Sample records for variable-range hopping transport

  1. Electrical transport via variable range hopping in an individual multi-wall carbon nanotube

    NASA Astrophysics Data System (ADS)

    Husain Khan, Zishan; Husain, M.; Perng, T. P.; Salah, Numan; Habib, Sami

    2008-11-01

    E-beam lithography is used to make four leads on an individual multi-wall carbon nanotube for carrying out electrical transport measurements. Temperature dependence of conductance of an individual multi-wall carbon nanotube (MWNT) is studied over a temperature range of (297 4.8 K). The results indicate that the conduction is governed by variable range hopping (VRH) for the entire temperature range (297 4.8 K). This VRH mechanism changes from three dimensions (3D) to two dimensions (2D) as we go down to 70 K. Three-dimensional variable range hopping (3D VRH) is responsible for conduction in the temperature range (297 70 K), which changes to two-dimensional VRH for much lower temperatures (70 4.8 K). For 3D VRH, various Mott parameters such as density of states, hopping distance and hopping energy have been calculated. The 2D VRH mechanism has been applied for the temperature range (70 4.8 K) and, with the help of this model, the parameters such as localization length and hopping distance are calculated. All these parameters give interesting information about this complex structure, which may be useful for many applications.

  2. Efros-Shklovskii variable range hopping and nonlinear transport in 1 T /1 T'-MoS2

    NASA Astrophysics Data System (ADS)

    Papadopoulos, N.; Steele, G. A.; van der Zant, H. S. J.

    2017-12-01

    We have studied temperature- and electric-field-dependent carrier transport in single flakes of MoS2 treated with n -butyllithium. The temperature dependence of the four-terminal resistance follows the Efros-Shklovskii variable range hopping conduction mechanism. From measurements in the Ohmic and non-Ohmic regime, we estimate the localization length and the average hopping length of the carriers, as well as the effective dielectric constant. Furthermore, a comparison between two- and four-probe measurements yields a contact resistance that increases significantly with decreasing temperature.

  3. Range and energetics of charge hopping in organic semiconductors

    NASA Astrophysics Data System (ADS)

    Abdalla, Hassan; Zuo, Guangzheng; Kemerink, Martijn

    2017-12-01

    The recent upswing in attention for the thermoelectric properties of organic semiconductors (OSCs) adds urgency to the need for a quantitative description of the range and energetics of hopping transport in organic semiconductors under relevant circumstances, i.e., around room temperature (RT). In particular, the degree to which hops beyond the nearest neighbor must be accounted for at RT is still largely unknown. Here, measurements of charge and energy transport in doped OSCs are combined with analytical modeling to reach the univocal conclusion that variable-range hopping is the proper description in a large class of disordered OSC at RT. To obtain quantitative agreement with experiment, one needs to account for the modification of the density of states by ionized dopants. These Coulomb interactions give rise to a deep tail of trap states that is independent of the material's initial energetic disorder. Insertion of this effect into a classical Mott-type variable-range hopping model allows one to give a quantitative description of temperature-dependent conductivity and thermopower measurements on a wide range of disordered OSCs. In particular, the model explains the commonly observed quasiuniversal power-law relation between the Seebeck coefficient and the conductivity.

  4. Electron and thermal transport via variable range hopping in MoSe2 single crystals

    NASA Astrophysics Data System (ADS)

    Suri, Dhavala; Patel, R. S.

    2017-06-01

    Bulk single crystal molybdenum diselenide has been studied for its electronic and thermal transport properties. We perform resistivity measurements with current in-plane (CIP) and current perpendicular to plane (CPP) as a function of temperature. The CIP measurements exhibit metal to semiconductor transition at ≃31 K. In the semiconducting phase (T > 31 K), the transport is best explained by the variable range hopping (VRH) model. Large magnitude of resistivity in the CPP mode indicates strong structural anisotropy. The Seebeck coefficient as a function of temperature measured in the range of 90-300 K also agrees well with the VRH model. The room temperature Seebeck coefficient is found to be 139 μV/K. VRH fittings of the resistivity and the Seebeck coefficient data indicate high degree of localization.

  5. Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

    DOE PAGES

    Liu, Huili; Sung Choe, Hwan; Chen, Yabin; ...

    2017-09-05

    Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

  6. Variable range hopping electric and thermoelectric transport in anisotropic black phosphorus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Huili; Sung Choe, Hwan; Chen, Yabin

    Black phosphorus (BP) is a layered semiconductor with a high mobility of up to ~1000 cm 2 V -1 s -1 and a narrow bandgap of ~0.3 eV, and shows potential applications in thermoelectrics. In stark contrast to most other layered materials, electrical and thermoelectric properties in the basal plane of BP are highly anisotropic. In order to elucidate the mechanism for such anisotropy, we fabricated BP nanoribbons (~100 nm thick) along the armchair and zigzag directions, and measured the transport properties. It is found that both the electrical conductivity and Seebeck co efficient increase with temperature, a behavior contradictorymore » to that of traditional semiconductors. The three-dimensional variable range hopping model is adopted to analyze this abnormal temperature dependency of electrical conductivity and Seebeck coefficient. Furthermore, the hopping transport of the BP nanoribbons, attributed to high density of trap states in the samples, provides a fundamental understanding of the anisotropic BP for potential thermoelectric applications.« less

  7. Variable range hopping in ZnO films

    NASA Astrophysics Data System (ADS)

    Ali, Nasir; Ghosh, Subhasis

    2018-04-01

    We report the variable range hopping in ZnO films grown by RF magnetron sputtering in different argon and oxygen partial pressure. It has been found that Mott variable range hopping dominant over Efros variable range hopping in all ZnO films. It also has been found that hopping distance and energy increases with increasing oxygen partial pressure.

  8. Spin-glass and variable range hopping quantum interference magnetoresistance in FeSr2Y1.3Ce0.7Cu2O10-x

    NASA Astrophysics Data System (ADS)

    Sambale, S.; Williams, G. V. M.; Stephen, J.; Chong, S. V.

    2014-12-01

    Electronic transport and magnetic measurements have been made on FeSr2Y1.3Ce0.7Cu2O10-x. We observe a spin-glass at ˜23 K and a magnetoresistance that reaches -22% at 8 T. The magnetoresistance is due to variable range hopping quantum interference where at low temperatures each hop is over a large number of scatterers. This magnetoresistance is negative at and above 5 K and can be described by the Nguen, Spivak, and Shklovskii (NSS) model. However, there is an increasingly positive contribution to the magnetoresistance for temperatures below 5 K that may be due to scattering from localized free spins during each hop that is not accounted for in the NSS model.

  9. Low temperature resistivity studies of SmB6: Observation of two-dimensional variable-range hopping conductivity

    NASA Astrophysics Data System (ADS)

    Batkova, Marianna; Batko, Ivan; Gabáni, Slavomír; Gažo, Emil; Konovalova, Elena; Filippov, Vladimir

    2018-05-01

    We studied electrical resistance of a single-crystalline SmB6 sample with a focus on the region of the "low-temperature resistivity plateau". Our observations did not show any true saturation of the electrical resistance at temperatures below 3 K down to 70 mK. According to our findings, temperature dependence of the electrical conduction in a certain temperature interval above 70 mK can be decomposed into a temperature-independent term and a temperature-activated term that can be described by variable-range hopping formula for two-dimensional systems, exp [ -(T0 / T) 1 / 3 ]. Thus, our results indicate importance of hopping type of electrical transport in the near-surface region of SmB6.

  10. Variable-Range Hopping through Marginally Localized Phonons

    NASA Astrophysics Data System (ADS)

    Banerjee, Sumilan; Altman, Ehud

    2016-03-01

    We investigate the effect of coupling Anderson localized particles in one dimension to a system of marginally localized phonons having a symmetry protected delocalized mode at zero frequency. This situation is naturally realized for electrons coupled to phonons in a disordered nanowire as well as for ultracold fermions coupled to phonons of a superfluid in a one-dimensional disordered trap. To determine if the coupled system can be many-body localized we analyze the phonon-mediated hopping transport for both the weak and strong coupling regimes. We show that the usual variable-range hopping mechanism involving a low-order phonon process is ineffective at low temperature due to discreteness of the bath at the required energy. Instead, the system thermalizes through a many-body process involving exchange of a diverging number n ∝-log T of phonons in the low temperature limit. This effect leads to a highly singular prefactor to Mott's well-known formula and strongly suppresses the variable range hopping rate. Finally, we comment on possible implications of this physics in higher dimensional electron-phonon coupled systems.

  11. Hopping transport through an array of Luttinger liquid stubs

    NASA Astrophysics Data System (ADS)

    Chudnovskiy, A. L.

    2004-01-01

    We consider a thermally activated transport across and array of parallel one-dimensional quantum wires of finite length (quantum stubs). The disorder enters as a random tunneling between the nearest-neighbor stubs as well as a random shift of the bottom of the energy band in each stub. Whereas one-particle wave functions are localized across the array, the plasmons are delocalized, which affects the variable-range hopping. A perturbative analytical expression for the low-temperature resistance across the array is obtained for a particular choice of plasmon dispersion.

  12. Vortex variable range hopping in a conventional superconducting film

    NASA Astrophysics Data System (ADS)

    Percher, Ilana M.; Volotsenko, Irina; Frydman, Aviad; Shklovskii, Boris I.; Goldman, Allen M.

    2017-12-01

    The behavior of a disordered amorphous thin film of superconducting indium oxide has been studied as a function of temperature and magnetic field applied perpendicular to its plane. A superconductor-insulator transition has been observed, though the isotherms do not cross at a single point. The curves of resistance versus temperature on the putative superconducting side of this transition, where the resistance decreases with decreasing temperature, obey two-dimensional Mott variable-range hopping of vortices over wide ranges of temperature and resistance. To estimate the parameters of hopping, the film is modeled as a granular system and the hopping of vortices is treated in a manner analogous to hopping of charges. The reason the long-range interaction between vortices over the range of magnetic fields investigated does not lead to a stronger variation of resistance with temperature than that of two-dimensional Mott variable-range hopping remains unresolved.

  13. Electron transport in the two-dimensional channel material - zinc oxide nanoflake

    NASA Astrophysics Data System (ADS)

    Lai, Jian-Jhong; Jian, Dunliang; Lin, Yen-Fu; Ku, Ming-Ming; Jian, Wen-Bin

    2018-03-01

    ZnO nanoflakes of 3-5 μm in lateral size and 15-20 nm in thickness are synthesized. The nanoflakes are used to make back-gated transistor devices. Electron transport in the ZnO nanoflake channel between source and drain electrodes are investigated. In the beginning, we argue and determine that electrons are in a two-dimensional system. We then apply Mott's two-dimensional variable range hopping model to analyze temperature and electric field dependences of resistivity. The disorder parameter, localization length, hopping distance, and hopping energy of the electron system in ZnO nanoflakes are obtained and, additionally, their temperature behaviors and dependences on room-temperature resistivity are presented. On the other hand, the basic transfer characteristics of the channel material are carried out, as well, and the carrier concentration, the mobility, and the Fermi wavelength of two-dimensional ZnO nanoflakes are estimated.

  14. Charge carrier transport mechanisms in perovskite CdTiO{sub 3} fibers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imran, Z.; Rafiq, M. A., E-mail: aftab@cantab.net; Hasan, M. M.

    Electrical transport properties of electrospun cadmium titanate (CdTiO{sub 3}) fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behaviormore » followed by space charge limited current (SCLC) with traps at higher voltages at all temperatures (200 K – 420 K). Trap density in our fibers system is N{sub t} = 6.27 × 10{sup 17} /cm{sup 3}. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH) from 200 K – 300 K. The localized density of states were found to be N(E{sub F}) = 5.51 × 10{sup 21} eV{sup −1} cm{sup −3} at 2 V. Other VRH parameters such as hopping distance (R{sub hop}) and hopping energy (W{sub hop}) were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO{sub 3} fibers efficient material for capacitive energy storage devices.« less

  15. Electrically Detected Study of Variable Range Hopping in Silicon Nitrides

    NASA Astrophysics Data System (ADS)

    Waskiewicz, Ryan; Mutch, Michael; Lenahan, Patrick; King, Sean

    Electrically detected magnetic resonance (EDMR) offers greatly improved sensitivity over conventional electron paramagnetic resonance (EPR) studies in semiconductor/insulator systems; in EDMR measurements, one observes EPR via changes in device currents which are spin-dependent. In our study, we observe EDMR via spin-dependent trap assisted tunneling (SDTAT) via variable range hopping (VRH) through stoichiometric silicon nitride dielectric films. In these films, leakage current effectively changes at resonance. In our study, we have investigated the EDMR response as a function of dielectric electric field and temperature for films of various thicknesses. We believe that these measurements allow us to identify the defects responsible for transport in such these thin films using EDMR and to some extent measure the distances between the defects. The separation between the defects can, at least in principle, be measured using the recently demonstrated half-field EDMR response and we can also count total number of spins responsible for transport through dielectric films. Although we present results only on silicon nitride thin films, we believe that the approach utilized will be widely applicable to other dielectric films in which electronic transport is of interest. This project is sponsored in part by Intel Corporation and in part by the Department of Defense, Defense Threat Reduction Agency under Grant Number HDTRA1-16-0008.

