kappa-distributed electrons in nonplanar geometry. Themore » present investigation may have relevance in the study of propagation of IAWs in space and laboratory plasmas.« less
Nonequilibrium approach regarding metals from a linearised kappa distribution
NASA Astrophysics Data System (ADS)
Domenech-Garret, J. L.
2017-10-01
The widely used kappa distribution functions develop high-energy tails through an adjustable kappa parameter. The aim of this work is to show that such a parameter can itself be regarded as a function, which entangles information about the sources of disequilibrium. We first derive and analyse an expanded Fermi-Dirac kappa distribution. Later, we use this expanded form to obtain an explicit analytical expression for the kappa parameter of a heated metal on which an external electric field is applied. We show that such a kappa index causes departures from equilibrium depending on the physical magnitudes. Finally, we study the role of temperature and electric field on such a parameter, which characterises the electron population of a metal out of equilibrium.
Lawton, Samantha J; Weis, Allison M; Byrne, Barbara A; Fritz, Heather; Taff, Conor C; Townsend, Andrea K; Weimer, Bart C; Mete, Aslı; Wheeler, Sarah; Boyce, Walter M
2018-05-01
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was compared to conventional biochemical testing methods and nucleic acid analyses (16S rDNA sequencing, hippurate hydrolysis gene testing, whole genome sequencing [WGS]) for species identification of Campylobacter isolates obtained from chickens ( Gallus gallus domesticus, n = 8), American crows ( Corvus brachyrhynchos, n = 17), a mallard duck ( Anas platyrhynchos, n = 1), and a western scrub-jay ( Aphelocoma californica, n = 1). The test results for all 27 isolates were in 100% agreement between MALDI-TOF MS, the combined results of 16S rDNA sequencing, and the hippurate hydrolysis gene PCR ( p = 0.0027, kappa = 1). Likewise, the identifications derived from WGS from a subset of 14 isolates were in 100% agreement with the MALDI-TOF MS identification. In contrast, biochemical testing misclassified 5 isolates of C. jejuni as C. coli, and 16S rDNA sequencing alone was not able to differentiate between C. coli and C. jejuni for 11 sequences ( p = 0.1573, kappa = 0.0857) when compared to MALDI-TOF MS and WGS. No agreement was observed between MALDI-TOF MS dendrograms and the phylogenetic relationships revealed by rDNA sequencing or WGS. Our results confirm that MALDI-TOF MS is a fast and reliable method for identifying Campylobacter isolates to the species level from wild birds and chickens, but not for elucidating phylogenetic relationships among Campylobacter isolates.
Ugur, Muzeyyen; Kaya, Egemen; Gozen, Oguz; Koylu, Ersin O; Kanit, Lutfiye; Keser, Aysegul; Balkan, Burcu
2017-09-01
Delta and kappa opioid receptors (DOR and KOR, respectively) and their endogenous ligands, proenkephalin (PENK) and prodynorphin (PDYN)-derived opioid peptides are proposed as important mediators of nicotine reward. This study investigated the regulatory effect of chronic nicotine treatment on the gene expression of DOR, KOR, PENK and PDYN in the mesocorticolimbic system. Three groups of rats were injected subcutaneously with nicotine at doses of 0.2, 0.4, or 0.6 mg/kg/day for 6 days. Rats were decapitated 1 hr after the last dose on day six, as this timing coincides with increased dopamine release in the mesocorticolimbic system. mRNA levels in the ventral tegmental area (VTA), lateral hypothalamic area (LHA), amygdala (AMG), dorsal striatum (DST), nucleus accumbens, and medial prefrontal cortex were measured by quantitative real-time PCR. Our results showed that nicotine upregulated DOR mRNA in the VTA at all of the doses employed, in the AMG at the 0.4 and 0.6 mg/kg doses, and in the DST at the 0.4 mg/kg dose. Conversely, PDYN mRNA was reduced in the LHA with 0.6 mg/kg nicotine and in the AMG with 0.4 mg/kg nicotine. KOR mRNA was also decreased in the DST with 0.6 mg/kg nicotine. Nicotine did not regulate PENK mRNA in any brain region studied. © 2017 Wiley Periodicals, Inc.
MyD88 expression in the rat dental follicle: Implications for osteoclastogenesis and tooth eruption
Liu, Dawen; Yao, Shaomian; Wise, Gary E.
