Structural characterization and observation of variable range hopping conduction mechanism at high temperature in CdSe quantum dot solids

NASA Astrophysics Data System (ADS)

Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit

2013-03-01

We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.

Identification of Mott insulators and Anderson insulators in self-assembled gold nanoparticles thin films

NASA Astrophysics Data System (ADS)

Jiang, Cheng-Wei; Ni, I.-Chih; Tzeng, Shien-Der; Wu, Cen-Shawn; Kuo, Watson

2014-05-01

How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction.How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr06627d

Study of conduction behavior in Pr0.67Sr0.03Ag0.30MnO3

NASA Astrophysics Data System (ADS)

Bhat, Masroor Ahmad; Modi, Anchit; Pandey, Devendra K.; Gaur, N. K.

2018-05-01

In this paper, we report the conduction mechanism in Pr0.67Sr0.03Ag0.30MnO3 system synthesized via conventional solid state reaction route. The structural information was carried by X - Ray diffraction using Rietveld refinement which confirms the secondary phase of the sample. The SEM image shows the formation of double phase composite because of limited reaction of silver with parent compound. The resistivity behavior indicates the semiconducting behavior. The electronic nature can be estimated by means of variable range hopping (VRH) and small polaron hopping (SPH) model showing that the enhancement of double exchange interaction suppress the band gap and boost the carrier delocalization of charge carriers.

Conduction mechanism and dielectric relaxation in high dielectric KxTiyNi1-x-yO

NASA Astrophysics Data System (ADS)

Jana, Pradip Kumar; Sarkar, Sudipta; Karmakar, Shilpi; Chaudhuri, B. K.

2007-10-01

Complex impedance spectroscopic study has been made to elucidate the conductivity mechanism and dielectric relaxations in a low loss giant dielectric (ɛ'˜104) KxTiyNi1-x-yO (KTNO) system with x =0.05-0.30 and y =0.02 over a wide temperature range (200-400K). Below ambient temperature (300K), dc conductivity follows variable range hopping mechanism. The estimated activation energy for dielectric relaxation is found to be higher than the corresponding polaron hopping energy, which is attributed to the combined effect of K-doped grains and highly disordered grain boundary (GB) contributions in KTNO. Observed sharp fall of ɛ' below ˜270K is ascribed to the freezing of charge carriers. Comparatively lower value of relaxation time distribution parameter β of KTNO than that of the CaCu3Ti4O12 (CCTO) system reveals more disorder in KTNO. It is also found that KTNO is structurally more stable compared to the CCTO system, both having giant ɛ' value.

Thermally Stimulated Currents in Nanocrystalline Titania

PubMed Central

Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Cavallaro, Alessandro; Scaringella, Monica

2018-01-01

A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO2. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5–630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 1014–1018 cm−3, associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies. PMID:29303976

Thermally Stimulated Currents in Nanocrystalline Titania.

PubMed

Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Carnevale, Ennio Antonio; Cavallaro, Alessandro; Scaringella, Monica

2018-01-05

A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO₂. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5-630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 10 14 -10 18 cm -3 , associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies.

Variable-Range Hopping through Marginally Localized Phonons

NASA Astrophysics Data System (ADS)

Banerjee, Sumilan; Altman, Ehud

2016-03-01

We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.

Hopping conduction in zirconium oxynitrides thin film deposited by reactive magnetron sputtering

NASA Astrophysics Data System (ADS)

Guo, Jie; Zhan, Guanghui; Liu, Jingquan; Yang, Bin; Xu, Bin; Feng, Jie; Chen, Xiang; Yang, Chunsheng

2015-10-01

Zirconium oxynitrides thin film thermometers were demonstrated to be useful temperature sensors. However, the basic conduction mechanism of zirconium oxynitrides films has been a long-standing issue, which hinders the prediction and optimization of their ultimate performance. In this letter, zirconium oxynitrides films were grown on sapphire substrates by magnetron sputtering and their electric transport mechanism has been systemically investigated. It was found that in high temperatures region (>150 K) the electrical conductivity was dominated by thermal activation for all samples. In the low temperatures range, while Mott variable hopping conduction (VRH) was dominated the transport for films with relatively low resistance, a crossover from Mott VRH conduction to Efros-Shklovskii (ES) VRH was observed for films with relatively high resistance. This low temperature crossover from Mott to ES VRH indicates the presence of a Coulomb gap (~7 meV). These results demonstrate the competing and tunable conduction mechanism in zirconium oxynitrides thin films, which would be helpful for optimizing the performance of zirconium oxynitrides thermometer.

Spin-glass and variable range hopping quantum interference magnetoresistance in FeSr2Y1.3Ce0.7Cu2O10-x

NASA Astrophysics Data System (ADS)

Sambale, S.; Williams, G. V. M.; Stephen, J.; Chong, S. V.

2014-12-01

Electronic transport and magnetic measurements have been made on FeSr2Y1.3Ce0.7Cu2O10-x. We observe a spin-glass at ˜23 K and a magnetoresistance that reaches -22% at 8 T. The magnetoresistance is due to variable range hopping quantum interference where at low temperatures each hop is over a large number of scatterers. This magnetoresistance is negative at and above 5 K and can be described by the Nguen, Spivak, and Shklovskii (NSS) model. However, there is an increasingly positive contribution to the magnetoresistance for temperatures below 5 K that may be due to scattering from localized free spins during each hop that is not accounted for in the NSS model.

Reverse leakage current characteristics of InGaN/GaN multiple quantum well ultraviolet/blue/green light-emitting diodes

NASA Astrophysics Data System (ADS)

Zhou, Shengjun; Lv, Jiajiang; Wu, Yini; Zhang, Yuan; Zheng, Chenju; Liu, Sheng

2018-05-01

We investigated the reverse leakage current characteristics of InGaN/GaN multiple quantum well (MQW) near-ultraviolet (NUV)/blue/green light-emitting diodes (LEDs). Experimental results showed that the NUV LED has the smallest reverse leakage current whereas the green LED has the largest. The reason is that the number of defects increases with increasing nominal indium content in InGaN/GaN MQWs. The mechanism of the reverse leakage current was analyzed by temperature-dependent current–voltage measurement and capacitance–voltage measurement. The reverse leakage currents of NUV/blue/green LEDs show similar conduction mechanisms: at low temperatures, the reverse leakage current of these LEDs is attributed to variable-range hopping (VRH) conduction; at high temperatures, the reverse leakage current of these LEDs is attributed to nearest-neighbor hopping (NNH) conduction, which is enhanced by the Poole–Frenkel effect.

Sensitive photo-thermal response of graphene oxide for mid-infrared detection

NASA Astrophysics Data System (ADS)

Bae, Jung Jun; Yoon, Jung Hyun; Jeong, Sooyeon; Moon, Byoung Hee; Han, Joong Tark; Jeong, Hee Jin; Lee, Geon-Woong; Hwang, Ha Ryong; Lee, Young Hee; Jeong, Seung Yol; Lim, Seong Chu

2015-09-01

This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability.This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04039f

Charge carrier transport mechanisms in perovskite CdTiO{sub 3} fibers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imran, Z.; Rafiq, M. A., E-mail: aftab@cantab.net; Hasan, M. M.

Electrical transport properties of electrospun cadmium titanate (CdTiO{sub 3}) fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behaviormore » followed by space charge limited current (SCLC) with traps at higher voltages at all temperatures (200 K – 420 K). Trap density in our fibers system is N{sub t} = 6.27 × 10{sup 17} /cm{sup 3}. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH) from 200 K – 300 K. The localized density of states were found to be N(E{sub F}) = 5.51 × 10{sup 21} eV{sup −1} cm{sup −3} at 2 V. Other VRH parameters such as hopping distance (R{sub hop}) and hopping energy (W{sub hop}) were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO{sub 3} fibers efficient material for capacitive energy storage devices.« less

Electronic phase separation in insulating (Ga, Mn) As with low compensation: super-paramagnetism and hopping conduction

NASA Astrophysics Data System (ADS)

Yuan, Ye; Wang, Mao; Xu, Chi; Hübner, René; Böttger, Roman; Jakiela, Rafal; Helm, Manfred; Sawicki, Maciej; Zhou, Shengqiang

2018-03-01

In the present work, low compensated insulating (Ga,Mn)As with 0.7% Mn is obtained by ion implantation combined with pulsed laser melting. The sample shows variable-range hopping transport behavior with a Coulomb gap in the vicinity of the Fermi energy, and the activation energy is reduced by an external magnetic field. A blocking super-paramagnetism is observed rather than ferromagnetism. Below the blocking temperature, the sample exhibits a colossal negative magnetoresistance. Our studies confirm that the disorder-induced electronic phase separation occurs in (Ga,Mn)As samples with a Mn concentration in the insulator-metal transition regime, and it can account for the observed superparamagnetism and the colossal magnetoresistance.

Electronic transport in mixed-phase hydrogenated amorphous/nanocrystalline silicon thin films

NASA Astrophysics Data System (ADS)

Wienkes, Lee Raymond

Interest in mixed-phase silicon thin film materials, composed of an amorphous semiconductor matrix in which nanocrystalline inclusions are embedded, stems in part from potential technological applications, including photovoltaic and thin film transistor technologies. Conventional mixed-phase silicon films are produced in a single plasma reactor, where the conditions of the plasma must be precisely tuned, limiting the ability to adjust the film and nanoparticle parameters independently. The films presented in this thesis are deposited using a novel dual-plasma co-deposition approach in which the nanoparticles are produced separately in an upstream reactor and then injected into a secondary reactor where an amorphous silicon film is being grown. The degree of crystallinity and grain sizes of the films are evaluated using Raman spectroscopy and X-ray diffraction respectively. I describe detailed electronic measurements which reveal three distinct conduction mechanisms in n-type doped mixed-phase amorphous/nanocrystalline silicon thin films over a range of nanocrystallite concentrations and temperatures, covering the transition from fully amorphous to ~30% nanocrystalline. As the temperature is varied from 470 to 10 K, we observe activated conduction, multiphonon hopping (MPH) and Mott variable range hopping (VRH) as the nanocrystal content is increased. The transition from MPH to Mott-VRH hopping around 100K is ascribed to the freeze out of the phonon modes. A conduction model involving the parallel contributions of these three distinct conduction mechanisms is shown to describe both the conductivity and the reduced activation energy data to a high accuracy. Additional support is provided by measurements of thermal equilibration effects and noise spectroscopy, both done above room temperature (>300 K). This thesis provides a clear link between measurement and theory in these complex materials.

Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

PubMed Central

Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

2012-01-01

Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

Transport and charging mechanisms in Ta2O5 thin films for capacitive RF MEMS switches application

NASA Astrophysics Data System (ADS)

Persano, A.; Quaranta, F.; Martucci, M. C.; Cretı, P.; Siciliano, P.; Cola, A.

2010-06-01

The potential of sputtered Ta2O5 thin films to be used as dielectric layers in capacitive radio frequency microelectromechanical system switches is evaluated by investigating two factors of crucial importance for the performance of these devices which are the transport mechanisms and the charging effects in the dielectric layer. We find that Ta2O5 films show good electrical and dielectrical properties for the considered application in terms of a low leakage current density of 4 nA/cm2 for E =1 MV/cm, a high breakdown field of 4 MV/cm and a high dielectric constant of 32. For electric fields lower than 1 MV/cm the conduction mechanism is found to be variable-range hopping in the temperature range 300-400 K, while nearest-neighbor hopping is observed at higher temperatures. For fields in the range 1-4 MV/cm Poole-Frenkel becomes the dominant conduction mechanism. Current and capacitance transients used to investigate the charging effects show a decay which is well described by the stretched-exponential law, thus providing further insights on capture and emission processes.

Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

NASA Astrophysics Data System (ADS)

Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

2017-12-01

Charge transport in the temperature range 80 K < T < 300 K was studied in a composite of carbon spheres (CS), prepared via hydrothermal carbonization of sucrose, and the conducting polymer polyaniline (PANi). PANi was synthesized via the oxidative polymerization of aniline with ammonium peroxydisulfate (APS) in acidic media. The CS/PANi composite was prepared by coating the spheres with a thin polyaniline (PANi) film doped with hydrochloric acid (HCl) in situ during the polymerization process. Temperature dependent conductivity measurements show that three dimensional variable range hopping of electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

Visualizing Current Flow at the Mesoscale in Disordered Assemblies of Touching Semiconductor Nanocrystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Qinyi; Guest, Jeffrey R.; Thimsen, Elijah

2017-07-12

The transport of electrons through assemblies of nanocrystals is important to performance in optoelectronic applications for these materials. Previous work has primarily focused on single nanocrystals or transitions between pairs of nanocrystals. There is a gap in knowledge of how large numbers of nanocrystals in an assembly behave collectively, and how this collective behavior manifests at the mesoscale. In this work, the variable range hopping (VRH) transport of electrons in disordered assemblies of touching, heavily doped ZnO nanocrystals was visualized at the mesoscale as a function of temperature both theoretically, using the model of Skinner, Chen and Shklovskii (SCS), andmore » experimentally, with conductive atomic force microscopy on ultrathin films only a few particle layers thick. Agreement was obtained between the model and experiments, with a few notable exceptions. The SCS model predicts that a single network within the nanocrystal assembly, comprised of sites connected by small resistances, dominates conduction - namely the optimum band from variable range hopping theory. However, our experiments revealed that in addition to the optimum band, there are subnetworks that appear as additional peaks in the resistance histogram of conductive atomic force microscopy (CAFM) maps. Furthermore, the connections of these subnetworks to the optimum band change in time, such that some subnetworks become connected to the optimum band while others become disconnected and isolated from the optimum band; this observation appears to be an experimental manifestation of the ‘blinking’ phenomenon in our images of mesoscale transport.« less

Origin and enhancement of spin polarized current in diluted magnetic oxides by oxygen vacancies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, Hsiung, E-mail: hchou@mail.nsysu.edu.tw; Yang, Kung-Shang; Tsao, Yao-Chung

Spin polarized current (SPC) is a crucial characteristic of diluted magnetic oxides due to the potential application of oxides in spintronic devices. However, most research has been focused on ferromagnetic properties rather than polarization of electric current, because direct measurements are difficult and the origin of SPC has yet to be fully understood. The method to increase the SPC percentage is beyond practical consideration at present. To address this problem, we focus on the role of oxygen vacancies (V{sub O}) on SPC, which are controlled by growing the Co-doped ZnO thin-films at room temperature in a reducing atmosphere [Ar + (1%–30%)H{sub 2}].more » We found that the conductivity increases with an increase of V{sub O} via two independent channels: the variable range hopping (VRH) within localized states and the itinerant transport in the conduction band. The point contact Andreev reflection measurements at 4.2 K, where the electric conduction is governed only by the VRH mechanism, prove that the current flowing in the VRH hopping channel is SPC. The percentage of SPC increases with the introduction of V{sub O} and increase in its concentration. The transport measurement shows that by manipulating V{sub O}, one can control the percentage of VRH hopping conduction such that it can even dominate room temperature conduction. The highest achieved SPC ratio at room temperature was 80%.« less

Study of hopping type conduction from AC conductivity in multiferroic composite

NASA Astrophysics Data System (ADS)

Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

2018-05-01

0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

The crossover between tunnel and hopping conductivity in granulated films of noble metals

NASA Astrophysics Data System (ADS)

Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

2017-11-01

The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

Colossal dielectric behavior of semiconducting Sr2TiMnO6 ceramics

NASA Astrophysics Data System (ADS)

Meher, K. R. S. Preethi; Varma, K. B. R.

2009-02-01

Manganitelike double perovskite Sr2TiMnO6 (STMO) ceramics fabricated from the powders synthesized via the solid-state reaction route, exhibited dielectric constants as high as ˜105 in the low frequency range (100 Hz-10 kHz) at room temperature. The Maxwell-Wagner type of relaxation mechanism was found to be more appropriate to rationalize such high dielectric constant values akin to that observed in materials such as KxTiyNi(1-x-y)O and CaCu3Ti4O12. The dielectric measurements carried out on the samples with different thicknesses and electrode materials reflected the influence of extrinsic effects. The impedance studies (100 Hz-10 MHz) in the 180-300 K temperature range revealed the presence of two dielectric relaxations corresponding to the grain boundary and the electrode. The dielectric response of the grain boundary was found to be weakly dependent on the dc bias field (up to 11 V/cm). However, owing to the electrode polarization, the applied ac/dc field had significant effect on the low frequency dielectric response. At low temperatures (100-180 K), the dc conductivity of STMO followed a variable range hopping behavior. Above 180 K, it followed the Arrhenius behavior because of the thermally activated conduction process. The bulk conductivity relaxation owing to the localized hopping of charge carriers obeyed the typical universal dielectric response.

Controlling charge transport mechanisms in molecular junctions: Distilling thermally induced hopping from coherent-resonant conduction.

PubMed

Kim, Hyehwang; Segal, Dvira

2017-04-28

The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.

Realizing one-dimensional quantum and high-frequency transport features in aligned single-walled carbon nanotube ropes

NASA Astrophysics Data System (ADS)

Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath

2014-07-01

The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.

Effect of Carbon on the Electrical Properties of Copper Oxide-Based Bulk Composites

NASA Astrophysics Data System (ADS)

Kalinin, Yu. E.; Kashirin, M. A.; Makagonov, V. A.; Pankov, S. Yu.; Sitnikov, A. V.

2018-04-01

The effect of carbon filler on the electrical resistance and the thermopower of copper oxide-based composites produced by ceramic technology by hot pressing has been studied. It is found that the dependences of the electrical resistivity on the filler concentration are characteristic by S-like curves that are typical of percolation systems; in this case, the resistivity decreases more substantially as the carbon content increases as compared to the decrease in thermopower value, which is accompanied by the existence of the maximum of the factor of thermoelectric power near the percolation threshold. The studies of the temperature dependences of the resistivity and the thermopower at low temperatures show that, in the range 240-300 K, the predominant mechanism of the electrotransfer of all the composites under study is the hopping mechanism. At temperatures lower than 240 K, the composites with a nanocrystalline CuO matrix have a hopping conductivity with a variable hopping distance over localized states of the matrix near the Fermi level, which is related to the conductivity over intergrain CuO boundaries. A schematic model of the band structure of nanocrystalline CuO with carbon filler is proposed on the base of the analysis of the found experimental regularities of the electrotransfer.

D.C. electrical conductivity and conduction mechanism of some azo sulfonyl quinoline ligands and uranyl complexes.

PubMed

El-Ghamaz, N A; Diab, M A; El-Sonbati, A Z; Salem, O L

2011-12-01

Supramolecular coordination of dioxouranium(VI) heterochelates 5-sulphono-7-(4'-X phenylazo)-8-hydroxyquinoline HL(n) (n=1, X=CH(3); n=2, X=H; n=3, X=Cl; n=4, X=NO(2)) have been prepared and characterized with various physico-chemical techniques. The infrared spectral studies showed a monobasic bidentate behavior with the oxygen and azonitrogen donor system. The temperature dependence of the D.C. electrical conductivity of HL(n) ligands and their uranyl complexes has been studied in the temperature range 305-415 K. The thermal activation energies E(a) for HL(n) compounds were found to be in the range 0.44-0.9 eV depending on the nature of the substituent X. The complexation process decreased E(a) values to the range 0.043-045 eV. The electrical conduction mechanism has been investigated for all samples under investigation. It was found to obey the variable range hopping mechanism (VRH). Copyright © 2011 Elsevier B.V. All rights reserved.

Electronic transport mechanism in intrinsic and doped nanocrystalline silicon films deposited by RF-magnetron sputtering at low temperature

NASA Astrophysics Data System (ADS)

Benlakehal, D.; Belfedal, A.; Bouizem, Y.; Sib, J. D.; Chahed, L.; Zellama, K.

2016-12-01

The dependence on the temperature range, T, of the electronic transport mechanism in intrinsic and doped hydrogenated nanocrystalline silicon films, deposited by radiofrequency-magnetron sputtering at low substrate temperature, has been studied. Electrical conductivity measurements σ(T) have been conducted on these films, as a function of temperature, in the 93-450 K range. The analysis of these results clearly shows a thermally activated conduction process in the 273-450 K range which allows us to estimate the associated activation energy as well as the preexponential conductivity factor. While, in the lower temperature range (T < 273 K), a non-ohmic behavior is observed for the conductivity changes. The conductivity σ(T) presents a linear dependence on (T-1/4) , and a hopping mechanism is suggested to explain these results. By using the Percolation theory, further information can be gained about the density of states near the Fermi level as well as the range and the hopping energy.

Electron and thermal transport via variable range hopping in MoSe2 single crystals

NASA Astrophysics Data System (ADS)

Suri, Dhavala; Patel, R. S.

2017-06-01

Bulk single crystal molybdenum diselenide has been studied for its electronic and thermal transport properties. We perform resistivity measurements with current in-plane (CIP) and current perpendicular to plane (CPP) as a function of temperature. The CIP measurements exhibit metal to semiconductor transition at ≃31 K. In the semiconducting phase (T > 31 K), the transport is best explained by the variable range hopping (VRH) model. Large magnitude of resistivity in the CPP mode indicates strong structural anisotropy. The Seebeck coefficient as a function of temperature measured in the range of 90-300 K also agrees well with the VRH model. The room temperature Seebeck coefficient is found to be 139 μV/K. VRH fittings of the resistivity and the Seebeck coefficient data indicate high degree of localization.

Magneto-transport properties of a random distribution of few-layer graphene patches

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu

In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime.

Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

PubMed Central

Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

2016-01-01

We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices. PMID:27829663

Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

NASA Astrophysics Data System (ADS)

Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

2016-11-01

We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

PubMed

Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

2016-11-10

We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

Dielectric Measurements on Sol-Gel Derived Titania Films

NASA Astrophysics Data System (ADS)

Capan, Rifat; Ray, Asim K.

2017-11-01

Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.

Electronic correlation effects and the Coulomb gap at finite temperature.

PubMed

Sandow, B; Gloos, K; Rentzsch, R; Ionov, A N; Schirmacher, W

2001-02-26

We have investigated the effect of the long-range Coulomb interaction on the one-particle excitation spectrum of n-type germanium, using tunneling spectroscopy on mechanically controllable break junctions. At low temperatures, the tunnel conductance shows a minimum at zero bias voltage due to the Coulomb gap. Above 1 K, the gap is filled by thermal excitations. This behavior is reflected in the variable-range hopping resistivity measured on the same samples: up to a few degrees Kelvin the Efros-Shklovskii lnR infinity T(-1/2) law is obeyed, whereas at higher temperatures deviations from this law occur. The type of crossover differs from that considered previously in the literature.

Theoretical and experimental study of AC electrical conduction mechanism in the low temperature range of p-CuIn3Se5

NASA Astrophysics Data System (ADS)

Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.

2018-05-01

In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.

Origin of the Strain Sensitivity for an Organic Heptazole Thin-Film and Its Strain Gauge Application

NASA Astrophysics Data System (ADS)

Bae, Heesun; Jeon, Pyo Jin; Park, Ji Hoon; Lee, Kimoon

2018-04-01

The authors report on the origin of the strain sensitivity for an organic C26H16N2 (heptazole) thinfilm and its application for the detection of tensile strain. From the electrical characterization on the thin-film transistor adopting a heptazole channel, heptazole film exhibits p-channel conduction with a relatively low value of field-effect mobility (0.05 cm2/Vs), suggesting a hopping conduction behavior via hole carriers. By analyzing the strain and temperature dependences of the electrical conductivity, we reveal that the electrical conduction for a heptazole thin-film is dominated by the variable range hopping process with quite a large energy separation (224.9 meV) between the localized states under a relatively long attenuation length (10.46 Å). This indicates that a change in the inter-grain spacing that is much larger than the attenuation length is responsible for the reversible modification of electrical conductivity depending on strain for the heptazole film. By utilizing our heptazole thin-film both as a strain sensitive passive resistor and an active semiconducting channel layer, we can achieve a strain gauge device exhibiting reversible endurance for tensile strains up to 2.12%. Consequently, this study advances the understanding of the fundamental strain sensing mechanism in a heptazole thin-film toward finding a promise material with a strain gauge for applications as potential flexible devices and/or wearable electronics.

Positive magnetoresistance in Fe3Se4 nanowires

NASA Astrophysics Data System (ADS)

Li, D.; Jiang, J. J.; Liu, W.; Zhang, Z. D.

2011-04-01

We report the magnetotransport properties of Fe3Se4 nanowire arrays in anodic aluminum oxide (AAO) porous membrane. The temperature dependence of resistance of Fe3Se4 nanowires at a zero field shows thermal activated behavior below 295 K. The exponential relationship in resistance is consistent with the model of strong localization with variable-range hopping (VRH) for a finite one-dimensional wire. Resistance versus magnetic field curves below 100 K show small positive magnetoresistance (MR). The field dependencies of log[R(H)/R(0)] explain the positive MR as the effect of magnetic field on the VRH conduction.

Performance of multi-hop parallel free-space optical communication over gamma-gamma fading channel with pointing errors.

PubMed

Gao, Zhengguang; Liu, Hongzhan; Ma, Xiaoping; Lu, Wei

2016-11-10

Multi-hop parallel relaying is considered in a free-space optical (FSO) communication system deploying binary phase-shift keying (BPSK) modulation under the combined effects of a gamma-gamma (GG) distribution and misalignment fading. Based on the best path selection criterion, the cumulative distribution function (CDF) of this cooperative random variable is derived. Then the performance of this optical mesh network is analyzed in detail. A Monte Carlo simulation is also conducted to demonstrate the effectiveness of the results for the average bit error rate (ABER) and outage probability. The numerical result proves that it needs a smaller average transmitted optical power to achieve the same ABER and outage probability when using the multi-hop parallel network in FSO links. Furthermore, the system use of more number of hops and cooperative paths can improve the quality of the communication.

Electrophysical Properties of Onion-Like Carbon

NASA Astrophysics Data System (ADS)

Tkachev, E. N.; Romanenko, A. I.; Zhdanov, K. R.; Anikeeva, O. B.; Buryakov, T. I.; Kuznetsov, V. L.; Moseenkov, S. I.

2016-06-01

The paper examines electrophysical properties of onion-like carbon (OLC) samples, where particles have the average size of 4-8 nm and are formed by 5-10 nested fullerene-like spheres connected by 1-3 common curved graphene shells into aggregates with a size of 50-300 nm. We measured the temperature dependence of electrical resistance from 4.2 to 300 K and dependence of magnetoresistance in magnetic fields up to 6 T at the temperature of 4.2 K. Temperature dependences of electrical resistance of samples can be described within the framework of the Mott law with variable hop length for the one-dimensional case or within the framework of the Efros-Shklovskii Coulomb gap. We observed the quadratically increasing positive magnetoresistance up to 6 T associated with compression of wave functions of conduction electrons. Negative magnetoresistance was observed in the range of magnetic fields up to 1-2 T in the case of some samples. This is due to the fact that magnetic field suppresses the contributions to magnetoresistance made by interference effects in the area of hopping conductivity. The measurements were used to estimate the localization radius that is comparable to the diameter of OLC particles (nano-onions).

Purely hopping conduction in c-axis oriented LiNbO3 thin films

NASA Astrophysics Data System (ADS)

Shandilya, Swati; Tomar, Monika; Sreenivas, K.; Gupta, Vinay

2009-05-01

Dielectric constant and ac conductivity of highly c-axis oriented LiNbO3 thin film grown by pulsed laser deposition were studied in a metal-insulator-metal configuration over a wide temperature (200 to 450 K) and frequency (100 Hz to 1 MHz) range. The preferred oriented Al (1%) doped ZnO film with electrical conductivity 1.1×103 Ω-1 cm-1 was deposited for dual purpose: (1) to serve as nucleating center for LiNbO3 crystallites along preferred c-axis growth direction, and (2) to act as a suitable bottom electrode for electrical studies. The room temperature dc conductivity (σdc) of LiNbO3 film was about 5.34×10-10 Ω-1 cm-1 with activation energy ˜0.3 eV, indicating extrinsic conduction. The ac conductivity σac was found to be much higher in comparison to σdc in the low temperature region (<300 K) and exhibits a power law behavior due to the hopping of charge carriers. In higher temperature region (>300 K), σac shows a weak frequency dependence, whereas dielectric constant exhibits a strong frequency dispersion. The dielectric dispersion data has been discussed in the light of theoretical models based on Debye type mixed conduction and purely hopping conduction. The dominant conduction in c-axis oriented LiNbO3 thin film is attributed to the purely hopping where both σdc and σac arise due to same mechanism.

Carrier Transport and Effective Barrier Height of Low Resistance Metal Contact to Highly Mg-Doped p-GaN

NASA Astrophysics Data System (ADS)

Park, Youngjun; Kim, Hyunsoo

2011-08-01

The effective barrier height and carrier transport mechanism of low resistance Ag-based contact to highly Mg-doped p-GaN were investigated. The specific contact resistance obtained was as low as 7.0×10-4 Ω cm2. The electrical resistivity of p-GaN was found to increase depending on ˜T-1/4, indicating variable-range hopping (VRH) conduction through Mg-related deep-level defects. Based on the VRH conduction model, the effective barrier height for carrier transport could be measured as 0.12 eV, which is low enough to explain the formation of excellent ohmic contact. The deep-level defects were also found to induce surface Fermi pinning.

Thermoelectric Properties of Selenospinel Cu6Fe4Sn12Se32

NASA Astrophysics Data System (ADS)

Suekuni, Koichiro; Kunii, Masaru; Nishiate, Hirotaka; Ohta, Michihiro; Yamamoto, Atsushi; Koyano, Mikio

2012-06-01

This report describes thermoelectric properties up to 500 K for polycrystalline selenospinel Cu6Fe4Sn12Se32 samples. Thermal conductivity shows a low value of 1 W/Km because of their structural complexity such as Fe/Sn site disorder. Electrical resistivity ρ varies as exp( T 0/ T 1/4) and thermopower S varies as T 1/2 at low temperatures, which indicates that Mott variable-range hopping is the dominant conduction mechanism. However, at high temperatures (above 350 K), ρ and S decrease simultaneously. The temperature dependences are attributed to the thermal excitation of electrons. The possible band structure for Cu6Fe4Sn12Se32 is examined to clarify the behavior of ρ and S.

AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

PubMed

Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

2015-06-01

In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

Optoelectrical, structural and morphological characterization of Cu2ZnSnSe4 compound used in photovoltaic applications

NASA Astrophysics Data System (ADS)

Mesa, F.; Leguizamon, A.; Dussan, A.; Gordillo, G.

2016-10-01

In this work, results are reported concerning the effect of the deposition parameters on the structural properties of Cu2ZnSnSe4 (CZTSe) thin films, grown through a chemical reaction of the metallic precursors by co-evaporation in a two-stage process. XRD measurements revealed that the samples deposited by selenization of Cu and Sn grow in the kesterite phase (CZTSe), respectively. Effect of the deposition temperature and mass ratio Cu/ZnSe on the transport properties of CZTSe films were analyzed. It was also found that the electrical conductivity of the thin films is affected by the transport of free carriers in extended states of the conduction band as well as for variable range hopping transport mechanisms, each one predominating in a different temperature range. The molecular and morphological effect on the compound through Raman and AFM measurements was studied.

The influence of oxidation time on the properties of oxidized zinc films

NASA Astrophysics Data System (ADS)

Rambu, A. P.

2012-09-01

The effect of oxidation time on the structural characteristics and electronic transport mechanism of zinc oxide thin films prepared by thermal oxidation, have been investigated. Zinc metallic films were deposited by thermal evaporation under vacuum, the subsequent oxidation of Zn films being carried out in open atmosphere. XRD and AFM analysis indicate that obtained films posses a polycrystalline structure, the crystallites having a preferential orientation. Structural analysis reveals that microstructure of the films (crystallite size, surface roughness, internal stress) is depending on the oxidation time of metallic films. The electrical behavior of ZnO films was investigated, during a heat treatment (two heating/cooling cycles). It was observed that after the first heating, the temperature dependences of electrical conductivity become reversible. Mott variable range hopping model was proposed to analyze the temperature dependence of the electrical conductivity, in low temperature ranges. Values of some characteristic parameters were calculated.

CONSISTENCY OF FIELD-BASED MEASURES OF NEUROMUSCULAR CONTROL USING FORCE PLATE DIAGNOSTICS IN ELITE MALE YOUTH SOCCER PLAYERS

PubMed Central

READ, PAUL; OLIVER, JON L.; DE STE CROIX, MARK B.A.; MYER, GREGORY D.; LLOYD, RHODRI S.

2016-01-01

Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players and reliability data is sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force plate diagnostics in this cohort. Twenty six pre-peak height velocity (PHV) and twenty five post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single leg 75% horizontal hop and stick (75%HOP) and single leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilisation (TTS), time to pVGRF, and pVGRF asymmetry were recorded. A test, re-test design was used and reliability statistics included: change in mean, intraclass correlation coefficient (ICC) and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the three protocols (CV range = 13.8 – 49.7%). ICC values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be utilized to support a screening battery for elite male youth soccer players and for test re-test comparison. PMID:27075641

Human hopping on damped surfaces: strategies for adjusting leg mechanics.

PubMed

Moritz, Chet T; Farley, Claire T

2003-08-22

Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.

Human hopping on damped surfaces: strategies for adjusting leg mechanics.

PubMed Central

Moritz, Chet T; Farley, Claire T

2003-01-01

Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003

Study of temperature dependent electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses

NASA Astrophysics Data System (ADS)

Deepika, Singh, Hukum

2018-05-01

This paper reports the variation in electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses studied at different temperatures. The amorphous samples were prepared using the melt quenching method and the electrical measurements were performed on Keithley Electrometer in the temperature ranging from 298-373 K. The I-V characteristics were noted at different temperatures and the data obtained was analysed to get dc electrical conductivity and activation energy of electrical conduction. Further, Mott's 3D VRH model has been applied to obtain density of states, hopping range and hopping energy at different temperatures. The obtained results show that dc electrical conductivity increases with increase in Bi composition in Se-Te system. These compositions also show close agreement to Mott's VRH model.