  16. Sensitive photo-thermal response of graphene oxide for mid-infrared detection

    NASA Astrophysics Data System (ADS)

    Bae, Jung Jun; Yoon, Jung Hyun; Jeong, Sooyeon; Moon, Byoung Hee; Han, Joong Tark; Jeong, Hee Jin; Lee, Geon-Woong; Hwang, Ha Ryong; Lee, Young Hee; Jeong, Seung Yol; Lim, Seong Chu

    2015-09-01

    This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability.This study characterizes the effects of incident infrared (IR) radiation on the electrical conductivity of graphene oxide (GO) and examines its potential for mid-IR detection. Analysis of the mildly reduced GO (m-GO) transport mechanism near room temperature reveals variable range hopping (VRH) for the conduction of electrons. This VRH behavior causes the m-GO resistance to exhibit a strong temperature dependence, with a large negative temperature coefficient of resistance of approximately -2 to -4% K-1. In addition to this hopping transport, the presence of various oxygen-related functional groups within GO enhances the absorption of IR radiation significantly. These two GO material properties are synergically coupled and provoke a remarkable photothermal effect within this material; specifically, a large resistance drop is exhibited by m-GO in response to the increase in temperature caused by the IR absorption. The m-GO bolometer effect identified in this study is different from that exhibited in vanadium oxides, which require added gold-black films that function as IR absorbers owing to their limited IR absorption capability. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04039f

  17. Realizing one-dimensional quantum and high-frequency transport features in aligned single-walled carbon nanotube ropes

    NASA Astrophysics Data System (ADS)

    Ncube, Siphephile; Chimowa, George; Chiguvare, Zivayi; Bhattacharyya, Somnath

    2014-07-01

    The superiority of the electronic transport properties of single-walled carbon nanotube (SWNT) ropes over SWNT mats is verified from low temperature and frequency-dependent transport. The overall change of resistance versus in nanotube mats shows that 3D variable range hopping is the dominant conduction mechanism within the 2-300 K range. The magneto-resistance (MR) is found to be predominantly negative with a parabolic nature, which can also be described by the hopping model. Although the positive upturn of the MR at low temperatures establishes the contribution from quantum interference, the inherent quantum transport in individual tubes is suppressed at elevated temperatures. Therefore, to minimize multi-channel effects from inter-tube interactions and other defects, two-terminal devices were fabricated from aligned SWNT (extracted from a mat) for low temperature transport as well as high-frequency measurements. In contrast to the mat, the aligned ropes exhibit step-like features in the differential conductance within the 80-300 K temperature range. The effects of plasmon propagation, unique to one dimension, were identified in electronic transport as a non-universal power-law dependence of the differential conductance on temperature and source-drain voltage. The complex impedance showed high power transmission capabilities up to 65 GHz as well as oscillations in the frequency range up to 30 GHz. The measurements suggest that aligned SWNT ropes have a realistic potential for high-speed device applications.

  18. Temperature and field-dependent transport measurements in continuously tunable tantalum oxide memristors expose the dominant state variable

    NASA Astrophysics Data System (ADS)

    Graves, Catherine E.; Dávila, Noraica; Merced-Grafals, Emmanuelle J.; Lam, Si-Ty; Strachan, John Paul; Williams, R. Stanley

    2017-03-01

    Applications of memristor devices are quickly moving beyond computer memory to areas of analog and neuromorphic computation. These applications require the design of devices with different characteristics from binary memory, such as a large tunable range of conductance. A complete understanding of the conduction mechanisms and their corresponding state variable(s) is crucial for optimizing performance and designs in these applications. Here we present measurements of low bias I-V characteristics of 6 states in a Ta/ tantalum-oxide (TaOx)/Pt memristor spanning over 2 orders of magnitude in conductance and temperatures from 100 K to 500 K. Our measurements show that the 300 K device conduction is dominated by a temperature-insensitive current that varies with non-volatile memristor state, with an additional leakage contribution from a thermally-activated current channel that is nearly independent of the memristor state. We interpret these results with a parallel conduction model of Mott hopping and Schottky emission channels, fitting the voltage and temperature dependent experimental data for all memristor states with only two free parameters. The memristor conductance is linearly correlated with N, the density of electrons near EF participating in the Mott hopping conduction, revealing N to be the dominant state variable for low bias conduction in this system. Finally, we show that the Mott hopping sites can be ascribed to oxygen vacancies, where the local oxygen vacancy density responsible for critical hopping pathways controls the memristor conductance.

  19. DC electrical conductivity of Ag2O-TeO2-V2O5 glassy systems

    NASA Astrophysics Data System (ADS)

    Souri, D.; Tahan, Z. Esmaeili; Salehizadeh, S. A.

    2016-04-01

    In the present article, samples of xAg2O-40TeO2-(60 - x)V2O5 ternary tellurite glasses with 0 ≤ x ≤ 50 (in mol%) have been prepared using the melt-quenching technique. XRD analysis, density measurement by Archimedes' law, determination of reduced vanadium ions by titration method, and electrical conductivity measurement by using four-probe methods have been done for these glasses. The mixed electronic-ionic conduction of these glasses has been investigated over a wide temperature range of 150-380 K. The experimental results have been analyzed with different theoretical models of hopping conduction. The analysis shows that at high temperatures the conductivity data are consistent with Mott's model of phonon-assisted polaronic hopping, while Mott's variable-range hopping model and Greaves' hopping model are valid at low temperatures. The temperature dependence of the conductivity has been also interpreted in the framework of the percolation model proposed by Triberis and Friedman. The analysis of the conductivity data also indicates that the hopping in these tellurite glasses occurs in the non-adiabatic regime. In each sample, based upon the justified transport mechanism, carrier density and mobility have been determined at different temperatures. The values of oxygen molar volume indicate the effect of Ag2O concentration on the thermal stability or fragility of understudied samples.

  20. Hierarchical Hopping through Localized States in a Random Potential

    NASA Astrophysics Data System (ADS)

    Rajan, Harihar; Srivastava, Vipin

    2003-03-01

    Generalisation of Mott's idea on (low - temperature, large-time), Variable-range-hopping is considered to include hopping at some what higher temperature(that do not kill localization). These transitions complement the variable- range-hopping in that they do not conserve energy and occur at relatively lower time scales. The hopper picks the next state in a hierarchical fashion in accordance with certain conditions. The results are found to tie up nicely with an interesting property pertaining to the energy dependence of localized states. Acknowlwdgements: One of us(VS) would like to thank Association of Commonwealth Universities and Leverhulme Trust for financial help and to Sir Sam Edwards for hospitality at Cavendish Laboratory,Cambridge CB3 0HE.

  1. Comparative studies of the structure, morphology and electrical conductivity of polyaniline weakly doped with chlorocarboxylic acids

    NASA Astrophysics Data System (ADS)

    Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif

    2007-08-01

    We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.

  2. Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

    NASA Astrophysics Data System (ADS)

    Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

    2017-12-01

    Charge transport in the temperature range 80 K < T < 300 K was studied in a composite of carbon spheres (CS), prepared via hydrothermal carbonization of sucrose, and the conducting polymer polyaniline (PANi). PANi was synthesized via the oxidative polymerization of aniline with ammonium peroxydisulfate (APS) in acidic media. The CS/PANi composite was prepared by coating the spheres with a thin polyaniline (PANi) film doped with hydrochloric acid (HCl) in situ during the polymerization process. Temperature dependent conductivity measurements show that three dimensional variable range hopping of electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

  3. Crossover from Polaronic to Magnetically Phase-Separated Behavior in La1-xSrxCoO3

    NASA Astrophysics Data System (ADS)

    Phelan, D.; El Khatib, S.; Wang, S.; Barker, J.; Zhao, J.; Zheng, H.; Mitchell, J. F.; Leighton, C.

    2013-03-01

    Dilute hole-doping in La1-xSrxCoO3 leads to the formation of ``spin-state polarons'' where a non-zero spin-state is stabilized on the nearest Co3+ ions surrounding a hole. Here, we discuss the development of electronic/magnetic properties of this system from non-magnetic x=0, through the regime of spin-state polarons, and into the region where longer-range spin correlations and phase separation develop. We present magnetometry, transport, heat capacity, and small-angle neutron scattering (SANS) on single crystals. Magnetometry indicates a crossover with x from Langevin-like behavior (polaronic) to a state with a freezing temperature and finite coercivity. Fascinating correlations with this behavior are seen in transport measurements, the evolution from polaronic to clustered states being accompanied by a crossover from Mott variable range hopping to intercluster hopping. SANS data shows Lorentzian scattering from short-range ferromagnetic clusters first emerging around x = 0.03 with correlation lengths of order two unit cells. We argue that this system provides a unique opportunity to understand in detail the crossover from polaronic to truly phase-separated states.

  4. Transport and charging mechanisms in Ta2O5 thin films for capacitive RF MEMS switches application

    NASA Astrophysics Data System (ADS)

    Persano, A.; Quaranta, F.; Martucci, M. C.; Cretı, P.; Siciliano, P.; Cola, A.

    2010-06-01

    The potential of sputtered Ta2O5 thin films to be used as dielectric layers in capacitive radio frequency microelectromechanical system switches is evaluated by investigating two factors of crucial importance for the performance of these devices which are the transport mechanisms and the charging effects in the dielectric layer. We find that Ta2O5 films show good electrical and dielectrical properties for the considered application in terms of a low leakage current density of 4 nA/cm2 for E =1 MV/cm, a high breakdown field of 4 MV/cm and a high dielectric constant of 32. For electric fields lower than 1 MV/cm the conduction mechanism is found to be variable-range hopping in the temperature range 300-400 K, while nearest-neighbor hopping is observed at higher temperatures. For fields in the range 1-4 MV/cm Poole-Frenkel becomes the dominant conduction mechanism. Current and capacitance transients used to investigate the charging effects show a decay which is well described by the stretched-exponential law, thus providing further insights on capture and emission processes.

  5. Electronic phase separation in insulating (Ga, Mn) As with low compensation: super-paramagnetism and hopping conduction

    NASA Astrophysics Data System (ADS)

    Yuan, Ye; Wang, Mao; Xu, Chi; Hübner, René; Böttger, Roman; Jakiela, Rafal; Helm, Manfred; Sawicki, Maciej; Zhou, Shengqiang

    2018-03-01

    In the present work, low compensated insulating (Ga,Mn)As with 0.7% Mn is obtained by ion implantation combined with pulsed laser melting. The sample shows variable-range hopping transport behavior with a Coulomb gap in the vicinity of the Fermi energy, and the activation energy is reduced by an external magnetic field. A blocking super-paramagnetism is observed rather than ferromagnetism. Below the blocking temperature, the sample exhibits a colossal negative magnetoresistance. Our studies confirm that the disorder-induced electronic phase separation occurs in (Ga,Mn)As samples with a Mn concentration in the insulator-metal transition regime, and it can account for the observed superparamagnetism and the colossal magnetoresistance.

  6. Magneto-transport properties of a random distribution of few-layer graphene patches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu

    In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime.

  7. Visualizing Current Flow at the Mesoscale in Disordered Assemblies of Touching Semiconductor Nanocrystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Qinyi; Guest, Jeffrey R.; Thimsen, Elijah

    2017-07-12

    The transport of electrons through assemblies of nanocrystals is important to performance in optoelectronic applications for these materials. Previous work has primarily focused on single nanocrystals or transitions between pairs of nanocrystals. There is a gap in knowledge of how large numbers of nanocrystals in an assembly behave collectively, and how this collective behavior manifests at the mesoscale. In this work, the variable range hopping (VRH) transport of electrons in disordered assemblies of touching, heavily doped ZnO nanocrystals was visualized at the mesoscale as a function of temperature both theoretically, using the model of Skinner, Chen and Shklovskii (SCS), andmore » experimentally, with conductive atomic force microscopy on ultrathin films only a few particle layers thick. Agreement was obtained between the model and experiments, with a few notable exceptions. The SCS model predicts that a single network within the nanocrystal assembly, comprised of sites connected by small resistances, dominates conduction - namely the optimum band from variable range hopping theory. However, our experiments revealed that in addition to the optimum band, there are subnetworks that appear as additional peaks in the resistance histogram of conductive atomic force microscopy (CAFM) maps. Furthermore, the connections of these subnetworks to the optimum band change in time, such that some subnetworks become connected to the optimum band while others become disconnected and isolated from the optimum band; this observation appears to be an experimental manifestation of the ‘blinking’ phenomenon in our images of mesoscale transport.« less

  8. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

    PubMed Central

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-01-01

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices. PMID:27829663

  9. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes

    NASA Astrophysics Data System (ADS)

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-11-01

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS2) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS2 and pentacene. The pentacene/MoS2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

  10. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

    PubMed

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-11-10

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

  11. Dichotomy between the band and hopping transport in organic crystals: insights from experiments.

    PubMed

    Yavuz, I

    2017-10-04

    The molecular understanding of charge-transport in organic crystals has often been tangled with identifying the true dynamical origin. While in two distinct cases where complete delocalization and localization of charge-carriers are associated with band-like and hopping-like transports, respectively, their possible coalescence poses some mystery. Moreover, the existing models are still controversial at ambient temperatures. Here, we review the issues in charge-transport theories of organic materials and then provide an overview of prominent transport models. We explored ∼60 organic crystals, the single-crystal hole/electron mobilities of which have been predicted by band-like and hopping-like transport models, separately. Our comparative results show that at room-temperature neither of the models are exclusively capable of accurately predicting mobilities in a very broad range. Hopping-like models well-predict experimental mobilities around μ ∼ 1 cm 2 V -1 s -1 but systematically diverge at high mobilities. Similarly, band-like models are good at μ > ∼50 cm 2 V -1 s -1 but systematically diverge at lower mobilities. These results suggest the development of a unique and robust room-temperature transport model incorporating a mixture of these two extreme cases, whose relative importance is associated with their predominant regions. We deduce that while band models are beneficial for rationally designing high mobility organic-semiconductors, hopping models are good to elucidate the charge-transport of most organic-semiconductors.