2010-01-01
Myeloid differentiation factor 88 (MyD88) is a key adaptor molecule in the interleukin-1 (IL-1) and IL-18 Toll-like receptor signaling pathway. Because it is present in dental follicle (DF) cells in vitro, the purpose of this study was to determine its chronological expression in vivo, as well as its possible role in osteoclastogenesis and tooth eruption. An oligo DNA microarray was used to determine gene expression of MyD88 in vivo in the DFs from the first mandibular molars of postnatal rats from days 1–11. The results showed that MyD88 was expressed maximally at day 3. Using siRNA to knock down MyD88 expression in the DF cells also reduced the gene expression of nuclear factor-kappa B-1 (NFKB1) and monocyte chemoattractant protein 1 (MCP-1). IL-1α up-regulated the expression of NFKB1, MCP-1 and receptor activator of nuclear factor kappa B ligand (RANKL), but knockdown of MyD88 nullified this IL-1α effect. Conditioned medium from DF cells with MyD88 knocked down reduced chemotactic activity for mononuclear cells and reduced osteoclastogenesis as opposed to controls. In conclusion, the maximal expression of MyD88 at day 3 in the DF may contribute to the major burst of osteoclastogenesis needed for eruption by up-regulating MCP-1 and RANKL expression. PMID:20662905
Assar, Emelia A; Vidalle, Magdalena Castellano; Chopra, Mridula; Hafizi, Sassan
2016-07-01
We studied the effect of the potent dietary antioxidant lycopene on multiple points along the nuclear factor kappa B (NF-κB) signaling pathway in prostate and breast cancer cells. Lycopene significantly inhibited prostate and breast cancer cell growth at physiologically relevant concentrations of ≥1.25 μM. Similar concentrations also caused a 30-40 % reduction in inhibitor of kappa B (IκB) phosphorylation in the cells, as determined by western blotting. Furthermore, the same degree of inhibition by lycopene was observed for NF-κB transcriptional activity, as determined by reporter gene assay. Concomitant with this, immunofluorescence staining of lycopene-treated cells showed a significant suppression (≥25 %) of TNF-induced NF-κB p65 subunit nuclear translocation. Further probing of lycopene's effects on upstream elements of the NF-κB pathway showed a 25 % inhibition of both activity of recombinant IκB kinase β (IKKβ) kinase in a cell-free in vitro assay, as well as activity of IKKβ immunoprecipitated from MDA-MB-231 cells treated with lycopene. In conclusion, the anticancer properties of lycopene may occur through inhibition of the NF-κB signaling pathway, beginning at the early stage of cytoplasmic IKK kinase activity, which then leads to reduced NF-κB-responsive gene regulation. Furthermore, these effects in cancer cells were observed at concentrations of lycopene that are relevant and achievable in vivo.
GARNET--gene set analysis with exploration of annotation relations.
Rho, Kyoohyoung; Kim, Bumjin; Jang, Youngjun; Lee, Sanghyun; Bae, Taejeong; Seo, Jihae; Seo, Chaehwa; Lee, Jihyun; Kang, Hyunjung; Yu, Ungsik; Kim, Sunghoon; Lee, Sanghyuk; Kim, Wan Kyu
2011-02-15
Gene set analysis is a powerful method of deducing biological meaning for an a priori defined set of genes. Numerous tools have been developed to test statistical enrichment or depletion in specific pathways or gene ontology (GO) terms. Major difficulties towards biological interpretation are integrating diverse types of annotation categories and exploring the relationships between annotation terms of similar information. GARNET (Gene Annotation Relationship NEtwork Tools) is an integrative platform for gene set analysis with many novel features. It includes tools for retrieval of genes from annotation database, statistical analysis & visualization of annotation relationships, and managing gene sets. In an effort to allow access to a full spectrum of amassed biological knowledge, we have integrated a variety of annotation data that include the GO, domain, disease, drug, chromosomal location, and custom-defined annotations. Diverse types of molecular networks (pathways, transcription and microRNA regulations, protein-protein interaction) are also included. The pair-wise relationship between annotation gene sets was calculated using kappa statistics. GARNET consists of three modules--gene set manager, gene set analysis and gene set retrieval, which are tightly integrated to provide virtually automatic analysis for gene sets. A dedicated viewer for annotation network has been developed to facilitate exploration of the related annotations. GARNET (gene annotation relationship network tools) is an integrative platform for diverse types of gene set analysis, where complex relationships among gene annotations can be easily explored with an intuitive network visualization tool (http://garnet.isysbio.org/ or http://ercsb.ewha.ac.kr/garnet/).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benyhe, S.; Varga, E.; Hepp, J.
1990-09-01
The distribution and properties of frog brain kappa-opioid receptor subtypes differ not only from those of the guinea pig brain, but also from that of the rat brain. In guinea pig cerebellum the kappa 1 is the dominant receptor subtype, frog brain contains mainly the kappa 2 subtype, and the distribution of the rat brain subtypes is intermediate between the two others. In competition experiments it has been established that ethylketocyclazocine and N-cyclopropylmethyl-norazidomorphine, which are nonselective kappa-ligands, have relatively high affinities to frog brain membranes. The kappa 2 ligands (Met5)enkephalin-Arg6-Phe7 and etorphine also show high affinities to the frog brain.more » Kappa 1 binding sites measured in the presence of 5 microM/D-Ala2-Leu5/enkephalin represent 25-30% of (3H)ethylketocyclazocine binding in frog brain membranes. The kappa 2 subtype in frog brain resembles more to the mu subtype than the delta subtype of opioid receptors, but it differs from the mu subtype in displaying low affinity toward beta-endorphin and /D-Ala2-(Me)Phe4-Gly5-ol/enkephalin (DAGO). From our data it is evident that the opioid receptor subtypes are already present in the amphibian brain but the differences among them are less pronounced than in mammalian brain.« less
Zipoli, V; Portaccio, E; Siracusa, G; Pracucci, G; Sorbi, S; Amato, M P
2003-10-01
We assessed the interobserver agreement on the diagnosis of multiple sclerosis (MS) in a study sample consisting of 41 MS (15 relapsing remitting, two secondary progressive, five primary progressive and 19 presenting their first clinical attack) and three non-MS cases. Clinical and paraclinical information was recorded in standardized forms. Four neurologists were asked to make a diagnosis using Poser's and McDonald's criteria and to assess MRI scans according to the McDonald's guidelines. In terms of the kappa statistic (kappa), we found a moderate agreement on the overall diagnosis using both Poser's and McDonald's criteria (kappa, respectively 0.57 and 0.52). As for distinct diagnostic categories, we observed a moderate to substantial agreement for the three McDonald categories (range of kappa values 0.49-0.64) and a fair to substantial agreement for the nine Poser categories (range of kappa values 0.37-0.67). Taking into account clinical information, the agreement on dissemination over time was substantially higher (kappa = 0.69) than that found on dissemination over space (kappa = 0.46). In contrast, for MRI assessment, the agreement for spatial dissemination was substantial (kappa = 0.74) compared with the fair agreement (kappa = 0.25) yielded by dissemination over time. The new McDonald's criteria yield a good overall diagnostic reliability, and compare favourably with Poser's classification in terms of agreement on distinct diagnostic categories.