Nonlinear conductivity in silicon nitride

NASA Astrophysics Data System (ADS)

Tuncer, Enis

2017-08-01

To better comprehend electrical silicon-package interaction in high voltage applications requires full characterization of the electrical properties of dielectric materials employed in wafer and package level design. Not only the packaging but wafer level dielectrics, i.e. passivation layers, would experience high electric fields generated by the voltage applied pads. In addition the interface between the passivation layer and a mold compound might develop space charge because of the mismatch in electrical properties of the materials. In this contribution electrical properties of a thin silicon nitride (Si3N4) dielectric is reported as a function of temperature and electric field. The measured values later analyzed using different temperature dependent exponential expressions and found that the Mott variable range hopping conduction model was successful to express the data. A full temperature/electric field dependency of conductivity is generated. It was found that the conduction in Si3N4 could be expressed like a field ionization or Fowler-Nordheim mechanism.

Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

NASA Astrophysics Data System (ADS)

Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

2018-04-01

We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1-x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase (T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase (T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac(T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant (ɛ' = 1273), dielectric loss (tanδ = 0.047) at 1 kHz, electromechanical coupling coefficients (k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants (d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

NASA Astrophysics Data System (ADS)

Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

2018-07-01

We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1- x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase ( T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase ( T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac( T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant ( ɛ' = 1273), dielectric loss (tan δ = 0.047) at 1 kHz, electromechanical coupling coefficients ( k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants ( d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

Analysis of Electrical Transport and Noise Mechanisms in Amorphous Silicon

DTIC Science & Technology

2015-11-23

and Skhlovskii [9] considered the long range Coulomb interaction and found that it reduces the DOS to zero at the Fermi level, thereby creating a so...called “ Coulomb gap (CG)” at low enough temperatures. This form of hopping conductivity results when an electron migrates from one site to another...site leaving a positively charged vacancy. For hopping to occur, the electron must have sufficient energy to overcome this Coulomb interaction

AC conduction of Ba1-xCaxTiO3 and BZT-BCTx

NASA Astrophysics Data System (ADS)

Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van

2018-03-01

Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.

Hopping transport through an array of Luttinger liquid stubs

NASA Astrophysics Data System (ADS)

Chudnovskiy, A. L.

2004-01-01

We consider a thermally activated transport across and array of parallel one-dimensional quantum wires of finite length (quantum stubs). The disorder enters as a random tunneling between the nearest-neighbor stubs as well as a random shift of the bottom of the energy band in each stub. Whereas one-particle wave functions are localized across the array, the plasmons are delocalized, which affects the variable-range hopping. A perturbative analytical expression for the low-temperature resistance across the array is obtained for a particular choice of plasmon dispersion.

Frequency effects on charge ordering in Y0.5Ca0.5MnO3 by impedance spectroscopy

NASA Astrophysics Data System (ADS)

Sarwar, Tuba; Qamar, Afzaal; Nadeem, Muhammad

2015-02-01

In this work, structural and electrical properties of Y0.5Ca0.5MnO3 are investigated by employing X-ray diffraction and impedance spectroscopy, respectively. Applied ac electric field showed the charge ordering transition temperature around 265 K and below this temperature the heteromorphic behavior of the sample is discussed in the proximity of TCO. With frequency effects the volume of robust charge orbital ordering (COO) domains diminishes due to different competing phases along with Jahn Teller distortions. Comprehensive melting and collapse of charge orbital ordering occurs below TN(125 K), where a colossal drop in the value of impedance is observed. The change in profile of modulus plane plots determines the spreading of relaxation time of intermingled phases. Hopping mechanism is elaborated in terms of strong electron phonon coupling. Variable range hopping model and Arrhenius model are used to discuss the short and long range hopping between Mn3+ and Mn4+ channels assessing the activation energy Ea.

The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

PubMed

Harakeh, Zeena; Bogt, Tom F M Ter

2018-02-16

Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.

PubMed

Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J

2014-11-07

The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.

Manipulating Conduction in Metal Oxide Semiconductors: Mechanism Investigation and Conductance Tuning in Doped Fe2O3 Hematite and Metal/Ga2O3/Metal Heterostructure

NASA Astrophysics Data System (ADS)

Zhao, Bo

This study aims at understanding the fundamental mechanisms of conduction in several metal oxide semiconductors, namely alpha-Fe2O 3 and beta-Ga2O3, and how it could be tuned to desired values/states to enable a wide range of application. In the first effort, by adding Ti dopant, we successfully turned Fe2O3 from insulating to conductive by fabricated compositionally and structurally well-defined epitaxial alpha-(TixFe1-x)2 O3(0001) films for x ≤ 0.09. All films were grown by oxygen plasma assisted molecular beam epitaxy on Al2O3(0001) sapphire substrate with a buffer layer of Cr2O3 to relax the strain from lattice mismatch. Van der Pauw resistivity and Hall effect measurements reveal carrier concentrations between 1019 and 1020 cm-3 at room temperature and mobilities in the range of 0.1 to 0.6 cm2/V˙s. Such low mobility, unlike conventional band-conduction semiconductor, was attributed to hopping mechanism due to strong electron-phonon interaction in the lattice. More interestingly, conduction mechanism transitions from small-polaron hopping at higher temperatures to variable range hopping at lower temperatures with a transition temperature between 180 to 140 K. Consequently, by adding Ti dopant, conductive Fe 2O3 hematite thin films were achieved with a well-understood conducting mechanism that could guide further device application such as spin transistor and water splitting. In the case of Ga2O3, while having a band gap as high as 5 eV, they are usually conductive for commercially available samples due to unintentional Si doping. However, we discovered the conductance could be repeatedly switched between high resistance state and low resistance state when made into metal/Ga2O3 /metal heterostructure. However, to obtain well controlled switching process with consistent switching voltages and resistances, understanding switching mechanism is the key. In this study, we fabricated resistive switching devices utilizing a Ni/Ga2O3/Ir heterostructure. Bipolar switching, non-volatility, and repeatable switching are tested for the devices fabricated. Following previous discoveries on Ni/Ga2O3 single crystal which shows interface barrier type change (Schottky ↔ Ohmic) upon annealing accompanied by defects migration, characterization of the interface behavior on resistive switching cell Ni/Ga2O 3(thin film)/Ir under two different resistive states was performed using X-ray photoemission spectroscopy (XPS). Most interestingly, feathers in XPS spectrum of Ga allow for a unique nondestructive approach to investigate interface by XPS through electron transparent top contact. Theoretical modeling shows that Ga migrate towards the interface upon switching to low resistive state, indicating a possible mechanism that involves interfacial switch through barrier height modifying. Such device holds potential to become the next generation of non-volatile memory device, resistive RAM.

Consistency of Field-Based Measures of Neuromuscular Control Using Force-Plate Diagnostics in Elite Male Youth Soccer Players.

PubMed

Read, Paul J; Oliver, Jon L; Croix, Mark Ba De Ste; Myer, Gregory D; Lloyd, Rhodri S

2016-12-01

Read, P, Oliver, JL, Croix, MD, Myer, GD, and Lloyd, RS. Consistency of field-based measures of neuromuscular control using force-plate diagnostics in elite male youth soccer players. J Strength Cond Res 30(12): 3304-3311, 2016-Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players, and reliability data are sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force-plate diagnostics in this cohort. Twenty-six pre-peak height velocity (PHV) and 25 post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single-leg 75% horizontal hop and stick (75%HOP), and single-leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilization, time to pVGRF, and pVGRF asymmetry were recorded. A test-retest design was used, and reliability statistics included change in mean, intraclass correlation coefficient, and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the 3 protocols (CV range = 13.8-49.7%). Intraclass correlation coefficient values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be used to support a screening battery for elite male youth soccer players and for test-retest comparison.

Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.

2013-12-01

Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.

Leakage current transport mechanism under reverse bias in Au/Ni/GaN Schottky barrier diode

NASA Astrophysics Data System (ADS)

Peta, Koteswara Rao; Kim, Moon Deock

2018-01-01

The leakage current transport mechanism under reverse bias of Au/Ni/GaN Schottky diode is studied using temperature dependent current-voltage (I-V-T) and capacitance-voltage (C-V) characteristics. I-V measurement in this study is in the range of 140 K-420 K in steps of 10 K. A reduction in voltage dependent barrier height and a strong internal electric field in depletion region under reverse bias suggested electric field enhanced thermionic emission in carrier transport via defect states in Au/Ni/GaN SBD. A detailed analysis of reverse leakage current revealed two different predominant transport mechanisms namely variable-range hopping (VRH) and Poole-Frenkel (PF) emission conduction at low (<260 K) and high (>260 K) temperatures respectively. The estimated thermal activation energies (0.20-0.39 eV) from Arrhenius plot indicates a trap assisted tunneling of thermally activated electrons from a deep trap state into a continuum of states associated with each conductive threading dislocation.

The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

PubMed

Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

2016-06-01

When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xian, Fenglin; Department of Electronic Materials Engineering, Research School of Physics and Engineering, The Australian National University, Canberra 2601; Ye, Jiandong, E-mail: yejd@nju.edu.cn

In this work, anion alloying is engineered in ZnON nanocrystalline films, and the resultant evolution of the structural transition, subgap states, and carrier transport is investigated. A broad distribution of sub-gap states above the valence band maximum is introduced by nitrogen due to the hybridization of N 2p and O 2p orbitals. The phase transition from partially amorphous states to full crystallinity occurs above a characteristic growth temperature of 100 °C, and the localized states are suppressed greatly due to the reduction of nitrogen composition. The electronic properties are dominated by grain boundary scattering and electron transport across boundary barriers throughmore » thermal activation at band edge states at high temperatures. The conductivity below 130 K exhibits a weak temperature dependence, which is a signature of variable-range hopping conduction between localized states introduced by nitrogen incorporation.« less

ac conductivity in Gd doped Pb(Zr0.53Ti0.47)O3 ceramics

NASA Astrophysics Data System (ADS)

Portelles, J.; Almodovar, N. S.; Fuentes, J.; Raymond, O.; Heiras, J.; Siqueiros, J. M.

2008-10-01

This study is focused in the conduction processes taking place in 0.6 wt % Gd doped lead zirconate titanate samples PbZr0.53Ti0.47O3:Gd (PZT53/47:Gd) in the vicinity of the morphotropic phase boundary. Doped samples show very large dielectric permittivity with respect to that of undoped ones near the transition temperature. The frequency dependent ac conductivity of PZT53/47:Gd ceramics was studied in the 30-450 °C temperature range. X-ray diffraction analyses indicate the incorporation of Gd atoms to the structure. The changes in the dielectric properties as functions of temperature of the doped samples are taken as additional evidence of the incorporation of Gd into the crystal structure. Gd acts as donor center promoting extrinsic n-type conduction. The ac conductivity behavior obeys Jonscher universal relation in the 100 Hz-1 MHz frequency range for temperatures between 30 and 300 °C. The measured conductivity values for Gd doped PZT53/47 are higher than those of pure PZT53/47. According to the correlated barrier hopping model, the preponderant conduction mechanism in the frequency-temperature response was recognized as small polarons hopping mechanism.

Magneto Transport of CVD Carbon in Artificial Opals

NASA Astrophysics Data System (ADS)

Wang, Lei; Yin, Ming; Arammash, Fauzi; Datta, Timir

2014-03-01

Magneto-transport of carbon inverse opal structures were investigated in the 2.5 to 300 K temperatures and magnetic fields in the 0-10T regime. Qualitatively, our observations lie between those reported by previous researchers. Over this temperature range, transport (in zero magnetic field) is non-metallic; the resistance decreased with rising temperature however the temperature dependent behavior is not activated, as observed with variable range hopping. In three-dimensions, such behavior can also be the result of weak localization and electron-electron interactions; in particular the change in conductivity is a polynomial in fractional powers of absolute temperature. At sub-helium temperature regimes the relative magneto resistance is measured to be ~ 0.1 percent per Tesla. Results of data analysis for several different scenarios will be reported. DOD award #60177-RT-H from the ARO.

Electrical conductivity and modulus formulation in zinc modified bismuth boro-tellurite glasses

NASA Astrophysics Data System (ADS)

Dhankhar, Sunil; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Punia, R.; Kishore, N.

2016-09-01

The ac conductivity of zinc modified tellurium based quaternary glasses having composition 60 TeO2-10 B2O3-(30 - x) Bi2O3-x ZnO; x = 10, 15, 20, 25 and 30 has been investigated in the frequency range 10-1-105 Hz and in temperature range 483-593 K. Frequency and temperature dependent ac conductivity found to obey Jonscher power law modified by Almond-West. DC conductivity, crossover frequency and frequency exponent have been estimated from the fitting of the experimental data of conductivity with Jonscher power law modified by Almond-West. The ac conductivity and its frequency exponent have been analyzed by various theoretical models. In presently studied glasses ac conduction takes place via tunneling of overlapping large polaron tunneling. Activation energy is found to be increased with increase in zinc content and dc conduction takes place via variable range hopping proposed by Mott with some modification suggested by Punia et al. The value of the stretched exponent ( β) obtained by fitting of M^' ' }} reveals the presence of non-Debye type relaxation. Scaling spectra of ac conductivity and electric modulus collapse into a single master curve for all compositions and temperatures, reveals the presence of composition and temperature independent conduction and relaxation process in these glasses. Activation energy of conduction ( W) and electric modulus ( E R ) are nearly equal, indicating that polaron have to overcome the same energy barrier during conduction as well as relaxation processes.

Hopper on wheels: evolving the hopping robot concept

NASA Technical Reports Server (NTRS)

Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.

2001-01-01

This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.

Colossal permittivity and the polarization mechanism of (Mg, Mn) co-doped LaGaO3 ceramics

NASA Astrophysics Data System (ADS)

Luo, Tingting; Liu, Zhifu; Zhang, Faqiang; Li, Yongxiang

2018-03-01

Mg and Mn co-doped LaGa0.7-xMgxMn0.3O3 (x = 0, 0.05, 0.10, 0.15) ceramics were prepared by a solid-state reaction method. The electrical properties of the LaGa0.7-xMgxMn0.3O3 ceramics were studied in detail by dielectric spectra, impedance spectra, and I-V characteristic analysis. Colossal permittivity up to 104 could be obtained across the frequency range up to 104 Hz. The impedance analysis of the co-doped LaGaO3 ceramics indicated that the Mott's variable range hopping (VRH) polarization should be the main origin of colossal permittivity. Mg and Mn co-doping suppressed the formation of Mn3+ and enhanced the VRH polarization, resulting in increased permittivity. Partial localization of electrons by Mg reduced the long-range electron hopping and led to the decrease in dielectric loss.

Electron transport in the two-dimensional channel material - zinc oxide nanoflake

NASA Astrophysics Data System (ADS)

Lai, Jian-Jhong; Jian, Dunliang; Lin, Yen-Fu; Ku, Ming-Ming; Jian, Wen-Bin

2018-03-01

ZnO nanoflakes of 3-5 μm in lateral size and 15-20 nm in thickness are synthesized. The nanoflakes are used to make back-gated transistor devices. Electron transport in the ZnO nanoflake channel between source and drain electrodes are investigated. In the beginning, we argue and determine that electrons are in a two-dimensional system. We then apply Mott's two-dimensional variable range hopping model to analyze temperature and electric field dependences of resistivity. The disorder parameter, localization length, hopping distance, and hopping energy of the electron system in ZnO nanoflakes are obtained and, additionally, their temperature behaviors and dependences on room-temperature resistivity are presented. On the other hand, the basic transfer characteristics of the channel material are carried out, as well, and the carrier concentration, the mobility, and the Fermi wavelength of two-dimensional ZnO nanoflakes are estimated.

Ceramics at High Temperatures

NASA Astrophysics Data System (ADS)

Zheng, Peng; Zhang, Rui-zhi; Chen, Hao-ying; Hao, Wen-tao

2014-06-01

The Seebeck coefficient and electrical conductivity of CaCu3Ti4O12 (CCTO) ceramics were measured and analyzed in the high temperature range of 300°C to 800°C, and then the electrical conduction mechanism was investigated by using a combination of experimental data fitting and first-principles calculations. The Seebeck coefficient of the CCTO ceramic sintered at 1050°C is negative with largest absolute value of ˜650 μV/K at 300°C, and the electrical conductivity is 2-3 orders greater than the value reported previously by other researchers. With increasing sintering temperature, the Seebeck coefficient decreases while the electrical conductivity increases. The temperature dependence of the electrical conductivity follows the rule of adiabatic hopping conduction of small polarons. The calculated density of states of CCTO indicates that the conduction band is mainly contributed by the antibonding states of Cu 3 d electrons, therefore small-polaron hopping between CuO4 square planar clusters was proposed. Possible ways to further improve the thermoelectric properties of CCTO are also discussed.

The Helicopter Observation Platform for Marine and Continental Boundary Layer Studies

NASA Astrophysics Data System (ADS)

Avissar, R.; Broad, K.; Walko, R. L.; Drennan, W. M.; Williams, N. J.

2016-02-01

The University of Miami has acquired a commercial helicopter (Airbus H125) that was transformed into a one-of-a-kind Helicopter Observation Platform (HOP) that fills critical gaps in physical, chemical and biological observations of the environment. This new research facility is designed to carry sensors and instrument inlets in the undisturbed air in front of the helicopter nose at low airspeed and at various altitudes, from a few feet above the Earth's surface (where much of the climate and weather "action" takes place, and where we live) and up through the atmospheric boundary layer and the mid troposphere. The HOP, with its hovering capability, is also ideal for conducting various types of remote-sensing observations. It provides a unique and essential component of airborne measurement whose purpose, among others, is to quantify the exchanges of gases and energy at the Earth surface, as well as aerosol properties that affect the environment, the climate system, and human health. For its first scientific mission, an eddy-correlation system is being mounted in front of its nose to conduct high-frequency measurements of turbulence variables relevant to atmospheric boundary layer studies.Fully fueled and with both pilot and co-pilot on board, the HOP can carry a scientific payload of up to about 1,000 lbs internally (about 3,000 lbs externally) and fly for nearly 4 hours without refueling at an airspeed of 65 knots ( 30 m/s) that is ideal for in-situ observations. Its fast cruising speed is about 140 knots andits range, at that speed, is about 350 nautical miles. This specific helicopter was chosen because of its flat floor design, which is particularly convenient for installing scientific payload and also because of its high-altitude capability (it is the only commercial helicopter that ever landed at the top of Mt Everest).The HOP is available to the entire scientific community for any project that is feasible from a flight safety point of view and that fulfills the flight regulations of the country that it is flown in. It can be easily transported anywhere in the world and can also be operated from a properly equipped ship at sea foroceanographic research.

The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.

PubMed

Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W

2009-07-01

The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.

The magnetic ordering in high magnetoresistance Mn-doped ZnO thin films

DOE PAGES

Venkatesh, S.; Baras, A.; Lee, J. -S.; ...

2016-03-24

Here, we studied the nature of magnetic ordering in Mn-doped ZnO thin films that exhibited ferromagnetism at 300 K and superparamagnetism at 5 K. We directly inter-related the magnetisation and magnetoresistance by invoking the polaronpercolation theory and variable range of hopping conduction below the metal-to-insulator transition. By obtaining a qualitative agreement between these two models, we attribute the ferromagnetism to the s-d exchange-induced spin splitting that was indicated by large positive magnetoresistance (~40 %). Low temperature superparamagnetism was attributed to the localization of carriers and non-interacting polaron clusters. This analysis can assist in understanding the presence or absence of ferromagnetismmore » in doped/un-doped ZnO.« less

Metal to insulator transition in Sb doped SnO2 monocrystalline nanowires thin films

NASA Astrophysics Data System (ADS)

Costa, I. M.; Bernardo, E. P.; Marangoni, B. S.; Leite, E. R.; Chiquito, A. J.

2016-12-01

We report on the growth and transport properties of single crystalline Sb doped SnO2 wires grown from chemical vapour deposition. While undoped samples presented semiconducting behaviour, doped ones clearly undergo a transition from an insulating state ( d R /d T <0 ) to a metallic one ( d R /d T >0 ) around 130 -150 K depending on the doping level. Data analysis in the framework of the metal-to-insulator transition theories allowed us to investigate the underlying physics: electron-electron and electron-phonon interactions were identified as the scattering mechanisms present in the metallic phase, while the conduction mechanism of the semiconducting phase (undoped sample) was characterized by thermal activation and variable range hopping mechanisms.

Hierarchical multifunctional composites by conformally coating aligned carbon nanotube arrays with conducting polymer.

PubMed

Vaddiraju, Sreeram; Cebeci, Hülya; Gleason, Karen K; Wardle, Brian L

2009-11-01

A novel method for the fabrication of carbon nanotube (CNT)-conducting polymer composites is demonstrated by conformally coating extremely high aspect ratio vertically aligned-CNT (A-CNT) arrays with conducting polymer via oxidative chemical vapor deposition (oCVD). A mechanical densification technique is employed that allows the spacing of the A-CNTs to be controlled, yielding a range of inter-CNT distances between 20 and 70 nm. Using this morphology control, oCVD is shown to conformally coat 8-nm-diameter CNTs having array heights up to 1 mm (an aspect ratio of 10(5)) at all inter-CNT spacings. Three phase CNT-conducting polymer nanocomposites are then fabricated by introducing an insulating epoxy via capillary-driven wetting. CNT morphology is maintained during processing, allowing quantification of direction-dependent (nonisotropic) composite properties. Electrical conductivity occurs primarily along the CNT axial direction, such that the conformal conducting polymer has little effect on the activation energy required for charge conduction. In contrast, the conducting polymer coating enhanced the conductivity in the radial direction by lowering the activation energy required for the creation of mobile charge carriers, in agreement with variable-range-hopping models. The fabrication strategy introduced here can be used to create many multifunctional materials and devices (e.g., direction-tailorable hydrophobic and highly conducting materials), including a new four-phase advanced fiber composite architecture.

Effect of pH on the electrical properties and conducting mechanism of SnO2 nanoparticles

NASA Astrophysics Data System (ADS)

Periathai, R. Sudha; Abarna, S.; Hirankumar, G.; Jeyakumaran, N.; Prithivikumaran, N.

2017-03-01

Semiconductor nanoparticles have attracted more interests because of their size-dependent optical and electrical properties.SnO2 is an oxygen-deficient n-type semiconductor with a wide band gap of 3.6 eV (300 K). It has many remarkable applications as sensors, catalysts, transparent conducting electrodes, anode material for rechargeable Li- ion batteries and optoelectronic devices. In the present work, the role of pH in determining the electrical and dielectric properties of SnO2 nanoparticles has been studied as a function of temperature ranging from Room temperature (RT) to 114 °C in the frequency range of 7 MHz to 50 mHz using impedance spectroscopic technique. The non linear behavior observed in the thermal dependence of the conductance of SnO2 nanoparticles is explained by means of the surface property of SnO2 nanoparticles where proton hopping mechanism is dealt with. Jonscher's power law has been fitted for the conductance spectra and the frequency exponent ("s" value) gives an insight about the ac conducting mechanism. The temperature dependence of electrical relaxation phenomenon in the material has been observed. The complex electric modulus analysis indicates the possibility of hopping conduction mechanism in the system with non-exponential type of conductivity relaxation.

Polaronic conductivity and scaling behavior of lithium iron phosphate glass

NASA Astrophysics Data System (ADS)

Banday, Azeem; Murugavel, Sevi

2018-05-01

Charge transport properties of the Lithium Iron Phosphate (LFP) glass has been investigated in a wide frequency and temperature range by means of broadband dielectric spectroscopy. The conductivity spectra has been studied on the basis of Jonscher power law for characterizing the hopping dynamics of charge carriers. The ac conductivity and scaling behavior of the LFP glass has been studied in the temperature range from 333K to 573K and frequency range from 100 mHz to 1 MHz. The conductivity isotherms of LFP glass do not superimpose upon each other by using Summerfield scaling. The structural peculiarities in the material could result in different conduction pathways giving rise to the deviation from Summerfield scaling.

Dielectric and AC conductivity studies on SrBi4Ti4O15

NASA Astrophysics Data System (ADS)

Jose, Roshan; Saravanan, K. Venkata

2018-05-01

The four layered SrBi4Ti4O15 ceramics which belong to the aurivillius family of oxide was prepared by conventional solid state reaction technique. Analysis of the dielectric data as a function of temperature and frequency revealed normal phase transition. The frequency dependent ac conductivity follows Jonscher's universal power law. Frequency exponent (n), pre-exponential factor (A), bulk dc conductivity (σdc), and hopping frequency (ωp) were determined from the fitting curves. The variation of frequency exponent with temperature indicates that large polaron hopping mechanism up to curie-temperature, then its changes to small polaron hopping. The activation energies were calculated from ac conductivity, bulk dc conductivity and hopping frequency. The activation energies revealed that conductivity had contributions from migrations of oxygen vacancies, bismuth ion vacancies and strontium ion vacancies.

Thermally activated charge transport in microbial protein nanowires

PubMed Central

Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

2016-01-01

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors. PMID:27009596

Thermally activated charge transport in microbial protein nanowires

NASA Astrophysics Data System (ADS)

Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

2016-03-01

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

Thermally activated charge transport in microbial protein nanowires.

PubMed

Lampa-Pastirk, Sanela; Veazey, Joshua P; Walsh, Kathleen A; Feliciano, Gustavo T; Steidl, Rebecca J; Tessmer, Stuart H; Reguera, Gemma

2016-03-24

The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

Superconducting and magnetic properties of Bi 2Sr 2Ca 1- xY xCu 2O y (0≦ x≦1)

NASA Astrophysics Data System (ADS)

Yoshizaki, R.; Saito, Y.; Abe, Y.; Ikeda, H.

1988-07-01

The effect of substitution of Y atoms for Ca atoms has been studied in the Bi 2Sr 2Ca 1- xY xCu 2O y compound system. For x<0.5, superconductivity is observed and its fractional volume is reduced with increasing x, though the transition temperature of about 85 K is maintained. For x≧0.5 samples, the electrical resistivity behavior can be well described by the three-dimensional variable range hopping conduction, indicating that the system is essentially insulating. In this range of x, magnetic susceptibility shows spin-glass-type cusp at 13 K in the heating process after zero-field cooling and an enhanced cusp at 11 K in the field-cooling process. In the temperature range above about 150 K the Curie-Weiss dependence holds well with a positive paramagnetic Curie temperature, which increases to 40 K with increasing x in the insulating region.

Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

PubMed

Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

2006-04-01

A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

Effect of high energy ions on the electrical and morphological properties of Poly(3-Hexylthiophene) (P3HT) thin film

NASA Astrophysics Data System (ADS)

Sharma, Trupti; Singhal, R.; Vishnoi, R.; Sharma, G. D.; Biswas, S. K.

2018-05-01

The spin-coated thin films of Poly(3-Hexylthiophene) (P3HT) on the glass and Si (double side polished) substrates have been irradiated with 55 MeV Si+4 swift heavy ions (SHI) at fluences in the range from 1 × 1010 to 1 × 1012 ions/cm2. Structural modifications produced by energetic ions are observed by characterization of pristine and irradiated P3HT thin films. Different techniques like high-resolution X-ray diffraction (HR-XRD), micro-Raman spectroscopy and Fourier transform infrared spectroscopy (FTIR) were used to analyze the structural changes in the material. A significant increase in crystallinity and room temperature electrical conductivity of P3HT film has been detected on exposure to the heavy ions. The observed increase in the electrical conductivity with increased fluences is explained in the light of improved ordering of polymer chains after irradiation. Mott's variable range hopping model has been used to explain the conduction mechanism in the material in the temperature range of 230-350 K. The modification in surface properties also observed using AFM analysis and contact angle measurement. It is observed that nature of the P3HT thin films remains hydrophobic after irradiation.

A study of H and D doped ZnO epitaxial films grown by pulsed laser deposition

NASA Astrophysics Data System (ADS)

Li, Y. J.; Kaspar, T. C.; Droubay, T. C.; Joly, A. G.; Nachimuthu, P.; Zhu, Z.; Shutthanandan, V.; Chambers, S. A.

2008-09-01

We examine the crystal structure and electrical and optical properties of ZnO epitaxial films grown by pulsed laser deposition in a H2 or D2 ambient. n-type electrical conductivity is enhanced by three orders of magnitude as a result of growing in H2 (D2) compared to ZnO films grown in O2. Hall effect measurements reveal very small carrier activation energies and carrier concentrations in the mid-1018 cm-3 range. Optical absorption measurements show that the enhanced conductivity is not a result of ZnO reduction and interstitial Zn formation. Photoluminescence spectra suggest excitonic emission associated with exciton-hydrogen donor complex formation and show no evidence for midgap emission resulting from defects. We have modeled the transport properties of H (D) doped ZnO films using variable range hopping and surface layer conductivity models, but our data do not fit well with these models. Rather, it appears that growth in H2 (D2) promotes the formation of an exceedingly shallow donor state not seen in ZnO crystals annealed in H2 after growth. This new state may be associated with H (D) substitution at O sites in the lattice.

Dielectric relaxation dynamics and AC conductivity scaling of metal-organic framework (MOF-5) based polymer electrolyte nanocomposites incorporated with ionic liquid

NASA Astrophysics Data System (ADS)

Dutta, Rituraj; Kumar, A.

2017-10-01

Dielectric relaxation dynamics and AC conductivity scaling of a metal-organic framework (MOF-5) based poly (vinylidene fluoride-co-hexafluoropropylene) (PVdf-HFP) incorporated with 1-Butyl-3-methylimidazolium hexafluorophosphate have been studied over a frequency range of 40 Hz-5 MHz and in the temperature range of 300 K-380 K. High values of dielectric permittivity (~{{\\varepsilon }\\prime} ) having strong dispersion are obtained at low frequency because of interfacial polarization. The real part of the dielectric modulus spectra (M‧) shows no prominent peak, whereas the imaginary part (M″) shows certain peaks, with a reduction in relaxation time (τ) that can be attributed to a non-Debye relaxation mechanism. The spectra also depict both concentration- and temperature-independent scaling behavior. The power law dependent variation of AC conductivity follows the jump relaxation model and reveals activated ion hopping over diffusion barriers. The value of the frequency exponent is observed to decrease with increasing concentration of ionic liquid, indicating the forward hopping of ions in the relaxation process. The AC conductivity scaling curves at different temperatures also depict the temperature-independent relaxation dynamics.

AC and DC conductivity due to hopping mechanism in double ion doped ceramics

NASA Astrophysics Data System (ADS)

Rizwana, Mahboob, Syed; Sarah, P.

2018-04-01

Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.

A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

PubMed Central

Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

2010-01-01

Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

Go with your gut: Digestibility and digestive function of two arid-zone Australian murids, Pseudomys australis and Notomys alexis.

PubMed

Stannard, Hayley J; Tulk, Melissa L; Bortolazzo, Melissa J; Old, Julie M

2018-06-01

Spinifex hopping-mice (Notomys alexis) and plains mice (Pseudomys australis) are able to successfully occupy arid zones of Australia. We studied the digestive parameters and energy assimilation of captive spinifex hopping-mice and plains mice. The experiment consisted of six diets fed to the animals for periods of 12days per food type. On a dry matter basis, the plains mice consumed between 2.5 and 7.2% and the hopping-mice between 5.8 and 9.3% of their body mass in food per day. The body mass of the spinifex hopping-mice increased significantly on the sunflower seed diet, while body mass did not change significantly for the plains mice on any diet. Apparent digestibility of macronutrients was similar in the hopping-mice and plains mice when maintained on the same diet, however digestibility of total micronutrients differed. Maintenance energy requirements for the plains mice were 529kJkg -0.75 d -1 and spinifex hopping-mice 550kJkg -0.75 d -1 . Spinifex hopping-mice and plains mice are able to exploit a range of food items and efficiently digest macronutrients, to ensure they meet their nutritional needs, an ability they require in the variable arid environment. The information gained in this study increases the paucity of information on Australian native murids, specifically their digestive function and energy requirements, and will aid captive murid management. The study will allow future expansion into field studies, to aid the conservation of wild rodent diets and nutrition of arid zone murids. Copyright © 2018 Elsevier GmbH. All rights reserved.

Crystal growth and magneto-transport behavior of PdS1-δ

NASA Astrophysics Data System (ADS)

Cao, Lin; Lv, Yang-Yang; Chen, Si-Si; Li, Xiao; Zhou, Jian; Yao, Shu-Hua; Chen, Y. B.; Lu, Minghui; Chen, Yan-Feng

2018-04-01

PdS is theoretically proposed to novel topological material with eight-band fermions. Here, PdS1-δ crystals were successfully grown from KI as solvent by modified flux method. The single crystalline quality and compositional homogeneity of grown PdS1-δ are characterized by X-ray diffraction and energy dispersion spectroscopy. Temperature dependent electrical transport property of PdS1-δ demonstrates a semiconductor-like behavior. Analysis of temperature-dependent resistance indicates that there is variable-range-hopping behavior at low temperature. The clear negative MR of PdS1-δ single crystals is measured at the low temperature (<30 K), which may be ascribed to the interaction between conducting carriers and localized moments. however, the magneto-transport results have not shown the clues of topological feature of PdS.

Spin-orbit interaction and negative magnetoresistance for localized electrons in InSb quantum wells

NASA Astrophysics Data System (ADS)

Ishida, S.; Manago, T.; Nishizako, N.; Geka, H.; Shibasaki, I.

2010-02-01

Weak-field magnetoresistance (MR) in the variable-range hopping (VRH) in the presence of spin-orbit interaction (SOI) for 2DEGs at the hetero-interface of InSb quantum wells was examined in view of the quantum interference (QI) effect. Samples with the sheet resistance, ρ> ρc= h/ e2, exhibit VRH, while those with ρ< ρc exhibit weak localiz ation (WL) at low temperatures, where h/ e2 is the quantum resistance. In the WL regime, a positive magnetoresistance (MR) peak due to the weak anti-localization (WAL) with SOI is clearly observed in low magnetic field. In contrast, the low-field hopping MR remains entirely negative surviving the SOI, indicating that the hopping MR due to the QI is completely negative regardless of the SOI. This result supports the predictions based on the directed-path approach for forward-scattering paths ignoring the back-scattering return loops for the QI in the VRH.