  12. Hopping conduction in zirconium oxynitrides thin film deposited by reactive magnetron sputtering

    NASA Astrophysics Data System (ADS)

    Guo, Jie; Zhan, Guanghui; Liu, Jingquan; Yang, Bin; Xu, Bin; Feng, Jie; Chen, Xiang; Yang, Chunsheng

    2015-10-01

    Zirconium oxynitrides thin film thermometers were demonstrated to be useful temperature sensors. However, the basic conduction mechanism of zirconium oxynitrides films has been a long-standing issue, which hinders the prediction and optimization of their ultimate performance. In this letter, zirconium oxynitrides films were grown on sapphire substrates by magnetron sputtering and their electric transport mechanism has been systemically investigated. It was found that in high temperatures region (>150 K) the electrical conductivity was dominated by thermal activation for all samples. In the low temperatures range, while Mott variable hopping conduction (VRH) was dominated the transport for films with relatively low resistance, a crossover from Mott VRH conduction to Efros-Shklovskii (ES) VRH was observed for films with relatively high resistance. This low temperature crossover from Mott to ES VRH indicates the presence of a Coulomb gap (~7 meV). These results demonstrate the competing and tunable conduction mechanism in zirconium oxynitrides thin films, which would be helpful for optimizing the performance of zirconium oxynitrides thermometer.

  13. Characterization of SiO2/SiC interface states and channel mobility from MOSFET characteristics including variable-range hopping at cryogenic temperature

    NASA Astrophysics Data System (ADS)

    Yoshioka, Hironori; Hirata, Kazuto

    2018-04-01

    The characteristics of SiC MOSFETs (drain current vs. gate voltage) were measured at 0.14-350 K and analyzed considering variable-range hopping conduction through interface states. The total interface state density was determined to be 5.4×1012 cm-2 from the additional shift in the threshold gate voltage with a temperature change. The wave-function size of interface states was determined from the temperature dependence of the measured hopping current and was comparable to the theoretical value. The channel mobility was approximately 100 cm2V-1s-1 and was almost independent of temperature.

  14. Magneto Transport of CVD Carbon in Artificial Opals

    NASA Astrophysics Data System (ADS)

    Wang, Lei; Yin, Ming; Arammash, Fauzi; Datta, Timir

    2014-03-01

    Magneto-transport of carbon inverse opal structures were investigated in the 2.5 to 300 K temperatures and magnetic fields in the 0-10T regime. Qualitatively, our observations lie between those reported by previous researchers. Over this temperature range, transport (in zero magnetic field) is non-metallic; the resistance decreased with rising temperature however the temperature dependent behavior is not activated, as observed with variable range hopping. In three-dimensions, such behavior can also be the result of weak localization and electron-electron interactions; in particular the change in conductivity is a polynomial in fractional powers of absolute temperature. At sub-helium temperature regimes the relative magneto resistance is measured to be ~ 0.1 percent per Tesla. Results of data analysis for several different scenarios will be reported. DOD award #60177-RT-H from the ARO.

  15. Spin diffusion in disordered organic semiconductors

    NASA Astrophysics Data System (ADS)

    Li, Ling; Gao, Nan; Lu, Nianduan; Liu, Ming; Bässler, Heinz

    2015-12-01

    An analytical theory for spin diffusion in disordered organic semiconductors is derived. It is based on percolation theory and variable range hopping in a disordered energy landscape with a Gaussian density of states. It describes universally the dependence of the spin diffusion on temperature, carrier density, material disorder, magnetic field, and electric field at the arbitrary magnitude of the Hubbard energy of charge pairs. It is found that, compared to the spin transport carried by carriers hopping, the spin exchange will hinder the spin diffusion process at low carrier density, even under the condition of a weak electric field. Importantly, under the influence of a bias voltage, anomalous spreading of the spin packet will lead to an abnormal temperature dependence of the spin diffusion coefficient and diffusion length. This explains the recent experimental data for spin diffusion length observed in Alq3.

  16. Electron transport and noise spectroscopy in organic magnetic tunnel junctions with PTCDA and Alq3 barriers

    NASA Astrophysics Data System (ADS)

    Martinez, Isidoro; Cascales, Juan Pedro; Hong, Jhen-Yong; Lin, Minn-Tsong; Prezioso, Mirko; Riminucci, Alberto; Dediu, Valentin A.; Aliev, Farkhad G.

    2016-10-01

    The possible influence of internal barrier dynamics on spin, charge transport and their fluctuations in organic spintronics remains poorly understood. Here we present investigation of the electron transport and low frequency noise at temperatures down to 0.3K in magnetic tunnel junctions with an organic PTCDA barriers with thickness up to 5 nm in the tunneling regime and with 200 nm thick Alq3 barrier in the hopping regime. We observed high tunneling magneto-resistance at low temperatures (15-40%) and spin dependent super-poissonian shot noise in organic magnetic tunnel junctions (OMTJs) with PTCDA. The Fano factor exceeds 1.5-2 values which could be caused by interfacial states controlled by spin dependent bunching in the tunneling events through the molecules.1 The bias dependence of the low frequency noise in OMTJs with PTCDA barriers which includes both 1/f and random telegraph noise activated at specific biases will also be discussed. On the other hand, the organic junctions with ferromagnetic electrodes and thick Alq3 barriers present sub-poissonian shot noise which depends on the temperature, indicative of variable range hopping.

  17. Transport and magnetic properties of disordered Li xV yO 2 ( x=0.8 and y=0.8)

    NASA Astrophysics Data System (ADS)

    Du, Fei; Li, Ang; Liu, Daliang; Zhan, Shiying; Hu, Fang; Wang, Chunzhong; Chen, Yan; Feng, Shouhua; Chen, Gang

    2009-07-01

    The magnetic and electron transport properties of rhombohedral Li xV yO 2 ( x=0.8 and y=0.8) are studied. The dc susceptibility of Li xV yO 2 can be well fitted to the modified Curie-Weiss law, which verified the paramagnetic ground state. The magnetic hysteresis and ac susceptibility also confirm this paramagnetism. The Li xV yO 2 exhibits semiconducting behavior, which is explained by thermal activated process at high temperature and variable-range hopping mechanism at low temperature. Anderson localization plays an important role in both the electron transport behavior and the magnetic behavior due to the site disorder between the Li + ion and V 4+ ion.

  18. Carrier Transport and Effective Barrier Height of Low Resistance Metal Contact to Highly Mg-Doped p-GaN

    NASA Astrophysics Data System (ADS)

    Park, Youngjun; Kim, Hyunsoo

    2011-08-01

    The effective barrier height and carrier transport mechanism of low resistance Ag-based contact to highly Mg-doped p-GaN were investigated. The specific contact resistance obtained was as low as 7.0×10-4 Ω cm2. The electrical resistivity of p-GaN was found to increase depending on ˜T-1/4, indicating variable-range hopping (VRH) conduction through Mg-related deep-level defects. Based on the VRH conduction model, the effective barrier height for carrier transport could be measured as 0.12 eV, which is low enough to explain the formation of excellent ohmic contact. The deep-level defects were also found to induce surface Fermi pinning.

  19. Optoelectrical, structural and morphological characterization of Cu2ZnSnSe4 compound used in photovoltaic applications

    NASA Astrophysics Data System (ADS)

    Mesa, F.; Leguizamon, A.; Dussan, A.; Gordillo, G.

    2016-10-01

    In this work, results are reported concerning the effect of the deposition parameters on the structural properties of Cu2ZnSnSe4 (CZTSe) thin films, grown through a chemical reaction of the metallic precursors by co-evaporation in a two-stage process. XRD measurements revealed that the samples deposited by selenization of Cu and Sn grow in the kesterite phase (CZTSe), respectively. Effect of the deposition temperature and mass ratio Cu/ZnSe on the transport properties of CZTSe films were analyzed. It was also found that the electrical conductivity of the thin films is affected by the transport of free carriers in extended states of the conduction band as well as for variable range hopping transport mechanisms, each one predominating in a different temperature range. The molecular and morphological effect on the compound through Raman and AFM measurements was studied.

  20. Accurate description of charge transport in organic field effect transistors using an experimentally extracted density of states

    NASA Astrophysics Data System (ADS)

    Roelofs, W. S. C.; Mathijssen, S. G. J.; Janssen, R. A. J.; de Leeuw, D. M.; Kemerink, M.

    2012-02-01

    The width and shape of the density of states (DOS) are key parameters to describe the charge transport of organic semiconductors. Here we extract the DOS using scanning Kelvin probe microscopy on a self-assembled monolayer field effect transistor (SAMFET). The semiconductor is only a single monolayer which has allowed extraction of the DOS over a wide energy range, pushing the methodology to its fundamental limit. The measured DOS consists of an exponential distribution of deep states with additional localized states on top. The charge transport has been calculated in a generic variable range-hopping model that allows any DOS as input. We show that with the experimentally extracted DOS an excellent agreement between measured and calculated transfer curves is obtained. This shows that detailed knowledge of the density of states is a prerequisite to consistently describe the transfer characteristics of organic field effect transistors.

  1. Duality in Power-Law Localization in Disordered One-Dimensional Systems

    NASA Astrophysics Data System (ADS)

    Deng, X.; Kravtsov, V. E.; Shlyapnikov, G. V.; Santos, L.

    2018-03-01

    The transport of excitations between pinned particles in many physical systems may be mapped to single-particle models with power-law hopping, 1 /ra . For randomly spaced particles, these models present an effective peculiar disorder that leads to surprising localization properties. We show that in one-dimensional systems almost all eigenstates (except for a few states close to the ground state) are power-law localized for any value of a >0 . Moreover, we show that our model is an example of a new universality class of models with power-law hopping, characterized by a duality between systems with long-range hops (a <1 ) and short-range hops (a >1 ), in which the wave function amplitude falls off algebraically with the same power γ from the localization center.

  2. Quantum interference magnetoconductance of polycrystalline germanium films in the variable-range hopping regime

    NASA Astrophysics Data System (ADS)

    Li, Zhaoguo; Peng, Liping; Zhang, Jicheng; Li, Jia; Zeng, Yong; Zhan, Zhiqiang; Wu, Weidong

    2018-06-01

    Direct evidence of quantum interference magnetotransport in polycrystalline germanium films in the variable-range hopping (VRH) regime is reported. The temperature dependence of the conductivity of germanium films fulfilled the Mott VRH mechanism with the form of ? in the low-temperature regime (?). For the magnetotransport behaviour of our germanium films in the VRH regime, a crossover, from negative magnetoconductance at the low-field to positive magnetoconductance at the high-field, is observed while the zero-field conductivity is higher than the critical value (?). In the regime of ?, the magnetoconductance is positive and quadratic in the field for some germanium films. These features are in agreement with the VRH magnetotransport theory based on the quantum interference effect among random paths in the hopping process.

  3. Magnetic hard gap due to bound magnetic polarons in the localized regime.

    PubMed

    Rimal, Gaurab; Tang, Jinke

    2017-02-08

    We investigate the low temperature electron transport properties of manganese doped lead sulfide films. The system shows variable range hopping at low temperatures that crosses over into an activation regime at even lower temperatures. This crossover is destroyed by an applied magnetic field which suggests a magnetic origin of the hard gap, associated with bound magnetic polarons. Even though the gap forms around the superconducting transition temperature of lead, we do not find evidence of this being due to insulator-superconductor transition. Comparison with undoped PbS films, which do not show the activated transport behavior, suggests that bound magnetic polarons create the hard gap in the system that can be closed by magnetic fields.

  4. Leakage current transport mechanism under reverse bias in Au/Ni/GaN Schottky barrier diode

    NASA Astrophysics Data System (ADS)

    Peta, Koteswara Rao; Kim, Moon Deock

    2018-01-01

    The leakage current transport mechanism under reverse bias of Au/Ni/GaN Schottky diode is studied using temperature dependent current-voltage (I-V-T) and capacitance-voltage (C-V) characteristics. I-V measurement in this study is in the range of 140 K-420 K in steps of 10 K. A reduction in voltage dependent barrier height and a strong internal electric field in depletion region under reverse bias suggested electric field enhanced thermionic emission in carrier transport via defect states in Au/Ni/GaN SBD. A detailed analysis of reverse leakage current revealed two different predominant transport mechanisms namely variable-range hopping (VRH) and Poole-Frenkel (PF) emission conduction at low (<260 K) and high (>260 K) temperatures respectively. The estimated thermal activation energies (0.20-0.39 eV) from Arrhenius plot indicates a trap assisted tunneling of thermally activated electrons from a deep trap state into a continuum of states associated with each conductive threading dislocation.

  5. Crystal growth and magneto-transport behavior of PdS1-δ

    NASA Astrophysics Data System (ADS)

    Cao, Lin; Lv, Yang-Yang; Chen, Si-Si; Li, Xiao; Zhou, Jian; Yao, Shu-Hua; Chen, Y. B.; Lu, Minghui; Chen, Yan-Feng

    2018-04-01

    PdS is theoretically proposed to novel topological material with eight-band fermions. Here, PdS1-δ crystals were successfully grown from KI as solvent by modified flux method. The single crystalline quality and compositional homogeneity of grown PdS1-δ are characterized by X-ray diffraction and energy dispersion spectroscopy. Temperature dependent electrical transport property of PdS1-δ demonstrates a semiconductor-like behavior. Analysis of temperature-dependent resistance indicates that there is variable-range-hopping behavior at low temperature. The clear negative MR of PdS1-δ single crystals is measured at the low temperature (<30 K), which may be ascribed to the interaction between conducting carriers and localized moments. however, the magneto-transport results have not shown the clues of topological feature of PdS.