Kappa-Electrons Downstream of the Solar Wind Termination Shock
NASA Astrophysics Data System (ADS)
Fahr, H. J.
2017-12-01
A theoretical description of the solar wind electron distribution function downstream of the termination shock under the influence of the shock-induced injection of overshooting KeV-energetic electrons will be presented. A kinetic phasespace transport equation in the bulk frame of the heliosheath plasma flow is developed for the solar wind electrons, taking into account shock-induced electron injection, convective changes, magnetic cooling processes and whistler wave-induced energy diffusion. Assuming that the local electron distribution under the prevailing Non-LTE conditions can be represented by a local kappa function with a local kappa parameter that varies with the streamline coordinates, we determine the parameters of the resulting, initial kappa distribution for the downstream electrons. From this initial function spectral electron fluxes can be derived and can be compared with those measured by the VOYAGER-1 spacecraft in the range between 40 to 70 KeV. It can then be shown that with kappa values around kappa = 6 one can in fact fit these data very satisfactorily. In addition it is shown that for isentropic electron flows kappa-distributed electrons have to undergo simultaneous changes of both parameters, i.e. kappa and theta, of the electron kappa function. It is also shown then that under the influence of energy sinks and sources the electron flux becomes non-isentropic with electron entropies changing along the streamline.
Gene expression variability in human hepatic drug metabolizing enzymes and transporters.
Yang, Lun; Price, Elvin T; Chang, Ching-Wei; Li, Yan; Huang, Ying; Guo, Li-Wu; Guo, Yongli; Kaput, Jim; Shi, Leming; Ning, Baitang
2013-01-01
Interindividual variability in the expression of drug-metabolizing enzymes and transporters (DMETs) in human liver may contribute to interindividual differences in drug efficacy and adverse reactions. Published studies that analyzed variability in the expression of DMET genes were limited by sample sizes and the number of genes profiled. We systematically analyzed the expression of 374 DMETs from a microarray data set consisting of gene expression profiles derived from 427 human liver samples. The standard deviation of interindividual expression for DMET genes was much higher than that for non-DMET genes. The 20 DMET genes with the largest variability in the expression provided examples of the interindividual variation. Gene expression data were also analyzed using network analysis methods, which delineates the similarities of biological functionalities and regulation mechanisms for these highly variable DMET genes. Expression variability of human hepatic DMET genes may affect drug-gene interactions and disease susceptibility, with concomitant clinical implications.
Nomogram for sample size calculation on a straightforward basis for the kappa statistic.
Hong, Hyunsook; Choi, Yunhee; Hahn, Seokyung; Park, Sue Kyung; Park, Byung-Joo
2014-09-01
Kappa is a widely used measure of agreement. However, it may not be straightforward in some situation such as sample size calculation due to the kappa paradox: high agreement but low kappa. Hence, it seems reasonable in sample size calculation that the level of agreement under a certain marginal prevalence is considered in terms of a simple proportion of agreement rather than a kappa value. Therefore, sample size formulae and nomograms using a simple proportion of agreement rather than a kappa under certain marginal prevalences are proposed. A sample size formula was derived using the kappa statistic under the common correlation model and goodness-of-fit statistic. The nomogram for the sample size formula was developed using SAS 9.3. The sample size formulae using a simple proportion of agreement instead of a kappa statistic and nomograms to eliminate the inconvenience of using a mathematical formula were produced. A nomogram for sample size calculation with a simple proportion of agreement should be useful in the planning stages when the focus of interest is on testing the hypothesis of interobserver agreement involving two raters and nominal outcome measures. Copyright © 2014 Elsevier Inc. All rights reserved.