Interplay of long-range and short-range Coulomb interactions in an Anderson-Mott insulator

NASA Astrophysics Data System (ADS)

Baćani, Mirko; Novak, Mario; Orbanić, Filip; Prša, Krunoslav; Kokanović, Ivan; Babić, Dinko

2017-07-01

In this paper, we tackle the complexity of coexisting disorder and Coulomb electron-electron interactions (CEEIs) in solids by addressing a strongly disordered system with intricate CEEIs and a screening that changes both with charge carrier doping level Q and temperature T . We report on an experimental comparative study of the T dependencies of the electrical conductivity σ and magnetic susceptibility χ of polyaniline pellets doped with dodecylbenzenesulfonic acid over a wide range. This material is special within the class of doped polyaniline by exhibiting in the electronic transport a crossover between a low-T variable range hopping (VRH) and a high-T nearest-neighbor hopping (NNH) well below room temperature. Moreover, there is evidence of a soft Coulomb gap ΔC in the disorder band, which implies the existence of a long-range CEEI. Simultaneously, there is an onsite CEEI manifested as a Hubbard gap U and originating in the electronic structure of doped polyaniline, which consists of localized electron states with dynamically varying occupancy. Therefore, our samples represent an Anderson-Mott insulator in which long-range and short-range CEEIs coexist. The main result of the study is the presence of a crossover between low- and high-T regimes not only in σ (T ) but also in χ (T ) , the crossover temperature T* being essentially the same for both observables over the entire doping range. The relatively large electron localization length along the polymer chains results in U being small, between 12 and 20 meV for the high and low Q , respectively. Therefore, the thermal energy at T* is sufficiently large to lead to an effective closing of the Hubbard gap and the consequent appearance of NNH in the electronic transport within the disorder band. ΔC is considerably larger than U , decreasing from 190 to 30 meV as Q increases, and plays the role of an activation energy in the NNH.

Electronic and transport properties of Li-doped NiO epitaxial thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, J. Y.; Li, W. W.; Hoye, R. L. Z.

NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. Understanding and improving its optical and transport properties have been of considerable interest. In this work, we have investigated the effect of Li doping on the electronic, optical and transport properties of NiO epitaxial thin films grown by pulsed laser deposition. We show that Li doping significantly increases the p-type conductivity of NiO, but all the films have relatively low room-temperature mobilities (<0.05 cm2 V -1s -1). The conduction mechanism is better described by small-polaron hoping model in the temperaturemore » range of 200 K < T <330 K, and variable range hopping at T <200 K. A combination of x-ray photoemission and O K-edge x-ray absorption spectroscopic investigations reveal that the Fermi level gradually shifts toward the valence band maximum (VBM) and a new hole state develops with Li doping. Both the VBM and hole states are composed of primarily Zhang-Rice bound states, which accounts for the small polaron character (low mobility) of hole conduction. Our work provides guidelines for the search for p-type oxide materials and device optimization.NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. This work reports the controlling of conductivity and increase of work functions by Li doping.« less

Electrical conductivity and dielectric properties of TlInS2 single crystals

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.

2011-07-01

TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.

Electrical modulus and dielectric behavior of Cr3+ substituted Mg-Zn nanoferrites

NASA Astrophysics Data System (ADS)

Mansour, S. F.; Abdo, M. A.

2017-04-01

The dielectric parameters and ac electrical conductivity of Mg0.8Zn0.2CrxFe2-xO4; (0≤x≤0.025) nanoferrites synthesized citrate-nitrate auto-combustion method were studied using the complex impedance technique in the frequency and temperature ranges 4 Hz-5 MHz and 303-873 K respectively. Hopping of charge carriers plus interfacial polarization could interpret the behaviors of dielectric constant (ε‧), dielectric loss tangent (tanδ) and ac electrical conductivity (σac) with frequency, temperatures and composition. The up-normal behavior observed in tanδ trend with temperatures confirms the presence of relaxation loss (dipoles losses). Correlated barrier hopping (CBH) of electron is the conduction mechanism of the investigated nanoferrites. Cole-Cole plots at different temperatures emphasize the main role of grain and grain boundaries in the properties of the investigated nanoferrites. Cr3+ substitution can control the dielectric parameters and ac electrical conductivity of Mg-Zn nanoferrites making it candidates for versatile applications.

Nerve Conduction Through Dendrites via Proton Hopping.

PubMed

Kier, Lemont B

2017-01-01

In our previous studies of nerve conduction conducted by proton hopping, we have considered the axon, soma, synapse and the nodes of Ranvier. The role of proton hopping described the passage of information through each of these units of a typical nerve system. The synapse projects information from the axon to the dendrite and their associated spines. We have invoked the passage of protons via a hopping mechanism to illustrate the continuum of the impulse through the system, via the soma following the dendrites. This is proposed to be a continuum invoked by the proton hopping method. With the proposal of the activity through the dendrites, via proton hopping, a complete model of the nerve function is invoked. At each step to the way, a water pathway is present and is invoked in the proposed model as the carrier of the message via proton hopping. The importance of the dendrites is evident by the presence of a vast number of spines, each possessing the possibility to carry unique messages through the nervous system. With this model of the role of dendrites, functioning with the presence of proton hopping, a complete model of the nerve system is presented. The validity of this model will be available for further studies and models to assess it's validity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Development of NTD Ge Sensors for Superconducting Bolometer

NASA Astrophysics Data System (ADS)

Garai, A.; Mathimalar, S.; Singh, V.; Dokania, N.; Nanal, V.; Pillay, R. G.; Ramakrishnan, S.; Shrivastava, A.; Jagadeesan, K. C.; Thakare, S. V.

2016-08-01

Neutron transmutation-doped (NTD) Ge sensors have been prepared by irradiating device-grade Ge with thermal neutrons at Dhruva reactor, BARC, Mumbai. These sensors are intended to be used for the study of neutrinoless double beta decay in ^{124}Sn with a superconducting Tin bolometer. Resistance measurements are performed on NTD Ge sensors in the temperature range 100-350 mK. The observed temperature dependence is found to be consistent with the variable-range hopping mechanism.

Role of carrier density and disorder on anisotropic charge transport in polypyrrole

NASA Astrophysics Data System (ADS)

Varade, Vaibhav; Anjaneyulu, P.; Suchand Sangeeth, C. S.; Ramesh, K. P.; Menon, Reghu

2013-01-01

Polypyrrole (PPy) has been synthesized electrochemically on platinum substrate by varying synthesis temperature and dopant concentration. The charge transport in PPy has been investigated as a function of temperature for both in-plane and out-of-plane geometry in a wide temperature range of 5 K-300 K. The charge transport showed strong anisotropy and various mechanisms were used to explain the transport. The conductivity ratio, σr = σ(300 K)/σ(5 K) is calculated for each sample to quantify the relative disorder. At all the temperatures, the conductivity values for in-plane transport are found to be more for PPy synthesized at lower temperature, while the behavior is found to be different for out-of-plane transport. The carrier density is found to play a crucial role in case of in-plane transport. An effort has been made to correlate charge transport to morphology by analyzing temperature and frequency dependence of conductivity. Charge transport in lateral direction is found to be dominated by hopping whereas tunneling mechanisms are dominated in vertical direction. Parameters such as density of states at the Fermi level [N(EF)], average hopping distance (R), and average hopping energy (W) have been estimated for each samples in both geometry.

Low-temperature thermal transport and thermopower of monolayer transition metal dichalcogenide semiconductors

NASA Astrophysics Data System (ADS)

Sengupta, Parijat; Tan, Yaohua; Klimeck, Gerhard; Shi, Junxia

2017-10-01

We study the low temperature thermal conductivity of single-layer transition metal dichalcogenides (TMDCs). In the low temperature regime where heat is carried primarily through transport of electrons, thermal conductivity is linked to electrical conductivity through the Wiedemann-Franz law (WFL). Using a k.p Hamiltonian that describes the K and K{\\prime} valley edges, we compute the zero-frequency electric (Drude) conductivity using the Kubo formula to obtain a numerical estimate for the thermal conductivity. The impurity scattering determined transit time of electrons which enters the Drude expression is evaluated within the self-consistent Born approximation. The analytic expressions derived show that low temperature thermal conductivity (1) is determined by the band gap at the valley edges in monolayer TMDCs and (2) in presence of disorder which can give rise to the variable range hopping regime, there is a distinct reduction. Additionally, we compute the Mott thermopower and demonstrate that under a high frequency light beam, a valley-resolved thermopower can be obtained. A closing summary reviews the implications of results followed by a brief discussion on applicability of the WFL and its breakdown in context of the presented calculations.

Etching-free patterning method for electrical characterization of atomically thin MoSe2 films grown by chemical vapor deposition

NASA Astrophysics Data System (ADS)

Utama, M. Iqbal Bakti; Lu, Xin; Zhan, Da; Ha, Son Tung; Yuan, Yanwen; Shen, Zexiang; Xiong, Qihua

2014-10-01

Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures.Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures. Electronic supplementary information (ESI) available: Further experiments on patterning and additional electrical characterizations data. See DOI: 10.1039/c4nr03817g

The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

NASA Astrophysics Data System (ADS)

Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

2018-04-01

For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

Near interface traps in SiO{sub 2}/4H-SiC metal-oxide-semiconductor field effect transistors monitored by temperature dependent gate current transient measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fiorenza, Patrick; La Magna, Antonino; Vivona, Marilena

This letter reports on the impact of gate oxide trapping states on the conduction mechanisms in SiO{sub 2}/4H-SiC metal-oxide-semiconductor field effect transistors (MOSFETs). The phenomena were studied by gate current transient measurements, performed on n-channel MOSFETs operated in “gate-controlled-diode” configuration. The measurements revealed an anomalous non-steady conduction under negative bias (V{sub G} > |20 V|) through the SiO{sub 2}/4H-SiC interface. The phenomenon was explained by the coexistence of a electron variable range hopping and a hole Fowler-Nordheim (FN) tunnelling. A semi-empirical modified FN model with a time-depended electric field is used to estimate the near interface traps in the gate oxide (N{sub trap} ∼ 2 × 10{supmore » 11} cm{sup −2}).« less

A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

PubMed

Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

2018-05-08

With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

Structural versus electrical properties of an organic-inorganic hybrid material based on sulfate

NASA Astrophysics Data System (ADS)

Ben Rached, Asma; Guionneau, Philippe; Lebraud, Eric; Mhiri, Tahar; Elaoud, Zakaria

2017-01-01

A new organo-sulfate compound is obtained by slow evaporation at room temperature and is characterized by powder and single-crystal X-ray diffraction (XRD) at variable temperatures. The benzylammonium monohydrogenosulfate of formula C6H5CH2NH3+. HSO4-, denoted (BAS), crystallizes in the monoclinic system P21/c space group with the following parameters at room temperature: a=5.623(5)Å, b=20.239(5) Å, c=8.188(5)Å, β=94.104(5)°. The crystal structure consists of infinite parallel two-dimensional planes built by HSO4- anions and C6H5CH2NH3+ cations interconnected by strong O-H….. O and N-H….. O hydrogen bonds. A phase transition is detected at 350 K by differential scanning calorimetry (DSC) and confirmed by powder XRD. Conductivity measurements using the impedance spectroscopy technique allow to determine the conductivity relaxation parameters associated with the H+ conduction from an analysis of the M"/M"max spectrum measured in a wide temperature range. Transport properties of this material appear to be due to an H+ ion hopping mechanism.

Direct evidence for double-exchange coupling in Ru- substituted La0.7Pb0.3Mn 1 - x Ru x O3, 0.0 <= x <= 0.4

NASA Astrophysics Data System (ADS)

Sundar Manoharan, S.; Sahu, R. K.; Rao, M. L.; Elefant, D.; Schneider, C. M.

2002-08-01

The La0.7Pb0.3Mn 1 - x Ru x O3 (0.0 <= x <= 0.4) system shows an innate relationship between Mn and Ru ions by a unique double-exchange mediated transport behavior. This is exonerated by the coexistence of Tp and Tc (range 330 K 245 K for 0.0 <= x <= 0.4). For Ru > 30%, the hole carrier mass influences the transport property. X-ray absorption spectra suggest that the Tc-Tp match is due to the transport mediated by the Mn3+/Mn4+ leftrightarrow Ru4+/Ru5+ redox pair and also due to the broad low-spin Ru:4d conduction band. For x > 0.2, T < 0.5Tc obeys a modified variable-range hopping model, where kT0 propto (M/Ms)2, suggesting a random magnetic potential which localizes the charge carriers.

Large effects of A-site average cation size on the properties of the double perovskites Ba2-xSrxMnReO6:  A d5-d1 system

NASA Astrophysics Data System (ADS)

Popov, Guerman; Greenblatt, Martha; Croft, Mark

2003-01-01

Ba2-xSrxMnReO6 (x=0, 0.5, 1, 2) phases with a double-perovskite structure were prepared by solid-state techniques in evacuated sealed silica tubes. Mn2+ and Re6+ are virtually completely ordered on the B sites. The compounds are ferrimagnetic below 120 K. The maximum saturation moment was obtained for a compound with x=0.5 whose tolerance factor is closest to 1. The whole series of compounds, 0.0⩽x⩽2.0, exhibits semiconducting behavior with variable-range hopping type of conduction. Sr2MnReO6 has an unusually high coercive field (2.6 T at 5 K) and two transitions in the M-H loop. Ba2MnReO6 shows large positive magnetoresistance (14% at 80 K, 5 T) below 140 K, while the other compositions studied exhibit negative magnetoresistance in the temperature range measured.

First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

USDA-ARS?s Scientific Manuscript database

Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

Microwave-Assisted Synthesis of Boron and Nitrogen co-doped Reduced Graphene Oxide for the Protection of Electromagnetic Radiation in Ku-Band.

PubMed

Umrao, Sima; Gupta, Tejendra K; Kumar, Shiv; Singh, Vijay K; Sultania, Manish K; Jung, Jung Hwan; Oh, Il-Kwon; Srivastava, Anchal

2015-09-09

The electromagnetic interference (EMI) shielding of reduced graphene oxide (MRG), B-doped MRG (B-MRG), N-doped MRG (N-MRG), and B-N co-doped MRG (B-N-MRG) have been studied in the Ku-band frequency range (12.8-18 GHz). We have developed a green, fast, and cost-effective microwave assisted route for synthesis of doped MRG. B-N-MRG shows high electrical conductivity in comparison to MRG, B-MRG and N-MRG, which results better electromagnetic interference (EMI) shielding ability. The co-doping of B and N significantly enhances the electrical conductivity of MRG from 21.4 to 124.4 Sm(-1) because N introduces electrons and B provides holes in the system and may form a nanojunction inside the material. Their temperature-dependent electrical conductivity follows 2D-variable range hopping (2D-VRH) and Efros-Shklovskii-VRH (ES-VRH) conduction model in a low temperature range (T<50 K). The spatial configuration of MRG after doping of B and N enhances the space charge polarization, natural resonance, dielectric polarization, and trapping of EM waves by internal reflection leading to a high EMI shielding of -42 dB (∼99.99% attenuation) compared to undoped MRG (-28 dB) at a critical thickness of 1.2 mm. Results suggest that the B-N-MRG has great potential as a candidate for a new type of EMI shielding material useful in aircraft, defense industries, communication systems, and stealth technology.

Anomalously small resistivity and thermopower of strongly compensated semiconductors and topological insulators

NASA Astrophysics Data System (ADS)

Chen, Tianran; Shklovskii, B. I.

2013-04-01

In the recent paper, we explained why the maximum bulk resistivity of topological insulators (TIs) such as Bi2Se3 is so small [B. Skinner, T. Chen, and B. I. Shklovskii, Phys. Rev. Lett.PRLTAO0031-900710.1103/PhysRevLett.109.176801 109, 176801 (2012)]. Using the model of completely compensated semiconductor we showed that when the Fermi level is pinned in the middle of the gap the activation energy of resistivity is Δ=0.3(Eg/2), where Eg is the semiconductor gap. In this paper, we consider a strongly compensated n-type semiconductor. We find the position of the Fermi level μ calculated from the bottom of the conduction band Ec and the activation energy of resistivity Δ as a function of compensation K, and show that Δ=0.3(Ec-μ) holds at any 0<1-K≪1. In the same range of relatively high temperatures, the Peltier energy (heat) Π is even smaller: Π≃Δ/2=0.15(Ec-μ). We also show that at low temperatures, the activated conductivity crosses over to variable range hopping (VRH) and find the characteristic temperature of VRH, TES, as a function of K.

Low-temperature thermoelectric properties of Pb doped Cu2SnSe3

NASA Astrophysics Data System (ADS)

Prasad K, Shyam; Rao, Ashok; Gahtori, Bhasker; Bathula, Sivaiah; Dhar, Ajay; Chang, Chia-Chi; Kuo, Yung-Kang

2017-09-01

A series of Cu2Sn1-xPbxSe3 (0 ≤ x ≤ 0.04) compounds was prepared by solid state synthesis technique. The electrical resistivity (ρ) decreased with increase in Pb content up to x = 0.01, thereafter it increased with further increase in x (till x = 0.03). However, the lowest value of electrical resistivity is observed for Cu2Sn0.96Pb0.04Se3. Analysis of electrical resistivity of all the samples suggests that small poloron hoping model is operative in the high temperature regime while variable range hopping is effective in the low temperature regime. The positive Seebeck coefficient (S) for pristine and doped samples in the entire temperature range indicates that the majority charge carriers are holes. The electronic thermal conductivity (κe) of the Cu2Sn1-xPbxSe3 compounds was estimated by the Wiedemann-Franz law and found that the contribution from κe is less than 1% of the total thermal conductivity (κ). The highest ZT 0.013 was achieved at 400 K for the sample Cu2Sn0.98Pb0.02Se3, about 30% enhancement as compared to the pristine sample.

Gap state analysis in electric-field-induced band gap for bilayer graphene.

PubMed

Kanayama, Kaoru; Nagashio, Kosuke

2015-10-29

The origin of the low current on/off ratio at room temperature in dual-gated bilayer graphene field-effect transistors is considered to be the variable range hopping in gap states. However, the quantitative estimation of gap states has not been conducted. Here, we report the systematic estimation of the energy gap by both quantum capacitance and transport measurements and the density of states for gap states by the conductance method. An energy gap of ~ 250 meV is obtained at the maximum displacement field of ~ 3.1 V/nm, where the current on/off ratio of ~ 3 × 10(3) is demonstrated at 20 K. The density of states for the gap states are in the range from the latter half of 10(12) to 10(13) eV(-1) cm(-2). Although the large amount of gap states at the interface of high-k oxide/bilayer graphene limits the current on/off ratio at present, our results suggest that the reduction of gap states below ~ 10(11) eV(-1) cm(-2) by continual improvement of the gate stack makes bilayer graphene a promising candidate for future nanoelectronic device applications.

Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment

NASA Astrophysics Data System (ADS)

Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan

2006-10-01

The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.

AC conductivity and dielectric behavior of bulk Furfurylidenemalononitrile

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.

2012-06-01

AC conductivity and dielectric behavior for bulk Furfurylidenemalononitrile have been studied over a temperature range (293-333 K) and frequency range (50-5×106 Hz). The frequency dependence of ac conductivity, σac, has been investigated by the universal power law, σac(ω)=Aωs. The variation of the frequency exponent (s) with temperature was analyzed in terms of different conduction mechanisms, and it was found that the correlated barrier hopping (CBH) model is the predominant conduction mechanism. The temperature dependence of σac(ω) showed a linear increase with the increase in temperature at different frequencies. The ac activation energy was determined at different frequencies. Dielectric data were analyzed using complex permittivity and complex electric modulus for bulk Furfurylidenemalononitrile at various temperatures.

The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

NASA Astrophysics Data System (ADS)

Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

2014-11-01

Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB2 has a very high bulk glass transition temperature Tg, and we observe no three-state hopping or sequential two-state hopping previously seen on lower Tg glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Duc; Girolami, Gregory S.; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB{sub 2} glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunnelingmore » spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB{sub 2} has a very high bulk glass transition temperature T{sub g}, and we observe no three-state hopping or sequential two-state hopping previously seen on lower T{sub g} glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses.« less

"Makin' Somethin' Outta Little-to-Nufin'': Racism, Revision and Rotating Records--The Hip-Hop DJ in Composition Praxis

ERIC Educational Resources Information Center

Craig, Todd

2015-01-01

Prompted by a moment in the classroom in which the DJ becomes integral for the writing instructor, this article looks at how the hip-hop DJ and hip-hop DJ/Producer become the intrinsic examples for first-year college writing students to think about how they conduct revision in their writing. After a review of two seminal hip-hop books and other…

Climate, weather, and hops

USDA-ARS?s Scientific Manuscript database

As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

Electrically Detected Study of Variable Range Hopping in Silicon Nitrides

NASA Astrophysics Data System (ADS)

Waskiewicz, Ryan; Mutch, Michael; Lenahan, Patrick; King, Sean

Electrically detected magnetic resonance (EDMR) offers greatly improved sensitivity over conventional electron paramagnetic resonance (EPR) studies in semiconductor/insulator systems; in EDMR measurements, one observes EPR via changes in device currents which are spin-dependent. In our study, we observe EDMR via spin-dependent trap assisted tunneling (SDTAT) via variable range hopping (VRH) through stoichiometric silicon nitride dielectric films. In these films, leakage current effectively changes at resonance. In our study, we have investigated the EDMR response as a function of dielectric electric field and temperature for films of various thicknesses. We believe that these measurements allow us to identify the defects responsible for transport in such these thin films using EDMR and to some extent measure the distances between the defects. The separation between the defects can, at least in principle, be measured using the recently demonstrated half-field EDMR response and we can also count total number of spins responsible for transport through dielectric films. Although we present results only on silicon nitride thin films, we believe that the approach utilized will be widely applicable to other dielectric films in which electronic transport is of interest. This project is sponsored in part by Intel Corporation and in part by the Department of Defense, Defense Threat Reduction Agency under Grant Number HDTRA1-16-0008.

Wheeled hopping robot

DOEpatents

Fischer, Gary J [Albuquerque, NM

2010-08-17

The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

AC conductivity and dielectric properties of bulk tungsten trioxide (WO3)

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.; Saadeldin, M.; Zaghllol, M.

2012-11-01

AC conductivity and dielectric properties of tungsten trioxide (WO3) in a pellet form were studied in the frequency range from 42 Hz to 5 MHz with a variation of temperature in the range from 303 K to 463 K. AC conductivity, σac(ω) was found to be a function of ωs where ω is the angular frequency and s is the frequency exponent. The values of s were found to be less than unity and decrease with increasing temperature, which supports the correlated barrier hopping mechanism (CBH) as the dominant mechanism for the conduction in WO3. The dielectric constant (ε‧) and dielectric loss (ε″) were measured. The Cole-Cole diagram determined complex impedance for different temperatures.

Variable-range-hopping magnetoresistance

NASA Astrophysics Data System (ADS)

Azbel, Mark Ya

1991-03-01

The hopping magnetoresistance R of a two-dimensional insulator with metallic impurities is considered. In sufficiently weak magnetic fields it increases or decreases depending on the impurity density n: It decreases if n is low and increases if n is high. In high magnetic fields B, it always exponentially increases with √B . Such fields yield a one-dimensional temperature dependence: lnR~1/ √T . The calculation provides an accurate leading approximation for small impurities with one eigenstate in their potential well. In the limit of infinitesimally small impurities, an impurity potential is described by a generalized function. This function, similar to a δ function, is localized at a point, but, contrary to a δ function in the dimensionality above 1, it has finite eigenenergies. Such functions may be helpful in the study of scattering and localization of any waves.

Spin diffusion in disordered organic semiconductors

NASA Astrophysics Data System (ADS)

Li, Ling; Gao, Nan; Lu, Nianduan; Liu, Ming; Bässler, Heinz

2015-12-01

An analytical theory for spin diffusion in disordered organic semiconductors is derived. It is based on percolation theory and variable range hopping in a disordered energy landscape with a Gaussian density of states. It describes universally the dependence of the spin diffusion on temperature, carrier density, material disorder, magnetic field, and electric field at the arbitrary magnitude of the Hubbard energy of charge pairs. It is found that, compared to the spin transport carried by carriers hopping, the spin exchange will hinder the spin diffusion process at low carrier density, even under the condition of a weak electric field. Importantly, under the influence of a bias voltage, anomalous spreading of the spin packet will lead to an abnormal temperature dependence of the spin diffusion coefficient and diffusion length. This explains the recent experimental data for spin diffusion length observed in Alq3.

Harvesting electricity from human hair.

PubMed

Tulachan, Brindan; Singh, Sushil K; Philip, Deepu; Das, Mainak

2016-01-01

Electrical conductivity of human hair is a debatable issue among hair experts and scientists. There are unsubstantiated claims that hair conducts electricity. However, hair experts provided ample evidence that hair is an insulator. Although wet hair exhibited drastic reduction in resistivity; scientists regarded hair as a proton semiconductor at the best. Here, we demonstrate that hair filaments generate electricity on absorbing water vapor between 50 degrees and 80 degrees C. This electricity can operate low power electronic systems. Essentially, we are exposing the hydrated hair polymer to a high temperature (50 degrees-80 degrees C). It has long been speculated that when certain biopolymers are simultaneously hydrated and exposed to high temperature, they exhibit significant proton hopping at a specific temperature regime. This happens due to rapid movement of water molecules on the polymer surface. This lead us to speculate that the observed flow of current is partly ionic and partly due to "proton hopping" in the hydrated nano spaces of hair filament. Such proton hopping is exceptionally high when the hydrated hair polymer is exposed to a temperature between 50 degrees and 80 degrees C. Differential scanning calorimetry data further corroborated the results and indicated that indeed at this temperature range, there is an enormous movement of water molecules on the hair polymer surface. This enormously rapid movement of water molecules lead to the "making and breaking" of innumerable hydrogen bonds and thus resulting in hopping of the protons. What is challenging is "how to tap these hopping protons to obtain useful electricity?" We achieved this by placing a bundle of hair between two different electrodes having different electro negativities, and exposing it to water vapor (water + heat). The two different electrodes offered directionality to the hopping protons and the existing ions and thus resulting in the generation of useful current. Further, by continuously hydrating the polymer with water vapor, we prolonged the process. If this interesting aspect of polymer is exploited further and fine tuned, then it will open new avenues for development of sophisticated polymer-based systems, which could be used to harvest electricity from waste heat.

Variable tunneling barriers in FEBID based PtC metal-matrix nanocomposites as a transducing element for humidity sensing.

PubMed

Kolb, Florian; Schmoltner, Kerstin; Huth, Michael; Hohenau, Andreas; Krenn, Joachim; Klug, Andreas; List, Emil J W; Plank, Harald

2013-08-02

The development of simple gas sensing concepts is still of great interest for science and technology. The demands on an ideal device would be a single-step fabrication method providing a device which is sensitive, analyte-selective, quantitative, and reversible without special operating/reformation conditions such as high temperatures or special environments. In this study we demonstrate a new gas sensing concept based on a nanosized PtC metal-matrix system fabricated in a single step via focused electron beam induced deposition (FEBID). The sensors react selectively on polar H2O molecules quantitatively and reversibly without any special reformation conditions after detection events, whereas non-polar species (O2, CO2, N2) produce no response. The key elements are isolated Pt nanograins (2-3 nm) which are embedded in a dielectric carbon matrix. The electrical transport in such materials is based on tunneling effects in the correlated variable range hopping regime, where the dielectric carbon matrix screens the electric field between the particles, which governs the final conductivity. The specific change of these dielectric properties by the physisorption of polar gas molecules (H2O) can change the tunneling probability and thus the overall conductivity, allowing their application as a simple and straightforward sensing concept.

Leg kinematics and kinetics in landing from a single-leg hop for distance. A comparison between dominant and non-dominant leg.

PubMed

van der Harst, J J; Gokeler, A; Hof, A L

2007-07-01

Anterior cruciate ligament (ACL) deficiency can be a major problem for athletes and subsequent reconstruction of the ACL may be indicated if a conservative regimen has failed. After ACL reconstruction signs of abnormality in the use of the leg remain for a long time. It is expected that the landing after a single-leg hop for distance (horizontal hop) might give insight in the differences in kinematics and kinetics between uninjured legs and ACL-reconstructed legs. Before the ACL-reconstructed leg can be compared with the contralateral leg, knowledge of differences between legs of uninjured subjects is needed. Kinematic and kinetic variables of both legs were measured with an optoelectronic system and a force plate and calculated by inverse dynamics. The dominant leg (the leg with biggest horizontal hop distance) and the contralateral leg of nine uninjured subjects were compared. No significant differences were found in most of the kinematic and kinetic variables between dominant leg and contralateral leg of uninjured subjects. Only hop distance and hip extension angles differed significantly. This study suggests that there are no important differences between dominant leg and contralateral leg in healthy subjects. As a consequence, the uninvolved leg of ACL-reconstructed patients can be used as a reference. The observed variables of this study can be used as a reference of normal values and normal differences between legs in healthy subjects.

Electrical conduction mechanism and dielectric characterization of MnTPPCl thin films

NASA Astrophysics Data System (ADS)

Meikhail, M. S.; Oraby, A. H.; El-Nahass, M. M.; Zeyada, H. M.; Al-Muntaser, A. A.

2018-06-01

The AC conductivity and dielectric properties of MnTPPCl sandwich structure as Au/MnTPPCl/Au were studied. The conductivity of the MnTPPCl thin films have been interpreted by the correlated barrier hopping (CBH) model. The dominant conduction process have found to be the single polaron hopping conduction. The values of the hopping distance, Rω, barrier height, W, and the localized-state density, N, are estimated at different frequencies. The behavior of dielectric constant and dielectric loss was discussed as a function of temperature and frequency. The dielectric constant was described in terms of polarization mechanism in materials. The spectral behavior of dielectric loss is interpreted on the basis of the Giuntini et al. model [1]. The value of WM is obtained as 0.32 eV. A non-Debye relaxation phenomenon was observed from the dielectric relaxation mechanism.

Intensity-level assessment of lower body plyometric exercises based on mechanical output of lower limb joints.

PubMed

Sugisaki, Norihide; Okada, Junichi; Kanehisa, Hiroaki

2013-01-01

The present study aimed to quantify the intensity of lower extremity plyometric exercises by determining joint mechanical output. Ten men (age, 27.3 ± 4.1 years; height, 173.6 ± 5.4 cm; weight, 69.4 ± 6.0 kg; 1-repetition maximum [1RM] load in back squat 118.5 ± 12.0 kg) performed the following seven plyometric exercises: two-foot ankle hop, repeated squat jump, double-leg hop, depth jumps from 30 and 60 cm, and single-leg and double-leg tuck jumps. Mechanical output variables (torque, angular impulse, power, and work) at the lower limb joints were determined using inverse-dynamics analysis. For all measured variables, ANOVA revealed significant main effects of exercise type for all joints (P < 0.05) along with significant interactions between joint and exercise (P < 0.01), indicating that the influence of exercise type on mechanical output varied among joints. Paired comparisons revealed that there were marked differences in mechanical output at the ankle and hip joints; most of the variables at the ankle joint were greatest for two-foot ankle hop and tuck jumps, while most hip joint variables were greatest for repeated squat jump or double-leg hop. The present results indicate the necessity for determining mechanical output for each joint when evaluating the intensity of plyometric exercises.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Differences between direct current and alternating current capacitance nonlinearities in high-k dielectrics and their relation to hopping conduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khaldi, O.; Kassmi, M.; El Manar University, LMOP, 2092 Tunis

2014-08-28

Capacitance nonlinearities were studied in atomic layer deposited HfO{sub 2} films using two types of signals: a pure ac voltage of large magnitude (ac nonlinearities) and a small ac voltage superimposed to a large dc voltage (dc nonlinearities). In theory, ac and dc nonlinearities should be of the same order of magnitude. However, in practice, ac nonlinearities are found to be an order of magnitude higher than dc nonlinearities. Besides capacitance nonlinearities, hopping conduction is studied using low-frequency impedance measurements and is discussed through the correlated barrier hopping model. The link between hopping and nonlinearity is established. The ac nonlinearitiesmore » are ascribed to the polarization of isolated defect pairs, while dc nonlinearities are attributed to electrode polarization which originates from defect percolation paths. Both the ac and dc capacitance nonlinearities display an exponential variation with voltage, which results from field-induced lowering of the hopping barrier energy.« less

Crossover from Polaronic to Magnetically Phase-Separated Behavior in La1-xSrxCoO3

NASA Astrophysics Data System (ADS)

Phelan, D.; El Khatib, S.; Wang, S.; Barker, J.; Zhao, J.; Zheng, H.; Mitchell, J. F.; Leighton, C.

2013-03-01

Dilute hole-doping in La1-xSrxCoO3 leads to the formation of ``spin-state polarons'' where a non-zero spin-state is stabilized on the nearest Co3+ ions surrounding a hole. Here, we discuss the development of electronic/magnetic properties of this system from non-magnetic x=0, through the regime of spin-state polarons, and into the region where longer-range spin correlations and phase separation develop. We present magnetometry, transport, heat capacity, and small-angle neutron scattering (SANS) on single crystals. Magnetometry indicates a crossover with x from Langevin-like behavior (polaronic) to a state with a freezing temperature and finite coercivity. Fascinating correlations with this behavior are seen in transport measurements, the evolution from polaronic to clustered states being accompanied by a crossover from Mott variable range hopping to intercluster hopping. SANS data shows Lorentzian scattering from short-range ferromagnetic clusters first emerging around x = 0.03 with correlation lengths of order two unit cells. We argue that this system provides a unique opportunity to understand in detail the crossover from polaronic to truly phase-separated states.