  6. Thermally Stimulated Currents in Nanocrystalline Titania

    PubMed Central

    Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Cavallaro, Alessandro; Scaringella, Monica

    2018-01-01

    A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO2. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5–630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 1014–1018 cm−3, associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies. PMID:29303976

  7. Thermally Stimulated Currents in Nanocrystalline Titania.

    PubMed

    Bruzzi, Mara; Mori, Riccardo; Baldi, Andrea; Carnevale, Ennio Antonio; Cavallaro, Alessandro; Scaringella, Monica

    2018-01-05

    A thorough study on the distribution of defect-related active energy levels has been performed on nanocrystalline TiO₂. Films have been deposited on thick-alumina printed circuit boards equipped with electrical contacts, heater and temperature sensors, to carry out a detailed thermally stimulated currents analysis on a wide temperature range (5-630 K), in view to evidence contributions from shallow to deep energy levels within the gap. Data have been processed by numerically modelling electrical transport. The model considers both free and hopping contribution to conduction, a density of states characterized by an exponential tail of localized states below the conduction band and the convolution of standard Thermally Stimulated Currents (TSC) emissions with gaussian distributions to take into account the variability in energy due to local perturbations in the highly disordered network. Results show that in the low temperature range, up to 200 K, hopping within the exponential band tail represents the main contribution to electrical conduction. Above room temperature, electrical conduction is dominated by free carriers contribution and by emissions from deep energy levels, with a defect density ranging within 10 14 -10 18 cm -3 , associated with physio- and chemi-sorbed water vapour, OH groups and to oxygen vacancies.

  8. Effects of europium substitution for In on structure and photoelectric properties of CuIn{sub 1−x}Eu{sub x}Te{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nie, Xiaomeng; Guo, Yongquan

    2016-01-15

    The structures and optical and electric properties of europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2} have been studied systematically using powder X-ray diffraction (XRD), scanning electron microscopy (SEM) with energy dispersive spectrum (EDS), ultraviolet and visible spectrophotometer (UV–vis), and standard four-probe method. The studies reveal that the minor europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} could still stabilize the chalcopyrite structure in a solid solution of x=0.1. The lattice parameters are going up with increasing the content of europium in CuIn{sub 1−x}Eu{sub x}Te{sub 2} due to the size effect at In site. The structural refinement confirms that Eu partly substitutes formore » In and occupies the 4b crystal position. SEM morphologies show that the europium doping into CuIn{sub 1−x}Eu{sub x}Te{sub 2} can fine the grains from the largely agglomerated state to the uniformly separated state. The electrical resistivities of single phase CuIn{sub 1−x}Eu{sub x}Te{sub 2} follow a mixture model of hopping conductivity and variable range hopping conductivity. The absorption band-gaps of CuIn{sub 1−x}Eu{sub x}Te{sub 2} at room temperature tend to increase with increasing Eu content. CuIn{sub 1−x}Eu{sub x}Te{sub 2} might be a good candidate for photovoltaic cell. - Graphical abstract: CuIn{sub 0.9}Eu{sub 0.1}Te{sub 2} follows a mixture of hopping conductivity and variable range hopping conductivity mechanism. - Highlights: • Novel europium doped CuIn{sub 1−x}Eu{sub x}Te{sub 2}. • Potential application for devices and solar cells. • A mixture of hopping and variable range hopping conductivity mechanism.« less

  9. Origin and enhancement of spin polarized current in diluted magnetic oxides by oxygen vacancies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chou, Hsiung, E-mail: hchou@mail.nsysu.edu.tw; Yang, Kung-Shang; Tsao, Yao-Chung

    Spin polarized current (SPC) is a crucial characteristic of diluted magnetic oxides due to the potential application of oxides in spintronic devices. However, most research has been focused on ferromagnetic properties rather than polarization of electric current, because direct measurements are difficult and the origin of SPC has yet to be fully understood. The method to increase the SPC percentage is beyond practical consideration at present. To address this problem, we focus on the role of oxygen vacancies (V{sub O}) on SPC, which are controlled by growing the Co-doped ZnO thin-films at room temperature in a reducing atmosphere [Ar + (1%–30%)H{sub 2}].more » We found that the conductivity increases with an increase of V{sub O} via two independent channels: the variable range hopping (VRH) within localized states and the itinerant transport in the conduction band. The point contact Andreev reflection measurements at 4.2 K, where the electric conduction is governed only by the VRH mechanism, prove that the current flowing in the VRH hopping channel is SPC. The percentage of SPC increases with the introduction of V{sub O} and increase in its concentration. The transport measurement shows that by manipulating V{sub O}, one can control the percentage of VRH hopping conduction such that it can even dominate room temperature conduction. The highest achieved SPC ratio at room temperature was 80%.« less

  10. Role of carrier density and disorder on anisotropic charge transport in polypyrrole

    NASA Astrophysics Data System (ADS)

    Varade, Vaibhav; Anjaneyulu, P.; Suchand Sangeeth, C. S.; Ramesh, K. P.; Menon, Reghu

    2013-01-01

    Polypyrrole (PPy) has been synthesized electrochemically on platinum substrate by varying synthesis temperature and dopant concentration. The charge transport in PPy has been investigated as a function of temperature for both in-plane and out-of-plane geometry in a wide temperature range of 5 K-300 K. The charge transport showed strong anisotropy and various mechanisms were used to explain the transport. The conductivity ratio, σr = σ(300 K)/σ(5 K) is calculated for each sample to quantify the relative disorder. At all the temperatures, the conductivity values for in-plane transport are found to be more for PPy synthesized at lower temperature, while the behavior is found to be different for out-of-plane transport. The carrier density is found to play a crucial role in case of in-plane transport. An effort has been made to correlate charge transport to morphology by analyzing temperature and frequency dependence of conductivity. Charge transport in lateral direction is found to be dominated by hopping whereas tunneling mechanisms are dominated in vertical direction. Parameters such as density of states at the Fermi level [N(EF)], average hopping distance (R), and average hopping energy (W) have been estimated for each samples in both geometry.

  11. Experimental insight into the magnetic and electrical properties of amorphous Ge1-xMnx

    NASA Astrophysics Data System (ADS)

    Conta, Gianluca; Amato, Giampiero; Coïsson, Marco; Tiberto, Paola

    2017-12-01

    We present a study of the electrical and magnetic properties of the amorphous Ge1-xMnx.DMS, with 2% ≤ x ≤ 17%, by means of SQUID magnetometry and low temperature DC measurements. The thin films were grown by physical vapour deposition at 50°C in ultrahigh vacuum. The DC electrical characterizations show that variable range hopping is the main mechanism of charge transport below room temperature. Magnetic characterization reveals that a unique and smooth magnetic transition is present in our samples, which can be attributed to ferromagnetic percolation of bound magnetic polarons.

  12. Direct evidence for double-exchange coupling in Ru- substituted La0.7Pb0.3Mn 1 - x Ru x O3, 0.0 <= x <= 0.4

    NASA Astrophysics Data System (ADS)

    Sundar Manoharan, S.; Sahu, R. K.; Rao, M. L.; Elefant, D.; Schneider, C. M.

    2002-08-01

    The La0.7Pb0.3Mn 1 - x Ru x O3 (0.0 <= x <= 0.4) system shows an innate relationship between Mn and Ru ions by a unique double-exchange mediated transport behavior. This is exonerated by the coexistence of Tp and Tc (range 330 K 245 K for 0.0 <= x <= 0.4). For Ru > 30%, the hole carrier mass influences the transport property. X-ray absorption spectra suggest that the Tc-Tp match is due to the transport mediated by the Mn3+/Mn4+ leftrightarrow Ru4+/Ru5+ redox pair and also due to the broad low-spin Ru:4d conduction band. For x > 0.2, T < 0.5Tc obeys a modified variable-range hopping model, where kT0 propto (M/Ms)2, suggesting a random magnetic potential which localizes the charge carriers.

  13. Mismatch in cation size causes rapid anion dynamics in solid electrolytes: the role of the Arrhenius pre-factor.

    PubMed

    Breuer, Stefan; Wilkening, Martin

    2018-03-28

    Crystalline ion conductors exhibiting fast ion dynamics are of utmost importance for the development of, e.g., sensors or rechargeable batteries. In some layer-structured or nanostructured compounds fluorine ions participate in remarkably fast self-diffusion processes. As has been shown earlier, F ion dynamics in nanocrystalline, defect-rich BaF 2 is much higher than that in the coarse-grained counterpart BaF 2 . The thermally metastable fluoride (Ba,Ca)F 2 , which can be prepared by joint high-energy ball milling of the binary fluorides, exhibits even better ion transport properties. While long-range ion dynamics has been studied recently, less information is known about local ion hopping processes to which 19 F nuclear magnetic resonance (NMR) spin-lattice relaxation is sensitive. The present paper aims at understanding ion dynamics in metastable, nanocrystalline (Ba,Ca)F 2 by correlating short-range ion hopping with long-range transport properties. Variable-temperature NMR line shapes clearly indicate fast and slow F spin reservoirs. Surprisingly, from an atomic-scale point of view increased ion dynamics at intermediate values of composition is reflected by increased absolute spin-lattice relaxation rates rather than by a distinct minimum in activation energy. Hence, the pre-factor of the underlying Arrhenius relation, which is determined by the number of mobile spins, the attempt frequency and entropy effects, is identified as the parameter that directly enhances short-range ion dynamics in metastable (Ba,Ca)F 2 . Concerted ion migration could also play an important role to explain the anomalies seen in NMR spin-lattice relaxation.

  14. -Sb Glasses at Low Temperatures

    NASA Astrophysics Data System (ADS)

    Souri, Dariush; Azizpour, Parvin; Zaliani, Hamideh

    2014-09-01

    Semiconducting glasses of the type 40TeO2-(60 - x) V2O5- xSb were prepared by rapid melt quenching and their dc electrical conductivity was measured in the temperature range 180-296 K. For these glassy samples, the dc electrical conductivity ranged from 2.26 × 10-7 S cm-1 to 1.11 × 10-5 S cm-1 at 296 K, indicating the conductivity is enhanced by increasing the V2O5 content. These experimental results could be explained on the basis of different mechanisms (based on polaron-hopping theory) in the different temperature regions. At temperatures above Θ D/2 (where Θ D is the Debye temperature), the non-adiabatic small polaron hopping (NASPH) model is consistent with the data, whereas at temperatures below Θ D/2, a T -1/4 dependence of the conductivity indicative of the variable range hopping (VRH) mechanism is dominant. For all these glasses crossover from SPH to VRH conduction was observed at a characteristic temperature T R ≤ Θ D/2. In this study, the hopping carrier density and carrier mobility were determined at different temperatures. N ( E F), the density of states at (or near) the Fermi level, was also determined from the Mott variables; the results were dependent on V2O5 content.

  15. Cotunneling and polaronic effect in granular systems

    NASA Astrophysics Data System (ADS)

    Ioselevich, A. S.; Sivak, V. V.

    2017-06-01

    We theoretically study the conductivity in arrays of metallic grains due to the variable-range multiple cotunneling of electrons with short-range (screened) Coulomb interaction. The system is supposed to be coupled to random stray charges in the dielectric matrix that are only loosely bounded to their spatial positions by elastic forces. The flexibility of the stray charges gives rise to a polaronic effect, which leads to the onset of Arrhenius-type conductivity behavior at low temperatures, replacing conventional Mott variable-range hopping. The effective activation energy logarithmically depends on temperature due to fluctuations of the polaron barrier heights. We present the unified theory that covers both weak and strong polaron effect regimes of hopping in granular metals and describes the crossover from elastic to inelastic cotunneling.

  16. Anisotropic magnetism and spin-dependent transport in Co nanoparticle embedded ZnO thin films

    NASA Astrophysics Data System (ADS)

    Li, D. Y.; Zeng, Y. J.; Pereira, L. M. C.; Batuk, D.; Hadermann, J.; Zhang, Y. Z.; Ye, Z. Z.; Temst, K.; Vantomme, A.; Van Bael, M. J.; Van Haesendonck, C.

    2013-07-01

    Oriented Co nanoparticles were obtained by Co ion implantation in crystalline ZnO thin films grown by pulsed laser deposition. Transmission electron microscopy revealed the presence of elliptically shaped Co precipitates with nanometer size, which are embedded in the ZnO thin films, resulting in anisotropic magnetic behavior. The low-temperature resistance of the Co-implanted ZnO thin films follows the Efros-Shklovskii type variable-range-hopping. Large negative magnetoresistance (MR) exceeding 10% is observed in a magnetic field of 1 T at 2.5 K and the negative MR survives up to 250 K (0.3%). The negative MR reveals hysteresis as well as anisotropy that correlate well with the magnetic properties, clearly demonstrating the presence of spin-dependent transport.

  17. Electronic transport mechanism in intrinsic and doped nanocrystalline silicon films deposited by RF-magnetron sputtering at low temperature

    NASA Astrophysics Data System (ADS)

    Benlakehal, D.; Belfedal, A.; Bouizem, Y.; Sib, J. D.; Chahed, L.; Zellama, K.

    2016-12-01

    The dependence on the temperature range, T, of the electronic transport mechanism in intrinsic and doped hydrogenated nanocrystalline silicon films, deposited by radiofrequency-magnetron sputtering at low substrate temperature, has been studied. Electrical conductivity measurements σ(T) have been conducted on these films, as a function of temperature, in the 93-450 K range. The analysis of these results clearly shows a thermally activated conduction process in the 273-450 K range which allows us to estimate the associated activation energy as well as the preexponential conductivity factor. While, in the lower temperature range (T < 273 K), a non-ohmic behavior is observed for the conductivity changes. The conductivity σ(T) presents a linear dependence on (T-1/4) , and a hopping mechanism is suggested to explain these results. By using the Percolation theory, further information can be gained about the density of states near the Fermi level as well as the range and the hopping energy.