The Correlation between Angle Kappa and Ocular Biometry in Koreans
Choi, Se Rang
2013-01-01
Purpose To investigate normative angle kappa data and to examine whether correlations exist between angle kappa and ocular biometric measurements (e.g., refractive error, axial length) and demographic features in Koreans. Methods Data from 436 eyes (213 males and 223 females) were analyzed in this study. The angle kappa was measured using Orbscan II. We used ocular biometric measurements, including refractive spherical equivalent, interpupillary distance and axial length, to investigate the correlations between angle kappa and ocular biometry. The IOL Master ver. 5.02 was used to obtain axial length. Results The mean patient age was 57.5 ± 12.0 years in males and 59.4 ± 12.4 years in females (p = 0.11). Angle kappa averaged 4.70 ± 2.70 degrees in men and 4.89 ± 2.14 degrees in women (p = 0.48). Axial length and spherical equivalent were correlated with angle kappa (r = -0.342 and r = 0.197, respectively). The correlation between axial length and spherical equivalent had a negative correlation (r = -0.540, p < 0.001). Conclusions Angle kappa increased with spherical equivalent and age. Thus, careful manipulation should be considered in older and hyperopic patients when planning refractive or strabismus surgery. PMID:24311927
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Huixian; Wacker, Daniel; Mileni, Mauro
Opioid receptors mediate the actions of endogenous and exogenous opioids on many physiological processes, including the regulation of pain, respiratory drive, mood, and - in the case of {kappa}-opioid receptor ({kappa}-OR) - dysphoria and psychotomimesis. Here we report the crystal structure of the human {kappa}-OR in complex with the selective antagonist JDTic, arranged in parallel dimers, at 2.9 {angstrom} resolution. The structure reveals important features of the ligand-binding pocket that contribute to the high affinity and subtype selectivity of JDTic for the human {kappa}-OR. Modelling of other important {kappa}-OR-selective ligands, including the morphinan-derived antagonists norbinaltorphimine and 5'-guanidinonaltrindole, and the diterpenemore » agonist salvinorin A analogue RB-64, reveals both common and distinct features for binding these diverse chemotypes. Analysis of site-directed mutagenesis and ligand structure-activity relationships confirms the interactions observed in the crystal structure, thereby providing a molecular explanation for {kappa}-OR subtype selectivity, and essential insights for the design of compounds with new pharmacological properties targeting the human {kappa}-OR.« less
Gurtner, Kari M; Shosha, Eslam; Bryant, Sandra C; Andreguetto, Bruna D; Murray, David L; Pittock, Sean J; Willrich, Maria Alice V
2018-02-19
Cerebrospinal fluid (CSF) used in immunoglobulin gamma (IgG) index testing and oligoclonal bands (OCBs) are common laboratory tests used in the diagnosis of multiple sclerosis. The measurement of CSF free light chains (FLC) could pose as an alternative to the labor-intensive isoelectric-focusing (IEF) gels used for OCBs. A total of 325 residual paired CSF and serum specimens were obtained after physician-ordered OCB IEF testing. CSF kappa (cKFLC) and lambda FLC (cLFLC), albumin and total IgG were measured. Calculations were performed based on combinations of analytes: CSF sum of kappa and lambda ([cKFLC+cLFLC]), kappa-index (K-index) ([cKFLC/sKFLC]/[CSF albumin/serum albumin]), kappa intrathecal fraction (KFLCIF) {([cKFLC/sKFLC]-[0.9358×CSF albumin/serum albumin]^[0.6687×sKFLC]/cKFLC)} and IgG-index ([CSF IgG/CSF albumin]/[serum IgG/serum albumin]). Patients were categorized as: demyelination (n=67), autoimmunity (n=53), non-inflammatory (n=50), inflammation (n=38), degeneration (n=28), peripheral neuropathy (n=24), infection (n=13), cancer (n=11), neuromyelitis optica (n=10) and others (n=31). cKFLC measurement used alone at a cutoff of 0.0611 mg/dL showed >90% agreement to OCBs, similar or better performance than all other calculations, reducing the number of analytes and variables. When cases of demyelinating disease were reviewed, cKFLC measurements showed 86% clinical sensitivity/77% specificity. cKFLC alone demonstrates comparable performance to OCBs along with increased sensitivity for demyelinating diseases. Replacing OCB with cKFLC would alleviate the need for serum and CSF IgG and albumin and calculated conversions. cKFLC can overcome challenges associated with performance, interpretation, and cost of traditional OCBs, reducing costs and maintaining sensitivity and specificity supporting MS diagnosis.