Theory of quantum metal to superconductor transitions in highly conducting systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spivak, B.

2010-04-06

We derive the theory of the quantum (zero temperature) superconductor to metal transition in disordered materials when the resistance of the normal metal near criticality is small compared to the quantum of resistivity. This can occur most readily in situations in which 'Anderson's theorem' does not apply. We explicitly study the transition in superconductor-metal composites, in an swave superconducting film in the presence of a magnetic field, and in a low temperature disordered d-wave superconductor. Near the point of the transition, the distribution of the superconducting order parameter is highly inhomogeneous. To describe this situation we employ a procedure whichmore » is similar to that introduced by Mott for description of the temperature dependence of the variable range hopping conduction. As the system approaches the point of the transition from the metal to the superconductor, the conductivity of the system diverges, and the Wiedemann-Franz law is violated. In the case of d-wave (or other exotic) superconductors we predict the existence of (at least) two sequential transitions as a function of increasing disorder: a d-wave to s-wave, and then an s-wave to metal transition.« less

Magneto-transport of highly conductive carbon nanotube assemblies under high-field

NASA Astrophysics Data System (ADS)

Bulmer, John; Lekawa-Raus, Agnieszka; Koziol, Krzysztof; ECNM Group Team

2014-03-01

The magneto-transport response of carbon nanotube (CNT) assemblies has a resistance decrease with magnetic field, which is typically followed by a resistance increase with higher field. These negative and positive components of the magneto-resistance are from, respectively, suppression of weak localization and suppression of inter-tube coupling brought on by the magnetic restriction of the electron wave function. Recently, highly conductive CNT films, which were either doped or enriched with metallic chiralities, showed only a decrease in resistance with field and indicate that the extent of carrier delocalization is beyond individual CNTs. These magneto-transport measurements, however, were no greater then approximately 12 T and it is not clear when or if the magneto-resistance will go positive. In this study we prepared highly conductive single wall CNT films that have been either heavily doped, enriched with metallic chiralities, highly aligned, or a combination of these three. The magneto-resistance was measured up to 65 T with temperatures down to 2 K. The most metallic-like samples had the greatest delay in the positive magneto-resistance upturn. Fluctuation induced tunneling, variable range hopping, and weak localization models were each considered to quantitatively evaluate the transport behavior. http://www.kkoziol.org/index.html

Zinc chloride modified electronic transport and relaxation studies in barium-tellurite glasses

NASA Astrophysics Data System (ADS)

Dhankhar, Sunil; Kundu, R. S.; Rani, Sunita; Sharma, Preeti; Murugavel, S.; Punia, Rajesh; Kishore, N.

2017-09-01

The ac conductivity of halide based tellurium glasses having composition 70 TeO2-(30-x) BaO-x ZnCl2; x = 5, 10, 15, 20 and 25 has been investigated in the frequency range 10-1 Hz to 105Hz and in the temperature range 453 K to 553 K. The frequency and temperature dependent ac conductivity show mixed behaviour with increase in halide content and found to obey Jonscher's universal power law. The values of dc conductivity, crossover frequency and frequency exponent have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. For determining the conduction mechanism in studied glass system, frequency exponent has been analyzed by various theoretical models. In presently studied glasses, the ac conduction takes place via overlapping large polaron tunneling (OLPT). The values of activation energy for dc conduction (W) and the one associated with relaxation process ( E R) are found to increase with increase in x up to glass sample with x = 15 and thereafter it decrease with increase in zinc chloride content. DC conduction takes place via variable range hopping (VRH) as proposed by Mott with some modification suggested by Punia et al. The value of real part of modulus ( M') is observed to decrease with increase in temperature. The value of stretched exponent (β) obtained from fitting of M'' reveals the presence of non-Debye type of relaxation in presently studied glass samples. Scaling spectra of ac conductivity and values of electric modulus ( M' and M'') collapse into a single master curve for all the compositions and temperatures. The values of relaxation energy ( E R) for all the studied glass compositions are almost equal to W, suggesting that polarons have to overcome same barrier while relaxing and conducting. The conduction and relaxation processes in the studied glass samples are composition and temperature independent. [Figure not available: see fulltext.

Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

PubMed

Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

2018-03-30

Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

Hopping robot

DOEpatents

Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.

2001-01-01

The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.

Effect of rare-earth substitution at La-site on structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds (x = 0, 0.2, 0.3; RE = Eu, Gd, Y)

NASA Astrophysics Data System (ADS)

Choudhary, Y. R. S.; Mangavati, Suraj; Patil, Siddanagouda; Rao, Ashok; Nagaraja, B. S.; Thomas, Riya; Okram, G. S.; Kini, Savitha G.

2018-04-01

In the present communication, we present results on the effect of rare-earth (RE) substitution at La-site on the structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds. The lattice parameters are observed to decrease with RE-doping which is attributed to the fact that the substituted RE ions (RE = Eu, Gd and Y) are smaller than that of La ion. In high temperature semiconducting regime, small polaron hopping (SPH) model is valid, whereas, variable hopping model is valid in low temperature metallic region. The resistivity in the entire temperature range follows percolation model. All the samples exhibit sign reversal in thermopower, S. From temperature dependent S data, it is seen that SPH model is applicable in high temperature regime.

From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

NASA Astrophysics Data System (ADS)

Dolberry, Maurice E.

Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

PubMed

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-09-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

PubMed Central

Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

2016-01-01

[Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

Impedance Spectroscopy and AC Conductivity Studies of Bulk 3-Amino-7-(dimethylamino)-2-methyl-hydrochloride

NASA Astrophysics Data System (ADS)

El-Shabaan, M. M.

2018-02-01

Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.

Duality in Power-Law Localization in Disordered One-Dimensional Systems

NASA Astrophysics Data System (ADS)

Deng, X.; Kravtsov, V. E.; Shlyapnikov, G. V.; Santos, L.

2018-03-01

The transport of excitations between pinned particles in many physical systems may be mapped to single-particle models with power-law hopping, 1 /ra . For randomly spaced particles, these models present an effective peculiar disorder that leads to surprising localization properties. We show that in one-dimensional systems almost all eigenstates (except for a few states close to the ground state) are power-law localized for any value of a >0 . Moreover, we show that our model is an example of a new universality class of models with power-law hopping, characterized by a duality between systems with long-range hops (a <1 ) and short-range hops (a >1 ), in which the wave function amplitude falls off algebraically with the same power γ from the localization center.

The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

PubMed

Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

2016-08-15

Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural and electrical properties of conducting diamond nanowires.

PubMed

Sankaran, Kamatchi Jothiramalingam; Lin, Yen-Fu; Jian, Wen-Bin; Chen, Huang-Chin; Panda, Kalpataru; Sundaravel, Balakrishnan; Dong, Chung-Li; Tai, Nyan-Hwa; Lin, I-Nan

2013-02-01

Conducting diamond nanowires (DNWs) films have been synthesized by N₂-based microwave plasma enhanced chemical vapor deposition. The incorporation of nitrogen into DNWs films is examined by C 1s X-ray photoemission spectroscopy and morphology of DNWs is discerned using field-emission scanning electron microscopy and transmission electron microscopy (TEM). The electron diffraction pattern, the visible-Raman spectroscopy, and the near-edge X-ray absorption fine structure spectroscopy display the coexistence of sp³ diamond and sp² graphitic phases in DNWs films. In addition, the microstructure investigation, carried out by high-resolution TEM with Fourier transformed pattern, indicates diamond grains and graphitic grain boundaries on surface of DNWs. The same result is confirmed by scanning tunneling microscopy and scanning tunneling spectroscopy (STS). Furthermore, the STS spectra of current-voltage curves discover a high tunneling current at the position near the graphitic grain boundaries. These highly conducting regimes of grain boundaries form effective electron paths and its transport mechanism is explained by the three-dimensional (3D) Mott's variable range hopping in a wide temperature from 300 to 20 K. Interestingly, this specific feature of high conducting grain boundaries of DNWs demonstrates a high efficiency in field emission and pave a way to the next generation of high-definition flat panel displays or plasma devices.

Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

PubMed

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors

NASA Astrophysics Data System (ADS)

Marple, M. A. T.; Avila-Paredes, H.; Kim, S.; Sen, S.

2018-05-01

A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

Atomistic interpretation of the ac-dc crossover frequency in crystalline and glassy ionic conductors.

PubMed

Marple, M A T; Avila-Paredes, H; Kim, S; Sen, S

2018-05-28

A comprehensive analysis of the ionic dynamics in a wide variety of crystalline and glassy ionic conductors, obtained in recent studies using a combination of electrochemical impedance and nuclear magnetic resonance spectroscopic techniques, is presented. These results demonstrate that the crossover frequency, between the frequency-independent dc conductivity and the frequency-dependent ac conductivity, corresponds to the time scale of "successful" diffusive hops of the mobile ions between the trapping sites in the structure. These inter-site hops are typically compound in nature and consist of several elementary hops in the intervening region between the neighboring trapping sites.

"Music Fit for Us Minorities": Latinas/os' Use of Hip Hop as Pedagogy and Interpretive Framework to Negotiate and Challenge Racism

ERIC Educational Resources Information Center

Pulido, Isaura

2009-01-01

Using Critical Race and Latino Critical theories, this study examines 20 in-depth interviews conducted by the author with Mexican and Puerto Rican youth from the Chicago area. The author contends that youth utilized hip hop music in multiple and overlapping ways, engaging hip hop music as both a pedagogy that centers the perspectives of people of…

Topological Anderson insulator induced by inter-cell hopping disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lv, Shu-Hui; College of Sciences, Hebei University of Science and Technology, Shijiazhuang 050018; Song, Juntao, E-mail: jtsong@mail.hebtu.edu.cn

We have studied in detail the influence of same-orbit and different-orbit hopping disorders in HgTe/CdTe quantum wells. Intriguingly, similar to the behavior of the on-site Anderson disorder, a phase transition from a topologically trivial phase to a topological phase is induced at a proper strength of the same-orbit hopping disorder. For different-orbit hopping disorder, however, the phase transition does not occur. The results have been analytically verified by using effective medium theory. A consistent conclusion can be obtained by comparing phase diagrams, conductance, and conductance fluctuations. In addition, the influence of Rashba spin-orbit interaction (RSOI) on the system has beenmore » studied for different types of disorder, and the RSOI shows different influence on topological phase at different disorders. The topological phase induced by same-orbit hopping disorder is more robust against the RSOI than that induced by on-site Anderson disorder. For different-orbit hopping disorder, no matter whether the RSOI is included or not, the phase transition does not occur. The results indicate, whether or not the topological Anderson insulator can be observed depends on a competition between the different types of the disorder as well as the strength of the RSOI in a system.« less

Effects of interdot hopping and Coulomb blockade on the thermoelectric properties of serially coupled quantum dots

PubMed Central

2012-01-01

We have theoretically studied the thermoelectric properties of serially coupled quantum dots (SCQDs) embedded in an insulator connected to metallic electrodes. In the framework of Keldysh Green’s function technique, the Landauer formula of transmission factor is obtained using the equation of motion method. Based on such analytical expressions of charge and heat currents, we calculate the electrical conductance, Seebeck coefficient, electron thermal conductance, and figure of merit (ZT) of SCQDs in the linear response regime. The effects of interdot hopping and electron Coulomb interactions on ZT are analyzed. We demonstrate that ZT is not a monotonic increasing function of interdot electron hopping strength (tc). We also show that in the absence of phonon thermal conductance, SCQD can reach the Carnot efficiency as tcapproaches zero. PMID:22591807

Surface Diffusion in Systems of Interacting Brownian Particles

NASA Astrophysics Data System (ADS)

Mazroui, M'hammed; Boughaleb, Yahia

The paper reviews recent results on diffusive phenomena in two-dimensional periodic potential. Specifically, static and dynamic properties are investigated by calculating different correlation functions. Diffusion process is first studied for one-dimensional system by using the Fokker-Planck equation which is solved numerically by the matrix continued fraction method in the case of bistable potential. The transition from hopping to liquid-like diffusion induced by variation of some parameters is discussed. This study will therefore serve to demonstrate the influence of this form of potential. Further, an analytical approximation for the dc-conductivity is derived for a wide damping range in the framework of the Linear Response Theory. On the basis of this expression, calculations of the ac conductivity of two-dimensional system with Frenkel-Kontorova pair interaction in the intermediate friction regime is performed by using the continued fraction expansion method. The dc-conductivity expression is used to determine the rest of the development. By varying the density of mobile ions we discuss commensurability effects. To get information about the diffusion mechanism, the full width at half maximum λω(q), of the quasi-elastic line of the dynamical structure factor S(q,ω) is computed. The calculations are extended up to large values of q covering several Brillouin zones. The analysis of λω(q) with different parameters shows that the most probable diffusion process in good two-dimensional superionic conductors consists of a competition between a back correlated hopping in one direction and forward correlated hopping in addition to liquid-like motions in the other direction.

Quantum Spin Dynamics with Pairwise-Tunable, Long-Range Interactions

DTIC Science & Technology

2016-08-05

rection of the arrows. Dashed (dotted) lines mark the NNN hopping terms (coefficients ±t2). NNNN long -range hopping along curved lines are included to...Quantum spin dynamics with pairwise-tunable, long -range interactions C.-L. Hunga,b,1,2, Alejandro González-Tudelac,1,2, J. Ignacio Ciracc, and H. J...atoms) that interact by way of a variety of processes, such as atomic collisions. Such pro- cesses typically lead to short -range, nearest-neighbor

Rapid differentiation of citrus Hop stunt viroid variants by use of real-time RT-PCR and high resolution melting analysis

USDA-ARS?s Scientific Manuscript database

The RNA genome of Hop stunt viroid (HSVd) contains five to six nucleotides in a variable (V) domain, called the cachexia expression motif, which is associated with pathogenic and non-pathogenic variants in citrus. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological i...

Magnetoresistance in two-dimensional array of Ge/Si quantum dots

NASA Astrophysics Data System (ADS)

Stepina, N. P.; Koptev, E. S.; Pogosov, A. G.; Dvurechenskii, A. V.; Nikiforov, A. I.; Zhdanov, E. Yu

2012-07-01

Magnetoresistance in two-dimensional array of Ge/Si was studied for a wide range of the conductance, where the transport regime changes from hopping to diffusive one. The behavior of magnetoresistance is similar for all samples; it is negative in weak fields and becomes positive with increasing of magnetic field. Negative magnetoresistance can be described in the frame of weak localization approach with suggestion that quantum interference contribution to the conductance is restricted not only by the phase breaking length but also by the localization length.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d-dimensional regular lattices.

PubMed

Dias, W S; Bertrand, D; Lyra, M L

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d>4.

Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d -dimensional regular lattices

NASA Astrophysics Data System (ADS)

Dias, W. S.; Bertrand, D.; Lyra, M. L.

2017-06-01

Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d >4 .

Longitudinal hopping in intervehicle communication: Theory and simulations on modeled and empirical trajectory data

NASA Astrophysics Data System (ADS)

Thiemann, Christian; Treiber, Martin; Kesting, Arne

2008-09-01

Intervehicle communication enables vehicles to exchange messages within a limited broadcast range and thus self-organize into dynamical and geographically embedded wireless ad hoc networks. We study the longitudinal hopping mode in which messages are transported using equipped vehicles driving in the same direction as a relay. Given a finite communication range, we investigate the conditions where messages can percolate through the network, i.e., a linked chain of relay vehicles exists between the sender and receiver. We simulate message propagation in different traffic scenarios and for different fractions of equipped vehicles. Simulations are done with both, modeled and empirical traffic data. These results are used to test the limits of applicability of an analytical model assuming a Poissonian distance distribution between the relays. We found a good agreement for homogeneous traffic scenarios and sufficiently low percentages of equipped vehicles. For higher percentages, the observed connectivity was higher than that of the model while in stop-and-go traffic situations it was lower. We explain these results in terms of correlations of the distances between the relay vehicles. Finally, we introduce variable transmission ranges and found that this additional stochastic component generally increased connectivity compared to a deterministic transmission with the same mean.

Three-Dimensional Tracking of Interfacial Hopping Diffusion

NASA Astrophysics Data System (ADS)

Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

2017-12-01

Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

Combustion powered linear actuator

DOEpatents

Fischer, Gary J.

2007-09-04

The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

Influence of Ag, Cd or Pb Addition on Electrical and Dielectric Properties of Bulk Glassy Se-Ge

NASA Astrophysics Data System (ADS)

El-Metwally, E. G.; Shakra, A. M.

2018-05-01

Bulk glassy samples of Se0.7Ge0.3 and Se0.7Ge0.25 X 0.05 (X = Ag, Cd or Pb) chalcogenide glass have been prepared by melt-quenching method. The studied compositions were examined in powder form by x-ray diffraction analysis. The direct-current (dc) conductivity σ_{{dc}} was measured for bulk samples in the temperature range from 303 K to 433 K, revealing enhancement with temperature for all samples. The results indicate two values of activation energy ( Δ E_{{σ1 }} and Δ E_{{σ2 }} ) due to two conduction mechanisms. Measurements of the alternating-current (ac) conductivity σ_{{ac}} ( ω ) and dielectric properties for bulk samples were carried out in the temperature range from 303 K to 433 K and frequency range from 1 kHz to 1 MHz. The ac conductivity σ_{{ac}} ( ω ) was temperature dependent and proportional to ωS , where S is the frequency exponent, which reduced with rising temperature, and ω is the angular frequency. These results are discussed based on a correlated barrier hopping model. The calculated values of the maximum height of the barrier W_{{M}} for each composition are consistent with carrier hopping over a potential barrier. The density of localized states N( {E_{{F}} } ) at the Fermi level lay in the range from 1019 eV-1 cm-3 to 1020 eV-1 cm-3, and increased with temperature. The dielectric constant ɛ1 ( ω ) and loss ɛ2 ( ω ) increased with temperature but decreased with frequency. The values of σ_{{dc}} , σ_{{ac}} ( ω ) , ɛ1 ( ω ) , and ɛ2 ( ω ) increased with temperature and with addition of Ag, Cd or Pb. The observed increase was greater for Se0.7Ge0.25Pb0.05 than for Se0.7Ge0.25Cd0.05, which was greater than for Se0.7Ge0.25Ag0.05.

Molybdenum Carbamate Nanosheets as a New Class of Potential Phase Change Materials.

PubMed

Zhukovskyi, Maksym; Plashnitsa, Vladimir; Petchsang, Nattasamon; Ruth, Anthony; Bajpai, Anshumaan; Vietmeyer, Felix; Wang, Yuanxing; Brennan, Michael; Pang, Yunsong; Werellapatha, Kalpani; Bunker, Bruce; Chattopadhyay, Soma; Luo, Tengfei; Janko, Boldizsar; Fay, Patrick; Kuno, Masaru

2017-06-14

We report for the first time the synthesis of large, free-standing, Mo 2 O 2 (μ-S) 2 (Et 2 dtc) 2 (MoDTC) nanosheets (NSs), which exhibit an electron-beam induced crystalline-to-amorphous phase transition. Both electron beam ionization and femtosecond (fs) optical excitation induce the phase transition, which is size-, morphology-, and composition-preserving. Resulting NSs are the largest, free-standing regularly shaped two-dimensional amorphous nanostructures made to date. More importantly, amorphization is accompanied by dramatic changes to the NS electrical and optical response wherein resulting amorphous species exhibit room-temperature conductivities 5 orders of magnitude larger than those of their crystalline counterparts. This enhancement likely stems from the amorphization-induced formation of sulfur vacancy-related defects and is supported by temperature-dependent transport measurements, which reveal efficient variable range hopping. MoDTC NSs represent one instance of a broader class of transition metal carbamates likely having applications because of their intriguing electrical properties as well as demonstrated ability to toggle metal oxidation states.

The Effect of Rician Fading and Partial-Band Interference on Noise- Normalized Fast Frequency-Hopped MFSK Receivers

DTIC Science & Technology

1994-03-01

FSK 16. PmCI coot 17. SECURITY CLASSWsAI1OW IL SICUURW CLA$SIICATION SECURITY CLASSIICATION 20. LIMIATION Of ABSTRACT CW REPOW ? OF TiNS PAU OF ...hop k of a symbol when partial-band interference is present is obtained from (11) and the linear transformation of random variables given by (3) as...from (13) and the transformation of random variables indicated by (9) as [16] fzwjm(zwik) = f cTak!X. (Xmk, = ZmkOkI17) f~(0,kdo . -- (,.U(zk’ )fE2

Conductivity study and fourier transform infrared (FTIR) characterization of methyl cellulose solid polymer electrolyte with sodium iodide conducting ion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abiddin, Jamal Farghali Bin Zainal; Ahmad, Azizah Hanom; Institute of Science, Universiti Teknologi MARA, 40450 Shah Alam, Selangor D.E.

2015-08-28

Sodium ion (Na{sup +}) based solid polymer electrolyte (SPE) has been prepared using solution cast technique with distilled water as solvent and Methylcellulose (MC) as a polymer host. Methylcellulose polymer was chosen as the polymer host due to the abundance of lone pair electrons in the carbonyl and C-O-C constituents, which in turn provide multiple hopping sites for the Na{sup +} conducting ions. Variable compositions of sodium iodide (NaI) salt were prepared to investigate the optimum MC-NaI weight ratio. Results from Electrical Impedance Spectroscopy (EIS) technique show that pure methylcellulose has a low conductivity of 3.61 × 10{sup −11} S/cm.Themore » conductivity increases as NaI content increases up to optimum NaIcomposition of 40 wt%, which yields an average conductivity of 2.70 × 10{sup −5} S/cm.« less

Conductivity study and fourier transform infrared (FTIR) characterization of methyl cellulose solid polymer electrolyte with sodium iodide conducting ion

NASA Astrophysics Data System (ADS)

Abiddin, Jamal Farghali Bin Zainal; Ahmad, Azizah Hanom

2015-08-01

Sodium ion (Na+) based solid polymer electrolyte (SPE) has been prepared using solution cast technique with distilled water as solvent and Methylcellulose (MC) as a polymer host. Methylcellulose polymer was chosen as the polymer host due to the abundance of lone pair electrons in the carbonyl and C-O-C constituents, which in turn provide multiple hopping sites for the Na+ conducting ions. Variable compositions of sodium iodide (NaI) salt were prepared to investigate the optimum MC-NaI weight ratio. Results from Electrical Impedance Spectroscopy (EIS) technique show that pure methylcellulose has a low conductivity of 3.61 × 10-11 S/cm.The conductivity increases as NaI content increases up to optimum NaIcomposition of 40 wt%, which yields an average conductivity of 2.70 × 10-5 S/cm.

Nuclear magnetic resonance investigation of dynamics in poly(ethylene oxide) based polyether-ester-sulfonate ionomers

NASA Astrophysics Data System (ADS)

Roach, David J.

Nuclear magnetic resonance (NMR) spectroscopy has been utilized to investigate the dynamics of poly(ethylene oxide)-based lithium sulfonate ionomer samples that have low glass transition temperatures. 1H and 7Li spin-lattice relaxation times (T1) of the bulk polymer and lithium ions, respectively, were measured and analyzed in samples with a range of ion contents. The temperature dependence of T1 values along with the presence of minima in T1 as a function of temperature enabled correlation times and activation energies to be obtained for both the segmental motion of the polymer backbone and the hopping motion of lithium cations. Similar activation energies for motion of both the polymer and lithium ions in the samples with lower ion content indicate that the polymer segmental motion and lithium ion hopping motion are correlated in these samples, even though lithium hopping is about ten times slower than the segmental motion. A divergent trend is observed for correlation times and activation energies of the highest ion content sample with 100% lithium sulfonation due to the presence of ionic aggregation. Details of the polymer and cation dynamics on the nanosecond timescale are discussed and complement the findings of X-ray scattering and Quasi Elastic Neutron Scattering experiments. Polymer backbone dynamics of single ion conducting poly(ethylene oxide) (PEO)-based ionomer samples with low glass transition temperatures (T g) have been investigated using solid-state nuclear magnetic resonance (NMR). Experiments detecting 13C with 1H decoupling under magic angle spinning (MAS) conditions identified the different components and relative mobilities of the polymer backbone of a suite of. lithium- and sodium-containing ionomer samples with varying cation contents. Variable temperature (203-373 K) 1H-13C cross-polarization MAS (CP-MAS) experiments also provided qualitative assessment of the differences in the motions of the polymer backbone components as a function of cation content. Each of the main backbone components (PEO spacer and isophthalate groups) exhibit distinct motions, following the trends expected for motional characteristics based on earlier Quasi Elastic Neutron Scattering and 1H spin-lattice relaxation rate measurements. The temperature dependences of 13C linewidths were used to both qualitatively and quantitatively examine the effects of cation content on PEO mobility. Variable contact time 1H-13C CP-MAS experiments were used to further assess the motions of the polymer backbone on the microsecond timescale. The motion of the PEO spacer, determined from the rate of magnetization transfer from 1H to 13C nuclei, in all ionic samples becomes similar for T [special characters omitted] 1.1 Tg, indicating that the motions of the polymer backbones on the microsecond timescale become insensitive to ion interactions. These results compliment previous findings and present an improved picture of the dependence of backbone dynamics on cation type and density in these amorphous PEO-based ionomer systems. 7Li PFG NMR experiments provided measurements of the self-diffusion coefficients for Li+ cations in the PEO600-y Li ionomer series over a range of temperatures. When the Tg values are taken into account, the self-diffusion coefficients of Li+ in each sample follow a similar trendline, indicating that lithium diffusion is independent of ion concentration at any given reduced inverse temperature, Tg/T. Ion aggregation increases Tg and slows both lithium cation diffusion and displacement, but there is no further slowing beyond the Tg effect in the PEO600-y Li ionomers samples. The differences in activation energies obtained from diffusion measurements and relaxation times suggest that at least one additional barrier must be overcome for cations emerge from local hopping motion to macroscopic cation transpfort. Using the Nernst- Einstein equation lithium diffusion coefficients were also calculated from conductivity measurements. The differences between the diffusion measured by the two separate techniques indicate the presence of ion pairs. The activation energy of lithium diffusion was found to be nearly identical between the PFG NMR and conductivity, suggesting that the conductivity and ionic diffusion are related to the same ionic dynamics. As the ion content within the PEO600-y Li samples increases the relative concentration of nonconducting ion pairs decrease. Also an increase in temperature causes a fraction of ion pairs to thermally dissociate into positive triple ions.

Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

PubMed Central

Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

2014-01-01

Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

PubMed Central

Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

2010-01-01

The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

Nanoscale live cell imaging using hopping probe ion conductance microscopy

PubMed Central

Novak, Pavel; Li, Chao; Shevchuk, Andrew I.; Stepanyan, Ruben; Caldwell, Matthew; Hughes, Simon; Smart, Trevor G.; Gorelik, Julia; Ostanin, Victor P.; Lab, Max J.; Moss, Guy W. J.; Frolenkov, Gregory I.; Klenerman, David; Korchev, Yuri E.

2009-01-01

We describe a major advance in scanning ion conductance microscopy: a new hopping mode that allows non-contact imaging of the complex surfaces of live cells with resolution better than 20 nm. The effectiveness of this novel technique was demonstrated by imaging networks of cultured rat hippocampal neurons and mechanosensory stereocilia of mouse cochlear hair cells. The technique allows studying nanoscale phenomena on the surface of live cells under physiological conditions. PMID:19252505

Role of antimony in the charge transport mechanisms for La0.67Ca0.33Mn1-xSbxO3 manganites

NASA Astrophysics Data System (ADS)

Kataria, B. R.; Solanki, Pankaj; Pandya, D. D.; Solanki, P. S.; Shah, N. A.

2018-07-01

Single phasic La0.67Ca0.33Mn1-xSbxO3 (LCMSO; x = 0.00, 0.02, 0.04, 0.06, 0.08 and 0.10) samples were characterized by performing temperature and magnetic field dependent resistance measurements. Present study, mainly, aims for the better understanding of possible charge conduction mechanisms responsible for the low temperature resistivity and high temperature [well above metal to insulator transition temperature (TP)] semiconducting regions. Variation in resistivity and TP with Sb5+ content (x) and applied magnetic field has been discussed in the light of the modifications in structural and magnetic lattices of smaller diamagnetic Sb5+ doped LCMSO system. Various models and mechanisms have been theoretical employed to fit obtained experimental resistivity data for the low temperature resistivity and semiconducting regions of all LCMSO manganites. It is found that low temperature resistivity minima follows the coulomb blockade model while charge conduction in the semiconducting region obeys the variable range hopping (VRH) mechanism. Variation in low temperature blocking energy, activation energy in semiconducting region and magnetoresistance (MR) with Sb5+ content (x) and applied magnetic field has been discussed in detail.

Frequency and temperature dependent dielectric properties of TiO2-V2O5 nanocomposites

NASA Astrophysics Data System (ADS)

Ray, Apurba; Roy, Atanu; De, Sayan; Chatterjee, Souvik; Das, Sachindranath

2018-03-01

In this manuscript, we have reported the crystal structure, dielectric response, and transport phenomenon of TiO2-V2O5 nanocomposites. The nanocomposites were synthesized using a sol-gel technique having different molar ratios of Ti:V (10:10, 10:15, and 10:20). The phase composition and the morphology have been studied using X-ray diffraction and field emission scanning electron microscope, respectively. The impedance spectroscopy studies of the three samples over a wide range of temperature (50 K-300 K) have been extensively described using the internal barrier layer capacitor model. It is based on the contribution of domain and domain boundary, relaxations of the materials, which are the main crucial factors for the enhancement of the dielectric response. The frequency dependent ac conductivity of the ceramics strongly obeys the well-known Jonscher's power law, and it has been clearly explained using the theory of jump relaxation model. The temperature dependent bulk conductivity is fairly recognized to the variable-range hopping of localized polarons. The co-existence of mixed valence state of Ti ions (Ti3+ and Ti4+) in the sample significantly contributes to the change of dielectric property. The overall study of dielectric response explains that the dielectric constant and the dielectric loss are strongly dependent on temperature and frequency and decrease with an increase of frequency as well as temperature.

Dielectric and impedance spectral characteristics of bulk ZnIn2Se4

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Attia, A. A.; Salem, G. F.; Ali, H. A. M.; Ismail, M. I.

2014-02-01

The frequency and temperature dependence of ac conductivity, dielectric constant and dielectric loss of ZnIn2Se4 in a pellet form were investigated in the frequency range of 102-106 Hz and temperature range of 293-356 K. The behavior of ac conductivity was interpreted by the correlated barrier hopping (CBH) model. Temperature dependence of ac conductivity indicates that ac conduction is a thermally activated process. The density of localized states N(EF) and ac activation energy were estimated for various frequencies. Dielectric constant and dielectric loss showed a decrease with increasing frequency and an increase with increasing in temperature. The frequency dependence of real and imaginary parts of the complex impedance was investigated. The relaxation time decreases with the increase in temperature. The impedance spectrum exhibits the appearance of the single semicircular arc. The radius of semicircular arcs decreases with increasing temperature which suggests a mechanism of temperature-dependent on relaxation.

A Review of Hip Hop-Based Interventions for Health Literacy, Health Behaviors, and Mental Health.

PubMed

Robinson, Cendrine; Seaman, Elizabeth L; Montgomery, LaTrice; Winfrey, Adia

2018-06-01

African-American children and adolescents experience an undue burden of disease for many health outcomes compared to their White peers. More research needs to be completed for this priority population to improve their health outcomes and ameliorate health disparities. Integrating hip hop music or hip hop dance into interventions may help engage African-American youth in health interventions and improve their health outcomes. We conducted a review of the literature to characterize hip hop interventions and determine their potential to improve health. We searched Web of Science, Scopus, PsycINFO, and EMBASE to identify studies that assessed hip hop interventions. To be included, studies had to (1) be focused on a psychosocial or physical health intervention that included hip hop and (2) present quantitative data assessing intervention outcomes. Twenty-three articles were identified as meeting all inclusion criteria and were coded by two reviewers. Articles were assessed with regards to sample characteristics, study design, analysis, intervention components, and results. Hip hop interventions have been developed to improve health literacy, health behavior, and mental health. The interventions were primarily targeted to African-American and Latino children and adolescents. Many of the health literacy and mental health studies used non-experimental study designs. Among the 12 (of 14) health behavior studies that used experimental designs, the association between hip hop interventions and positive health outcomes was inconsistent. The number of experimental hip hop intervention studies is limited. Future research is required to determine if hip hop interventions can promote health.

Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities.

PubMed

Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

2015-08-11

To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott's variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics.

Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities

PubMed Central

Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

2015-01-01

To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott’s variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics. PMID:26260674

Localization in a random XY model with long-range interactions: Intermediate case between single-particle and many-body problems

NASA Astrophysics Data System (ADS)

Burin, Alexander L.

2015-09-01

Many-body localization in an XY model with a long-range interaction is investigated. We show that in the regime of a high strength of disordering compared to the interaction an off-resonant flip-flop spin-spin interaction (hopping) generates the effective Ising interactions of spins in the third order of perturbation theory in a hopping. The combination of hopping and induced Ising interactions for the power-law distance dependent hopping V (R ) ∝R-α always leads to the localization breakdown in a thermodynamic limit of an infinite system at α <3 d /2 where d is a system dimension. The delocalization takes place due to the induced Ising interactions U (R ) ∝R-2 α of "extended" resonant pairs. This prediction is consistent with the numerical finite size scaling in one-dimensional systems. Many-body localization in an XY model is more stable with respect to the long-range interaction compared to a many-body problem with similar Ising and Heisenberg interactions requiring α ≥2 d which makes the practical implementations of this model more attractive for quantum information applications. The full summary of dimension constraints and localization threshold size dependencies for many-body localization in the case of combined Ising and hopping interactions is obtained using this and previous work and it is the subject for the future experimental verification using cold atomic systems.