  18. Analysis of Electrical Transport and Noise Mechanisms in Amorphous Silicon

    DTIC Science & Technology

    2015-11-23

    and Skhlovskii [9] considered the long range Coulomb interaction and found that it reduces the DOS to zero at the Fermi level, thereby creating a so...called “ Coulomb gap (CG)” at low enough temperatures. This form of hopping conductivity results when an electron migrates from one site to another...site leaving a positively charged vacancy. For hopping to occur, the electron must have sufficient energy to overcome this Coulomb interaction

  19. Longitudinal hopping in intervehicle communication: Theory and simulations on modeled and empirical trajectory data

    NASA Astrophysics Data System (ADS)

    Thiemann, Christian; Treiber, Martin; Kesting, Arne

    2008-09-01

    Intervehicle communication enables vehicles to exchange messages within a limited broadcast range and thus self-organize into dynamical and geographically embedded wireless ad hoc networks. We study the longitudinal hopping mode in which messages are transported using equipped vehicles driving in the same direction as a relay. Given a finite communication range, we investigate the conditions where messages can percolate through the network, i.e., a linked chain of relay vehicles exists between the sender and receiver. We simulate message propagation in different traffic scenarios and for different fractions of equipped vehicles. Simulations are done with both, modeled and empirical traffic data. These results are used to test the limits of applicability of an analytical model assuming a Poissonian distance distribution between the relays. We found a good agreement for homogeneous traffic scenarios and sufficiently low percentages of equipped vehicles. For higher percentages, the observed connectivity was higher than that of the model while in stop-and-go traffic situations it was lower. We explain these results in terms of correlations of the distances between the relay vehicles. Finally, we introduce variable transmission ranges and found that this additional stochastic component generally increased connectivity compared to a deterministic transmission with the same mean.

  20. The crossover between tunnel and hopping conductivity in granulated films of noble metals

    NASA Astrophysics Data System (ADS)

    Kavokin, Alexey; Kutrovskaya, Stella; Kucherik, Alexey; Osipov, Anton; Vartanyan, Tigran; Arakelyan, Sergey

    2017-11-01

    The conductivity of thin films composed by clusters of gold and silver nanoparticles has been studies in a wide range of temperatures. The switch from a temperature independence to an exponential thermal dependence of the conductivity manifests the crossover between the tunnel and thermally activated hopping regimes of the electronic transport at the temperature of 60 °C. The characteristic thermal activation energy that governs hopping of electrons between nanoparticles is estimated as 1.3 eV. We have achieved a good control of the composition and thicknesses of nano-cluster films by use of the laser ablation method in colloidal solutions.

  1. Involvement of Vacuolar Sequestration and Active Transport in Tolerance of Saccharomyces cerevisiae to Hop Iso-α-Acids▿ † ¶

    PubMed Central

    Hazelwood, Lucie A.; Walsh, Michael C.; Pronk, Jack T.; Daran, Jean-Marc

    2010-01-01

    The hop plant, Humulus lupulus L., has an exceptionally high content of secondary metabolites, the hop α-acids, which possess a range of beneficial properties, including antiseptic action. Studies performed on the mode of action of hop iso-α-acids have hitherto been restricted to lactic acid bacteria. The present study investigated molecular mechanisms of hop iso-α-acid resistance in the model eukaryote Saccharomyces cerevisiae. Growth inhibition occurred at concentrations of hop iso-α-acids that were an order of magnitude higher than those found with hop-tolerant prokaryotes. Chemostat-based transcriptome analysis and phenotype screening of the S. cerevisiae haploid gene deletion collection were used as complementary methods to screen for genes involved in hop iso-α-acid detoxification and tolerance. This screening and further analysis of deletion mutants confirmed that yeast tolerance to hop iso-α-acids involves three major processes, active proton pumping into the vacuole by the vacuolar-type ATPase to enable vacuolar sequestration of iso-α-acids and alteration of cell wall structure and, to a lesser extent, active export of iso-α-acids across the plasma membrane. Furthermore, iso-α-acids were shown to affect cellular metal homeostasis by acting as strong zinc and iron chelators. PMID:19915041

  2. Vertical Hole Transport and Carrier Localization in InAs /InAs1 -xSbx Type-II Superlattice Heterojunction Bipolar Transistors

    NASA Astrophysics Data System (ADS)

    Olson, B. V.; Klem, J. F.; Kadlec, E. A.; Kim, J. K.; Goldflam, M. D.; Hawkins, S. D.; Tauke-Pedretti, A.; Coon, W. T.; Fortune, T. R.; Shaner, E. A.; Flatté, M. E.

    2017-02-01

    Heterojunction bipolar transistors are used to measure vertical hole transport in narrow-band-gap InAs /InAs1 -xSbx type-II superlattices (T2SLs). Vertical hole mobilities (μh) are reported and found to decrease rapidly from 360 cm2/V s at 120 K to approximately 2 cm2/V s at 30 K, providing evidence that holes are confined to localized states near the T2SL valence-miniband edge at low temperatures. Four distinct transport regimes are identified: (1) pure miniband transport, (2) miniband transport degraded by temporary capture of holes in localized states, (3) hopping transport between localized states in a mobility edge, and (4) hopping transport through defect states near the T2SL valence-miniband edge. Region (2) is found to have a thermal activation energy of ɛ2=36 meV corresponding to the energy range of a mobility edge. Region (3) is found to have a thermal activation energy of ɛ3=16 meV corresponding to the hopping transport activation energy. This description of vertical hole transport is analogous to electronic transport observed in disordered amorphous semiconductors displaying Anderson localization. For the T2SL, we postulate that localized states are created by disorder in the group-V alloy of the InAs1 -xSbx hole well causing fluctuations in the T2SL valence-band energy.

  3. Electrical and magnetic properties of La0.67Ba0.33Mn1- x (Me) x O3 perovskite manganites: case of manganese substituted by trivalent (Me = Cr) and tetravalent (Me = Ti) elements

    NASA Astrophysics Data System (ADS)

    Oumezzine, Marwène; Peña, Octavio; Kallel, Sami; Kallel, Nabil; Guizouarn, Thierry; Gouttefangeas, Francis; Oumezzine, Mohamed

    2014-03-01

    The effects of non-magnetic Ti4+ substitution on the structural, electrical and magnetic properties of La0.67Ba0.33Mn1- x Ti x O3 (0≤ x≤0.1) are investigated and compared to those existing in La0.67Ba0.33Mn1- x Cr x O3 (magnetic Cr3+). The structural refinement by the Rietveld method revealed that Ti-doped samples crystallize in the cubic lattice with space group , while samples with Cr crystallize in the hexagonal setting of the rhombohedral space group for identical contents of dopant. The most relevant structural features are an increase of the lattice parameters, of the cell volume and of the inter-ionic distances with increasing Ti doping level. Both series of samples show a decrease of the paramagnetic-ferromagnetic transition temperature when the amount of chromium or titanium increases. Transport measurements show that when increasing the metal doping, the resistivity increases whereas the metallic behavior of the parent compound La0.67Ba0.33MnO3 is destroyed. For a substitution higher than 5 at.% of Ti and 10 at.% of Cr, the samples exhibit a semiconducting behavior in the whole range of temperature, for which the electronic transport can be explained by variable range hopping and/or small polaron hopping models.

  4. Redirected charge transport arising from diazonium grafting of carbon coated LiFePO4.

    PubMed

    Madec, L; Seid, K A; Badot, J-C; Humbert, B; Moreau, P; Dubrunfaut, O; Lestriez, B; Guyomard, D; Gaubicher, J

    2014-11-07

    The morphological and the electrical properties of carbon coated LiFePO4 (LFPC) active material functionalized by 4-ethynylbenzene tetrafluoroboratediazonium salt were investigated. For this purpose, FTIR, Raman, XPS, High Resolution Transmission Electron Microscopy (HRTEM) and Broadband Dielectric Spectroscopy (BDS) were considered. Electronic conductivities of LFPC samples at room temperature were found to decrease in a large frequency range upon simple immersion in polar solvents and to decrease further upon functionalization. Due to their high dipole moment, strongly physisorbed molecules detected by XPS likely add barriers to electron hopping. Significant alteration of the carbon coating conductivity was only observed, however, upon functionalization. This effect is most presumably associated with an increase in the sp(3) content determined by Raman spectroscopy, which is a strong indication of the formation of a covalent bond between the organic layer and the carbon coating. In this case, the electron flux appears to be redirected and relayed by short-range (intra chain) and long-range (inter chain) electron transport through molecular oligomers anchored at the LFPC surface. The latter are controlled by tunnelling and slightly activated hopping, which enable higher conductivity at low temperature (T < 250 K). Alteration of the electron transport within the carbon coating also allows detection of a relaxation phenomenon that corresponds to small polaron hopping in bulk LiFePO4. XPS and HRTEM images allow a clear correlation of these findings with the island type oligomeric structure of grafted molecules.

  5. Interplay of long-range and short-range Coulomb interactions in an Anderson-Mott insulator

    NASA Astrophysics Data System (ADS)

    Baćani, Mirko; Novak, Mario; Orbanić, Filip; Prša, Krunoslav; Kokanović, Ivan; Babić, Dinko

    2017-07-01

    In this paper, we tackle the complexity of coexisting disorder and Coulomb electron-electron interactions (CEEIs) in solids by addressing a strongly disordered system with intricate CEEIs and a screening that changes both with charge carrier doping level Q and temperature T . We report on an experimental comparative study of the T dependencies of the electrical conductivity σ and magnetic susceptibility χ of polyaniline pellets doped with dodecylbenzenesulfonic acid over a wide range. This material is special within the class of doped polyaniline by exhibiting in the electronic transport a crossover between a low-T variable range hopping (VRH) and a high-T nearest-neighbor hopping (NNH) well below room temperature. Moreover, there is evidence of a soft Coulomb gap ΔC in the disorder band, which implies the existence of a long-range CEEI. Simultaneously, there is an onsite CEEI manifested as a Hubbard gap U and originating in the electronic structure of doped polyaniline, which consists of localized electron states with dynamically varying occupancy. Therefore, our samples represent an Anderson-Mott insulator in which long-range and short-range CEEIs coexist. The main result of the study is the presence of a crossover between low- and high-T regimes not only in σ (T ) but also in χ (T ) , the crossover temperature T* being essentially the same for both observables over the entire doping range. The relatively large electron localization length along the polymer chains results in U being small, between 12 and 20 meV for the high and low Q , respectively. Therefore, the thermal energy at T* is sufficiently large to lead to an effective closing of the Hubbard gap and the consequent appearance of NNH in the electronic transport within the disorder band. ΔC is considerably larger than U , decreasing from 190 to 30 meV as Q increases, and plays the role of an activation energy in the NNH.

  6. Electronic and optical properties of La-doped S r3I r2O7 epitaxial thin films

    NASA Astrophysics Data System (ADS)

    Souri, M.; Terzic, J.; Johnson, J. M.; Connell, J. G.; Gruenewald, J. H.; Thompson, J.; Brill, J. W.; Hwang, J.; Cao, G.; Seo, A.

    2018-02-01

    We have investigated structural, transport, and optical properties of tensile strained (Sr1-xL ax ) 3I r2O7 (x =0 , 0.025, 0.05) epitaxial thin films. While high-Tc superconductivity is predicted theoretically in the system, we have observed that all of the samples remain insulating with finite optical gap energies and Mott variable-range hopping characteristics in transport. Cross-sectional scanning transmission electron microscopy indicates that structural defects such as stacking faults appear in this system. The insulating behavior of the La-doped S r3I r2O7 thin films is presumably due to disorder-induced localization and ineffective electron doping of La, which brings to light the intriguing difference between epitaxial thin films and bulk single crystals of the iridates.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xian, Fenglin; Department of Electronic Materials Engineering, Research School of Physics and Engineering, The Australian National University, Canberra 2601; Ye, Jiandong, E-mail: yejd@nju.edu.cn

    In this work, anion alloying is engineered in ZnON nanocrystalline films, and the resultant evolution of the structural transition, subgap states, and carrier transport is investigated. A broad distribution of sub-gap states above the valence band maximum is introduced by nitrogen due to the hybridization of N 2p and O 2p orbitals. The phase transition from partially amorphous states to full crystallinity occurs above a characteristic growth temperature of 100 °C, and the localized states are suppressed greatly due to the reduction of nitrogen composition. The electronic properties are dominated by grain boundary scattering and electron transport across boundary barriers throughmore » thermal activation at band edge states at high temperatures. The conductivity below 130 K exhibits a weak temperature dependence, which is a signature of variable-range hopping conduction between localized states introduced by nitrogen incorporation.« less

  8. Characterization of a highly hop-resistant Lactobacillus brevis strain lacking hop transport.

    PubMed

    Behr, Jürgen; Gänzle, Michael G; Vogel, Rudi F

    2006-10-01

    Resistance to hops is a prerequisite for lactic acid bacteria to spoil beer. In this study we analyzed mechanisms of hop resistance of Lactobacillus brevis at the metabolism, membrane physiology, and cell wall composition levels. The beer-spoiling organism L. brevis TMW 1.465 was adapted to high concentrations of hop compounds and compared to a nonadapted strain. Upon adaptation to hops the metabolism changed to minimize ethanol stress. Fructose was used predominantly as a carbon source by the nonadapted strain but served as an electron acceptor upon adaptation to hops, with concomitant formation of acetate instead of ethanol. Furthermore, hop adaptation resulted in higher levels of lipoteichoic acids (LTA) incorporated into the cell wall and altered composition and fluidity of the cytoplasmic membrane. The putative transport protein HitA and enzymes of the arginine deiminase pathway were overexpressed upon hop adaptation. HorA was not expressed, and the transport of hop compounds from the membrane to the extracellular space did not account for increased resistance to hops upon adaptation. Accordingly, hop resistance is a multifactorial dynamic property, which can develop during adaptation. During hop adaptation, arginine catabolism contributes to energy and generation of the proton motive force until a small fraction of the population has established structural improvements. This acquired hop resistance is energy independent and involves an altered cell wall composition. LTA shields the organism from accompanying stresses and provides a reservoir of divalent cations, which are otherwise scarce as a result of their complexation by hop acids. Some of the mechanisms involved in hop resistance overlap with mechanisms of pH resistance and ethanol tolerance and as a result enable beer spoilage by L. brevis.