Dover, James H.; Berry, William B.N.; Ross, Reuben James
1980-01-01
Recent geologic mapping in the northern Pioneer Mountains combined with the identification of graptolites from 116 new collections indicate that the Ordovician and Silurian Phi Kappa and Trail Creek Formations occur in a series of thrust-bounded slices within a broad zone of imbricate thrust faulting. Though confirming a deformational style first reported in a 1963 study by Michael Churkin, our data suggest that the complexity and regional extent of the thrust zone were not previously recognized. Most previously published sections of the Phi Kappa and Trail Creek Formations were measured across unrecognized thrust faults and therefore include not only structural repetitions of graptolitic Ordovician and Silurian rocks but also other tectonically juxtaposed lithostratigraphic units of diverse ages as well. Because of this discovery, the need to reconsider the stratigraphic validity of these formations and their lithology, nomenclature, structural distribution, facies relations, and graptolite faunas has arisen. The Phi Kappa Formation in most thrust slices has internal stratigraphic continuity despite the intensity of deformation to which it was subjected. As revised herein, the Phi Kappa Formation is restricted to a structurally repeated succession of predominantly black, carbonaceous, graptolitic argillite and shale. Some limy, light-gray-weathering shale occurs in the middle part of the section, and fine-grained locally pebbly quartzite is present at the base. The basal quartzite is here named the Basin Gulch Quartzite Member of the Phi Kappa. The Phi Kappa redefined on a lithologic basis represents the span of Ordovician time from W. B. N. Berry's graptolite zones 2-4 through 15 and also includes approximately 17 m of lithologically identical shale of Early and Middle Silurian age at the top. The lower contact of the formation as revised is tectonic. The Phi Kappa is gradationally overlain by the Trail Creek Formation as restricted herein. Most of the coarser clastic rocks reported in previously measured sections of the Phi Kappa, as well as the sequence along Phi Kappa Creek from which the name originates, are excluded from the Phi Kappa as revised and are reassigned to two structural plates of Mississippian Copper Basin Formation; other strata now excluded from the formation are reassigned to the Trail Creek Formation and to an unnamed Silurian and Devonian unit. As redefined, the Phi Kappa Formation is only about 240 m thick, compared with the 3,860 m originally estimated, and it occupies only about 25 percent of the outcrop area previously mapped in 1930 by H. G. Westgate and C. P. Ross. Despite this drastic reduction in thickness and the exclusion of the rocks along Phi Kappa Creek, the name Phi Kappa is retained because of widely accepted prior usage to denote the Ordovician graptolitic shale facies of central Idaho, and because the Phi Kappa Formation as revised is present in thrust slices on Phi Kappa Mountain, at the head of Phi Kappa Creek. The lithic and faunal consistency of this unit throughout the area precludes the necessity for major facies telescoping along individual faults within the outcrop belt. However, tens of kilometers of tectonic shortening seems required to juxtapose the imbricated Phi Kappa shale facies with the Middle Ordovician part of the carbonate and quartzite shale sequence of east central Idaho. The shelf rocks are exposed in the Wildhorse structural window of the northeastern Pioneer Mountains, and attain a thickness of at least 1,500 m throughout the region north and east of the Pioneer Mountains. The Phi Kappa is in direct thrust contact on intensely deformed medium- to high-grade metamorphic equivalents of the same shelf sequence in the Pioneer window at the south end of the Phi Kappa-Trail Creek outcrop belt. Along East Pass, Big Lake, and Pine Creeks, north of the Pioneer Mountains, some rocks previously mapped as Ramshorn Slate are lithologically and faunally equivalent to the P
Zhou, Lei-Lei; Xu, Xiao-Yue; Ni, Jie; Zhao, Xia; Zhou, Jian-Wei; Feng, Ji-Feng
2018-06-01
Due to the low incidence and the heterogeneity of subtypes, the biological process of T-cell lymphomas is largely unknown. Although many genes have been detected in T-cell lymphomas, the role of these genes in biological process of T-cell lymphomas was not further analyzed. Two qualified datasets were downloaded from Gene Expression Omnibus database. The biological functions of differentially expressed genes were evaluated by gene ontology enrichment and KEGG pathway analysis. The network for intersection genes was constructed by the cytoscape v3.0 software. Kaplan-Meier survival curves and log-rank test were employed to assess the association between differentially expressed genes and clinical characters. The intersection mRNAs were proved to be associated with fundamental processes of T-cell lymphoma cells. These intersection mRNAs were involved in the activation of some cancer-related pathways, including PI3K/AKT, Ras, JAK-STAT, and NF-kappa B signaling pathway. PDGFRA, CXCL12, and CCL19 were the most significant central genes in the signal-net analysis. The results of survival analysis are not entirely credible. Our findings uncovered aberrantly expressed genes and a complex RNA signal network in T-cell lymphomas and indicated cancer-related pathways involved in disease initiation and progression, providing a new insight for biotargeted therapy in T-cell lymphomas. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Pang, Keliang; Tanski, Joseph M; Parkin, Gerard
2008-02-28
The nickel boratrane complexes [kappa4-B(mimBut))3]Ni(kappa1-OAc), [kappa4-B(mimBut)3]NiNCS and [kappa4-B(mimBut)3]NiN3 are obtained via metathesis of the chloride ligand of [kappa4-B(mimBut)3]NiCl with TlOAc, KSCN and NaN3, respectively; the Ni-->B bond in these complexes is a site of reactivity, thereby providing a means of synthesizing nickel complexes that feature B-functionalized tris(mercaptoimidazolyl)borate derivatives, [YTmBut]NiZ.
Carmona, Jorge U; Ríos, Diana L; López, Catalina; Álvarez, María E; Pérez, Jorge E; Bohórquez, Mabel E
2016-07-01
Platelet-rich plasma (PRP) preparations are a common treatment in equine osteoarthritis (OA). However, there are controversies regarding the ideal concentration of platelets and leukocytes in these biological substances necessary to induce an adequate anti-inflammatory and anabolic response in articular cartilage. The aims were to study the influence of leukocyte- and platelet-rich gel (L-PRG) and pure platelet-rich gel (P-PRG) supernatants on the histological changes of cartilage, the degree of chondrocyte apoptosis, the production of hyaluronan (HA) and the gene expression of nuclear factor kappa beta (NFkβ), matrix metalloproteinase 13 (MMP-13), a disintegrin and metalloproteinase with thrombospondin motifs 4 (ADAMTS-4), collagen type I alpha 1 (COL1A1), collagen type II alpha 1 (COL2A1) and cartilage oligomeric matrix protein (COMP) in normal cartilage explants (CEs) challenged with lipopolysaccharide (LPS). Overall, 25 % L-PRG supernatant (followed in order of importance by, 50 % P-PRG, 25 % P-PRG and 50 % L-PRG) represented the substance with the most important anti-inflammatory and anabolic effect. 25 % P-PRG supernatant presented important anabolic effects, but it induced a more severe chondrocyte apoptosis than the other evaluated substances. 25 % L-PRG supernatant presented the best therapeutic profile. Our results demonstrate that the biological variability of PRP preparations makes their application rather challenging. Additional in vivo research is necessary to know the effect of PRP preparations at different concentrations.