Powdery mildew reaction of hop cultivars and USDA germplasm, 2015

USDA-ARS?s Scientific Manuscript database

This research was conducted to identify possible sources of resistance to the disease powdery mildew in publicly-available hop germplasm and cultivars. Germplasm with the highest levels of downy mildew resistance in the USDA collection and various cultivars of interest were screened for their reac...

Carryover effect of hip and knee exercises program on functional performance in individuals with patellofemoral pain syndrome

PubMed Central

Ahmed Hamada, Hamada; Hussein Draz, Amira; Koura, Ghada Mohamed; Saab, Ibtissam M.

2017-01-01

[Purpose] This study was carried out to investigate the carryover effect of hip and knee exercises program on functional performance (single legged hop test as functional performance test and Kujala score for functional activities). [Subjects and Methods] Thirty patients with patellofemoral pain syndrome were randomly assigned into two equal groups. Group (A) consisted of 15 patients undergoing hip strengthening exercises for four weeks then measuring all variables followed by additional four weeks of knee exercises program then measuring all variables again. Group (B): consisted of 15 patients undergoing knee exercises program for four weeks then measuring all variables followed by additional four weeks of hip strengthening exercises then measuring all variables. Functional abilities and knee muscles performance were assessed using Kujala questionnaire and single legged hop test respectively pre and after the completion of the first 4 weeks then after 8 weeks for both groups. [Results] Significantly increase in Kujala questionnaire in group A compared with group B was observed. While, there were significant increase in single legged hop performance test in group B compared with group A. [Conclusion] Starting with hip exercises improve the performance of subjects more than functional activities while starting with knee exercises improve the functional activities of subjects more than performance. PMID:28878459

Carryover effect of hip and knee exercises program on functional performance in individuals with patellofemoral pain syndrome.

PubMed

Ahmed Hamada, Hamada; Hussein Draz, Amira; Koura, Ghada Mohamed; Saab, Ibtissam M

2017-08-01

[Purpose] This study was carried out to investigate the carryover effect of hip and knee exercises program on functional performance (single legged hop test as functional performance test and Kujala score for functional activities). [Subjects and Methods] Thirty patients with patellofemoral pain syndrome were randomly assigned into two equal groups. Group (A) consisted of 15 patients undergoing hip strengthening exercises for four weeks then measuring all variables followed by additional four weeks of knee exercises program then measuring all variables again. Group (B): consisted of 15 patients undergoing knee exercises program for four weeks then measuring all variables followed by additional four weeks of hip strengthening exercises then measuring all variables. Functional abilities and knee muscles performance were assessed using Kujala questionnaire and single legged hop test respectively pre and after the completion of the first 4 weeks then after 8 weeks for both groups. [Results] Significantly increase in Kujala questionnaire in group A compared with group B was observed. While, there were significant increase in single legged hop performance test in group B compared with group A. [Conclusion] Starting with hip exercises improve the performance of subjects more than functional activities while starting with knee exercises improve the functional activities of subjects more than performance.

Temperature dependent simulation of diamond depleted Schottky PIN diodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hathwar, Raghuraj; Dutta, Maitreya; Chowdhury, Srabanti

2016-06-14

Diamond is considered as an ideal material for high field and high power devices due to its high breakdown field, high lightly doped carrier mobility, and high thermal conductivity. The modeling and simulation of diamond devices are therefore important to predict the performances of diamond based devices. In this context, we use Silvaco{sup ®} Atlas, a drift-diffusion based commercial software, to model diamond based power devices. The models used in Atlas were modified to account for both variable range and nearest neighbor hopping transport in the impurity bands associated with high activation energies for boron doped and phosphorus doped diamond.more » The models were fit to experimentally reported resistivity data over a wide range of doping concentrations and temperatures. We compare to recent data on depleted diamond Schottky PIN diodes demonstrating low turn-on voltages and high reverse breakdown voltages, which could be useful for high power rectifying applications due to the low turn-on voltage enabling high forward current densities. Three dimensional simulations of the depleted Schottky PIN diamond devices were performed and the results are verified with experimental data at different operating temperatures.« less

Room temperature magnetism and metal to semiconducting transition in dilute Fe doped Sb1-xSex semiconducting alloy thin films

NASA Astrophysics Data System (ADS)

Agrawal, Naveen; Sarkar, Mitesh; Chawda, Mukesh; Ganesan, V.; Bodas, Dhananjay

2015-02-01

The magnetism was observed in very dilute Fe doped alloy thin film Fe0.008Sb1-xSex, for x = 0.01 to 0.10. These thin films were grown on silicon substrate using thermal evaporation technique. Structural, electrical, optical, charge carrier concentration measurement, surface morphology and magnetic properties were observed using glancing incidence x-ray diffraction (GIXRD), four probe resistivity, photoluminescence, Hall measurement, atomic force microscopy (AFM) and magnetic force microscopy (MFM) techniques, respectively. No peaks of iron were seen in GIXRD. The resistivity results show that activation energy increases with increase in selenium (Se) concentration. The Arrhenius plot reveals metallic behavior below room temperature. The low temperature conduction is explained by variable range-hopping mechanism, which fits very well in the temperature range 150-300 K. The decrease in density of states has been observed with increasing selenium concentration (x = 0.01 to 0.10). There is a metal-to-semiconductor phase transition observed above room temperature. This transition temperature is Se concentration dependent. The particle size distribution ˜47-61 nm is evaluated using AFM images. These thin films exhibit ferromagnetic interactions at room temperature.

Study of dielectric relaxation and AC conductivity of InP:S single crystal

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.

2012-07-01

The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.

Effect of Impedance Relaxation in Conductance Mechanisms in TiO2/ITO/ZnO:Al/p-Si Heterostructure

NASA Astrophysics Data System (ADS)

Nouiri, M.; El Mir, L.

2018-03-01

The electrical conduction of a TiO2/ITO/ZnO:Al/p-Si structure under alternating-current excitation was investigated in the temperature range of 80 K to 300 K. The frequency dependence of the capacitance and conductance revealed the response of a thermally activated trap characterized by activation energy of about 140 meV. The frequency dependence of the conductance obeyed the universal dynamic response according to the common relation G = Aωs . The temperature dependence of the frequency exponent s illustrates that, in the low frequency range, conduction is governed by the correlated barrier hopping (CBH) mechanism involving two distinct energy levels for all investigated temperatures. For the high frequency region, conduction takes place according to the overlapping large-polaron tunneling mechanism at low temperatures but the CBH mechanism becomes dominant in the high temperature region. This difference in electrical behavior between low and high temperatures can be attributed to the dominance of dielectric relaxation at low compared with high temperatures.

Evaluation of fungicides for hop downy mildew, Hubbard, Oregon, 2016

USDA-ARS?s Scientific Manuscript database

This research was conducted to quantify the degree of control of the disease with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standard fungicide,...

Evaluation of fungicides for hop downy mildew, Woodburn, Oregon, 2016

USDA-ARS?s Scientific Manuscript database

This research was conducted to quantify the degree of control of the disease downy mildew with a phosphorous acid-based fungicide, the present industry-standard for management of downy mildew on hop in the Pacific Northwestern U.S. No suppression of the disease was observed with the industry standa...

Dielectric relaxation and localized electron hopping in colossal dielectric (Nb,In)-doped TiO2 rutile nanoceramics.

PubMed

Tsuji, Kosuke; Han, HyukSu; Guillemet-Fritsch, Sophie; Randall, Clive A

2017-03-28

Dielectric spectroscopy was performed on a Nb and In co-doped rutile TiO 2 nano-crystalline ceramic (n-NITO) synthesized by a low-temperature spark plasma sintering (SPS) technique. The dielectric properties of the n-NITO were not largely affected by the metal electrode contacts. Huge dielectric relaxation was observed at a very low temperature below 35 K. Both the activation energy and relaxation time suggested that the electronic hopping motion is the underlying mechanism responsible for the colossal dielectric permittivity (CP) and its relaxation, instead of the internal barrier layer effect or a dipolar relaxation. With Havriliak-Negami (H-N) fitting, a relaxation time with a large distribution of dielectric relaxations was revealed. The broad distributed relaxation phenomena indicated that Nb and In were involved, controlling the dielectric relaxation by modifying the polarization mechanism and localized states. The associated distribution function is calculated and presented. The frequency-dependent a.c. conductance is successfully explained by a hopping conduction model of the localized electrons with the distribution function. It is demonstrated that the dielectric relaxation is strongly correlated with the hopping electrons in the localized states. The CP in SPS n-NITO is then ascribed to a hopping polarization.

Low Power Multi-Hop Networking Analysis in Intelligent Environments.

PubMed

Etxaniz, Josu; Aranguren, Gerardo

2017-05-19

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide.

Low Power Multi-Hop Networking Analysis in Intelligent Environments

PubMed Central

Etxaniz, Josu; Aranguren, Gerardo

2017-01-01

Intelligent systems are driven by the latest technological advances in many different areas such as sensing, embedded systems, wireless communications or context recognition. This paper focuses on some of those areas. Concretely, the paper deals with wireless communications issues in embedded systems. More precisely, the paper combines the multi-hop networking with Bluetooth technology and a quality of service (QoS) metric, the latency. Bluetooth is a radio license-free worldwide communication standard that makes low power multi-hop wireless networking available. It establishes piconets (point-to-point and point-to-multipoint links) and scatternets (multi-hop networks). As a result, many Bluetooth nodes can be interconnected to set up ambient intelligent networks. Then, this paper presents the results of the investigation on multi-hop latency with park and sniff Bluetooth low power modes conducted over the hardware test bench previously implemented. In addition, the empirical models to estimate the latency of multi-hop communications over Bluetooth Asynchronous Connectionless Links (ACL) in park and sniff mode are given. The designers of devices and networks for intelligent systems will benefit from the estimation of the latency in Bluetooth multi-hop communications that the models provide. PMID:28534847

Condom use and hip hop culture: the case of urban young men in New York City.

PubMed

Muñoz-Laboy, Miguel A; Castellanos, Daniel H; Haliburton, Chanel S; del Aguila, Ernesto Vasquez; Weinstein, Hannah J; Parker, Richard G

2008-06-01

We explored how young men's perceptions of and participation in hip hop culture--urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music--and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Differences in young men's perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Popular discourses on young men's health risks often blame youths' cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men's lives and what aspects of youths' culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk.

Effect of substitution group on dielectric properties of 4H-pyrano [3, 2-c] quinoline derivatives thin films

NASA Astrophysics Data System (ADS)

H, M. Zeyada; F, M. El-Taweel; M, M. El-Nahass; M, M. El-Shabaan

2016-07-01

The AC electrical conductivity and dielectrical properties of 2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3, 2-c]quinoline-3-carbonitrile (Ph-HPQ) and 2-amino-4-(2-chlorophenyl)-6-ethyl-5-oxo-5,6-dihydro-4H-pyrano [3, 2-c] quinoline-3-carbonitrile (Ch-HPQ) thin films were determined in the frequency range of 0.5 kHz-5 MHz and the temperature range of 290-443 K. The AC electrical conduction of both compounds in thin film form is governed by the correlated barrier hopping (CBH) mechanism. Some parameters such as the barrier height, the maximum barrier height, the density of charges, and the hopping distance were determined as functions of temperature and frequency. The phenoxyphenyl group has a greater influence on those parameters than the chlorophenyl group. The AC activation energies were determined at different frequencies and temperatures. The dielectric behaviors of Ph-HPQ and Ch-HPQ were investigated using the impedance spectroscopy technique. The impedance data are presented in Nyquist diagrams for different temperatures. The Ch-HPQ films have higher impedance than the Ph-HPQ films. The real dielectric constant and dielectric loss show a remarkable dependence on the frequency and temperature. The Ph-HPQ has higher dielectric constants than the Ch-HPQ.

Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

PubMed Central

Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

2007-01-01

The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

PubMed

Neiens, Silva D; Steinhaus, Martin

2018-02-14

The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

PubMed Central

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-01-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

PubMed

Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

2017-08-01

Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT.

PubMed

Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L

2016-08-01

Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. 3B, non-consectutive cohort study.

COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT

PubMed Central

Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.

2016-01-01

ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Conclusion Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. Level of Evidence 3B, non-consectutive cohort study PMID:27525177

A Crystal-Physical Model of Electrotransfer in the Superionic Conductor Pb1 - x Sc x F2 + x ( x = 0.1)

NASA Astrophysics Data System (ADS)

Sorokin, N. I.

2018-04-01

The frequency (ν = 10-1-107 Hz) dependences of electrical conductivity σ(ν) of single crystals of superionic conductor Pb0.9Sc0.1F2.1 (10 mol % ScF3) with fluorite type structure (CaF2) in the temperature range 153-410 K have been investigated. The static bulk conductivity σ dc =1.5 × 10-4 S/cm and average hopping frequency ν h = 1.5 × 107 Hz of charge carriers (mobile ions F-) at room temperature (293 K) have been defined from the σ dc (ν) experimental curves. Enthalpies of thermoactivated processes of ionic conductivity σ dc ( T) (Δ H σ = 0.393 ± 0.005 eV) and dielectric relaxation ν h ( T) (Δ H h = 0.37 ± 0.03 eV) coincide within their errors. A crystal-physical model of fluorine-ion transport in a Pb0.9Sc0.1F2.1 crystal lattice has been proposed. The characteristic parameters of charge carriers have been calculated: concentration n mob = 2.0 × 1021 cm-3, the distance of the hopping d ≈ 0.5 nm and mobility μmob = 4.5 × 10-7 cm2/s V (293 K).

Matrix-valued Boltzmann equation for the nonintegrable Hubbard chain.

PubMed

Fürst, Martin L R; Mendl, Christian B; Spohn, Herbert

2013-07-01

The standard Fermi-Hubbard chain becomes nonintegrable by adding to the nearest neighbor hopping additional longer range hopping amplitudes. We assume that the quartic interaction is weak and investigate numerically the dynamics of the chain on the level of the Boltzmann type kinetic equation. Only the spatially homogeneous case is considered. We observe that the huge degeneracy of stationary states in the case of nearest neighbor hopping is lost and the convergence to the thermal Fermi-Dirac distribution is restored. The convergence to equilibrium is exponentially fast. However for small next-nearest neighbor hopping amplitudes one has a rapid relaxation towards the manifold of quasistationary states and slow relaxation to the final equilibrium state.

"Writing in the Margins": Brazilian Hip-Hop as an Educational Project

ERIC Educational Resources Information Center

Pardue, Derek

2004-01-01

Hip-hop culture's force as part of globalization in the fields of economics, popular aesthetics, and identity politics has been well documented. However, its articulation to educational practices has received less attention. This article draws upon fieldwork conducted in 1999 and 2002 in a youth correctional facility to analyze how state…

Quasiclassical description of the nearest-neighbor hopping dc conduction via hydrogen-like donors in intermediately compensated GaAs crystals

NASA Astrophysics Data System (ADS)

Poklonski, N. A.; Vyrko, S. A.; Zabrodskii, A. G.

2010-08-01

Expressions for the pre-exponential factor σ3 and the thermal activation energy ɛ3 of hopping electric conductivity of electrons via hydrogen-like donors in n-type gallium arsenide are obtained in the quasiclassical approximation. Crystals with the donor concentration N and the acceptor concentration KN at the intermediate compensation ratio K (approximately from 0.25 to 0.75) are considered. We assume that the donors in the charge states (0) and (+1) and the acceptors in the charge state (-1) form a joint nonstoichiometric simple cubic 'sublattice' within the crystalline matrix. In such sublattice the distance between nearest impurity atoms is Rh = [(1 + K)N]-1/3 which is also the length of an electron hop between donors. To take into account orientational disorder of hops we assume that the impurity sublattice randomly and smoothly changes orientation inside a macroscopic sample. Values of σ3(N) and ɛ3(N) calculated for the temperature of 2.5 K agree with known experimental data at the insulator side of the insulator-metal phase transition.

Dielectric relaxation and ac conductivity behavior of carboxyl functionalized multiwalled carbon nanotubes/poly (vinyl alcohol) composites

NASA Astrophysics Data System (ADS)

Amrin, Sayed; Deshpande, V. D.

2017-03-01

We study the dielectric relaxation and ac conductivity behavior of MWCNT-COOH/Polyvinyl alcohol nanocomposite films in the temperature (T) range 303-423 K and in the frequency (f) range 0.1 Hz-1 MHz. The dielectric constant increases with an increase in temperature and also with an increase in MWCNT-COOH loading into the polymer matrix, as a result of interfacial polarization. The permittivity data were found to fit well with the modified Cole-Cole equation. Temperature dependent values of the relaxation times, free charge carrier conductivity and space charge carrier conductivity were extracted from the equation. An observed increment in the ac conductivity for the nanocomposites was analysed by a Jonscher power law which suggests that the correlated barrier hopping is the dominant charge transport mechanism for the nanocomposite films. The electric modulus study revealed deviations from ideal Debye-type behavior which are explained by considering a generalized susceptibility function. XRD and DSC results show an increase in the degree of crystallinity.

Electrical conductivity and dielectric relaxation of 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile

NASA Astrophysics Data System (ADS)

El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.

2014-03-01

The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.

Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

PubMed Central

Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

2011-01-01

Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

PubMed

Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

2016-05-19

Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells

PubMed

Kuznetsov; Mendez; Zuo; Snider; Croke

2000-07-10

We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.

Specific features of electrical properties of porous biocarbons prepared from beech wood and wood artificial fiberboards

NASA Astrophysics Data System (ADS)

Popov, V. V.; Orlova, T. S.; Magarino, E. Enrique; Bautista, M. A.; Martínez-Fernández, J.

2011-02-01

This paper reports on comparative investigations of the structural and electrical properties of biomorphic carbons prepared from natural beech wood, as well as medium-density and high-density fiberboards, by means of carbonization at different temperatures T carb in the range 650-1000°C. It has been demonstrated using X-ray diffraction analysis that biocarbons prepared from medium-density and high-density fiberboards at all temperatures T carb contain a nanocrystalline graphite component, namely, three-dimensional crystallites 11-14 Å in size. An increase in the carbonization temperature T carb to 1000°C leads to the appearance of a noticeable fraction of two-dimensional graphene particles with the same sizes. The temperature dependences of the electrical resistivity ρ of the biomorphic carbons have been measured and analyzed in the temperature range 1.8-300 K. For all types of carbons under investigation, an increase in the carbonization temperature T carb from 600 to 900°C leads to a change in the electrical resistivity at T = 300 K by five or six orders of magnitude. The dependences ρ( T) for these materials are adequately described by the Mott law for the variable-range hopping conduction. It has been revealed that the temperature dependence of the electrical resistivity exhibits a hysteresis, which has been attributed to thermomechanical stresses in an inhomogeneous structure of the biocarbon prepared at a low carbonization temperature T carb. The crossover to the conductivity characteristic of disordered metal systems is observed at T carb ≳ 1000°C.

THE RELATIONSHIP BETWEEN VARIOUS MODES OF SINGLE LEG POSTURAL CONTROL ASSESSMENT

PubMed Central

Schmitz, Randy

2012-01-01

Purpose/Background: While various techniques have been developed to assess the postural control system, little is known about the relationship between single leg static and functional balance. The purpose of the current study was to determine the relationship between the performance measures of several single leg postural stability tests. Methods: Forty six recreationally active college students (17 males, 29 females, 21±3 yrs, 173±10 cm) performed six single leg tests in a counterbalanced order: 1) Firm Surface-Eyes Open, 2) Firm Surface-Eyes Closed, 3) Multiaxial Surface-Eyes Open, 4) Multiaxial Surface-Eyes Closed, 5) Star Excursion Balance Test (posterior medial reach), 6) Single leg Hop-Stabilization Test. Bivariate correlations were conducted between the six outcome variables. Results: Mild to moderate correlations existed between the static tests. No significant correlations existed involving either of the functional tests. Conclusions: The results indicate that while performance of static balance tasks are mildly to moderately related, they appear to be unrelated to functional reaching or hopping movements, supporting the utilization of a battery of tests to determine overall postural control performance. Level of Evidence: 3b PMID:22666640

Condom Use and Hip Hop Culture: The Case of Urban Young Men in New York City

PubMed Central

Muñoz-Laboy, Miguel A.; Castellanos, Daniel H.; Haliburton, Chanel S.; del Aguila, Ernesto Vasquez; Weinstein, Hannah J.; Parker, Richard G.

2008-01-01

Objectives. We explored how young men’s perceptions of and participation in hip hop culture—urban social and artistic expressions, such as clothing style, breakdancing, graffiti, and rap music—and how contextual factors of the hip hop scene may be associated with their condom use, condom-use self-efficacy, and sense of community. Methods. We conducted a cross-sectional survey of 95 African American and Latino men aged 15 to 25 years as part of a 4-year ethnographic study in New York City. Results. Differences in young men’s perceptions of and levels of affiliation with hip hop culture were not statistically associated with differences in their sense of community or condom-use self-efficacy. Frequency of participation in the hip hop nightclub scene was the strongest factor negatively associated with condom use. Conclusions. Popular discourses on young men’s health risks often blame youths’ cultures such as the hip hop culture for increased risk practices but do not critically examine how risk emerges in urban young men’s lives and what aspects of youths’ culture can be protective. Further research needs to focus on contextual factors of risk such as the role of hip hop nightlife on increased HIV risk. PMID:18445799

The Hip-Hop club scene: Gender, grinding and sex.

PubMed

Muñoz-Laboy, Miguel; Weinstein, Hannah; Parker, Richard

2007-01-01

Hip-Hop culture is a key social medium through which many young men and women from communities of colour in the USA construct their gender. In this study, we focused on the Hip-Hop club scene in New York City with the intention of unpacking narratives of gender dynamics from the perspective of young men and women, and how these relate to their sexual experiences. We conducted a three-year ethnographic study that included ethnographic observations of Hip-Hop clubs and their social scene, and in-depth interviews with young men and young women aged 15-21. This paper describes how young people negotiate gender relations on the dance floor of Hip-Hop clubs. The Hip-Hop club scene represents a context or setting where young men's masculinities are contested by the social environment, where women challenge hypermasculine privilege and where young people can set the stage for what happens next in their sexual and emotional interactions. Hip-Hop culture therefore provides a window into the gender and sexual scripts of many urban minority youth. A fuller understanding of these patterns can offer key insights into the social construction of sexual risk, as well as the possibilities for sexual health promotion, among young people in urban minority populations.

Small polaronic hole hopping mechanism and Maxwell-Wagner relaxation in NdFeO3

NASA Astrophysics Data System (ADS)

Ahmad, I.; Akhtar, M. J.; Younas, M.; Siddique, M.; Hasan, M. M.

2012-10-01

In the modern micro-electronics, transition metal oxides due to their colossal values of dielectric permittivity possess huge potential for the development of capacitive energy storage devices. In the present work, the dielectric permittivity and the effects of temperature and frequency on the electrical transport properties of polycrystalline NdFeO3, prepared by solid state reaction method, are discussed. Room temperature Mossbauer spectrum confirms the phase purity, octahedral environment for Fe ion, and high spin state of Fe3+ ion. From the impedance spectroscopic measurements, three relaxation processes are observed, which are related to grains, grain boundaries (gbs), and electrode-semiconductor contact in the measured temperature and frequency ranges. Decrease in resistances and relaxation times of the grains and grain boundaries with temperature confirms the involvement of thermally activated conduction mechanisms. Same type of charge carriers (i.e., small polaron hole hopping) have been found responsible for conduction and relaxation processes through the grain and grain boundaries. The huge value of the dielectric constant (˜8 × 103) at high temperature and low frequency is correlated to the Maxwell-Wagner relaxation due to electrode-sample contact.

Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

NASA Astrophysics Data System (ADS)

Mendels, Dan; Organic Electronics Group Technion Team

2014-03-01

An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

Carbon films embedded by nickel nanoparticles: The effect of deposition time on Berthelot-type hopping conduction parameters

NASA Astrophysics Data System (ADS)

Dalouji, Vali; Asareh, Nastaran; Hashemizadeh, Seyed Ali; Solaymani, Shahram

2016-12-01

In this paper, the electrical conductivity of carbon films embedded by nickel nanoparticles at different deposition times 50, 90, 180 and 600 s over a temperature range from 50 to 500 K was studied. The conductivity data in the temperature range T > 300 K shows the extended state conduction mechanism. The tunneling through a thermally vibrating barrier in the temperature range 50-150 K is described by the Berthelot-type conduction mechanism. It can be seen that the films deposited at 180 s have maximum conductivity and the Berthelot temperature is about 53.5 K. Due to the vibrations of Ni ions in the tetrahedral, sites the extents of the carrier wave function are lower than in the octahedral complexes sites which have maximum values of about 2.16 × 10^{-7} cm and 1.85 × 10^{-7} cm in the octahedral-metal stretching vibrations and intrinsic stretching vibrations of the metal ions at the tetrahedral site, respectively. On the other hand, the average distance between the sites in both vibrations at 180 s deposition modes have minimum values of 2.02 × 10^{-7} cm and 1.72 × 10^{-7} cm.

Thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics in different oxygen-reduction conditions

NASA Astrophysics Data System (ADS)

Li, Yi; Liu, Jian; Wang, Chun-Lei; Su, Wen-Bin; Zhu, Yuan-Hu; Li, Ji-Chao; Mei, Liang-Mo

2015-04-01

The thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics, reduced in different conditions, are investigated in the temperature range from 323 K to 1073 K. The electrical transport behaviors of the samples are dominated by the thermal-activated polaron hopping in the low temperature range, the Fermi glass behavior in the middle temperature range, and the Anderson localized behavior in the high temperature range. The thermal conductivity presents a plateau at high-temperatures, indicating a glass-like thermal conduction behavior. Both the thermoelectric power factor and the thermal conductivity increase with the increase of the degree of oxygen-reduction. Taking these two factors into account, the oxygen-reduction can still contribute to promoting the thermoelectric figure of merit. The highest ZT value is obtained to be ˜0.19 at 1073 K in the heaviest oxygen reduced sample. Project supported by the National Basic Research Program of China (Grant No. 2013CB632506) and the National Natural Science Foundation of China (Grant Nos. 51202132 and 51002087).

Electrical conductivity of oxidized-graphenic nanoplatelets obtained from bamboo: effect of the oxygen content

NASA Astrophysics Data System (ADS)

Gross, K.; Prías Barragán, J. J.; Sangiao, S.; De Teresa, J. M.; Lajaunie, L.; Arenal, R.; Ariza Calderón, H.; Prieto, P.

2016-09-01

The large-scale production of graphene and reduced-graphene oxide (rGO) requires low-cost and eco-friendly synthesis methods. We employed a new, simple, cost-effective pyrolytic method to synthetize oxidized-graphenic nanoplatelets (OGNP) using bamboo pyroligneous acid (BPA) as a source. Thorough analyses via high-resolution transmission electron microscopy and electron energy-loss spectroscopy provides a complete structural and chemical description at the local scale of these samples. In particular, we found that at the highest carbonization temperature the OGNP-BPA are mainly in a sp2 bonding configuration (sp2 fraction of 87%). To determine the electrical properties of single nanoplatelets, these were contacted by Pt nanowires deposited through focused-ion-beam-induced deposition techniques. Increased conductivity by two orders of magnitude is observed as oxygen content decreases from 17% to 5%, reaching a value of 2.3 × 103 S m-1 at the lowest oxygen content. Temperature-dependent conductivity reveals a semiconductor transport behavior, described by the Mott three-dimensional variable range hopping mechanism. From the localization length, we estimate a band-gap value of 0.22(2) eV for an oxygen content of 5%. This investigation demonstrates the great potential of the OGNP-BPA for technological applications, given that their structural and electrical behavior is similar to the highly reduced rGO sheets obtained by more sophisticated conventional synthesis methods.

Experimental insight into the magnetic and electrical properties of amorphous Ge1-xMnx

NASA Astrophysics Data System (ADS)

Conta, Gianluca; Amato, Giampiero; Coïsson, Marco; Tiberto, Paola

2017-12-01

We present a study of the electrical and magnetic properties of the amorphous Ge1-xMnx.DMS, with 2% ≤ x ≤ 17%, by means of SQUID magnetometry and low temperature DC measurements. The thin films were grown by physical vapour deposition at 50°C in ultrahigh vacuum. The DC electrical characterizations show that variable range hopping is the main mechanism of charge transport below room temperature. Magnetic characterization reveals that a unique and smooth magnetic transition is present in our samples, which can be attributed to ferromagnetic percolation of bound magnetic polarons.

Chicano Hip-Hop as Interethnic Contact Zone

ERIC Educational Resources Information Center

McFarland, Pancho

2008-01-01

Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

Frame error rate for single-hop and dual-hop transmissions in 802.15.4 LoWPANs

NASA Astrophysics Data System (ADS)

Biswas, Sankalita; Ghosh, Biswajit; Chandra, Aniruddha; Dhar Roy, Sanjay

2017-08-01

IEEE 802.15.4 is a popular standard for personal area networks used in different low-rate short-range applications. This paper examines the error rate performance of 802.15.4 in fading wireless channel. An analytical model is formulated for evaluating frame error rate (FER); first, for direct single-hop transmission between two sensor nodes, and second, for dual-hop (DH) transmission using an in-between relay node. During modeling the transceiver design parameters are chosen according to the specifications set for both the 2.45 GHz and 868/915 MHz bands. We have also developed a simulation test bed for evaluating FER. Some results showed expected trends, such as FER is higher for larger payloads. Other observations are not that intuitive. It is interesting to note that the error rates are significantly higher for the DH case and demands a signal-to-noise ratio (SNR) penalty of about 7 dB. Also, the FER shoots from zero to one within a very small range of SNR.

Characterization of host-dependent mutations of apple fruit crinkle viroid replicating in newly identified experimental hosts suggests maintenance of stem-loop structures in the left-hand half of the molecule is important for replication.

PubMed

Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo

2017-03-01

Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.

Etching-free patterning method for electrical characterization of atomically thin MoSe2 films grown by chemical vapor deposition.

PubMed

Utama, M Iqbal Bakti; Lu, Xin; Zhan, Da; Ha, Son Tung; Yuan, Yanwen; Shen, Zexiang; Xiong, Qihua

2014-11-07

Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong, Jie; Yan, Jiaqiang; Aczel, Adam A.

The structural, electrical, and magnetic properties of the double perovskite Ba 2LuReO 6 have been examined in this paper. It is an insulator whose temperature dependent conductivity is consistent with variable range hopping electrical transport. A transition to an antiferromagnet state with type I order occurs below T N = 31 K. High resolution time-of-flight neutron powder diffraction measurements show that it retains the cubic double perovskite structure down to 10 K. High intensity, low resolution neutron powder diffraction measurements confirm the antiferromagnetic order and indicate that cubic symmetry is still observed at 1.5 K. The small ordered moment ofmore » 0.34(4)μ B per Re is comparable to estimates of moments on 5d 2 ions in other antiferromagnetically ordered cubic double perovskites. Finally, comparisons with related double perovskites containing 5d 2 ions, such as Os 6+ and Re 5+, reveal that subtle changes in structure or electron configuration of the diamagnetic octahedral cations can have a large impact on the magnetic ground state, the size of the ordered moment, and the Néel temperature.« less

Surface quantum oscillations and weak antilocalization effect in topological insulator (Bi0.3Sb0.7)2Te3

NASA Astrophysics Data System (ADS)

Urkude, Rajashri; Rawat, Rajeev; Palikundwar, Umesh

2018-04-01

In 3D topological insulators, achieving a genuine bulk-insulating state is an important topic of research. The material system (Bi,Sb)2(Te,Se)3 has been proposed as a topological insulator with high resistivity and low carrier concentration. Topological insulators are predicted to present interesting surface transport phenomena but their experimental studies have been hindered by metallic bulk conduction that overwhelms the surface transport. Here we present a study of the bulk-insulating properties of (Bi0.3Sb0.7)2Te3. We show that a high resistivity exceeding 1 Ωm as a result of variable-range hopping behavior of state and Shubnikov-de Haas oscillations as coming from the topological surface state. We have been able to clarify both the bulk and surface transport channels, establishing a comprehensive understanding of the transport properties in this material. Our results demonstrate that (Bi0.3Sb0.7)2Te3 is a good material for studying the surface quantum transport in a topological insulator.

Liquid phase mass production of air-stable black phosphorus/phospholipids nanocomposite with ultralow tunneling barrier

NASA Astrophysics Data System (ADS)

Zhang, Qiankun; Liu, Yinan; Lai, Jiawei; Qi, Shaomian; An, Chunhua; Lu, Yao; Duan, Xuexin; Pang, Wei; Zhang, Daihua; Sun, Dong; Chen, Jian-Hao; Liu, Jing

2018-04-01

Few-layer black phosphorus (FLBP), a recently discovered two-dimensional semiconductor, has attracted substantial attention in the scientific and technical communities due to its great potential in electronic and optoelectronic applications. However, reactivity of FLBP flakes with ambient species limits its direct applications. Among various methods to passivate FLBP in ambient environment, nanocomposites mixing FLBP flakes with stable matrix may be one of the most promising approaches for industry applications. Here, we report a simple one-step procedure to mass produce air-stable FLBP/phospholipids nanocomposite in liquid phase. The resultant nanocomposite is found to have ultralow tunneling barrier for charge carriers which can be described by an Efros-Shklovskii variable range hopping mechanism. Devices made from such mass-produced FLBP/phospholipids nanocomposite show highly stable electrical conductivity and opto-electrical response in ambient conditions, indicating its promising applications in both electronic and optoelectronic applications. This method could also be generalized to the mass production of nanocomposites consisting of other air-sensitive 2D materials, such as FeSe, NbSe2, WTe2, etc.

Extreme Kinematics in Selected Hip Hop Dance Sequences.

PubMed

Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

2015-09-01

Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

Tunable electronic properties of graphene through controlling bonding configurations of doped nitrogen atoms.