  9. Magnetoreresistance of carbon nanotube-polypyrrole composite yarns

    NASA Astrophysics Data System (ADS)

    Ghanbari, R.; Ghorbani, S. R.; Arabi, H.; Foroughi, J.

    2018-05-01

    Three types of samples, carbon nanotube yarn and carbon nanotube-polypyrrole composite yarns had been investigated by measurement of the electrical conductivity as a function of temperature and magnetic field. The conductivity was well explained by 3D Mott variable range hopping (VRH) law at T < 100 K. Both positive and negative magnetoresistance (MR) were observed by increasing magnetic field. The MR data were analyzed based a theoretical model. A quadratic positive and negative MR was observed for three samples. It was found that the localization length decreases with applied magnetic field while the density of states increases. The increasing of the density of states induces increasing the number of available energy states for hopping. Thus the electron hopping probability increases in between sites with the shorter distance that results to small the average hopping length.

  10. Dielectric properties of magnetorheological elastomers with different microstructure

    NASA Astrophysics Data System (ADS)

    Moucka, R.; Sedlacik, M.; Cvek, M.

    2018-03-01

    Composite materials containing magnetic particles organised within the polymer matrix by the means of an external magnetic field during the curing process were prepared, and their dielectric properties were compared with their isotropic analogues of the same filler concentration but homogeneous spatial distribution. A substantial dielectric response observed for anisotropic systems in a form of relaxation processes was explained as charge transport via the mechanism of variable range hopping. The changes in registered relaxations' critical frequency and shape of dielectric spectra with the filler concentration were discussed in terms of decreasing anisotropy of the system. The knowledge of the dielectric response of studied systems is essential for their practical applications such as piezoresistive sensors or radio-absorbing materials.

  11. Coulomb gap: how a metal film becomes an insulator

    PubMed

    Butko; DiTusa; Adams

    2000-02-14

    Electron tunneling measurements of the density of states (DOS) in ultrathin Be films reveal that a correlation gap mediates their insulating behavior. In films with sheet resistance R<5000 Omega the correlation singularity appears as the usual perturbative ln(V) zero bias anomaly (ZBA) in the DOS. As R is increased further, however, the ZBA grows and begins to dominate the DOS spectrum. This evolution continues until a nonperturbative |V| Efros-Shklovskii Coulomb gap spectrum finally emerges in the highest R films. Transport measurements of films which display this gap are well described by a universal variable range hopping law R(T) = (h/2e(2))exp(T0/T)(1/2).

  12. Surface quantum oscillations and weak antilocalization effect in topological insulator (Bi0.3Sb0.7)2Te3

    NASA Astrophysics Data System (ADS)

    Urkude, Rajashri; Rawat, Rajeev; Palikundwar, Umesh

    2018-04-01

    In 3D topological insulators, achieving a genuine bulk-insulating state is an important topic of research. The material system (Bi,Sb)2(Te,Se)3 has been proposed as a topological insulator with high resistivity and low carrier concentration. Topological insulators are predicted to present interesting surface transport phenomena but their experimental studies have been hindered by metallic bulk conduction that overwhelms the surface transport. Here we present a study of the bulk-insulating properties of (Bi0.3Sb0.7)2Te3. We show that a high resistivity exceeding 1 Ωm as a result of variable-range hopping behavior of state and Shubnikov-de Haas oscillations as coming from the topological surface state. We have been able to clarify both the bulk and surface transport channels, establishing a comprehensive understanding of the transport properties in this material. Our results demonstrate that (Bi0.3Sb0.7)2Te3 is a good material for studying the surface quantum transport in a topological insulator.

  13. Transport mechanism of reverse surface leakage current in AlGaN/GaN high-electron mobility transistor with SiN passivation

    NASA Astrophysics Data System (ADS)

    Zheng, Xue-Feng; Fan, Shuang; Chen, Yong-He; Kang, Di; Zhang, Jian-Kun; Wang, Chong; Mo, Jiang-Hui; Li, Liang; Ma, Xiao-Hua; Zhang, Jin-Cheng; Hao, Yue

    2015-02-01

    The transport mechanism of reverse surface leakage current in the AlGaN/GaN high-electron mobility transistor (HEMT) becomes one of the most important reliability issues with the downscaling of feature size. In this paper, the research results show that the reverse surface leakage current in AlGaN/GaN HEMT with SiN passivation increases with the enhancement of temperature in the range from 298 K to 423 K. Three possible transport mechanisms are proposed and examined to explain the generation of reverse surface leakage current. By comparing the experimental data with the numerical transport models, it is found that neither Fowler-Nordheim tunneling nor Frenkel-Poole emission can describe the transport of reverse surface leakage current. However, good agreement is found between the experimental data and the two-dimensional variable range hopping (2D-VRH) model. Therefore, it is concluded that the reverse surface leakage current is dominated by the electron hopping through the surface states at the barrier layer. Moreover, the activation energy of surface leakage current is extracted, which is around 0.083 eV. Finally, the SiN passivated HEMT with a high Al composition and a thin AlGaN barrier layer is also studied. It is observed that 2D-VRH still dominates the reverse surface leakage current and the activation energy is around 0.10 eV, which demonstrates that the alteration of the AlGaN barrier layer does not affect the transport mechanism of reverse surface leakage current in this paper. Project supported by the National Natural Science Foundation of China (Grant Nos. 61334002, 61106106, and 61474091), the Opening Project of Science and Technology on Reliability Physics and Application Technology of Electronic Component Laboratory, China (Grant No. ZHD201206), the New Experiment Development Funds for Xidian University, China (Grant No. SY1213), the 111 Project, China (Grant No. B12026), the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry, China, and the Fundamental Research Funds for the Central Universities, China (Grant No. K5051325002).

  14. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  15. Thermally activated charge transport in microbial protein nanowires

    PubMed Central

    Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

    2016-01-01

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors. PMID:27009596

  16. Thermally activated charge transport in microbial protein nanowires

    NASA Astrophysics Data System (ADS)

    Lampa-Pastirk, Sanela; Veazey, Joshua P.; Walsh, Kathleen A.; Feliciano, Gustavo T.; Steidl, Rebecca J.; Tessmer, Stuart H.; Reguera, Gemma

    2016-03-01

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

  17. Thermally activated charge transport in microbial protein nanowires.

    PubMed

    Lampa-Pastirk, Sanela; Veazey, Joshua P; Walsh, Kathleen A; Feliciano, Gustavo T; Steidl, Rebecca J; Tessmer, Stuart H; Reguera, Gemma

    2016-03-24

    The bacterium Geobacter sulfurreducens requires the expression of conductive protein filaments or pili to respire extracellular electron acceptors such as iron oxides and uranium and to wire electroactive biofilms, but the contribution of the protein fiber to charge transport has remained elusive. Here we demonstrate efficient long-range charge transport along individual pili purified free of metal and redox organic cofactors at rates high enough to satisfy the respiratory rates of the cell. Carrier characteristics were within the orders reported for organic semiconductors (mobility) and inorganic nanowires (concentration), and resistivity was within the lower ranges reported for moderately doped silicon nanowires. However, the pilus conductance and the carrier mobility decreased when one of the tyrosines of the predicted axial multistep hopping path was replaced with an alanine. Furthermore, low temperature scanning tunneling microscopy demonstrated the thermal dependence of the differential conductance at the low voltages that operate in biological systems. The results thus provide evidence for thermally activated multistep hopping as the mechanism that allows Geobacter pili to function as protein nanowires between the cell and extracellular electron acceptors.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gallego-Marcos, Fernando; Sánchez, Rafael; Platero, Gloria

    We analyze long-range transport through an ac driven triple quantum dot with a single electron. Resonant transitions between separated and detuned dots are mediated by the exchange of n photons with the time-dependent field. An effective model is proposed in terms of second order (cotunneling) processes which dominate the long-range transport between the edge quantum dots. The ac field renormalizes the inter dot hopping, modifying the level hybridization. It results in a non-trivial behavior of the current with the frequency and amplitude of the external ac field.

  19. Electronic transport in mixed-phase hydrogenated amorphous/nanocrystalline silicon thin films

    NASA Astrophysics Data System (ADS)

    Wienkes, Lee Raymond

    Interest in mixed-phase silicon thin film materials, composed of an amorphous semiconductor matrix in which nanocrystalline inclusions are embedded, stems in part from potential technological applications, including photovoltaic and thin film transistor technologies. Conventional mixed-phase silicon films are produced in a single plasma reactor, where the conditions of the plasma must be precisely tuned, limiting the ability to adjust the film and nanoparticle parameters independently. The films presented in this thesis are deposited using a novel dual-plasma co-deposition approach in which the nanoparticles are produced separately in an upstream reactor and then injected into a secondary reactor where an amorphous silicon film is being grown. The degree of crystallinity and grain sizes of the films are evaluated using Raman spectroscopy and X-ray diffraction respectively. I describe detailed electronic measurements which reveal three distinct conduction mechanisms in n-type doped mixed-phase amorphous/nanocrystalline silicon thin films over a range of nanocrystallite concentrations and temperatures, covering the transition from fully amorphous to ~30% nanocrystalline. As the temperature is varied from 470 to 10 K, we observe activated conduction, multiphonon hopping (MPH) and Mott variable range hopping (VRH) as the nanocrystal content is increased. The transition from MPH to Mott-VRH hopping around 100K is ascribed to the freeze out of the phonon modes. A conduction model involving the parallel contributions of these three distinct conduction mechanisms is shown to describe both the conductivity and the reduced activation energy data to a high accuracy. Additional support is provided by measurements of thermal equilibration effects and noise spectroscopy, both done above room temperature (>300 K). This thesis provides a clear link between measurement and theory in these complex materials.

  20. Grain size effect on the electrical and magneto-transport properties of nanosized Pr0.67Sr0.33MnO3

    NASA Astrophysics Data System (ADS)

    Ng, S. W.; Lim, K. P.; Halim, S. A.; Jumiah, H.

    2018-06-01

    In this study, nanosized of Pr0.67Sr0.33MnO3 prepared via sol-gel method followed by heat treatment at 600-1000 °C in intervals of 100 °C were synthesized. The structure, surface morphology, electrical, magneto-transport and magnetic properties of the samples were investigated. Rietveld refinements of X-ray diffraction patterns confirm that single phase orthorhombic crystal structure with the space group of Pnma (62) is formed at 600 °C. A strong dependence of surface morphology, electrical and magneto-transport properties on grain size have been observed in this manganites system. Both grain size and crystallite size are increases with the sintering temperature due to the congregation effect. Upon increasing grain size, the paramagnetic-ferromagnetic transition temperature increases from 278 K to 295 K. The resistivity drops and the metal-insulator transition temperature shifted from 184 K to 248 K with increases of grain size due to the grain growth and reduction of grain boundary. Below metal-insulator transition temperature, the samples fit well to the combination of resistivity due to grain or domain boundaries, electron-electron scattering process and electron-phonon interaction. The resistivity data above the metal-insulator transition temperature is well described using small polaron hopping and variable range hopping models. It is found that the negative magnetoresistance also increases with larger grain size where the highest %MR of - 26% can be observed for sample sintered at 1000 °C (245 nm).

  1. Metal to insulator transition in Sb doped SnO2 monocrystalline nanowires thin films

    NASA Astrophysics Data System (ADS)

    Costa, I. M.; Bernardo, E. P.; Marangoni, B. S.; Leite, E. R.; Chiquito, A. J.

    2016-12-01

    We report on the growth and transport properties of single crystalline Sb doped SnO2 wires grown from chemical vapour deposition. While undoped samples presented semiconducting behaviour, doped ones clearly undergo a transition from an insulating state ( d R /d T <0 ) to a metallic one ( d R /d T >0 ) around 130 -150 K depending on the doping level. Data analysis in the framework of the metal-to-insulator transition theories allowed us to investigate the underlying physics: electron-electron and electron-phonon interactions were identified as the scattering mechanisms present in the metallic phase, while the conduction mechanism of the semiconducting phase (undoped sample) was characterized by thermal activation and variable range hopping mechanisms.

  2. CONSISTENCY OF FIELD-BASED MEASURES OF NEUROMUSCULAR CONTROL USING FORCE PLATE DIAGNOSTICS IN ELITE MALE YOUTH SOCCER PLAYERS

    PubMed Central

    READ, PAUL; OLIVER, JON L.; DE STE CROIX, MARK B.A.; MYER, GREGORY D.; LLOYD, RHODRI S.

    2016-01-01

    Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players and reliability data is sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force plate diagnostics in this cohort. Twenty six pre-peak height velocity (PHV) and twenty five post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single leg 75% horizontal hop and stick (75%HOP) and single leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilisation (TTS), time to pVGRF, and pVGRF asymmetry were recorded. A test, re-test design was used and reliability statistics included: change in mean, intraclass correlation coefficient (ICC) and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the three protocols (CV range = 13.8 – 49.7%). ICC values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be utilized to support a screening battery for elite male youth soccer players and for test re-test comparison. PMID:27075641

  3. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed

    Moritz, Chet T; Farley, Claire T

    2003-08-22

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain.

  4. Human hopping on damped surfaces: strategies for adjusting leg mechanics.

    PubMed Central

    Moritz, Chet T; Farley, Claire T

    2003-01-01

    Fast-moving legged animals bounce along the ground with spring-like legs and agilely traverse variable terrain. Previous research has shown that hopping and running humans maintain the same bouncing movement of the body's centre of mass on a range of elastic surfaces by adjusting their spring-like legs to exactly offset changes in surface stiffness. This study investigated human hopping on damped surfaces that dissipated up to 72% of the hopper's mechanical energy. On these surfaces, the legs did not act like pure springs. Leg muscles performed up to 24-fold more net work to replace the energy lost by the damped surface. However, considering the leg and surface together, the combination appeared to behave like a constant stiffness spring on all damped surfaces. By conserving the mechanics of the leg-surface combination regardless of surface damping, hoppers also conserved centre-of-mass motions. Thus, the normal bouncing movements of the centre of mass in hopping are not always a direct result of spring-like leg behaviour. Conserving the trajectory of the centre of mass by maintaining spring-like mechanics of the leg-surface combination may be an important control strategy for fast-legged locomotion on variable terrain. PMID:12965003

  5. The influence of oxidation time on the properties of oxidized zinc films

    NASA Astrophysics Data System (ADS)

    Rambu, A. P.