Effect of rottlerin, a PKC-{delta} inhibitor, on TLR-4-dependent activation of murine microglia
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Dong-Chan; Division of Research and Development, Neuronex, Inc., San31, Hyoja-dong, Nam-gu, Pohang 790-784; Kim, Sun-Hee
2005-11-11
In microglia, Toll-like receptors have been shown to recognize pathogen-associated molecular patterns and initiate innate immune responses upon interaction with infectious agents. The effect of rottlerin, a PKC-{delta} specific inhibitor, on TLR-4-mediated signaling was investigated in murine microglia stimulated with lipopolysaccharide and taxol. Pretreatment of microglia cells with rottlerin decreased LPS- and taxol-induced nitric oxide production in a concentration-dependent manner (IC{sub 50} = 99.1 {+-} 1.5 nM). Through MTT and FACS analysis, we found that the inhibition effect of rottlerin was not due to microglial cell death. Rottlerin pretreatment also attenuated LPS-induced phosphorylation of I{kappa}B-{alpha}, nuclear translocation of NF-{kappa}B, andmore » expression of type II nitric oxide synthase. In addition, microglial phagocytosis in response to TLR-4 activation was diminished in which rottlerin was pretreated. Together, these data raise the possibility that certain PKC-{delta} specific inhibitors can modulate TLR-4-derived signaling and inflammatory target gene expression, and can alter susceptibility to microbial infection and chronic inflammatory diseases in central nervous system.« less
NF-kappaB: Two Sides of the Same Coin
Silva, Rafael C. M. C.; Ferreira, Gerson M.; Abdelhay, Eliana
2018-01-01
Nuclear Factor-kappa B (NF-κB) is a transcription factor family that regulates a large number of genes that are involved in important physiological processes, including survival, inflammation, and immune responses. More recently, constitutive expression of NF-κB has been associated with several types of cancer. In addition, microorganisms, such as viruses and bacteria, cooperate in the activation of NF-κB in tumors, confirming the multifactorial role of this transcription factor as a cancer driver. Recent reports have shown that the NF-κB signaling pathway should receive attention for the development of therapies. In addition to the direct effects of NF-κB in cancer cells, it might also impact immune cells that can both promote or prevent tumor development. Currently, with the rise of cancer immunotherapy, the link among immune cells, inflammation, and cancer is a major focus, and NF-κB could be an important regulator for the success of these therapies. This review discusses the contrasting roles of NF-κB as a regulator of pro- and antitumor processes and its potential as a therapeutic target. PMID:29315242
NF-kappaB: Two Sides of the Same Coin.
Pires, Bruno R B; Silva, Rafael C M C; Ferreira, Gerson M; Abdelhay, Eliana
2018-01-09
Nuclear Factor-kappa B (NF-κB) is a transcription factor family that regulates a large number of genes that are involved in important physiological processes, including survival, inflammation, and immune responses. More recently, constitutive expression of NF-κB has been associated with several types of cancer. In addition, microorganisms, such as viruses and bacteria, cooperate in the activation of NF-κB in tumors, confirming the multifactorial role of this transcription factor as a cancer driver. Recent reports have shown that the NF-κB signaling pathway should receive attention for the development of therapies. In addition to the direct effects of NF-κB in cancer cells, it might also impact immune cells that can both promote or prevent tumor development. Currently, with the rise of cancer immunotherapy, the link among immune cells, inflammation, and cancer is a major focus, and NF-κB could be an important regulator for the success of these therapies. This review discusses the contrasting roles of NF-κB as a regulator of pro- and antitumor processes and its potential as a therapeutic target.