PubMed

Zhang, Jia; Zhao, Chao; Liu, Na; Zhang, Huanxi; Liu, Jingjing; Fu, Yong Qing; Guo, Bin; Wang, Zhenlong; Lei, Shengbin; Hu, PingAn

2016-06-21

Single-layer and mono-component doped graphene is a crucial platform for a better understanding of the relationship between its intrinsic electronic properties and atomic bonding configurations. Large-scale doped graphene films dominated with graphitic nitrogen (GG) or pyrrolic nitrogen (PG) were synthesized on Cu foils via a free radical reaction at growth temperatures of 230-300 °C and 400-600 °C, respectively. The bonding configurations of N atoms in the graphene lattices were controlled through reaction temperature, and characterized using Raman spectroscopy, X-ray photoelectron spectroscopy and scanning tunneling microscope. The GG exhibited a strong n-type doping behavior, whereas the PG showed a weak n-type doping behavior. Electron mobilities of the GG and PG were in the range of 80.1-340 cm(2) V(-1)·s(-1) and 59.3-160.6 cm(2) V(-1)·s(-1), respectively. The enhanced doping effect caused by graphitic nitrogen in the GG produced an asymmetry electron-hole transport characteristic, indicating that the long-range scattering (ionized impurities) plays an important role in determining the carrier transport behavior. Analysis of temperature dependent conductance showed that the carrier transport mechanism in the GG was thermal excitation, whereas that in the PG, was a combination of thermal excitation and variable range hopping.

Tunable electronic properties of graphene through controlling bonding configurations of doped nitrogen atoms

PubMed Central

Zhang, Jia; Zhao, Chao; Liu, Na; Zhang, Huanxi; Liu, Jingjing; Fu, Yong Qing; Guo, Bin; Wang, Zhenlong; Lei, Shengbin; Hu, PingAn

2016-01-01

Single–layer and mono–component doped graphene is a crucial platform for a better understanding of the relationship between its intrinsic electronic properties and atomic bonding configurations. Large–scale doped graphene films dominated with graphitic nitrogen (GG) or pyrrolic nitrogen (PG) were synthesized on Cu foils via a free radical reaction at growth temperatures of 230–300 °C and 400–600 °C, respectively. The bonding configurations of N atoms in the graphene lattices were controlled through reaction temperature, and characterized using Raman spectroscopy, X–ray photoelectron spectroscopy and scanning tunneling microscope. The GG exhibited a strong n–type doping behavior, whereas the PG showed a weak n–type doping behavior. Electron mobilities of the GG and PG were in the range of 80.1–340 cm2 V−1·s−1 and 59.3–160.6 cm2 V−1·s−1, respectively. The enhanced doping effect caused by graphitic nitrogen in the GG produced an asymmetry electron–hole transport characteristic, indicating that the long–range scattering (ionized impurities) plays an important role in determining the carrier transport behavior. Analysis of temperature dependent conductance showed that the carrier transport mechanism in the GG was thermal excitation, whereas that in the PG, was a combination of thermal excitation and variable range hopping. PMID:27325386

"Reaching the Hip-Hop Generation." The MEE Symposium (New York, New York, March 1-2, 1993). Final (Symposium Proceedings) Report.

ERIC Educational Resources Information Center

MEE Productions Inc., Philadelphia, PA. Research Div.

This final report attempts to capture the work and atmosphere of the recent symposium convened by Motivational Educational Entertainment, Inc. (MEE), a black-owned communications research, consulting, and video production company. In its commitment to helping urban youth, MEE conducted a study of the "hip-hop" generation and its…

Low-frequency dielectric properties of intrinsic and Al-doped rutile TiO{sub 2} thin films grown by the atomic layer deposition technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.

2016-06-28

Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less

Photon hopping and nanowire based hybrid plasmonic waveguide and ring-resonator

PubMed Central

Gu, Zhiyuan; Liu, Shuai; Sun, Shang; Wang, Kaiyang; Lyu, Quan; Xiao, Shumin; Song, Qinghai

2015-01-01

Nanowire based hybrid plasmonic structure plays an important role in achieving nanodevices, especially for the wide band-gap materials. However, the conventional schemes of nanowire based devices such as nano-resonators are usually isolated from the integrated nano-network and have extremely low quality (Q) factors. Here we demonstrate the transmission of waves across a gap in hybrid plasmonic waveguide, which is termed as “photon hopping”. Based on the photon hopping, we show that the emissions from nanodevices can be efficiently collected and conducted by additional nanowires. The collection ratio can be higher than 50% for a wide range of separation distance, transverse shift, and tilt. Moreover, we have also explored the possibility of improving performances of individual devices by nano-manipulating the nanowire to a pseudo-ring. Our calculations show that both Q factor and Purcell factor have been increased by more than an order of magnitude. We believe that our researches will be essential to forming nanolasers and the following nano-networks.

Unique dielectric dipole and hopping ion dipole relaxation in disordered systems

NASA Astrophysics Data System (ADS)

Govindaraj, G.

2018-04-01

Dielectric or ac conductivity measurements of dielectric and ion conducting glass and crystalline systems provide considerable insight into the nature of the dipolar and ionic motions in disordered solids. However, interpreting the dielectric or ac conductivity has been a matter of considerable debate based on the existing models and empirical formalism, particularly in regards to how best to represent the relaxation process that is the result of a transition from correlated to uncorrelated dipolar and ionic motions. A unique dipole interaction process has been proposed for the (a) dielectric dipole process (b) the hopping ion conducting dipole process and the (c) combination (a) and (b) for the description of dielectric spectra and ac conductivityspectra and results are reported.

Biomechanical symmetry in elite rugby union players during dynamic tasks: an investigation using discrete and continuous data analysis techniques.

PubMed

Marshall, Brendan; Franklyn-Miller, Andrew; Moran, Kieran; King, Enda; Richter, Chris; Gore, Shane; Strike, Siobhán; Falvey, Éanna

2015-01-01

While measures of asymmetry may provide a means of identifying individuals predisposed to injury, normative asymmetry values for challenging sport specific movements in elite athletes are currently lacking in the literature. In addition, previous studies have typically investigated symmetry using discrete point analyses alone. This study examined biomechanical symmetry in elite rugby union players using both discrete point and continuous data analysis techniques. Twenty elite injury free international rugby union players (mean ± SD: age 20.4 ± 1.0 years; height 1.86 ± 0.08 m; mass 98.4 ± 9.9 kg) underwent biomechanical assessment. A single leg drop landing, a single leg hurdle hop, and a running cut were analysed. Peak joint angles and moments were examined in the discrete point analysis while analysis of characterising phases (ACP) techniques were used to examine the continuous data. Dominant side was compared to non-dominant side using dependent t-tests for normally distributed data or Wilcoxon signed-rank test for non-normally distributed data. The significance level was set at α = 0.05. The majority of variables were found to be symmetrical with a total of 57/60 variables displaying symmetry in the discrete point analysis and 55/60 in the ACP. The five variables that were found to be asymmetrical were hip abductor moment in the drop landing (p = 0.02), pelvis lift/drop in the drop landing (p = 0.04) and hurdle hop (p = 0.02), ankle internal rotation moment in the cut (p = 0.04) and ankle dorsiflexion angle also in the cut (p = 0.01). The ACP identified two additional asymmetries not identified in the discrete point analysis. Elite injury free rugby union players tended to exhibit bi-lateral symmetry across a range of biomechanical variables in a drop landing, hurdle hop and cut. This study provides useful normative values for inter-limb symmetry in these movement tests. When examining symmetry it is recommended to incorporate continuous data analysis techniques rather than a discrete point analysis alone; a discrete point analysis was unable to detect two of the five asymmetries identified.

Fully patterned p-channel SnO TFTs using transparent Al2O3 gate insulator and ITO as source and drain contacts

NASA Astrophysics Data System (ADS)

Guzmán-Caballero, D. E.; Quevedo-López, M. A.; De la Cruz, W.; Ramírez-Bon, R.

2018-03-01

SnO p-type was used as active layer to fabricate thin film transistors (TFTs) through photolithography and dry etching processes. The SnO p-type thin films (25 nm) were deposited by DC reactive sputtering with variable oxygen (O2) flow rate to then be annealed in air at 250 ◦C. Al2O3 gate dielectric (15 nm) was deposited by atomic layer deposition. Hall measurements showed p-type carrier concentration (N h ) of around 1 × 1018 cm-3 and Hall mobilities (μ Hall) between 0.35 and 2.64 cm2 V-1 s-1, depending on the O2 flow rate during deposition. The hole transport was dominated by variable-range hopping conduction. A change in the preferred crystalline orientation in the SnO films from (101) to (110) was associated with the increase in μ Hall. In addition, Raman vibrational modes at 110 and 209 cm-1 of polycrystalline SnO films showed certain dependence with the grain orientation. The SnO-based TFTs showed p-type behavior with low threshold voltages (V T ) and low sub threshold swing (SS) in the range from 1.76 to 3.50 V and 1.63 to 3.24 V/dec., respectively. The TFTs mobilities in the saturation regime (μ sat) were in the range of 0.12 and 1.32 cm2 V-1 s-1. The current on/off ratio (I ON/I OFF) was in the order of 102, approximately. The large values of the interface trap density (D IT) contributed to the high I OFF and the low I ON/I OFF of the TFTs.

High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming

NASA Astrophysics Data System (ADS)

Murphy, D. W.; Webster, D. R.; Yen, J.

2012-11-01

Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy.

PubMed

Hsu, Chao-Jung; George, Steven Z; Chmielewski, Terese L

2016-12-01

Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Descriptive laboratory study. A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD 0-200ms and RTD 0-peak torque ). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD 0-200ms , and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD 0-200ms , and the knee extension moment was positively associated with RTD 0-200ms . At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD 0-200ms , and RTD 0-peak torque . Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance.

Association of Quadriceps Strength and Psychosocial Factors With Single-Leg Hop Performance in Patients With Meniscectomy

PubMed Central

Hsu, Chao-Jung; George, Steven Z.; Chmielewski, Terese L.

2016-01-01

Background: Clinicians use the single-leg hop test to assess readiness for return to sports after knee injury. Few studies have reported the results of single-leg hop testing after meniscectomy. Additionally, the contributions of impairments in quadriceps strength and psychosocial factors to single-leg hop performance are unknown. Purpose: To compare single-leg hop performance (distance and landing mechanics) between limbs and to examine the association of single-leg hop performance with quadriceps strength and psychosocial factors in patients with meniscectomy. Study Design: Descriptive laboratory study. Methods: A total of 22 subjects who underwent meniscectomy for traumatic meniscal tears received either standard rehabilitation alone or with additional quadriceps strengthening. Testing was conducted immediately postrehabilitation and at 1 year postsurgery. A single-leg hop test was performed bilaterally, and hop distance was used to create a hop symmetry index. Landing mechanics (peak knee flexion angle, knee extension moment, and peak vertical ground-reaction force) were analyzed with a motion-capture system and a force plate. An isokinetic dynamometer (60 deg/s) assessed knee extensor peak torque and rate of torque development (RTD0-200ms and RTD0–peak torque). Questionnaires assessed fear of reinjury (Tampa Scale for Kinesiophobia [TSK-11]) and self-efficacy (Knee Activity Self-Efficacy [KASE]). Results: Rehabilitation groups did not significantly differ in single-leg hop performance; therefore, groups were combined for further analyses. The mean hop symmetry index was 88.6% and 98.9% at postrehabilitation and 1 year postsurgery, respectively. Compared with the nonsurgical limb, the surgical limb showed decreased peak knee flexion angle at postrehabilitation and decreased knee extension moment at 1 year postsurgery. The hop symmetry index was positively associated with peak torque, RTD0-200ms, and the KASE score at postrehabilitation. Moreover, at postrehabilitation, the peak knee flexion angle was positively associated with peak torque and RTD0-200ms, and the knee extension moment was positively associated with RTD0-200ms. At 1 year postsurgery, peak knee flexion angle and knee extension moment were both positively associated with peak torque, RTD0-200ms, and RTD0–peak torque. Conclusion: Although the hop symmetry index could be considered satisfactory for returning to sports, asymmetries in landing mechanics still exist in the first year postmeniscectomy. Greater quadriceps strength was associated with greater single-leg hop distance and better landing mechanics at both postrehabilitation and 1 year postsurgery. Knee activity self-efficacy was the only psychosocial factor associated with single-leg hop performance and isolated to a positive association with single-leg hop distance at postrehabilitation. Clinical Relevance: Rate of development is not typically measured in the clinic but can be an additional quadriceps measure to monitor for single-leg hop performance. Quadriceps strength and psychosocial factors appear to have separate influence on single-leg hop performance after meniscectomy, which has implications for developing appropriate interventions for optimal single-leg hop performance. PMID:28210647

Effect of impurities of selenium and iron on the Anderson localization of 1T-TaS 2

NASA Astrophysics Data System (ADS)

Ōnuki, Y.; Inada, R.; Tanuma, S.

1980-01-01

The temperature dependence of electrical resistivities θ( T) of 1T-TaS 2, 1T-TaS 2- xSe x and 1T-Fe xTa 1- xS 2 is found to be θ( T) ∝ exp( T0/ T) 1/n in the temperature range of 4 K to the measured lowest temperature, 0.1 K, showing the variable range hopping of Anderson localized states. The n-value is nearly 3 for selenium doping and nearly 2 for non-doping and iron doping. The positive magnetoresistance, which is sizable only in the temperature range of 2 K to 0.5 K in 1T-TaS 2, is found to be remarkably enhanced by the selenium doping, while the tendency is reversed by the iron doping.

Systematic assessment of scaffold hopping versus activity cliff formation across bioactive compound classes following a molecular hierarchy.

PubMed

Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

2015-07-01

Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.

Mismatch in cation size causes rapid anion dynamics in solid electrolytes: the role of the Arrhenius pre-factor.

PubMed

Breuer, Stefan; Wilkening, Martin

2018-03-28

Crystalline ion conductors exhibiting fast ion dynamics are of utmost importance for the development of, e.g., sensors or rechargeable batteries. In some layer-structured or nanostructured compounds fluorine ions participate in remarkably fast self-diffusion processes. As has been shown earlier, F ion dynamics in nanocrystalline, defect-rich BaF 2 is much higher than that in the coarse-grained counterpart BaF 2 . The thermally metastable fluoride (Ba,Ca)F 2 , which can be prepared by joint high-energy ball milling of the binary fluorides, exhibits even better ion transport properties. While long-range ion dynamics has been studied recently, less information is known about local ion hopping processes to which 19 F nuclear magnetic resonance (NMR) spin-lattice relaxation is sensitive. The present paper aims at understanding ion dynamics in metastable, nanocrystalline (Ba,Ca)F 2 by correlating short-range ion hopping with long-range transport properties. Variable-temperature NMR line shapes clearly indicate fast and slow F spin reservoirs. Surprisingly, from an atomic-scale point of view increased ion dynamics at intermediate values of composition is reflected by increased absolute spin-lattice relaxation rates rather than by a distinct minimum in activation energy. Hence, the pre-factor of the underlying Arrhenius relation, which is determined by the number of mobile spins, the attempt frequency and entropy effects, is identified as the parameter that directly enhances short-range ion dynamics in metastable (Ba,Ca)F 2 . Concerted ion migration could also play an important role to explain the anomalies seen in NMR spin-lattice relaxation.

HOPPING CONDUCTIVITY AND MAGNETIC TRANSITIONS OF THE Cu2+ SPINS IN SINGLE-CRYSTAL La2CuO4+y

NASA Astrophysics Data System (ADS)

Thio, Tineke; Birgeneau, R. J.; Chen, C. Y.; Freer, B. S.; Gabbe, D. R.; Jenssen, H. P.; Kastner, M. A.; Picone, P. J.; Preyer, N. W.

Measurements are reported of the magnetoresistance (MR) for fields up to 23T in La2CuO4+y single crystals in which the Cu2+ spins order antiferromagnetically at TN˜240K, and in which the conductivity at low temperature is characterised by hopping between localised states. Using the MR, we map out the phase diagram of the spin flop transition, observed when the magnetic field is applied parallel to the zero-field staggered magnetisation, and that of the weak-ferromagnetic transition, observed with the field perpendicular to the CuO planes. In both transitions the antiferromagnetic propagation vector changes from the ěca direction at zero field to the ěcc direction at the highest fields. This rather subtle change of the Cu spin ordering is accompanied by a large increase in the interlayer hopping conductivity: up to a factor 2. We show that the magnetoconductance is proportional to the three-dimensional staggered moment with propagation vector in the orthorhombic ěcc direction. The origin of this unusual behaviour is an important unsolved problem.

Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

NASA Astrophysics Data System (ADS)

Beyer, Eric W.

The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

Phase sensitive molecular dynamics of self-assembly glycolipid thin films: A dielectric spectroscopy investigation

NASA Astrophysics Data System (ADS)

Velayutham, T. S.; Ng, B. K.; Gan, W. C.; Majid, W. H. Abd.; Hashim, R.; Zahid, N. I.; Chaiprapa, Jitrin

2014-08-01

Glycolipid, found commonly in membranes, is also a liquid crystal material which can self-assemble without the presence of a solvent. Here, the dielectric and conductivity properties of three synthetic glycolipid thin films in different thermotropic liquid crystal phases were investigated over a frequency and temperature range of (10-2-106 Hz) and (303-463 K), respectively. The observed relaxation processes distinguish between the different phases (smectic A, columnar/hexagonal, and bicontinuous cubic Q) and the glycolipid molecular structures. Large dielectric responses were observed in the columnar and bicontinuous cubic phases of the longer branched alkyl chain glycolipids. Glycolipids with the shortest branched alkyl chain experience the most restricted self-assembly dynamic process over the broad temperature range studied compared to the longer ones. A high frequency dielectric absorption (Process I) was observed in all samples. This is related to the dynamics of the hydrogen bond network from the sugar group. An additional low-frequency mechanism (Process II) with a large dielectric strength was observed due to the internal dynamics of the self-assembly organization. Phase sensitive domain heterogeneity in the bicontinuous cubic phase was related to the diffusion of charge carriers. The microscopic features of charge hopping were modelled using the random walk scheme, and two charge carrier hopping lengths were estimated for two glycolipid systems. For Process I, the hopping length is comparable to the hydrogen bond and is related to the dynamics of the hydrogen bond network. Additionally, that for Process II is comparable to the bilayer spacing, hence confirming that this low-frequency mechanism is associated with the internal dynamics within the phase.

Hip hopping the gap--performing arts approaches to sexual health disadvantage in young people in remote settings.

PubMed

Crouch, Alan; Robertson, Heather; Fagan, Patricia

2011-07-01

Closing the gap in Indigenous health and wellbeing in remote settings in the Torres Strait and Northern Peninsula Area of Far North Queensland (FNQ) includes addressing a well-documented sexual health disadvantage among young people. Community mobilization around the underlying risk factors influencing sexual health is required. Performing-arts-based workshops were conducted in schools and after-school venues in four remote Aboriginal and Torres Strait islander locations in FNQ in early 2010, to initiate consciousness-raising around the real dimensions of youth sexual health risk. Specific objectives included strengthening operational partnerships at school-level and developing ongoing consultative processes in each location for sexual health reference group development. Results include a significantly strengthened productive partnership with primary and high schools in each location and sixteen production-ready hip hop songs exploring a range of physical, emotional and sexual health themes authored by the students and recorded on site. Additional outcomes included the willingness of community councils and civil society organizations to support local sexual health reference group activity. This initiative, the Indigenous Hip Hop Project, although accompanied by opportunity costs including alternative, more core business uses of staff time and program budget, has demonstrated the power of tapping the creative energy of young people at risk and the potential for mobilizing communities to activism around sexual health disadvantage.

Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3−δ} (Me = Fe, Mn)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niwa, Eiki, E-mail: e-niwa@phys.chs.nihon-u.ac.jp; Department of Integrated Sciences in Physics and Biology, College of Humanities and Sciences, Nihon University, Setagaya-ku, Tokyo 156-8550; Maeda, Hiroki

Graphical abstract: Compositional dependence of (a) electrical conductivity and (b) E{sub a} for hopping conduction of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn). - Highlights: • Electrical conduction mechanism of LaNi{sub x}Me{sub 1−x}O{sub 3} (Me = Fe, Mn) was investigated. • Hopping conduction model could be applied for conductivity of both specimens. • The difference of E{sub a} due to that of energy level of Fe and Mn was observed. • Hole concentration estimated by iodimetry increases with increasing Ni content. - Abstract: Electrical conduction mechanism of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} expected as Sr-freemore » new cathode material for solid oxide fuel cells was analyzed. Electrical conduction behaviors of both specimens could be well fitted by small polaron hopping conduction model. The electrical conductivity of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} increased with increasing Ni content, showing agreement with decrease of activation energy for hopping conduction. The decrease of electrical conductivity and increase of activation energy of LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} were observed with increasing Ni content for 0.0 ≤ x ≤ 0.4. Further Ni substitution increased electrical conductivity and decreased activation energy for 0.4 ≤ x ≤ 0.6. It was revealed using iodometry that the difference of hole carrier density between LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1−x}O{sub 3+δ} was small. It was suspected that the origin of the difference of electrical conduction behavior of LaNi{sub x}Fe{sub 1−x}O{sub 3−δ} and LaNi{sub x}Mn{sub 1-x}O{sub 3+δ} was difference of energy level of e{sub g} band composed of Fe 3d or Mn 3d orbitals and their overlapping quantity with O 2p and Ni 3d band.« less

The Effect of Holder Pasteurization on Nutrients and Biologically-Active Components in Donor Human Milk: A Review

PubMed Central

Peila, Chiara; Moro, Guido E.; Bertino, Enrico; Cavallarin, Laura; Giribaldi, Marzia; Giuliani, Francesca; Cresi, Francesco; Coscia, Alessandra

2016-01-01

When a mother’s milk is unavailable, the best alternative is donor milk (DM). Milk delivered to Human Milk Banks should be pasteurized in order to inactivate the microbial agents that may be present. Currently, pasteurization, performed at 62.5 °C for 30 min (Holder Pasteurization, HoP), is recommended for this purpose in international guidelines. Several studies have been performed to investigate the effects of HoP on the properties of DM. The present paper has the aim of reviewing the published papers on this topic, and to provide a comparison of the reported variations of biologically-active DM components before and after HoP. This review was performed by searching the MEDLINE, EMBASE, CINHAL and Cochrane Library databases. Studies that clearly identified the HoP parameters and compared the same DM samples, before and after pasteurization, were focused on. A total of 44 articles satisfied the above criteria, and were therefore selected. The findings from the literature report variable results. A possible explanation for this may be the heterogeneity of the test protocols that were applied. Moreover, the present review spans more than five decades, and modern pasteurizers may be able to modify the degradation kinetics for heat-sensitive substances, compared to older ones. Overall, the data indicate that HoP affects several milk components, although it is difficult to quantify the degradation degree. However, clinical practices demonstrate that many beneficial properties of DM still persist after HoP. PMID:27490567

A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

PubMed

Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

2017-02-01

This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

The Effect of Holder Pasteurization on Nutrients and Biologically-Active Components in Donor Human Milk: A Review.

PubMed

Peila, Chiara; Moro, Guido E; Bertino, Enrico; Cavallarin, Laura; Giribaldi, Marzia; Giuliani, Francesca; Cresi, Francesco; Coscia, Alessandra

2016-08-02

When a mother's milk is unavailable, the best alternative is donor milk (DM). Milk delivered to Human Milk Banks should be pasteurized in order to inactivate the microbial agents that may be present. Currently, pasteurization, performed at 62.5 °C for 30 min (Holder Pasteurization, HoP), is recommended for this purpose in international guidelines. Several studies have been performed to investigate the effects of HoP on the properties of DM. The present paper has the aim of reviewing the published papers on this topic, and to provide a comparison of the reported variations of biologically-active DM components before and after HoP. This review was performed by searching the MEDLINE, EMBASE, CINHAL and Cochrane Library databases. Studies that clearly identified the HoP parameters and compared the same DM samples, before and after pasteurization, were focused on. A total of 44 articles satisfied the above criteria, and were therefore selected. The findings from the literature report variable results. A possible explanation for this may be the heterogeneity of the test protocols that were applied. Moreover, the present review spans more than five decades, and modern pasteurizers may be able to modify the degradation kinetics for heat-sensitive substances, compared to older ones. Overall, the data indicate that HoP affects several milk components, although it is difficult to quantify the degradation degree. However, clinical practices demonstrate that many beneficial properties of DM still persist after HoP.

Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

ERIC Educational Resources Information Center

Alim, H. Samy

2011-01-01

This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

ERIC Educational Resources Information Center

Love, Bettina L.

2015-01-01

Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

PubMed

Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

2013-10-01

Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

Molecular cloning and characterization of an Hsp90/70 organizing protein gene from Frankliniella occidentalis (Insecta: Thysanoptera, Thripidae).

PubMed

Li, Hong-Bo; Du, Yu-Zhou

2013-05-15

The heat shock 90/70 organizing protein (Hop), also known as Sti-1 (stress-induced protein-1), is a co-chaperone that usually mediates the interaction of Hsp90 and Hsp70 and has been extensively characterized in mammals and plants. However, its role in insects remains unknown. In the present study, we isolated and characterized a Hop homologue gene from Frankliniella occidentalis (Fohop). The Fohop contains a 1659bp ORF encoding a protein of 552 amino acids with a caculated molecular mass of approximately 62.25kDa, which displays a reasonable degree of identity with the known Hops and shares several canonical motifs, including three tetratricopeptide repeated motif domains (TPR1, TPR2A and TPR2B) and two aspartic acid-proline (DP) repeat motifs (DP1 and DP2). As in other hops, Fohop contains introns, but the number and the position are quite variable. The mRNA expression patterns indicated that Fohop was constitutively expressed throughout the developmental stages, but was obviously upregulated by heat stress both in larvae and adults. Our studies imply that Hop, as in other Hsps, may play an important role in heat shock response of F. occidentalis. Copyright © 2013 Elsevier B.V. All rights reserved.

Single-Leg Hop Test Performance and Isokinetic Knee Strength After Anterior Cruciate Ligament Reconstruction in Athletes

PubMed Central

Sueyoshi, Ted; Nakahata, Akihiro; Emoto, Gen; Yuasa, Tomoki

2017-01-01

Background: Isokinetic strength and hop tests are commonly used to assess athletes’ readiness to return to sport after knee surgery. Purpose/Hypothesis: The purpose of this study was to investigate the results of single-leg hop and isokinetic knee strength testing in athletes who underwent anterior cruciate ligament reconstruction (ACLR) upon returning to sport participation as well as to study the correlation between these 2 test batteries. The secondary purpose was to compare the test results by graft type (patellar tendon or hamstring). It was hypothesized that there would be no statistically significant limb difference in either isokinetic knee strength or single-leg hop tests, that there would be a moderate to strong correlation between the 2 test batteries, and that there would be no significant difference between graft types. Study Design: Cross-sectional study; Level of evidence, 3. Methods: Twenty-nine high school and collegiate athletes who underwent ACLR participated in this study. At the time of return to full sport participation, a series of hop tests and knee extension/flexion isokinetic strength measurements were conducted. The results were analyzed using analysis of variance and Pearson correlation (r). Results: The timed 6-m hop test was the only hop test that showed a significant difference between the involved and uninvolved limbs (2.3 and 2.2 seconds, respectively; P = .02). A significant difference between limbs in knee strength was found for flexion peak torque/body weight at 180 deg/s (P = .03), flexion total work/body weight at 180 deg/s (P = .04), and flexion peak torque/body weight at 300 deg/s (P = .03). The strongest correlation between the hop tests and knee strength was found between the total distance of the hop tests and flexion total work/body weight at 300 deg/s (r = 0.69) and between the timed 6-m hop test and flexion peak torque/body weight at 300 deg/s (r = –0.54). There was no statistically significant difference in hop test performance or isokinetic knee strength between graft types. Conclusion: The single-leg hop tests and isokinetic strength measurements were both useful for a bilateral comparison of knee functional performance and strength. Knee flexion strength deficits and flexion-to-extension ratios seemed to be correlated with single-leg hop test performance. There was no difference in postoperative hop test performance or knee strength according to graft type. PMID:29164167

Impedance spectroscopy study of 2, 2, 7, 7' -tetra kis-(N,N-di-4-methoxy phenyl amino)-9,9'-spirobifluorene thin films

NASA Astrophysics Data System (ADS)

Rana, Omwati; Agrawal, Kalpana; Rajput, S. S.; Zulfequar, M.; Husain, M.; Kamalasanan, M. N.; Srivastava, Ritu

2016-05-01

The electrical properties of thermally evaporated film of 2,2,7,7'-tetrakis-(N,N-di-4-methoxyphenylamino)-9,9'-spirobifluorene (Spiro MeO TAD) have been investigated for hole only devices as a function of temperatures at frequency range from 1Hz to 1 MHz using Impedance spectroscopy. Cole-Cole plots, at each temperature, show semicircles that can be modeled with a contact resistance and parallel resistance -capacitor(R-C) circuits. Bulk resistance decreases and electrical conductivity increases with increasing temperature which indicate negative temperature coefficient of resistance nature and short range translational type hopping mechanism in Spiro MeO TAD thin films.

Dielectric study of chalcogenide (Se80Te20)94Ge6 glass

NASA Astrophysics Data System (ADS)

Sharma, Neha; Patial, Balbir Singh; Thakur, Nagesh

2018-04-01

In the present study, dielectric characteristics specifically dielectric constant (ɛ'), dielectric loss (ɛ″) and AC conductivity (σAC) have been investigated for chalcogenide (Se80Te20)94Ge6 glass in the frequency range from 1Hz to 1MHz and within the temperature range from 300 K to 380 K. ɛ'(ω) and ɛ″(ω) are found to be frequency and temperature dependent. This behaviour is interpreted on the basis of Guintini's theory of dielectric dispersion. The investigated glass obeys the power law ωs (s<1) and decreases as temperature rises. The obtained results are discussed in terms of the correlation barrier hopping (CBH) model proposed by Elliot.

Steerable Hopping Six-Legged Robot

NASA Technical Reports Server (NTRS)

Younse, Paulo; Aghazarian, Hrand

2010-01-01

The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.

Study of electrical conductivity and memory switching in the zinc-vanadium-phosphate glasses

NASA Astrophysics Data System (ADS)

Mirzayi, M.; Hekmatshoar, M. H.

2013-07-01

Vanadium zinc phosphate glasses were prepared by the conventional melt quenching technique and effect of V2O5 concentration on d.c. conductivity of prepared samples were investigated. X-ray diffraction patterns confirmed the glassy character of the samples. The d.c. conductivity increased with increase in V2O5 content. Results showed that activation energy has a single value in the investigated range of temperature, which can be explained in accordance with Mott small pollaron hopping model. I-V characteristics at high electric field showed that switching in these glasses was memory type. The threshold field of switching was found to decrease with increase in V2O5 content. Non-linear behavior and switching phenomenon was explained by Pool-Frenkel effect and thermal model.

Possible origin of nonlinear conductivity and large dielectric constant in the commensurate charge-density-wave phase of 1 T -TaS2

NASA Astrophysics Data System (ADS)

Ma, Yongchang; Hou, Yanhui; Lu, Cuimin; Li, Lijun; Petrovic, Cedomir

2018-05-01

The electric field dependence of the dielectric properties and the nonlinear conductance of 1 T -TaS2 below 50 K has been investigated. A large dielectric constant of about 104 is obtained up to 107 Hz, which cannot be attributed to hopping of the localized carriers alone, the collective excitations of the commensurate charge-density-wave must be another contributor. The dielectric spectra disperse slightly in our measured temperature and frequency range. At a moderate dc bias field, the real part of the dielectric constant ɛ1(ω ) decreases. We propose that the separation of bound soliton-antisoliton pairs may be a contributor to the reduction of ɛ1(ω ) and the accompanying nonlinear conductivity with increasing dc bias.

Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

NASA Astrophysics Data System (ADS)

Bolch, Michael Adam

Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

PubMed Central

Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

2006-01-01

The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

Honest, Open, Proud for adolescents with mental illness: pilot randomized controlled trial.

PubMed

Mulfinger, Nadine; Müller, Sabine; Böge, Isabel; Sakar, Vehbi; Corrigan, Patrick W; Evans-Lacko, Sara; Nehf, Luise; Djamali, Julia; Samarelli, Anna; Kempter, Michael; Ruckes, Christian; Libal, Gerhard; Oexle, Nathalie; Noterdaeme, Michele; Rüsch, Nicolas

2018-06-01

Due to public stigma or self-stigma and shame, many adolescents with mental illness (MI) struggle with the decision whether to disclose their MI to others. Both disclosure and nondisclosure are associated with risks and benefits. Honest, Open, Proud (HOP) is a peer-led group program that supports participants with disclosure decisions in order to reduce stigma's impact. Previously, HOP had only been evaluated among adults with MI. This two-arm pilot randomized controlled trial included 98 adolescents with MI. Participants were randomly assigned to HOP and treatment as usual (TAU) or to TAU alone. Outcomes were assessed pre (T0/baseline), post (T1/after the HOP program), and at 3-week follow-up (T2/6 weeks after T0). Primary endpoints were stigma stress at T1 and quality of life at T2. Secondary outcomes included self-stigma, disclosure-related distress, empowerment, help-seeking intentions, recovery, and depressive symptoms. The trial is registered on ClinicalTrials (NCT02751229; http://www.clinicaltrials.gov). Compared to TAU, adolescents in the HOP program showed significantly reduced stigma stress at T1 (d = .92, p < .001) and increased quality of life at T2 (d = .60, p = .004). In a longitudinal mediation model, the latter effect was fully mediated by stigma stress reduction at T1. HOP further showed significant positive effects on self-stigma, disclosure-related distress, secrecy, help-seeking intentions, attitudes to disclosure, recovery, and depressive symptoms. Effects at T1 remained stable or improved further at follow-up. In a limited economic evaluation HOP was cost-efficient in relation to gains in quality of life. As HOP is a compact three-session program and showed positive effects on stigma and disclosure variables as well as on symptoms and quality of life, it could help to reduce stigma's negative impact among adolescents with MI. © 2017 Association for Child and Adolescent Mental Health.

Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

PubMed

Schumacher, Christian; Seyfarth, André

2017-01-01

In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific design). Consequently, variations in body mechanics are permitted with consistent compositions of sensory feedback pathways. Given the variability in human body morphology, such variations are highly relevant for human motor control.

Temperature gating and competing temperature-dependent effects in DNA molecular wires

NASA Astrophysics Data System (ADS)

Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

2017-02-01

While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

Transition temperature from band to hopping direct current conduction in crystalline semiconductors with hydrogen-like impurities: Heat versus Coulomb attraction

NASA Astrophysics Data System (ADS)

Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Zabrodskii, A. G.

2011-12-01

For nondegenerate bulk semiconductors, we have used the virial theorem to derive an expression for the temperature Tj of the transition from the regime of "free" motion of electrons in the c-band (or holes in the υ-band) to their hopping motion between donors (or acceptors). Distribution of impurities over the crystal was assumed to be of the Poisson type, while distribution of their energy levels was assumed to be of the Gaussian type. Our conception of the virial theorem implementation is that the transition from the band-like conduction to hopping conduction occurs when the average kinetic energy of an electron in the c-band (hole in the υ-band) is equal to the half of the absolute value of the average energy of the Coulomb interaction of an electron (hole) with the nearest neighbor ionized donor (acceptor). Calculations of Tj according to our model agree with experimental data for crystals of Ge, Si, diamond, etc. up to the concentrations of a hydrogen-like impurity, at which the phase insulator-metal transition (Mott transition) occurs. Under the temperature Th ≈ Tj /3, when the nearest neighbor hopping conduction via impurity atoms dominates, we obtained expressions for the electrostatic field screening length Λh in the Debye-Hückel approximation, taking into account a nonzero width of the impurity energy band. It is shown that the measurements of quasistatic capacitance of the semiconductor in a metal-insulator-semiconductor structure in the regime of the flat bands at the temperature Th allow to determine the concentration of doping impurity or its compensation ratio by knowing Λh.

Studies on frequency dependent electrical and dielectric properties of sintered zinc oxide pellets: effects of Al-doping

NASA Astrophysics Data System (ADS)

Tewari, S.; Ghosh, A.; Bhattacharjee, A.

2016-11-01

Sintered pellets of zinc oxide (ZnO), both undoped and Al-doped are prepared through a chemical process. Dopant concentration of Aluminium in ZnO [Al/Zn in weight percentage (wt%)] is varied from 0 to 3 wt%. After synthesis structural characterisation of the samples are performed with XRD and SEM-EDAX which confirm that all the samples are of ZnO having polycrystalline nature with particle size from 108.6 to 116 nm. Frequency dependent properties like a.c. conductivity, capacitance, impedance and phase angle are measured in the frequency range 10 Hz to 100 kHz as a function of temperature (in the range 25-150 °C). Nature of a.c. conductivity in these samples indicates hopping type of conduction arising from localised defect states. The frequency and temperature dependent properties under study are found to be as per correlated barrier hoping model. Dielectric and impedance properties studied in the samples indicate distributed relaxation, showing decrease of relaxation time with temperature.

Perceptions of the motivational climate, need satisfaction, and indices of well- and ill-being among hip hop dancers.

PubMed

Quested, Eleanor; Duda, Joan L

2009-01-01

Grounded in the self-determination theoretical framework (SDT) formulated by Deci and Ryan, and specifically the basic needs mini-theory (BNT), this study examined the relationship between perceptions of the motivational climate manifested in hip hop environments, satisfaction of the three basic needs, and indicators of well- and ill-being among hip hop dancers. Fifty-nine hip hop dancers (mean age: 20.29 years) completed a questionnaire assessing the variables of interest in the study. Perceptions of a task-involving climate were positively associated with satisfaction of the needs for autonomy, competence, and relatedness. Perceptions of an ego-involving climate negatively predicted relatedness. Satisfaction of the need for competence was positively associated with positive affect, and negatively linked to negative affect. Competence need satisfaction significantly mediated the relationship between a perceived task-involving climate and positive and negative affective states. In sum, the findings provided partial support for the facets of SDT and BNT. The results also indicated that promoting the task-involving features of dance learning environments may be beneficial to dancers' well-being.

Ac conductivity and dielectric properties of bulk tin phthalocyanine dichloride (SnPcCl 2)

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Farid, A. M.; Abd El-Rahman, K. F.; Ali, H. A. M.

2008-07-01

The ac conductivity, σac( ω), has been measured for bulk tin phthalocyanine dichloride (SnPcCl 2) in the form of compressed pellet with evaporated ohmic Au electrodes in a temperature range 303-403 K. Ac conductivity, σac( ω), is found to vary as ωs in the frequency range 42 Hz-5×10 6 Hz. At low range of frequency, s<1 and it decreases with the increase in temperature indicating a dominant hopping process. At high range of frequency, s is found to be equal to ≈1.09 and is temperature independent. The dielectric constant, ε1, and dialectic loss, ε2, have been determined for bulk SnPcCl 2. Both ε1 and ε2 decrease with the increase in frequency and increase with the increase in temperature. The Cole-Cole types have been used to determine some parameters such as; the macroscopic relaxation time ( τo), the molecular relaxation time ( τ), the activation energy for relaxation ( Eo) and the distribution parameter ( α). The temperature dependence of τ is expressed by a thermally activated process with the activation energy of 0.299 eV.

Bipedal hopping timed to a metronome to detect impairments in anticipatory motor control in people with mild multiple sclerosis.

PubMed

Kirkland, Megan C; Chen, Alice; Downer, Matthew B; Holloway, Brett J; Wallack, Elizabeth M; Lockyer, Evan J; Buckle, Natasha C M; Abbott, Courtney L; Ploughman, Michelle

2018-06-01

People with mild multiple sclerosis (MS) often report subtle deficits in balance and cognition but display no measurable impairment on clinical assessments. We examined whether hopping to a metronome beat had the potential to detect anticipatory motor control deficits among people with mild MS (Expanded Disability Status Scale ≤ 3.5). Participants with MS (n = 13), matched controls (n = 9), and elderly subjects (n = 13) completed tests of cognition (Montreal Cognitive Assessment (MoCA)) and motor performance (Timed 25 Foot Walk Test (T25FWT)). Participants performed two bipedal hopping tasks: at 40 beats/min (bpm) and 60-bpm in random order. Hop characteristics (length, symmetry, variability) and delay from the metronome beat were extracted from an instrumented walkway and compared between groups. The MS group became more delayed from the metronome beat over time whereas elderly subjects tended to hop closer to the beat (F = 4.52, p = 0.02). Delay of the first hop during 60-bpm predicted cognition in people with MS (R = 0.55, β = 4.64 (SD 4.63), F = 4.85, p = 0.05) but not among control (R = 0.07, p = 0.86) or elderly subjects (R = 0.17, p = 0.57). In terms of hopping characteristics, at 60-bpm, people with MS and matched controls were significantly different from the elderly group. However, at 40-bpm, the MS group was no longer significantly different from the elderly group, even though matched controls and elderly still differed significantly. This new timed hopping test may be able to detect both physical ability, and feed-forward anticipatory control impairments in people with mild MS. Hopping at a frequency of 40-bpm seemed more challenging. Several aspects of anticipatory motor control can be measured: including reaction time to the first metronome cue and the ability to adapt and anticipate the beat over time. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

Thermopower of molecular junctions: Tunneling to hopping crossover in DNA

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2016-12-01

We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].

Kinetic Analysis of Horizontal Plyometric Exercise Intensity.

PubMed

Kossow, Andrew J; Ebben, William P

2018-05-01

Kossow, AJ, DeChiara, TG, Neahous, SM, and Ebben, WP. Kinetic analysis of horizontal plyometric exercise intensity. J Strength Cond Res 32(5): 1222-1229, 2018-Plyometric exercises are frequently performed as part of a strength and conditioning program. Most studies assessed the kinetics of plyometric exercises primarily performed in the vertical plane. The purpose of this study was to evaluate the multiplanar kinetic characteristics of a variety of plyometric exercises, which have a significant horizontal component. This study also sought to assess sex differences in the intensity progression of these exercises. Ten men and 10 women served as subjects. The subjects performed a variety of plyometric exercises including the double-leg hop, standing long jump, single-leg standing long jump, bounding, skipping, power skipping, cone hops, and 45.72-cm hurdle hops. Subjects also performed the countermovement jump for comparison. All plyometric exercises were evaluated using a force platform. Dependent variables included the landing rate of force development and landing ground reaction forces for each exercise in the vertical, frontal, and sagittal planes. A 2-way mixed analysis of variance with repeated-measures for plyometric exercise type demonstrated main effects for exercise type for all dependent variables (p ≤ 0.001). There was no significant interaction between plyometric exercise type and sex for any of the variable assessed. Bonferroni-adjusted pairwise comparisons identified a number of differences between the plyometric exercises for the dependent variables assessed (p ≤ 0.05). These findings should be used to guide practitioners in the progression of plyometric exercise intensity, and thus program design, for those who require significant horizontal power in their sport.

Charge transport in molecular junctions: From tunneling to hopping with the probe technique

NASA Astrophysics Data System (ADS)

Kilgour, Michael; Segal, Dvira

2015-07-01

We demonstrate that a simple phenomenological approach can be used to simulate electronic conduction in molecular wires under thermal effects induced by the surrounding environment. This "Landauer-Büttiker's probe technique" can properly replicate different transport mechanisms, phase coherent nonresonant tunneling, ballistic behavior, and hopping conduction. Specifically, our simulations with the probe method recover the following central characteristics of charge transfer in molecular wires: (i) the electrical conductance of short wires falls off exponentially with molecular length, a manifestation of the tunneling (superexchange) mechanism. Hopping dynamics overtakes superexchange in long wires demonstrating an ohmic-like behavior. (ii) In off-resonance situations, weak dephasing effects facilitate charge transfer, but under large dephasing, the electrical conductance is suppressed. (iii) At high enough temperatures, kBT/ɛB > 1/25, with ɛB as the molecular-barrier height, the current is enhanced by a thermal activation (Arrhenius) factor. However, this enhancement takes place for both coherent and incoherent electrons and it does not readily indicate on the underlying mechanism. (iv) At finite-bias, dephasing effects may impede conduction in resonant situations. We further show that memory (non-Markovian) effects can be implemented within the Landauer-Büttiker's probe technique to model the interaction of electrons with a structured environment. Finally, we examine experimental results of electron transfer in conjugated molecular wires and show that our computational approach can reasonably reproduce reported values to provide mechanistic information.

Hops (Humulus lupulus L.) Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

PubMed Central

Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy

2017-01-01

Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284

Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

PubMed

Ahmadi, Sheida; Bowles, Richard K

2017-04-21

Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

Unified conduction mechanism in unconventional VZnCaFeO glasses

NASA Astrophysics Data System (ADS)

Ahmed, E. M.; Abdel-Wahab, F.

2014-09-01

Unconventional glasses with (70-x)%V2O5 - x%ZnO-10%CaO-20%FeO compositions (where x=0, 2.5, 5, 7.5, 10, 12.5 and 15 mol %) were prepared by a normal melt-quench technique. We investigated the DC and AC conductivities of these glasses as functions of temperature and frequency. We have noted that activation energy and pre-exponential factor of the DC conductivity both vary with composition and satisfy Meyer-Neldel rule (MNR). The AC conductivity exhibited a universal dynamic response: σAC=Aωs. The obtained results of the DC, AC and exponent factor S were discussed in terms of the modified correlated barrier hopping model, which assumes that the relaxation time should contain a Meyer-Neldel rule term. An agreement between experimental and theoretical results suggests that the conduction mechanism could be hopping of polarons over barriers.

AC conductivity and Dielectric Study of Chalcogenide Glasses of Se-Te-Ge System

NASA Astrophysics Data System (ADS)

Salman, Fathy

2004-01-01

The ac conductivity and dielectric properties of glassy system SexTe79 - xGe21, with x = 11, 14, 17 at.%, has been studied at temperatures 300 to 450 K and over a wide range of frequencies (50 Hz to 500 kHz). Experimental results indicate that the ac conductivity and the dielectric constants depend on temperature, frequency and Se content. The conductivity as a function of frequency exhibited two components: dc conductivity s dc, and ac conductivity s ac, where s ac ˜ w s. The mechanism of ac conductivity can be reasonably interpreted in terms of the correlated barrier hopping model (CBH). The activation energies are estimated and discussed. The dependence of ac conductivity and dielectric constants on the Se content x can be interpreted as the effect of Se fraction on the positional disorder. The impedance plot at each temperature appeared as a semicircle passes through the origin. Each semicircle is represented by an equivalent circuit of parallel resistance Rb and capacitance Cb.

A physical model for the reverse leakage current in (In,Ga)N/GaN light-emitting diodes based on nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Musolino, M.; Treeck, D. van, E-mail: treeck@pdi-berlin.de; Tahraoui, A.

2016-01-28

We investigated the origin of the high reverse leakage current in light emitting diodes (LEDs) based on (In,Ga)N/GaN nanowire (NW) ensembles grown by molecular beam epitaxy on Si substrates. To this end, capacitance deep level transient spectroscopy (DLTS) and temperature-dependent current-voltage (I-V) measurements were performed on a fully processed NW-LED. The DLTS measurements reveal the presence of two distinct electron traps with high concentrations in the depletion region of the p-i-n junction. These band gap states are located at energies of 570 ± 20 and 840 ± 30 meV below the conduction band minimum. The physical origin of these deep level states is discussed. Themore » temperature-dependent I-V characteristics, acquired between 83 and 403 K, show that different conduction mechanisms cause the observed leakage current. On the basis of all these results, we developed a quantitative physical model for charge transport in the reverse bias regime. By taking into account the mutual interaction of variable range hopping and electron emission from Coulombic trap states, with the latter being described by phonon-assisted tunnelling and the Poole-Frenkel effect, we can model the experimental I-V curves in the entire range of temperatures with a consistent set of parameters. Our model should be applicable to planar GaN-based LEDs as well. Furthermore, possible approaches to decrease the leakage current in NW-LEDs are proposed.« less

Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

NASA Astrophysics Data System (ADS)

Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

2017-11-01

Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

Cyclic electrical conductivity in BaTiO3-PbTiO3-V2O5 glass-ceramic nanocomposite

NASA Astrophysics Data System (ADS)

Bahgat, A. A.; Heikal, Sh.; Mahdy, Iman A.; Abd-Rabo, A. S.; Abdel Ghany, A.

2014-08-01

In this present work a glass of the composition 22.5 BaTiO3+7.5 PbTiO3+70 V2O5 was prepared by applying the conventional melt quashing technique. Isothermal annealing of the glass was applied at 732 K following differential scanning calorimetric analysis. The annealing was performed during different time intervals in the range of 0.25-24.0 h. X-ray diffraction and transmission electron microscopy were used to identify different phases as well as particle size precipitated during the annealing process. Nanocomposite glass-ceramic precipitation was recognized with nonperiodic cyclic particle sizes as a function of the annealing period. DC electrical conductivity, on the other hand, was conducted in the temperature range from 300 to 625 K. Electrical conductivity enhancement of the order 3×103 times after 2.5 h of annealing was observed. Nonperiodic cyclic DC electrical conductivity behavior was also observed and which was encountered in a reverse manner with particle size development. Furthermore, the analysis of the electrical conduction mechanism predicts that both adiabatic and nonadiabatic small polaron hopping trend may describe the experimental data depending on the particle size.

On the AC-conductivity mechanism in nano-crystalline Se79-xTe15In6Pbx (x = 0, 1, 2, 4, 6, 8 and 10) alloys

NASA Astrophysics Data System (ADS)

Anjali; Patial, Balbir Singh; Bhardwaj, Suresh; Awasthi, A. M.; Thakur, Nagesh

2017-10-01

In-depth analysis of complex AC-conductivity for nano-crystalline Se79-xTe15In6Pbx (x = 0, 1, 2, 4, 6, 8 and 10 at wt%) alloys is made in the temperature range 308-423 K and over the frequency range 10-1-107 Hz, to understand the conduction mechanism. The investigated nano-crystalline alloys were prepared by melt-quench technique. Sharp structural peaks in X-ray diffraction pattern indicate the nano-crystalline nature, which is also confirmed by FESEM. The AC conductivity shows universal characteristics and at higher frequency a transition from dc to dispersive behavior occurs. Moreover, it is confirmed that ac conductivity (σac) obeys the Jonscher power law as ωs (s< 1). The obtained results are analyzed in the light of various theoretical models. The correlated barrier hopping (CBH) model associated with non-intimate valence alternation pairs (NVAP's) is found most appropriate to describe the conduction mechanisms in these alloys. In addition, the CBH model description reveals that the bipolaron (single polaron) transport dominates at lower (higher) temperature. The density of localized states has also been deduced.

Bluetooth and security

NASA Astrophysics Data System (ADS)

Ivo, Penn

2004-04-01

Bluetooth is the new emerging technology for wireless communication. It can be used to connect almost any device to another device. The traditional example is to link a Personal Digital Assistant (PDA) or a laptop to a mobile phone. That way you can easily take remote connections with your PDA or laptop without getting your mobile phone from your pocket or messing around with cables. A Class 3 Bluetooth device has range of 0,1 - 10 meters. The architecture of Bluetooth is formed by the radio, the base frequency part and the Link Manager. Bluetooth uses the radio range of 2.45 GHz. The theoretical maximum bandwidth is 1 Mb/s, which is slowed down a bit by Forward Error Correction (FEC). Bluetooth specification designates the frequency hopping to be implemented with Gaussian Frequency Shift Keying (GFSK). The base frequency part of the Bluetooth architecture uses a combination of circuit and packet switching technologies. Bluetooth can support either one asynchronous data channel and up to three simultaneous synchronous speech channels, or one channel that transfers asynchronous data and synchronous speech simultaneously. The Link Manager is an essential part of the Bluetooth architecture. It uses Link Manager Protocol (LMP) to configure, authenticate and handle the connections between Bluetooth devices. Several Bluetooth devices can form an ad hoc network. In these piconets, one of the Bluetooth devices will act as a master and the others are slaves. The master sets the frequency-hopping behavior of the piconet. It is also possible to connect up to 10 piconets to each other to form so-called scatternets. Bluetooth has been designed to operate in noisy radio frequency environments, and uses a fast acknowledgement and frequency-hopping scheme to make the link robust, communication-wise. Bluetooth radio modules avoid interference from other signals by hopping to a new frequency after transmitting or receiving a packet. Compared with other systems operating in the same frequency band, the Bluetooth radio typically hops faster and uses shorter packets. This is because short packages and fast hopping limit the impact of microwave ovens and other sources of disturbances. Use of Forward Error Correction (FEC) limits the impact of random noise on long-distance links. Bluetooth transmissions are secure in a business and home environment. Bluetooth has built in sufficient encryption and authentication and is thus very secure in any environment. In addition to this, a frequency-hopping scheme with 1600 hops/sec. is employed. This is far quicker than any other competing system. This, together with an automatic output power adaption to reduce the range exactly to requirement, makes the system extremely difficult to eavesdrop. Information Integrity in Bluetooth has these components: Random Number Generation, Encryption, Encryption Key Management and Authentication.

Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

DOE PAGES

Velásquez, André C.; Nomura, Kinya; Cooper, Max D.; ...

2017-04-19

The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Velásquez, André C.; Nomura, Kinya; Cooper, Max D.

The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

Electron transport and noise spectroscopy in organic magnetic tunnel junctions with PTCDA and Alq3 barriers

NASA Astrophysics Data System (ADS)

Martinez, Isidoro; Cascales, Juan Pedro; Hong, Jhen-Yong; Lin, Minn-Tsong; Prezioso, Mirko; Riminucci, Alberto; Dediu, Valentin A.; Aliev, Farkhad G.

2016-10-01

The possible influence of internal barrier dynamics on spin, charge transport and their fluctuations in organic spintronics remains poorly understood. Here we present investigation of the electron transport and low frequency noise at temperatures down to 0.3K in magnetic tunnel junctions with an organic PTCDA barriers with thickness up to 5 nm in the tunneling regime and with 200 nm thick Alq3 barrier in the hopping regime. We observed high tunneling magneto-resistance at low temperatures (15-40%) and spin dependent super-poissonian shot noise in organic magnetic tunnel junctions (OMTJs) with PTCDA. The Fano factor exceeds 1.5-2 values which could be caused by interfacial states controlled by spin dependent bunching in the tunneling events through the molecules.1 The bias dependence of the low frequency noise in OMTJs with PTCDA barriers which includes both 1/f and random telegraph noise activated at specific biases will also be discussed. On the other hand, the organic junctions with ferromagnetic electrodes and thick Alq3 barriers present sub-poissonian shot noise which depends on the temperature, indicative of variable range hopping.

Kinematic and Kinetic Analysis of the Single-Leg Triple Hop Test in Women With and Without Patellofemoral Pain.

PubMed

dos Reis, Amir Curcio; Correa, João Carlos Ferrari; Bley, André Serra; Rabelo, Nayra Deise dos Anjos; Fukuda, Thiago Yukio; Lucareli, Paulo Roberto Garcia

2015-10-01

Cross-sectional study. To compare the biomechanical strategies of the trunk and lower extremity during the transition period between the first and second hop of a single-leg triple hop test in women with and without patellofemoral pain (PFP). Recent literature has shown that PFP is associated with biomechanical impairments of the lower extremities. A number of studies have analyzed the position of the trunk and lower extremities for functional activities such as walking, squatting, jumping, and the step-down test. However, studies on more challenging activities, such as the single-leg triple hop test, may be more representative of sports requiring jumping movements. Women between 18 and 35 years of age (control group, n = 20; PFP group, n = 20) participated in the study. Three-dimensional kinematic and kinetic data were collected during the transition period between the first and second hops while participants performed the single-leg triple hop test. Compared to the control group, women with PFP exhibited greater (P<.05) anterior and ipsilateral trunk lean, contralateral pelvic drop, hip internal rotation and adduction, and ankle eversion, while exhibiting less hip and knee flexion. A significant difference (P<.05) in time to peak joint angle was also found between groups for all the variables analyzed, except anterior pelvic tilt and hip flexion. In addition, women with PFP exhibited greater (P<.05) hip and knee abductor internal moments. Compared to the control group, women with PFP exhibited altered trunk, pelvis, hip, knee, and ankle kinematics and kinetics.

Relaxation processes and conduction mechanism in bismuth ferrite lead titanate composites

NASA Astrophysics Data System (ADS)

Sahu, Truptimayee; Behera, Banarji

2018-02-01

In this study, samarium (Sm)-doped multiferroic composites of 0.8BiSmxFe1-xO3-0.2PbTiO3 where x = 0.05, 0.10, 0.15, and 0.20 were prepared via the conventional solid state reaction route. The electrical properties of these composites were analyzed using an impedance analyzer over a wide range of temperatures and frequencies (102-106 Hz). The impedance and modulus analyses confirmed the presence of both bulk and grain boundary effects in the materials. The temperature dependence of impedance and modulus spectrum indicated the negative temperature coefficient of resistance behavior. The dielectric relaxation exhibited non-Debye type behavior and it was temperature dependent. The relaxation time (τ) and DC conductivity followed an Arrhenius type behavior. The frequency-dependent AC conductivity obeyed Jonscher's power law. The correlated barrier hopping model was appropriate to understand the conduction mechanism in the composites considered.

Precision improvement of frequency-modulated continuous-wave laser ranging system with two auxiliary interferometers

NASA Astrophysics Data System (ADS)

Shi, Guang; Wang, Wen; Zhang, Fumin

2018-03-01

The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.

Dopant driven tunability of dielectric relaxation in MxCo(1-x)Fe2O4 (M: Zn2+, Mn2+, Ni2+) nano-ferrites

NASA Astrophysics Data System (ADS)

Datt, Gopal; Abhyankar, A. C.

2017-07-01

Nano-ferrites with tunable dielectric and magnetic properties are highly desirable in modern electronics industries. This work reports the effect of ferromagnetic (Ni), anti-ferromagnetic (Mn), and non-magnetic (Zn) substitution on cobalt-ferrites' dielectric and magnetic properties. The Rietveld analysis of XRD data and the Raman spectroscopic study reveals that all the samples are crystallized in the Fd-3m space group. The T2g Raman mode was observed to split into branches, which is due to the presence of different cations (with different vibrational frequencies) at crystallographic A and B-sites. The magnetization study shows that the MnCoFe2O4 sample has the highest saturation magnetization of 87 emu/g, which is attributed to the presence of Mn2+ cations at the B-site with a magnetic moment of 5 μB. The dielectric permittivity of these nanoparticles (NPs) obeys the modified Debye model, which is further supported by Cole-Cole plots. The dielectric constant of MnCoFe2O4 ferrite is found to be one order higher than that of the other two ferrites. The increased bond length of the Mn2+-O2- bond along with the enhanced d-d electron transition between Mn 2 +/Co 2 +⇋Fe 3 + cations at the B-site are found to be the main contributing factors for the enhanced dielectric constant of MnCoFe2O4 ferrite. We find evidence of variable-range hopping of localized polarons in these ferrite NPs. The activation energy, hopping range, and density of states N (" separators="|EF ), of these polarons were calculated using Motts' 1/4th law. The estimated activation energies of these polarons at 300 K were found to be 288 meV, 426 meV, and 410 meV, respectively, for the MnCoFe2O4, NiCoFe2O4, and ZnCoFe2O4 ferrite NPs, while the hopping range of these polarons were found to be 27.14 Å, 11.66 Å, and 8.17 Å, respectively. Observation of a low dielectric loss of ˜0.04, in the frequency range of 0.1-1 MHz, in these NPs makes them potential candidates for energy harvesting devices in the modern electronics industry.

Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

PubMed

Kea, J; Kramer, J; Forwell, L; Birmingham, T

2001-08-01

Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

Magnetic, electronic, dielectric and optical properties of Pr(Ca:Sr)MnO 3

NASA Astrophysics Data System (ADS)

Sichelschmidt, J.; Paraskevopoulos, M.; Brando, M.; Wehn, R.; Ivannikov, D.; Mayr, F.; Pucher, K.; Hemberger, J.; Pimenov, A.; Krug von Nidda, H.-A.; Lunkenheimer, P.; Ivanov, V. Yu.; Mukhin, A. A.; Balbashov, A. M.; Loidl, A.

2001-03-01

The charge-ordered perovskite Pr0.65Ca0.28Sr0.07MnO3 was investigated by means of magnetic susceptibility, specific heat, dielectric and optical spectroscopy and electron-spin resonance techniques. Under moderate magnetic fields, the charge order melts yielding colossal magnetoresistance effects with changes of the resistivity over eleven orders of magnitude. The optical conductivity is studied from audio frequencies far into the visible spectral regime. Below the phonon modes hopping conductivity is detected. Beyond the phonon modes the optical conductivity is explained by polaronic excitations out of a bound state. ESR techniques yield detailed informations on the (H,T ) phase diagram and reveal a broadening of the linewidth which can be modeled in terms of activated polaron hopping.

Length-Dependent Nanotransport and Charge Hopping Bottlenecks in Long Thiophene-Containing π-Conjugated Molecular Wires.

PubMed

Smith, Christopher E; Odoh, Samuel O; Ghosh, Soumen; Gagliardi, Laura; Cramer, Christopher J; Frisbie, C Daniel

2015-12-23

Self-assembled conjugated molecular wires containing thiophene up to 6 nm in length were grown layer-by-layer using click chemistry. Reflection-absorption infrared spectroscopy, ellipsometry and X-ray photoelectron spectroscopy were used to follow the stepwise growth. The electronic structure of the conjugated wires was studied with cyclic voltammetry and UV-vis spectroscopy as well as computationally with density functional theory (DFT). The current-voltage curves (±1 V) of the conjugated molecular wires were measured with conducting probe atomic force microscopy (CP-AFM) in which the molecular wire film bound to a gold substrate was contacted with a conductive AFM probe. By systematically measuring the low bias junction resistance as a function of length for molecules 1-4 nm long, we extracted the structure dependent tunneling attenuation factor (β) of 3.4 nm(-1) and a contact resistance of 220 kΩ. The crossover from tunneling to hopping transport was observed at a molecular length of 4-5 nm with an activation energy of 0.35 eV extracted from Arrhenius plots of resistance versus temperature. DFT calculations revealed localizations of spin densities (polarons) on molecular wire radical cations. The calculations were employed to gauge transition state energies for hopping of polarons along wire segments. Individual estimated transition state energies were 0.2-0.4 eV, in good agreement with the experimental activation energy. The transition states correspond to flattening of dihedral angles about specific imine bonds. These results open up possibilities to further explore the influence of molecular architecture on hopping transport in molecular junctions, and highlight the utility of DFT to understand charge localization and associated hopping-based transport.

Topological insulator thin films starting from the amorphous phase-Bi{sub 2}Se{sub 3} as example

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barzola-Quiquia, J., E-mail: j.barzola@physik.uni-leipzig.de; Lehmann, T.; Stiller, M.

We present a new method to obtain topological insulator Bi{sub 2}Se{sub 3} thin films with a centimeter large lateral length. To produce amorphous Bi{sub 2}Se{sub 3} thin films, we have used a sequential flash-evaporation method at room temperature. Transmission electron microscopy has been used to verify that the prepared samples are in a pure amorphous state. During annealing, the samples transform into the rhombohedral Bi{sub 2}Se{sub 3} crystalline structure which was confirmed using X-ray diffraction and Raman spectroscopy. Resistance measurements of the amorphous films show the expected Mott variable range hopping conduction process with a high specific resistance compared tomore » the one obtained in the crystalline phase (metallic behavior). We have measured the magnetoresistance and the Hall effect at different temperatures between 2 K and 275 K. At temperatures T ≲ 50 K and fields B ≲ 1 T, we observe weak anti-localization in the MR; the Hall measurements confirm the n-type character of the samples. All experimental results of our films are in quantitative agreement with results from samples prepared using more sophisticated methods.« less

Type I antiferromagnetic order in Ba 2LuReO 6: Exploring the role of structural distortions in double perovskites containing 5d 2 ions

DOE PAGES

Xiong, Jie; Yan, Jiaqiang; Aczel, Adam A.; ...

2017-12-02

The structural, electrical, and magnetic properties of the double perovskite Ba 2LuReO 6 have been examined in this paper. It is an insulator whose temperature dependent conductivity is consistent with variable range hopping electrical transport. A transition to an antiferromagnet state with type I order occurs below T N = 31 K. High resolution time-of-flight neutron powder diffraction measurements show that it retains the cubic double perovskite structure down to 10 K. High intensity, low resolution neutron powder diffraction measurements confirm the antiferromagnetic order and indicate that cubic symmetry is still observed at 1.5 K. The small ordered moment ofmore » 0.34(4)μ B per Re is comparable to estimates of moments on 5d 2 ions in other antiferromagnetically ordered cubic double perovskites. Finally, comparisons with related double perovskites containing 5d 2 ions, such as Os 6+ and Re 5+, reveal that subtle changes in structure or electron configuration of the diamagnetic octahedral cations can have a large impact on the magnetic ground state, the size of the ordered moment, and the Néel temperature.« less

Intrinsic and spatially nonuniform ferromagnetism in Co-doped ZnO films

NASA Astrophysics Data System (ADS)

Tseng, L. T.; Suter, A.; Wang, Y. R.; Xiang, F. X.; Bian, P.; Ding, X.; Tseng, A.; Hu, H. L.; Fan, H. M.; Zheng, R. K.; Wang, X. L.; Salman, Z.; Prokscha, T.; Suzuki, K.; Liu, R.; Li, S.; Morenzoni, E.; Yi, J. B.

2017-09-01

Co doped ZnO films have been deposited by a laser-molecular beam epitaxy system. X-ray diffraction and UV spectra analysis show that Co effectively substitutes the Zn site. Transmission electron microscopy (TEM) and secondary ion mass spectroscopy analysis indicate that there are no clusters. Co dopants are uniformly distributed in ZnO film. Ferromagnetic ordering is observed in all samples deposited under an oxygen partial pressure, PO2=10-3 , 10-5, and 10-7 torr, respectively. However, the magnetization of PO2=10-3 and 10-5 is very small at room temperature. At low temperature, the ferromagnetic ordering is enhanced. Muon spin relaxation (μ SR ) measurements confirm the ferromagnetism in all samples, and the results are consistent with magnetization measurements. From μ SR and TEM analysis, the film deposited under PO2=10-7 torr shows intrinsic ferromagnetism. However, the volume fraction of the ferromagnetism phase is approximately 70%, suggesting that the ferromagnetism is not carrier mediated. Resistivity versus temperature measurements indicate Efros variable range hopping dominates the conductivity. From the above results, we can confirm that a bound magnetic polaron is the origin of the ferromagnetism.

Theoretical study of electron transport along self-assembled graphitic nanowires

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

2000-11-01

Electron transport through stacks of polyaromatic hydrocarbons is studied theoretically using the Landauer formalism. The polyaromatic hydrocarbons can be synthesized in many different sizes and can form molecular stacks with a varying number of molecules and with a rather strong π-overlap along the stack. This allows for a large flexibility in the nanostructure of these materials and makes it possible to study the variation in the conductance with a number of different factors: a near-linear increase in the conductance as a function of the number of atoms in the individual molecule is observed. Furthermore, the conductance drops exponentially with the number of molecules in the stacks, from which it follows that an increase in the intermolecular hopping results in an increase in the conductance which is proportional to the intermolecular hopping to the power of 2(N-1), where N is the number of molecules in the stack.

Analysis of the conduction mechanism and dielectric properties of N, N', N" tris(4-methylphenyl)phosphoric triamide

NASA Astrophysics Data System (ADS)

Ali, H. A. M.