    2012-09-01

    The effect of oxidation time on the structural characteristics and electronic transport mechanism of zinc oxide thin films prepared by thermal oxidation, have been investigated. Zinc metallic films were deposited by thermal evaporation under vacuum, the subsequent oxidation of Zn films being carried out in open atmosphere. XRD and AFM analysis indicate that obtained films posses a polycrystalline structure, the crystallites having a preferential orientation. Structural analysis reveals that microstructure of the films (crystallite size, surface roughness, internal stress) is depending on the oxidation time of metallic films. The electrical behavior of ZnO films was investigated, during a heat treatment (two heating/cooling cycles). It was observed that after the first heating, the temperature dependences of electrical conductivity become reversible. Mott variable range hopping model was proposed to analyze the temperature dependence of the electrical conductivity, in low temperature ranges. Values of some characteristic parameters were calculated.

  6. Impact of Space-Charge Layers on Sudden Death in Li/O2 Batteries.

    PubMed

    Radin, Maxwell D; Monroe, Charles W; Siegel, Donald J

    2015-08-06

    The performance of Li/O2 batteries is thought to be limited by charge transport through the solid Li2O2 discharge product. Prior studies suggest that electron tunneling is the main transport mechanism through thin, compact Li2O2 deposits. The present study employs a new continuum transport model to explore an alternative scenario, in which charge transport is mediated by polaron hopping. Unlike earlier models, which assume a uniform carrier concentration or local electroneutrality, the possibility of nonuniform space charge is accounted for at the Li2O2/electrolyte and Li2O2/electrode interfaces, providing a more realistic picture of transport in Li2O2 films. The temperature and current-density dependences of the discharge curves predicted by the model are in good agreement with flat-electrode experiments over a wide range of rates, supporting the hypothesis that polaron hopping contributes significantly to charge transport. Exercising the model suggests that this mechanism could explain the observed enhancement in cell performance at elevated temperature and that performance could be further improved by tuning the interfacial orientation of Li2O2 crystallites.

  7. The lunar hopping transporter

    NASA Technical Reports Server (NTRS)

    Degner, R.; Kaplan, M. H.; Manning, J.; Meetin, R.; Pasternack, S.; Peterson, S.; Seifert, H.

    1971-01-01

    Research on several aspects of lunar transport using the hopping mode is reported. Hopping exploits the weak lunar gravity, permits fuel economy because of partial recompression of propellant gas on landing, and does not require a continuous smooth surface for operation. Three questions critical to the design of a lunar hopping vehicle are addressed directly in this report: (1) the tolerance of a human pilot for repeated accelerations; (2) means for controlling vehicle attitude during ballistic flight; and (3) means of propulsion. In addition, a small scale terrestrial demonstrator built to confirm feasibility of the proposed operational mode is described, along with results of preliminary study of unmanned hoppers for moon exploration.

  8. Frequency effects on charge ordering in Y0.5Ca0.5MnO3 by impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Sarwar, Tuba; Qamar, Afzaal; Nadeem, Muhammad

    2015-02-01

    In this work, structural and electrical properties of Y0.5Ca0.5MnO3 are investigated by employing X-ray diffraction and impedance spectroscopy, respectively. Applied ac electric field showed the charge ordering transition temperature around 265 K and below this temperature the heteromorphic behavior of the sample is discussed in the proximity of TCO. With frequency effects the volume of robust charge orbital ordering (COO) domains diminishes due to different competing phases along with Jahn Teller distortions. Comprehensive melting and collapse of charge orbital ordering occurs below TN(125 K), where a colossal drop in the value of impedance is observed. The change in profile of modulus plane plots determines the spreading of relaxation time of intermingled phases. Hopping mechanism is elaborated in terms of strong electron phonon coupling. Variable range hopping model and Arrhenius model are used to discuss the short and long range hopping between Mn3+ and Mn4+ channels assessing the activation energy Ea.

  9. Highly Oriented Atomically Thin Ambipolar MoSe2 Grown by Molecular Beam Epitaxy

    PubMed Central

    2017-01-01

    Transition metal dichalcogenides (TMDCs), together with other two-dimensional (2D) materials, have attracted great interest due to the unique optical and electrical properties of atomically thin layers. In order to fulfill their potential, developing large-area growth and understanding the properties of TMDCs have become crucial. Here, we have used molecular beam epitaxy (MBE) to grow atomically thin MoSe2 on GaAs(111)B. No intermediate compounds were detected at the interface of as-grown films. Careful optimization of the growth temperature can result in the growth of highly aligned films with only two possible crystalline orientations due to broken inversion symmetry. As-grown films can be transferred onto insulating substrates, allowing their optical and electrical properties to be probed. By using polymer electrolyte gating, we have achieved ambipolar transport in MBE-grown MoSe2. The temperature-dependent transport characteristics can be explained by the 2D variable-range hopping (2D-VRH) model, indicating that the transport is strongly limited by the disorder in the film. PMID:28530829

  10. Tunable electronic properties of graphene through controlling bonding configurations of doped nitrogen atoms.

    PubMed

    Zhang, Jia; Zhao, Chao; Liu, Na; Zhang, Huanxi; Liu, Jingjing; Fu, Yong Qing; Guo, Bin; Wang, Zhenlong; Lei, Shengbin; Hu, PingAn

    2016-06-21

    Single-layer and mono-component doped graphene is a crucial platform for a better understanding of the relationship between its intrinsic electronic properties and atomic bonding configurations. Large-scale doped graphene films dominated with graphitic nitrogen (GG) or pyrrolic nitrogen (PG) were synthesized on Cu foils via a free radical reaction at growth temperatures of 230-300 °C and 400-600 °C, respectively. The bonding configurations of N atoms in the graphene lattices were controlled through reaction temperature, and characterized using Raman spectroscopy, X-ray photoelectron spectroscopy and scanning tunneling microscope. The GG exhibited a strong n-type doping behavior, whereas the PG showed a weak n-type doping behavior. Electron mobilities of the GG and PG were in the range of 80.1-340 cm(2) V(-1)·s(-1) and 59.3-160.6 cm(2) V(-1)·s(-1), respectively. The enhanced doping effect caused by graphitic nitrogen in the GG produced an asymmetry electron-hole transport characteristic, indicating that the long-range scattering (ionized impurities) plays an important role in determining the carrier transport behavior. Analysis of temperature dependent conductance showed that the carrier transport mechanism in the GG was thermal excitation, whereas that in the PG, was a combination of thermal excitation and variable range hopping.

  11. Tunable electronic properties of graphene through controlling bonding configurations of doped nitrogen atoms

    PubMed Central

    Zhang, Jia; Zhao, Chao; Liu, Na; Zhang, Huanxi; Liu, Jingjing; Fu, Yong Qing; Guo, Bin; Wang, Zhenlong; Lei, Shengbin; Hu, PingAn

    2016-01-01

    Single–layer and mono–component doped graphene is a crucial platform for a better understanding of the relationship between its intrinsic electronic properties and atomic bonding configurations. Large–scale doped graphene films dominated with graphitic nitrogen (GG) or pyrrolic nitrogen (PG) were synthesized on Cu foils via a free radical reaction at growth temperatures of 230–300 °C and 400–600 °C, respectively. The bonding configurations of N atoms in the graphene lattices were controlled through reaction temperature, and characterized using Raman spectroscopy, X–ray photoelectron spectroscopy and scanning tunneling microscope. The GG exhibited a strong n–type doping behavior, whereas the PG showed a weak n–type doping behavior. Electron mobilities of the GG and PG were in the range of 80.1–340 cm2 V−1·s−1 and 59.3–160.6 cm2 V−1·s−1, respectively. The enhanced doping effect caused by graphitic nitrogen in the GG produced an asymmetry electron–hole transport characteristic, indicating that the long–range scattering (ionized impurities) plays an important role in determining the carrier transport behavior. Analysis of temperature dependent conductance showed that the carrier transport mechanism in the GG was thermal excitation, whereas that in the PG, was a combination of thermal excitation and variable range hopping. PMID:27325386

  12. Perfect quantum excitation energy transport via single edge perturbation in a complete network

    NASA Astrophysics Data System (ADS)

    Bassereh, Hassan; Salari, Vahid; Shahbazi, Farhad; Ala-Nissila, Tapio

    2017-06-01

    We consider quantum excitation energy transport (EET) in a network of two-state nodes in the Markovian approximation by employing the Lindblad formulation. We find that EET from an initial site, where the excitation is inserted to the sink, is generally inefficient due to the inhibition of transport by localization of the excitation wave packet in a symmetric, fully-connected network. We demonstrate that the EET efficiency can be significantly increased up to ≈100% by perturbing hopping transport between the initial node and the one connected directly to the sink, while the rate of energy transport is highest at a finite value of the hopping parameter. We also show that prohibiting hopping between the other nodes which are not directly linked to the sink does not improve the efficiency. We show that external dephasing noise in the network plays a constructive role for EET in the presence of localization in the network, while in the absence of localization it reduces the efficiency of EET. We also consider the influence of off-diagonal disorder in the hopping parameters of the network.

  13. Magneto-transport of highly conductive carbon nanotube assemblies under high-field

    NASA Astrophysics Data System (ADS)

    Bulmer, John; Lekawa-Raus, Agnieszka; Koziol, Krzysztof; ECNM Group Team

    2014-03-01

    The magneto-transport response of carbon nanotube (CNT) assemblies has a resistance decrease with magnetic field, which is typically followed by a resistance increase with higher field. These negative and positive components of the magneto-resistance are from, respectively, suppression of weak localization and suppression of inter-tube coupling brought on by the magnetic restriction of the electron wave function. Recently, highly conductive CNT films, which were either doped or enriched with metallic chiralities, showed only a decrease in resistance with field and indicate that the extent of carrier delocalization is beyond individual CNTs. These magneto-transport measurements, however, were no greater then approximately 12 T and it is not clear when or if the magneto-resistance will go positive. In this study we prepared highly conductive single wall CNT films that have been either heavily doped, enriched with metallic chiralities, highly aligned, or a combination of these three. The magneto-resistance was measured up to 65 T with temperatures down to 2 K. The most metallic-like samples had the greatest delay in the positive magneto-resistance upturn. Fluctuation induced tunneling, variable range hopping, and weak localization models were each considered to quantitatively evaluate the transport behavior. http://www.kkoziol.org/index.html

  14. Electronic and transport properties of Li-doped NiO epitaxial thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, J. Y.; Li, W. W.; Hoye, R. L. Z.

    NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. Understanding and improving its optical and transport properties have been of considerable interest. In this work, we have investigated the effect of Li doping on the electronic, optical and transport properties of NiO epitaxial thin films grown by pulsed laser deposition. We show that Li doping significantly increases the p-type conductivity of NiO, but all the films have relatively low room-temperature mobilities (<0.05 cm2 V -1s -1). The conduction mechanism is better described by small-polaron hoping model in the temperaturemore » range of 200 K < T <330 K, and variable range hopping at T <200 K. A combination of x-ray photoemission and O K-edge x-ray absorption spectroscopic investigations reveal that the Fermi level gradually shifts toward the valence band maximum (VBM) and a new hole state develops with Li doping. Both the VBM and hole states are composed of primarily Zhang-Rice bound states, which accounts for the small polaron character (low mobility) of hole conduction. Our work provides guidelines for the search for p-type oxide materials and device optimization.NiO is a p-type wide bandgap semiconductor of use in various electronic devices ranging from solar cells to transparent transistors. This work reports the controlling of conductivity and increase of work functions by Li doping.« less

  15. Etching-free patterning method for electrical characterization of atomically thin MoSe2 films grown by chemical vapor deposition

    NASA Astrophysics Data System (ADS)

    Utama, M. Iqbal Bakti; Lu, Xin; Zhan, Da; Ha, Son Tung; Yuan, Yanwen; Shen, Zexiang; Xiong, Qihua

    2014-10-01

    Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures.Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures. Electronic supplementary information (ESI) available: Further experiments on patterning and additional electrical characterizations data. See DOI: 10.1039/c4nr03817g

  16. Consistency of Field-Based Measures of Neuromuscular Control Using Force-Plate Diagnostics in Elite Male Youth Soccer Players.

    PubMed

    Read, Paul J; Oliver, Jon L; Croix, Mark Ba De Ste; Myer, Gregory D; Lloyd, Rhodri S

    2016-12-01

    Read, P, Oliver, JL, Croix, MD, Myer, GD, and Lloyd, RS. Consistency of field-based measures of neuromuscular control using force-plate diagnostics in elite male youth soccer players. J Strength Cond Res 30(12): 3304-3311, 2016-Deficits in neuromuscular control during movement patterns such as landing are suggested pathomechanics that underlie sport-related injury. A common mode of assessment is measurement of landing forces during jumping tasks; however, these measures have been used less frequently in male youth soccer players, and reliability data are sparse. The aim of this study was to examine the reliability of a field-based neuromuscular control screening battery using force-plate diagnostics in this cohort. Twenty-six pre-peak height velocity (PHV) and 25 post-PHV elite male youth soccer players completed a drop vertical jump (DVJ), single-leg 75% horizontal hop and stick (75%HOP), and single-leg countermovement jump (SLCMJ). Measures of peak landing vertical ground reaction force (pVGRF), time to stabilization, time to pVGRF, and pVGRF asymmetry were recorded. A test-retest design was used, and reliability statistics included change in mean, intraclass correlation coefficient, and coefficient of variation (CV). No significant differences in mean score were reported for any of the assessed variables between test sessions. In both groups, pVGRF and asymmetry during the 75%HOP and SLCMJ demonstrated largely acceptable reliability (CV ≤ 10%). Greater variability was evident in DVJ pVGRF and all other assessed variables, across the 3 protocols (CV range = 13.8-49.7%). Intraclass correlation coefficient values ranged from small to large and were generally higher in the post-PHV players. The results of this study suggest that pVGRF and asymmetry can be reliably assessed using a 75%HOP and SLCMJ in this cohort. These measures could be used to support a screening battery for elite male youth soccer players and for test-retest comparison.