Baumann, G; Geisse, S; Sullivan, M
1991-03-01
The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Shuai; Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208; Lv, Jiaju
2012-03-30
Highlights: Black-Right-Pointing-Pointer Cyld deficiency suppresses pro-inflammatory phenotypic switch of VSMCs. Black-Right-Pointing-Pointer Cyld deficiency inhibits MAPK rather than NF-kB activity in inflamed VSMCs. Black-Right-Pointing-Pointer CYLD is up-regulated in the coronary artery with neointimal hyperplasia. -- Abstract: CYLD, a deubiquitinating enzyme (DUB), is a critical regulator of diverse cellular processes, ranging from proliferation and differentiation to inflammatory responses, via regulating multiple key signaling cascades such as nuclear factor kappa B (NF-{kappa}B) pathway. CYLD has been shown to inhibit vascular lesion formation presumably through suppressing NF-{kappa}B activity in vascular cells. However, herein we report a novel role of CYLD in mediating pro-inflammatory responsesmore » in vascular smooth muscle cells (VSMCs) via a mechanism independent of NF-{kappa}B activity. Adenoviral knockdown of Cyld inhibited basal and the tumor necrosis factor alpha (TNF{alpha})-induced mRNA expression of pro-inflammatory cytokines including monocyte chemotactic protein-1 (Mcp-1), intercellular adhesion molecule (Icam-1) and interleukin-6 (Il-6) in rat adult aortic SMCs (RASMCs). The CYLD deficiency led to increases in the basal NF-{kappa}B transcriptional activity in RASMCs; however, did not affect the TNF{alpha}-induced NF-{kappa}B activity. Intriguingly, the TNF{alpha}-induced I{kappa}B phosphorylation was enhanced in the CYLD deficient RASMCs. While knocking down of Cyld decreased slightly the basal expression levels of I{kappa}B{alpha} and I{kappa}B{beta} proteins, it did not alter the kinetics of TNF{alpha}-induced I{kappa}B protein degradation in RASMCs. These results indicate that CYLD suppresses the basal NF-{kappa}B activity and TNF{alpha}-induced I{kappa}B kinase activation without affecting TNF{alpha}-induced NF-{kappa}B activity in VSMCs. In addition, knocking down of Cyld suppressed TNF{alpha}-induced activation of mitogen activated protein kinases (MAPKs) including extracellular signal-activated kinases (ERK), c-Jun N-terminal kinase (JNK), and p38 in RASMCs. TNF{alpha}-induced RASMC migration and monocyte adhesion to RASMCs were inhibited by the Cyld knockdown. Finally, immunochemical staining revealed a dramatic augment of CYLD expression in the injured coronary artery with neointimal hyperplasia. Taken together, our results uncover an unexpected role of CYLD in promoting inflammatory responses in VSMCs via a mechanism involving MAPK activation but independent of NF-{kappa}B activity, contributing to the pathogenesis of vascular disease.« less
Inequalities between Kappa and Kappa-Like Statistics for "k x k" Tables
ERIC Educational Resources Information Center
Warrens, Matthijs J.
2010-01-01
The paper presents inequalities between four descriptive statistics that can be expressed in the form [P-E(P)]/[1-E(P)], where P is the observed proportion of agreement of a "kappa x kappa" table with identical categories, and E(P) is a function of the marginal probabilities. Scott's "pi" is an upper bound of Goodman and Kruskal's "lambda" and a…
Aga, Mini; Watters, Jyoti J; Pfeiffer, Zachary A; Wiepz, Gregory J; Sommer, Julie A; Bertics, Paul J
2004-04-01
Extracellular nucleotides such as ATP are present in abundance at sites of inflammation and tissue damage, and these agents exert a potent modulatory effect on macrophage/monocyte function via the nucleotide receptor P2X(7). In this regard, after exposure to bacterial LPS, P2X(7) activation augments expression of the inducible nitric oxide (NO) synthase and production of NO in macrophages. Because P2X(7) has been reported to stimulate certain members of the MAP kinase family (ERK1/2) and can enhance the DNA-binding activity of NF-kappa B, we tested the hypothesis that LPS and nucleotides regulate NF-kappa B-dependent inflammatory events via cross talk with MAPK-associated pathways. In this regard, the present studies revealed that cotreatment of macrophages with LPS and the P2X(7)-selective ligand 2'-3'-O-(4-benzoylbenzoyl)adenosine 5'-triphosphate (BzATP) results in the cooperative activation of NF-kappa B DNA-binding activity and a sustained attenuation of levels of the NF-kappa B inhibitory protein I kappa B alpha. Interestingly, a persistent reduction in I kappa B alpha levels is also observed when the MEK1/2 inhibitor U0126 is coadministered with LPS, suggesting that components of the MEK/ERK pathway are involved in regulating I kappa B alpha protein expression and/or turnover. The observation that U0126 and BzATP exhibit overlapping actions with respect to LPS-induced changes in I kappa B alpha levels is supported by the finding that Ras activation, which is upstream of MEK/ERK activation, is reduced upon macrophage cotreatment with BzATP and LPS compared with the effects of BzATP treatment alone. These data are consistent with the concept that the Ras/MEK/ERK pathways are involved in regulating NF-kappa B/I kappa B-dependent inflammatory mediator production and suggest a previously unidentified mechanism by which nucleotides can modulate LPS-induced action via cross talk between NF-kappa B and Ras/MEK/MAPK-associated pathways.