2016-03-01

The structure for the powder of N,N', N"-tris(4-methylphenyl)phosphoric triamide, TMP-TA, was characterized using X-ray diffraction (XRD) and differential thermal analysis (DTA) techniques. The ac conductivity and dielectric properties were measured in the frequency range of 42-105 Hz for the bulk TMP-TA in a pellet form at different temperatures. The frequency dependence of ac conductivity was expressed by a Jonscher's universal power law. The frequency exponent (s) was determined from the fitting of experimental data of ac conductivity. The correlated barrier hopping (CBH) model was found to be responsible for the ac conduction mechanism in TMP-TA. The activation energy was calculated from the temperature dependence of ac conductivity. The values of the density of states at the Fermi level were determined for different frequencies. The components of the electric modulus (M' and M") were calculated and used to estimate the relaxation time.

Sodium deficiency effect on the transport properties of La0.8Na0.2-x□xMnO3 manganites

NASA Astrophysics Data System (ADS)

Elghoul, N.; Wali, M.; Kraiem, S.; Rahmouni, H.; Dhahri, E.; Khirouni, K.

2015-12-01

Effect of sodium deficiency on the transport properties of La0.8Na0.2-x□xMnO3 manganites is investigated using impedance spectroscopy technique. In the whole explored temperature range (77-700 K), conductivity measurements show the appearance of a metal-semiconductor transition for all investigated samples. Also, a saturation region is observed in σ (T) curves. It is found that conduction mechanism is governed by hopping process. The conductivity of the material decreases with increasing sodium deficiency. The transition temperature and the activation energy values inferred from grain boundary resistance and conductivity analysis are closed to each other. Such result confirms the contribution of grain boundary on the electrical conductivity. The variation of the Average Normalized Change (ANC) and its derivative with temperature gives important information about the available density of trapped charge states. The obtained results explain the observed saturation region in conductivity at high temperature region.

Structural study and DC conductivity of vanadyl doped zinc lithium borate glasses

NASA Astrophysics Data System (ADS)

Seema, Khasa, S.; Dahiya, M. S.; Yadav, Arti; Agarwal, A.; Dahiya, S.

2015-06-01

Glasses with composition xZnOṡ(30 - x)ṡLi2Oṡ70B2O3 containing 2 mol% of V2O5 (x = 0, 2, 5, 7 and 10) were prepared by standard melt-quench technique. The amorphous nature of the glass samples was confirmed by using x-ray diffraction. The structural changes in these glasses have been investigated by employing IR spectroscopy in the mid-IR range. The infrared spectroscopic analysis confirms the presence of both triangular and tetraheldral coordinated boron units and absence of boroxol ring. It also shows that metal-oxide vibrations are present which are due to the bonding of lithium and zinc ions with oxygen. The dc conductivity was measured in the temperature range 353-523 K. The dc conductivity results show that conductivity decreases and activation energy increases when Li2O is replaced by ZnO, keeping the concentration of B2O3 constant. Decrease in conductivity and increase in activation energy shows that addition of ZnO to the glass matrix shows a "blocking effect" on the overall mobility of alkali ions, but at higher concentration the hopping effect was also observed.

Optimisation of active suspension control inputs for improved vehicle ride performance

NASA Astrophysics Data System (ADS)

Čorić, Mirko; Deur, Joško; Xu, Li; Tseng, H. Eric; Hrovat, Davor

2016-07-01

A collocation-type control variable optimisation method is used in the paper to analyse to which extent the fully active suspension (FAS) can improve the vehicle ride comfort while preserving the wheel holding ability. The method is first applied for a cosine-shaped bump road disturbance of different heights, and for both quarter-car and full 10 degree-of-freedom vehicle models. A nonlinear anti-wheel hop constraint is considered, and the influence of bump preview time period is analysed. The analysis is then extended to the case of square- or cosine-shaped pothole with different lengths, and the quarter-car model. In this case, the cost function is extended with FAS energy consumption and wheel damage resilience costs. The FAS action is found to be such to provide a wheel hop over the pothole, in order to avoid or minimise the damage at the pothole trailing edge. In the case of long pothole, when the FAS cannot provide the wheel hop, the wheel is travelling over the pothole bottom and then hops over the pothole trailing edge. The numerical optimisation results are accompanied by a simplified algebraic analysis.

Photoconductivity study of acid on Zinc phthalocyanine pyridine thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Sukhwinder, E-mail: ss7667@gmail.com; Saini, G. S. S.; Tripathi, S. K.

2016-05-06

The Metal Phthalocyanine (MPc) have attracted much interest because of chemical and high thermal stability. Molecules forming a crystal of MPc are held together by weak attractive Vander Waals forces. Organic semiconductors have π conjugate bonds which allow electrons to move via π-electron cloud overlaps. Conduction mechanisms for organic semiconductor are mainly through tunneling; hopping between localized states, mobility gaps, and phonon assisted hopping. The photo conductivity of thin films of these complexes changes when exposed to oxidizing and reducing gases. Arrhenius plot is used to find the thermal activation energy in the intrinsic region and impurity scattering region. Arrheniusmore » plotsare used to find the thermal activation energy.« less

Millimeter Wave Alternate Route Study.

DTIC Science & Technology

1981-04-01

processing gains are based upon the assumption that the jammer equally distributes his available power over all the hopping frequencies. If this is true...Examples Assumptions 0 25 GHz hopping range (e.g., 20 GHz to 45 GHz) 0 10 ms settling time * 0.1 second dwell time - implies 11% increase in channel data...of the architectures presented previously. The assumption that each link has equal probability p of being disrupted (i.e., successfully jammed) seems

Dielectric properties of magnetorheological elastomers with different microstructure

NASA Astrophysics Data System (ADS)

Moucka, R.; Sedlacik, M.; Cvek, M.

2018-03-01

Composite materials containing magnetic particles organised within the polymer matrix by the means of an external magnetic field during the curing process were prepared, and their dielectric properties were compared with their isotropic analogues of the same filler concentration but homogeneous spatial distribution. A substantial dielectric response observed for anisotropic systems in a form of relaxation processes was explained as charge transport via the mechanism of variable range hopping. The changes in registered relaxations' critical frequency and shape of dielectric spectra with the filler concentration were discussed in terms of decreasing anisotropy of the system. The knowledge of the dielectric response of studied systems is essential for their practical applications such as piezoresistive sensors or radio-absorbing materials.

Coulomb gap: how a metal film becomes an insulator

PubMed

Butko; DiTusa; Adams

2000-02-14

Electron tunneling measurements of the density of states (DOS) in ultrathin Be films reveal that a correlation gap mediates their insulating behavior. In films with sheet resistance R<5000 Omega the correlation singularity appears as the usual perturbative ln(V) zero bias anomaly (ZBA) in the DOS. As R is increased further, however, the ZBA grows and begins to dominate the DOS spectrum. This evolution continues until a nonperturbative |V| Efros-Shklovskii Coulomb gap spectrum finally emerges in the highest R films. Transport measurements of films which display this gap are well described by a universal variable range hopping law R(T) = (h/2e(2))exp(T0/T)(1/2).

Magnetic hard gap due to bound magnetic polarons in the localized regime.

PubMed

Rimal, Gaurab; Tang, Jinke

2017-02-08

We investigate the low temperature electron transport properties of manganese doped lead sulfide films. The system shows variable range hopping at low temperatures that crosses over into an activation regime at even lower temperatures. This crossover is destroyed by an applied magnetic field which suggests a magnetic origin of the hard gap, associated with bound magnetic polarons. Even though the gap forms around the superconducting transition temperature of lead, we do not find evidence of this being due to insulator-superconductor transition. Comparison with undoped PbS films, which do not show the activated transport behavior, suggests that bound magnetic polarons create the hard gap in the system that can be closed by magnetic fields.

Ionization equilibrium at the transition from valence-band to acceptor-band migration of holes in boron-doped diamond

NASA Astrophysics Data System (ADS)

Poklonski, N. A.; Vyrko, S. A.; Poklonskaya, O. N.; Kovalev, A. I.; Zabrodskii, A. G.

2016-06-01

A quasi-classical model of ionization equilibrium in the p-type diamond between hydrogen-like acceptors (boron atoms which substitute carbon atoms in the crystal lattice) and holes in the valence band (v-band) is proposed. The model is applicable on the insulator side of the insulator-metal concentration phase transition (Mott transition) in p-Dia:B crystals. The densities of the spatial distributions of impurity atoms (acceptors and donors) and of holes in the crystal are considered to be Poissonian, and the fluctuations of their electrostatic potential energy are considered to be Gaussian. The model accounts for the decrease in thermal ionization energy of boron atoms with increasing concentration, as well as for electrostatic fluctuations due to the Coulomb interaction limited to two nearest point charges (impurity ions and holes). The mobility edge of holes in the v-band is assumed to be equal to the sum of the threshold energy for diffusion percolation and the exchange energy of the holes. On the basis of the virial theorem, the temperature Tj is determined, in the vicinity of which the dc band-like conductivity of holes in the v-band is approximately equal to the hopping conductivity of holes via the boron atoms. For compensation ratio (hydrogen-like donor to acceptor concentration ratio) K ≈ 0.15 and temperature Tj, the concentration of "free" holes in the v-band and their jumping (turbulent) drift mobility are calculated. Dependence of the differential energy of thermal ionization of boron atoms (at the temperature 3Tj/2) as a function of their concentration N is calculated. The estimates of the extrapolated into the temperature region close to Tj hopping drift mobility of holes hopping from the boron atoms in the charge states (0) to the boron atoms in the charge states (-1) are given. Calculations based on the model show good agreement with electrical conductivity and Hall effect measurements for p-type diamond with boron atom concentrations in the range from 3 × 1017 to 3 × 1020 cm-3, i.e., up to the Mott transition. The model uses no fitting parameters.

Predictive parameters for return to pre-injury level of sport 6 months following anterior cruciate ligament reconstruction surgery.

PubMed

Müller, Ulrike; Krüger-Franke, Michael; Schmidt, Michael; Rosemeyer, Bernd

2015-12-01

The aim of the study was to find predictive parameters for a successful resumption of pre-injury level of sport 6 months post anterior cruciate ligament (ACL) reconstruction. In a prospective study, 40 patients with a ruptured ACL were surgically treated with semitendinosus tendon autograft. Six months after surgery, strength of knee extensors and flexors, four single-leg hop tests, Anterior Cruciate Ligament-Return to Sport after Injury Scale (ACL-RSI), subjective International Knee Documentation Committee (IKDC) 2000 and the Tampa Scale of Kinesiophobia-11 (TSK-11) were assessed. Seven months post-operatively, a standardized interview was conducted to identify "return to sport" (RS) and "non-return to sport" (nRS) patients. Logistic regression and "Receiver Operating Characteristic" (ROC) analyses were used to determine predictive parameters. No significant differences could be detected between RS and nRS patients concerning socio-demographic data, muscle tests, square hop and TSK-11. In nRS patients, the Limb Symmetry Index (LSI) of single hop for distance (p = 0.005), crossover hop (p = 0.008) and triple hop (p = 0.001) were significantly lower, in addition to the ACL-RSI (p = 0.013) and IKDC 2000 (p = 0.037). The cut-off points for LSI single hop for distance were 75.4 % (sensitivity 0.74; specificity 0.88), and for ACL-RSI 51.3 points (sensitivity 0.97; specificity 0.63). Logistic regression distinguished between RS and nRS subjects (sensitivity 0.97; specificity 0.63). The single hop for distance and ACL-RSI were found to be the strongest predictive parameters, assessing both the objective functional and the subjective psychological aspects of returning to sport. Both tests may help to identify patients at risk of not returning to pre-injury sport. II.

Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems

NASA Astrophysics Data System (ADS)

Missel, Andrew; Dahmen, Karin

2008-03-01

Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.

Theoretical study of spin Hall effect in conjugated Organic semiconductors

NASA Astrophysics Data System (ADS)

Mahani, M. R.; Delin, A.

The spin Hall effect (SHE), a direct conversion between electronic and spin currents, is a rapidly growing branch of spintronics. The study of SHE in conjugated polymers has gained momentum recently due to the weak spin-orbit couplings and hyperfine interactions in these materials. Our calculations of SHE based on the recent work, are the result of the misalignment of pi-orbitals in triads consisting of three molecules. In disordered organics, where the electronic conduction is through hopping of the electrons among randomly oriented molecules, instead of identifying a hopping triad to represent the entire system, we numerically solve the master equations for electrical and spin hall conductivities by summing the contributions from all triads in a sufficiently large system. The interference between the direct and indirect hoppings in these triads leads to SHE proportional to the orientation vector of molecule at the first order of spin-orbit coupling. Hence, our results show, the degree of molecular alignment as well as the strength of the spin-orbit coupling can be used to control the SHE in organics.

Electrical and magnetic properties of La0.67Ba0.33Mn1- x (Me) x O3 perovskite manganites: case of manganese substituted by trivalent (Me = Cr) and tetravalent (Me = Ti) elements

NASA Astrophysics Data System (ADS)

Oumezzine, Marwène; Peña, Octavio; Kallel, Sami; Kallel, Nabil; Guizouarn, Thierry; Gouttefangeas, Francis; Oumezzine, Mohamed

2014-03-01

The effects of non-magnetic Ti4+ substitution on the structural, electrical and magnetic properties of La0.67Ba0.33Mn1- x Ti x O3 (0≤ x≤0.1) are investigated and compared to those existing in La0.67Ba0.33Mn1- x Cr x O3 (magnetic Cr3+). The structural refinement by the Rietveld method revealed that Ti-doped samples crystallize in the cubic lattice with space group , while samples with Cr crystallize in the hexagonal setting of the rhombohedral space group for identical contents of dopant. The most relevant structural features are an increase of the lattice parameters, of the cell volume and of the inter-ionic distances with increasing Ti doping level. Both series of samples show a decrease of the paramagnetic-ferromagnetic transition temperature when the amount of chromium or titanium increases. Transport measurements show that when increasing the metal doping, the resistivity increases whereas the metallic behavior of the parent compound La0.67Ba0.33MnO3 is destroyed. For a substitution higher than 5 at.% of Ti and 10 at.% of Cr, the samples exhibit a semiconducting behavior in the whole range of temperature, for which the electronic transport can be explained by variable range hopping and/or small polaron hopping models.

An Evaluation of a Numerical Prediction Method for Electric Field Strength of Low Frequency Radio Waves based on Wave-Hop Ionospheric Propagation

NASA Astrophysics Data System (ADS)

Kitauchi, H.; Nozaki, K.; Ito, H.; Kondo, T.; Tsuchiya, S.; Imamura, K.; Nagatsuma, T.; Ishii, M.

2014-12-01

We present our recent efforts on an evaluation of the numerical prediction method of electric field strength for ionospheric propagation of low frequency (LF) radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012), "Prediction of field strength at frequencies below about 150 kHz," made by International Telecommunication Union Radiocommunication Sector (ITU-R). As part of the Japanese Antarctic Research Expedition (JARE), we conduct on-board measurements of the electric field strengths and phases of LF 40 kHz and 60 kHz of radio signals (call sign JJY) continuously along both the ways between Tokyo, Japan and Syowa Station, the Japanese Antarctic station, at 69° 00' S, 39° 35' E on East Ongul Island, Lützow-Holm Bay, East Antarctica. The measurements are made by a newly developed, highly sensitive receiving system installed on board the Japanese Antarctic research vessel (RV) Shirase. We obtained new data sets of the electric field strength up to approximately 13,000-14,000 km propagation of LF JJY 40 kHz and 60 kHz radio waves by utilizing a newly developed, highly sensitive receiving system, comprised of an orthogonally crossed double-loop antenna and digital-signal-processing lock-in amplifiers, on board RV Shirase during the 55th JARE from November 2013 to April 2014. We have made comparisons between those on-board measurements and the numerical predictions of field strength for long-range propagation of low frequency radio waves based on a wave-hop propagation theory described in Section 2.4 of Recommendation ITU-R P.684-6 (2012) to show that our results qualitatively support the recommended wave-hop theory for the great-circle paths approximately 7,000-8,000 km and 13,000-14,000 km propagations.

Plasmodium falciparum Hop (PfHop) Interacts with the Hsp70 Chaperone in a Nucleotide-Dependent Fashion and Exhibits Ligand Selectivity.

PubMed

Zininga, Tawanda; Makumire, Stanely; Gitau, Grace Wairimu; Njunge, James M; Pooe, Ofentse Jacob; Klimek, Hanna; Scheurr, Robina; Raifer, Hartmann; Prinsloo, Earl; Przyborski, Jude M; Hoppe, Heinrich; Shonhai, Addmore

2015-01-01

Heat shock proteins (Hsps) play an important role in the development and pathogenicity of malaria parasites. One of the most prominent functions of Hsps is to facilitate the folding of other proteins. Hsps are thought to play a crucial role when malaria parasites invade their host cells and during their subsequent development in hepatocytes and red blood cells. It is thought that Hsps maintain proteostasis under the unfavourable conditions that malaria parasites encounter in the host environment. Although heat shock protein 70 (Hsp70) is capable of independent folding of some proteins, its functional cooperation with heat shock protein 90 (Hsp90) facilitates folding of some proteins such as kinases and steroid hormone receptors into their fully functional forms. The cooperation of Hsp70 and Hsp90 occurs through an adaptor protein called Hsp70-Hsp90 organising protein (Hop). We previously characterised the Hop protein from Plasmodium falciparum (PfHop). We observed that the protein co-localised with the cytosol-localised chaperones, PfHsp70-1 and PfHsp90 at the blood stages of the malaria parasite. In the current study, we demonstrated that PfHop is a stress-inducible protein. We further explored the direct interaction between PfHop and PfHsp70-1 using far Western and surface plasmon resonance (SPR) analyses. The interaction of the two proteins was further validated by co-immunoprecipitation studies. We observed that PfHop and PfHsp70-1 associate in the absence and presence of either ATP or ADP. However, ADP appears to promote the association of the two proteins better than ATP. In addition, we investigated the specific interaction between PfHop TPR subdomains and PfHsp70-1/ PfHsp90, using a split-GFP approach. This method allowed us to observe that TPR1 and TPR2B subdomains of PfHop bind preferentially to the C-terminus of PfHsp70-1 compared to PfHsp90. Conversely, the TPR2A motif preferentially interacted with the C-terminus of PfHsp90. Finally, we observed that recombinant PfHop occasionally eluted as a protein species of twice its predicted size, suggesting that it may occur as a dimer. We conducted SPR analysis which suggested that PfHop is capable of self-association in presence or absence of ATP/ADP. Overall, our findings suggest that PfHop is a stress-inducible protein that directly associates with PfHsp70-1 and PfHsp90. In addition, the protein is capable of self-association. The findings suggest that PfHop serves as a module that brings these two prominent chaperones (PfHsp70-1 and PfHsp90) into a functional complex. Since PfHsp70-1 and PfHsp90 are essential for parasite growth, findings from this study are important towards the development of possible antimalarial inhibitors targeting the cooperation of these two chaperones.

Mobile bound states of Rydberg excitations in a lattice

NASA Astrophysics Data System (ADS)

Letscher, Fabian; Petrosyan, David

2018-04-01

Spin-lattice models play a central role in the studies of quantum magnetism and nonequilibrium dynamics of spin excitations—-magnons. We show that a spin lattice with strong nearest-neighbor interactions and tunable long-range hopping of excitations can be realized by a regular array of laser-driven atoms, with an excited Rydberg state representing the spin-up state and a Rydberg-dressed ground state corresponding to the spin-down state. We find exotic interaction-bound states of magnons that propagate in the lattice via the combination of resonant two-site hopping and nonresonant second-order hopping processes. Arrays of trapped Rydberg-dressed atoms can thus serve as a flexible platform to simulate and study fundamental few-body dynamics in spin lattices.

Origin of strong dispersion in Hubbard insulators

DOE PAGES

Wang, Y.; Wohlfeld, K.; Moritz, B.; ...

2015-08-10

Using cluster perturbation theory, we explain the origin of the strongly dispersive feature found at high binding energy in the spectral function of the Hubbard model. By comparing the Hubbard and $t₋J₋3s$ model spectra, we show that this dispersion does not originate from either coupling to spin fluctuations ($∝ J$ ) or the free hopping ($∝ t$ ). Instead, it should be attributed to a long-range, correlated hopping $∝ t²/U$ which allows an effectively free motion of the hole within the same antiferromagnetic sublattice. This origin explains both the formation of the high-energy anomaly in the single-particle spectrum and themore » sensitivity of the high-binding-energy dispersion to the next-nearest-neighbor hopping $t'$ .« less

Thermal, Structural, AC Conductivity, and Dielectric Properties of Ethyl-2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3,2-c]quinoline-3-carboxylate Thin Films

NASA Astrophysics Data System (ADS)

El-Shabaan, M. M.

2018-05-01

Thermal, structural, alternating-current (AC) conductivity (σ AC), and dielectric properties of ethyl-2-amino-6-ethyl-5-oxo-4-(3-phenoxyphenyl)-5,6-dihydro-4H-pyrano[3,2-c]quinoline-3-carboxylate (HPQC) thin films have been studied. Thermogravimetry analysis and differential scanning calorimetry confirmed the thermal stability of HPQC over a wide temperature range. Fourier-transform infrared spectroscopy and x-ray diffraction analysis were carried out on HPQC in powder form and as-deposited thin film. The crystal system and space group type were determined for HPQC in powder form. The AC conductivity and dielectric properties were determined in the frequency range from 0.5 kHz to 5 MHz and temperature range from 296 K to 443 K. The AC electrical conduction of HPQC thin film was found to be governed by the small-polaron tunneling mechanism. The polaron hopping energy (W H), tunneling distance (R), and density of states (N) near the Fermi level were determined as functions of temperature and frequency. The dielectric properties of HPQC thin film were studied by analysis of Nyquist diagrams, the dissipation factor (tan δ), and real (ɛ') and imaginary (ɛ″) parts of the dielectric constant.

Hip-Hop to Health Jr. for Latino preschool children.

PubMed

Fitzgibbon, Marian L; Stolley, Melinda R; Schiffer, Linda; Van Horn, Linda; KauferChristoffel, Katherine; Dyer, Alan

2006-09-01

Hip-Hop to Health Jr. was a diet/physical activity intervention designed to reduce gains in BMI (kilograms per meter squared) in preschool minority children. Twelve predominantly Latino Head Start centers participated in a group-randomized trial conducted between Fall 2001 and Winter 2003. Six centers were randomized to a culturally proficient 14-week (three times weekly) diet/physical activity intervention. Parents participated by completing weekly homework assignments. The children in the other six centers received a general health intervention that did not address either diet or physical activity. The primary outcome was change in BMI, and secondary outcomes were changes in dietary intake and physical activity. Measures were collected at baseline, post-intervention, and at Years 1 and 2 follow-up. There were no significant differences between intervention and control schools in either primary or secondary outcomes at post-intervention, Year 1, or Year 2 follow-ups. When Hip-Hop to Health Jr. was conducted in predominantly black Head Start centers, it was effective in reducing subsequent increases in BMI in preschool children. In contrast, when the program was conducted in Latino centers, it was not effective. Although the intervention did not prevent excessive weight gain in Latino children, it was very well received. Future interventions with this population may require further cultural tailoring and a more robust parent intervention.

Injury incidence in hip hop dance.

PubMed

Ojofeitimi, S; Bronner, S; Woo, H

2012-06-01

Hip hop dance has rapidly become a popular international art form. There is limited information on injury patterns in this population. The purpose of this study was to determine injury incidence and patterns among three groups of hip hop dancers. Three hundred and twelve intermediate, advanced, and expert hip hop dancers were recruited at battles, dance conferences, clubs, and on dance related web sites within the United States and internationally. A Web-based survey was conducted over a 6-month period. Inclusion criteria included intermediate and advanced level dancers over the age of 13. Dancers were divided into three main categories: Breakers, Popper/Lockers, and New Schoolers. Separate analysis of variances were used to compare injury pattern differences between groups. Two hundred and thirty-two dancers reported a total of 738 injuries. Five hundred and six of these (sustained by 205 dancers) were time-loss (TL) injuries. Annual injury incidence was 237% (162% involving TL). Lower extremity injuries were 52% and upper extremity injuries 32% of total injuries. Breakers had a higher injury incidence compared with Popper/Lockers, and New Schoolers. Hip hop dancers report injury rates that are higher than other dance forms but similar to gymnastics. These dancers should be educated concerning injury prevention, biomechanics, and use of protective equipment. © 2010 John Wiley & Sons A/S.

Holder pasteurization affects S100B concentrations in human milk.

PubMed

Peila, Chiara; Coscia, Alessandra; Bertino, Enrico; Li Volti, Giovanni; Galvano, Fabio; Visser, Gerard H A; Gazzolo, Diego

2018-02-01

Donor milk (DM) represents an important nutrition source for high-risk newborns. Holder pasteurization (HoP) is the most recommended procedure for DM treatment, providing a good compromise between microbiological safety and biological quality. HoP was previously shown to affect DM cytokines, growth factors and hormones levels, whilst no data concerning the possible effects of HoP on neurobiomarkers (NB) are available. Therefore, our study investigated whether the concentration in DM of a well-known NB involved in brain development/damage, namely S100B, changes due to HoP. We conducted a pretest-test study in 11 mothers, whose DM samples were sub-divided into two parts: the first was immediately frozen (-80 °C); the second was pasteurized with Holder method before freezing. S100B DM levels were measured using a commercially available immunoluminometric assay. S100B protein was detected in all milk samples. Results showed significant differences between groups (p < 0.05) in S100B levels after HoP. Our data provide evidence that S100B is present in preterm milk as well as in term milk during maturation degree. Moreover, the results confirm the susceptibility of this neurotrophic factor to pasteurization stresses and the need to develop new storage techniques to preserve the biological quality of human milk.

Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ

Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less

Effect of annealing on the temperature dependence of inelastic tunneling contributions vis-à-vis tunneling magnetoresistance and barrier parameters in CoFe/MgO/NiFe magnetic tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhusan Singh, Braj; Chaudhary, Sujeet, E-mail: sujeetc@physics.iitd.ac.in

The effect of annealing on the changes in the inelastic tunneling contributions in tunneling conductance of ion beam sputtered CoFe/MgO/NiFe magnetic tunnel junctions (MTJs) is investigated. The inelastic contributions are evaluated using hopping conduction model of Glazman and Matveev in the temperature range of 25–300 K. The hopping through number of series of localized states present in the barrier due to structural defects increases from 9 (in as deposited MTJ) to 18 after annealing (at 200 °C/1 h); although no changes in the interface roughness of CoFe-MgO and MgO-NiFe interfaces are observed as revealed by the x-ray reflectance studies on planar MTJs. Themore » bias dependence of tunneling magnetoresistance (TMR) at 25 K is found to get improved after annealing as revealed by the value V{sub 1/2} (the bias value at which the TMR reaches to half of its value at nearly zero bias); which is 78 mV (in MTJ annealed at 200 °C/1 h) 2.5 times the value of 33 mV (in as deposited MTJ). At 25 K the inelastic tunneling spectra revealed the presence of zero bias anomaly and magnon excitations in the range of 10–15 mV. While the barrier height exhibited a strong temperature dependence with nearly 100% increase from the value at 300 K to 25 K, the temperature dependence of TMR becomes steep after annealing.« less

A statistically compiled test battery for feasible evaluation of knee function after rupture of the Anterior Cruciate Ligament - derived from long-term follow-up data.

PubMed

Schelin, Lina; Tengman, Eva; Ryden, Patrik; Häger, Charlotte

2017-01-01

Clinical test batteries for evaluation of knee function after injury to the Anterior Cruciate Ligament (ACL) should be valid and feasible, while reliably capturing the outcome of rehabilitation. There is currently a lack of consensus as to which of the many available assessment tools for knee function that should be included. The present aim was to use a statistical approach to investigate the contribution of frequently used tests to avoid redundancy, and filter them down to a proposed comprehensive and yet feasible test battery for long-term evaluation after ACL injury. In total 48 outcome variables related to knee function, all potentially relevant for a long-term follow-up, were included from a cross-sectional study where 70 ACL-injured (17-28 years post injury) individuals were compared to 33 controls. Cluster analysis and logistic regression were used to group variables and identify an optimal test battery, from which a summarized estimator of knee function representing various functional aspects was derived. As expected, several variables were strongly correlated, and the variables also fell into logical clusters with higher within-correlation (max ρ = 0.61) than between clusters (max ρ = 0.19). An extracted test battery with just four variables assessing one-leg balance, isokinetic knee extension strength and hop performance (one-leg hop, side hop) were mathematically combined to an estimator of knee function, which acceptably classified ACL-injured individuals and controls. This estimator, derived from objective measures, correlated significantly with self-reported function, e.g. Lysholm score (ρ = 0.66; p<0.001). The proposed test battery, based on a solid statistical approach, includes assessments which are all clinically feasible, while also covering complementary aspects of knee function. Similar test batteries could be determined for earlier phases of ACL rehabilitation or to enable longitudinal monitoring. Such developments, established on a well-grounded consensus of measurements, would facilitate comparisons of studies and enable evidence-based rehabilitation.

Electrical conductivity and dielectric behavior in sodium zinc divanadates

NASA Astrophysics Data System (ADS)

Sallemi, F.; Louati, B.; Guidara, K.

2014-11-01

The Na2ZnV2O7 compound was obtained by the conventional solid-state reaction. The sample was characterized by X-ray powder diffraction, Raman and impedance spectroscopy. The ac electrical conductivity and dielectric properties have been investigated in the frequency and temperature range of 200 Hz-1 MHz and 513 K-729 K, respectively. The direct current conductivity process is thermally activated. The frequency dependence of the conductivity is interpreted using the power law. The close values of activation energies obtained from the analysis of hopping frequency and dc conductivity implies that the transport is due to Na+ cation displacement parallel to (0 0 1) plane located between ZnO4 and VO4 tetrahedra. The evolution of the complex permittivity as a function of angular frequency was investigated. Several important parameters such as charge carrier concentration, ionic mobility and diffusion coefficient were determined. Thermodynamic parameters such as the free energy of activation ∆F, the enthalpy ∆H, and the change in entropy ∆S have been calculated.

Synthesis and characterization of mesoporous indium tin oxide possessing an electronically conductive framework.

PubMed

Emons, Theo T; Li, Jianquan; Nazar, Linda F

2002-07-24

The new mesoporous transparent conducting oxide based on indium-tin-oxide, meso-ITO, has been synthesized by a modified sol-gel method, using CTAB as the surfactant. Critical was the employment of triethanolamine to control the rate of hydrolysis and inhibit deposition of the bulk oxides. Removal of the surfactant by calcination yielded a relatively well-ordered worm-hole motif arrangement of pores visible in the TEM and stable to 400 degrees C. BET measurements revealed no hysteresis in the absorption-desorption isotherm, consistent with a narrow pore-size distribution (between 20 and 40 A depending on the In:Sn ratio); surface areas ranged between 270 and 310 m2/g. This colorless material is the first mesoporous oxide exhibiting substantial framework conductivity, with a conductivity at 25 degrees C of 1.2 x 10-3 S/cm. This distinguishes it from mesoporous mixed-valence transition-metal oxides that exhibit weak hopping semiconductor behavior and much lower conductivity.

Adsorption and dynamics of Si atoms at the monolayer Pb/Si(111) surface

NASA Astrophysics Data System (ADS)

Kumar, Rakesh; Fang, Chuang-Kai; Lee, Chih-Hao; Hwang, Ing-Shouh

2017-06-01

In this work, we studied the adsorption behavior of deposited Si atoms along with their diffusion and other dynamic processes on a Pb monolayer-covered Si(111) surface from 125 to 230 K using a variable-temperature scanning tunneling microscope. The Pb-covered Si(111) surface forms a low-symmetry rowlike (√{7 }×√{3 } ) structure in this temperature range and the Si atoms bind favorably to two specific on-top sites (T1 A and T1 B) on the trimer row after deposition at the sample temperature of ˜125 K . The Si atoms were immobile at low temperatures and started to switch between the two neighboring T1 A and T1 B sites within the same trimer when the temperature was raised to ˜150 K . When the temperature was raised above ˜160 K , the adsorbed Si atoms could hop to other trimers along the same trimer row. Below ˜170 K , short hops to adjacent trimers dominated, but long hops dominated at temperatures above ˜170 K . The activation energy and prefactor for the Si atoms diffusion were derived through analysis of continuous-time imaging at temperatures from 160 to 174 K. In addition, irreversible aggregation of single Si atoms into Si clusters started to occur at the phase boundaries or defective sites at temperatures above ˜170 K . At temperature above ˜180 K , nearly all Si atoms aggregated into clusters, which may have important implications for the atomic mechanism of epitaxial growth of Si on the Pb-covered Si(111) surface. In addition, our study provides strong evidence for breaking in the mirror symmetry in the (√{7 }×√{3 } )-Pb structure, which has implications for the atomic model of this controversial structure.

Mn Impurity in Bulk GaAs Crystals

NASA Astrophysics Data System (ADS)

Pawłowski, M.; Piersa, M.; Wołoś, A.; Palczewska, M.; Strzelecka, G.; Hruban, A.; Gosk, J.; Kamińska, M.; Twardowski, A.

2006-11-01

Magnetic and electron transport properties of GaAs:Mn crystals grown by Czochralski method were studied. Electron spin resonance showed the presence of Mn acceptor A in two charge states: singly ionized A- in the form of Mn2+(d5), and neutral A0 in the form of Mn2+(d5) plus a bound hole (h). It was possible to determine the relative concentration of both types of centers from intensity of the corresponding electron spin resonance lines. Magnetization measured as a function of magnetic field (up to 6 T) in the temperature range of 2-300 K revealed overall paramagnetic behavior of the samples. Effective spin was found to be about 1.5 value, which was consistent with the presence of two types of Mn configurations. In most of the studied samples the dominance of Mn2+(d5)+h configuration was established and it increased after annealing of native donors. The total value of Mn content was obtained from fitting of magnetization curves with the use of parameters obtained from electron spin resonance. In electron transport, two mechanisms of conductivity were observed: valence band transport dominated above 70 K, and hopping conductivity within Mn impurity band at lower temperatures. From the analysis of the hopping conductivity and using the obtained values of the total Mn content, the effective radius of Mn acceptor in GaAs was estimated as a = 11 ± 3 Å.