Karami, A; Mazloom Zadeh, S; Rastin, A; Karami, A; Shiri, P
2015-01-01
Introduction: The urinary tract infection is the most common infection and drug resistance to it is increasing. Due to the acute infection, the prescribing of medicine is conducted before culture and antibiogram and according to the results, disk diffusion is adjusted. The aim of this study was to compare it with MIC to determine to what extent the current method could be useful. Methods: This descriptive cross-sectional investigation research regarding drug resistance was conducted with the help of two methods of disk diffusion and MIC on the isolations of patients' urine culture with UTI (midstream clean catch). Bacterial resistance was measured, and sensitivity and specificity were evaluated. Results: The MIC method was considered the gold standard and, according to the related formula, the sensitivity and specificity of disk diffusion were related to 13 antibiotics obtained as it follows: ciprofloxacin 69% and 69.1% (0.0001 > p and Kappa = .292), cotrimoxazole 50% and 77.3% (p = 0.010), nitrofurantoin 84.7% and 58.2% (0.0001 > p and Kappa = 0.44), ampicilin 83.3% and 85.3% (0.0001 > p and Kappa = 0.33), ofloxacin 65.5% and 83.9% (0.0001 > p and Kappa = 0.429), cephalexin 46.2% and 75.2% (p = 0.012 and Kappa = 0.116), gentamicin 64.2% and 66% (0.0001 > p and Kappa = 0.276), ceftriaxone 27.6% and 80.9% (p = 0.216 and Kappa = 0.074), nalidixic acid 42.1% and 89.2% (0.0001 > p and Kappa = 0.354), imipenem 63.4% and 70.4% (0.0001 > p and Kappa 0.306), co-amoxiclav 83% and 71% (0.0001 > p and Kappa = 0.412), cefixime 21% and 80.9% (0.0001 > p and Kappa = 0.412), vancomycin 55.9% and 94.7 (0.9001 > p and Kappa = 0.532). Sensitivity and specificity of this method were reported to be lower than MIC. Conclusions: Due to the low sensitivity and specificity of the disk diffusion method, antibiotic therapy should be certainly considered in clinical conditions, and risk factors for the infection and only by this approach cannot prescribe the drug.
Comparison of intra-oral and study cast measurements in the assessment of malocclusion.
Ovsenik, Maja; Farcnik, Franc M; Verdenik, Ivan
2004-06-01
Malocclusion assessment methods are based on registrations and measurements made on study casts, which requires that impressions be taken. In addition to being costly and time-consuming, this process can be unpleasant for very young children. Therefore, the aim of this study was to evaluate the reliability of intra-oral measurements that compute a malocclusion index score to determine malocclusion severity in the mixed dentition. The research was part of a longitudinal study in Slovenia on a sample of 530 3-year-old children. At 8 years of age (mean 8.5 years, standard deviation 0.2), a cohort of 101 children (44 boys, 57 girls) was randomly selected in a cross-sectional study. Quantitative registrations of space and occlusal anomalies were performed intra-orally as well as on study casts. Kappa (kappa) statistics were used to evaluate the agreement between clinical and study cast malocclusion assessments. Systematic bias of measurements was tested using Wilcoxon's signed rank test. The results showed complete agreement between the two measurements for anterior crossbite, anterior open bite and overjet scores (kappa = 1); excellent reliability for the buccal segment relationship (kappa = 0.93), transverse occlusion of posterior teeth (kappa = 0.87); and substantial agreement for overbite (kappa = 0.79) and midline deviation (kappa = 0.71). For the remainder of the traits the agreement was moderate: rotation of incisors (kappa = 0.58), crowding of upper incisors (kappa = 0.51), axial inclination of teeth (kappa = 0.44) and lower incisor crowding (kappa = 0.41). Intra-orally small, but statistically significant scoring of lower incisor rotation and crowding was identified. On the study casts the most favourable axial inclination was found for buccal segment occlusion. Overall classification into severity grades, based on the total malocclusion score, showed excellent agreement between the two methods (kappa = 0.89), without statistically significant bias. Malocclusion assessment, recorded and measured intra-orally, is as reliable as assessment on study casts. The proposed method can be used in screening, in epidemiological studies and in clinical orthodontic assessment.
Operator-sum representation for bosonic Gaussian channels
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ivan, J. Solomon; Sabapathy, Krishna Kumar; Simon, R.
2011-10-15
Operator-sum or Kraus representations for single-mode bosonic Gaussian channels are developed, and several of their consequences explored. The fact that the two-mode metaplectic operators acting as unitary purification of these channels do not, in their canonical form, mix the position and momentum variables is exploited to present a procedure which applies uniformly to all families in the Holevo classification. In this procedure the Kraus operators of every quantum-limited Gaussian channel can be simply read off from the matrix elements of a corresponding metaplectic operator. Kraus operators are employed to bring out, in the Fock basis, the manner in which themore » antilinear, unphysical matrix transposition map when accompanied by injection of a threshold classical noise becomes a physical channel, denoted D({kappa}) in the Holevo classification. The matrix transposition channels D({kappa}), D({kappa}{sup -1}) turn out to be a dual pair in the sense that their Kraus operators are related by the adjoint operation. The amplifier channel with amplification factor {kappa} and the beam-splitter channel with attenuation factor {kappa}{sup -1} turn out to be mutually dual in the same sense. The action of the quantum-limited attenuator and amplifier channels as simply scaling maps on suitable quasiprobabilities in phase space is examined in the Kraus picture. Consideration of cumulants is used to examine the issue of fixed points. The semigroup property of the amplifier and attenuator families leads in both cases to a Zeno-like effect arising as a consequence of interrupted evolution. In the cases of entanglement-breaking channels a description in terms of rank 1 Kraus operators is shown to emerge quite simply. In contradistinction, it is shown that there is not even one finite rank operator in the entire linear span of Kraus operators of the quantum-limited amplifier or attenuator families, an assertion far stronger than the statement that these are not entanglement breaking channels. A characterization of extremality in terms of Kraus operators, originally due to Choi, is employed to show that all quantum-limited Gaussian channels are extremal. The fact that almost every noisy Gaussian channel can be realized as a product of a pair of quantum-limited channels is used to construct a discrete set of linearly independent Kraus operators for these noisy Gaussian channels, including the classical noise channel, and these Kraus operators have a particularly simple structure.« less