  17. The Number of Trials Required to Obtain a Representative Movement Pattern During a Hurdle Hop Exercise.

    PubMed

    Gore, Shane J; Marshall, Brendan M; Franklyn-Miller, Andrew D; Falvey, Eanna C; Moran, Kieran A

    2016-06-01

    When reporting a subject's mean movement pattern, it is important to ensure that reported values are representative of the subject's typical movement. While previous studies have used the mean of 3 trials, scientific justification of this number is lacking. One approach is to determine statistically how many trials are required to achieve a representative mean. This study compared 4 methods of calculating the number of trials required in a hopping movement to achieve a representative mean. Fifteen males completed 15 trials of a lateral hurdle hop. Range of motion at the trunk, pelvis, hip, knee, and ankle, in addition to peak moments for the latter 3 joints were examined. The number of trials required was computed using a peak intraclass correlation coefficient method, sequential analysis with a bandwidth of acceptable variance in the mean, and a novel method based on the standard error of measurement (SEMind). The number of trials required across all variables ranged from 2 to 12 depending on method, joint, and anatomical plane. The authors advocate the SEMind method as it demonstrated fewer limitations than the other methods. Using the SEMind, the required number of trials for a representative mean during the lateral hurdle hop is 6.

  18. Transport and magnetic properties of Fe doped CaMnO3

    NASA Astrophysics Data System (ADS)

    Neetika; Das, A.; Dhiman, I.; Nigam, A. K.; Yadav, A. K.; Bhattacharyya, D.; Meena, S. S.

    2012-12-01

    The structural, transport, and magnetic properties of CaMn1-xFexO3-δ (0.0 ≤ x ≤ 0.3) have been studied by using resistivity, magnetization, and neutron powder diffraction techniques. The compounds are found to be isostructural and crystallize in GdFeO3-type orthorhombic structure (space group Pnma). With Fe doping, no structural change is observed. Mössbauer and paramagnetic susceptibility measurements show that Fe substitutes in 4+ valence state, and XANES measurements indicate the presence of mixed valence state of Mn. The compounds exhibit insulating behavior in the studied temperature range. The temperature dependence of resistivity is found to be described by small polaron model for x = 0 and variable range hopping model for x = 0.1. For higher x values, it follows a parallel combination resistance model. A small reduction in TN from 120 K to 100 K with increase in x is found. The magnetic structure changes from Gz-type collinear antiferromagnetic (AFM) structure for x = 0.0 to canted AFM structure GZFY-type for Fe doped compounds. The AFM component of the moment progressively decreases with x while FM component exhibits a maximum at x = 0.2.

  19. Charge Carrier Hopping Dynamics in Homogeneously Broadened PbS Quantum Dot Solids.

    PubMed

    Gilmore, Rachel H; Lee, Elizabeth M Y; Weidman, Mark C; Willard, Adam P; Tisdale, William A

    2017-02-08

    Energetic disorder in quantum dot solids adversely impacts charge carrier transport in quantum dot solar cells and electronic devices. Here, we use ultrafast transient absorption spectroscopy to show that homogeneously broadened PbS quantum dot arrays (σ hom 2 :σ inh 2 > 19:1, σ inh /k B T < 0.4) can be realized if quantum dot batches are sufficiently monodisperse (δ ≲ 3.3%). The homogeneous line width is found to be an inverse function of quantum dot size, monotonically increasing from ∼25 meV for the largest quantum dots (5.8 nm diameter/0.92 eV energy) to ∼55 meV for the smallest (4.1 nm/1.3 eV energy). Furthermore, we show that intrinsic charge carrier hopping rates are faster for smaller quantum dots. This finding is the opposite of the mobility trend commonly observed in device measurements but is consistent with theoretical predictions. Fitting our data to a kinetic Monte Carlo model, we extract charge carrier hopping times ranging from 80 ps for the smallest quantum dots to over 1 ns for the largest, with the same ethanethiol ligand treatment. Additionally, we make the surprising observation that, in slightly polydisperse (δ ≲ 4%) quantum dot solids, structural disorder has a greater impact than energetic disorder in inhibiting charge carrier transport. These findings emphasize how small improvements in batch size dispersity can have a dramatic impact on intrinsic charge carrier hopping behavior and will stimulate further improvements in quantum dot device performance.

  20. Study of Exciton Hopping Transport in PbS Colloidal Quantum Dot Thin Films Using Frequency- and Temperature-Scanned Photocarrier Radiometry

    NASA Astrophysics Data System (ADS)

    Hu, Lilei; Mandelis, Andreas; Melnikov, Alexander; Lan, Xinzheng; Hoogland, Sjoerd; Sargent, Edward H.

    2017-01-01

    Solution-processed colloidal quantum dots (CQDs) are promising materials for realizing low-cost, large-area, and flexible photovoltaic devices. The study of charge carrier transport in quantum dot solids is essential for understanding energy conversion mechanisms. Recently, solution-processed two-layer oleic-acid-capped PbS CQD solar cells with one layer treated with tetrabutylammonium iodide (TBAI) serving as the main light-absorbing layer and the other treated with 1,2-ethanedithiol (EDT) acting as an electron-blocking/hole-extraction layer were reported. These solar cells demonstrated a significant improvement in power conversion efficiency of 8.55% and long-term air stability. Coupled with photocarrier radiometry measurements, this work used a new trap-state mediated exciton hopping transport model, specifically for CQD thin films, to unveil and quantify exciton transport mechanisms through the extraction of hopping transport parameters including exciton lifetimes, hopping diffusivity, exciton detrapping time, and trap-state density. It is shown that PbS-TBAI has higher trap-state density than PbS-EDT that results in higher PbS-EDT exciton lifetimes. Hopping diffusivities of both CQD thin film types show similar temperature dependence, particularly higher temperatures yield higher hopping diffusivity. The higher diffusivity of PbS-TBAI compared with PbS-EDT indicates that PbS-TBAI is a much better photovoltaic material than PbS-EDT. Furthermore, PCR temperature spectra and deep-level photothermal spectroscopy provided additional insights to CQD surface trap states: PbS-TBAI thin films exhibit a single dominant trap level, while PbS-EDT films with lower trap-state densities show multiple trap levels.

  1. Random walk numerical simulation for hopping transport at finite carrier concentrations: diffusion coefficient and transport energy concept.

    PubMed

    Gonzalez-Vazquez, J P; Anta, Juan A; Bisquert, Juan

    2009-11-28

    The random walk numerical simulation (RWNS) method is used to compute diffusion coefficients for hopping transport in a fully disordered medium at finite carrier concentrations. We use Miller-Abrahams jumping rates and an exponential distribution of energies to compute the hopping times in the random walk simulation. The computed diffusion coefficient shows an exponential dependence with respect to Fermi-level and Arrhenius behavior with respect to temperature. This result indicates that there is a well-defined transport level implicit to the system dynamics. To establish the origin of this transport level we construct histograms to monitor the energies of the most visited sites. In addition, we construct "corrected" histograms where backward moves are removed. Since these moves do not contribute to transport, these histograms provide a better estimation of the effective transport level energy. The analysis of this concept in connection with the Fermi-level dependence of the diffusion coefficient and the regime of interest for the functioning of dye-sensitised solar cells is thoroughly discussed.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Emin, David, E-mail: emin@unm.edu

    Charge carriers that execute multi-phonon hopping generally interact strongly enough with phonons to form polarons. A polaron's sluggish motion is linked to slowly shifting atomic displacements that severely reduce the intrinsic width of its transport band. Here a means to estimate hopping polarons' bandwidths from Seebeck-coefficient measurements is described. The magnitudes of semiconductors' Seebeck coefficients are usually quite large (>k/|q| = 86 μV/K) near room temperature. However, in accord with the third law of thermodynamics, Seebeck coefficients must vanish at absolute zero. Here, the transition of the Seebeck coefficient of hopping polarons to its low-temperature regime is investigated. The temperature and sharpness ofmore » this transition depend on the concentration of carriers and on the width of their transport band. This feature provides a means of estimating the width of a polaron's transport band. Since the intrinsic broadening of polaron bands is very small, less than the characteristic phonon energy, the net widths of polaron transport bands in disordered semiconductors approach the energetic disorder experienced by their hopping carriers, their disorder energy.« less

  3. Controlling charge transport mechanisms in molecular junctions: Distilling thermally induced hopping from coherent-resonant conduction.

    PubMed

    Kim, Hyehwang; Segal, Dvira

    2017-04-28

    The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.

  4. Hopper on wheels: evolving the hopping robot concept

    NASA Technical Reports Server (NTRS)

    Schell, S.; Tretten, A.; Burdick, J.; Fuller, S. B.; Fiorini, P.

    2001-01-01

    This paper describes the evolution of our concept of hopping robot for planetary exploration, that combines coarse long range mobility achieved by hopping, with short range wheeled mobility for precision target acquisition.

  5. Molecular cloning of a putative divalent-cation transporter gene as a new genetic marker for the identification of Lactobacillus brevis strains capable of growing in beer.

    PubMed

    Hayashi, N; Ito, M; Horiike, S; Taguchi, H

    2001-05-01

    Random amplified polymorphic DNA (RAPD) PCR analysis of Lactobacillus brevis isolates from breweries revealed that one of the random primers could distinguish beer-spoilage strains of L. brevis from nonspoilage strains. The 1.1-kb DNA fragment amplified from all beer-spoilers included one open reading frame, termed hitA (hop-inducible cation transporter), which encodes an integral membrane protein with 11 putative trans-membrane domains and a binding protein-dependent transport signature of a non-ATP binding membrane transporter common to several prokaryotic and eukaryotic transporters. The hitA polypeptide is homologous to the natural resistance-associated macrophage protein (Nramp) family characterized as divalent-cation transport proteins in many prokaryotic and eukaryotic organisms. Northern blot analysis indicated that the hitA transcripts are expressed in cells cultivated in MRS broth supplemented with hop bitter compounds, which act as mobile-carrier ionophores, dissipating the trans-membrane pH gradient in bacteria sensitive to the hop bitter compounds by exchanging H+ for cellular divalent cations such as Mn2+. This suggests that the hitA gene products may play an important role in making the bacteria resistant to hop bitter compounds in beer by transporting metal ions such as Mn2+ into cells that no longer maintain the proton gradient.

  6. Gold nanoparticle assemblies stabilized by bis(phthalocyaninato)lanthanide(III) complexes through van der Waals interactions

    NASA Astrophysics Data System (ADS)

    Noda, Yuki; Noro, Shin-Ichiro; Akutagawa, Tomoyuki; Nakamura, Takayoshi

    2014-01-01

    Gold nanoparticle assemblies possess diverse application potential, ranging from industrial nanotechnology to medical biotechnology. Because the structures and properties of assemblies are directly affected by the stabilization mechanism between the organic molecules serving as protecting ligands and the gold nanoparticle surface, it is crucial to find and investigate new stabilization mechanisms. Here, we report that π-conjugated phthalocyanine rings can serve as stabilizing ligands for gold nanoparticles. Bis(phthalocyaninato)lutetium(III) (LuPc2) or bis(phthalocyaninato)terbium(III) (TbPc2), even though complex, do not have specific binding units and stabilize gold nanoparticles through van der Waals interaction between parallel adsorbed phthalocyanine ligands and the gold nanoparticle surface. AC magnetic measurements and the electron-transport properties of the assemblies give direct evidence that the phthalocyanines are isolated from each other. Each nanoparticle shows weak electronic coupling despite the short internanoparticle distance (~1 nm), suggesting Efros-Shklovskii-type variable-range hopping and collective single-electron tunnelling behaviours.

  7. Colossal permittivity and the polarization mechanism of (Mg, Mn) co-doped LaGaO3 ceramics

    NASA Astrophysics Data System (ADS)

    Luo, Tingting; Liu, Zhifu; Zhang, Faqiang; Li, Yongxiang

    2018-03-01

    Mg and Mn co-doped LaGa0.7-xMgxMn0.3O3 (x = 0, 0.05, 0.10, 0.15) ceramics were prepared by a solid-state reaction method. The electrical properties of the LaGa0.7-xMgxMn0.3O3 ceramics were studied in detail by dielectric spectra, impedance spectra, and I-V characteristic analysis. Colossal permittivity up to 104 could be obtained across the frequency range up to 104 Hz. The impedance analysis of the co-doped LaGaO3 ceramics indicated that the Mott's variable range hopping (VRH) polarization should be the main origin of colossal permittivity. Mg and Mn co-doping suppressed the formation of Mn3+ and enhanced the VRH polarization, resulting in increased permittivity. Partial localization of electrons by Mg reduced the long-range electron hopping and led to the decrease in dielectric loss.

  8. Charge relaxation and dynamics in organic semiconductors

    NASA Astrophysics Data System (ADS)

    Kwok, H. L.

    2006-08-01

    Charge relaxation in dispersive materials is often described in terms of the stretched exponential function (Kohlrausch law). The process can be explained using a "hopping" model which in principle, also applies to charge transport such as current conduction. This work analyzed reported transient photoconductivity data on functionalized pentacene single crystals using a geometric hopping model developed by B. Sturman et al and extracted values (or range of values) on the materials parameters relevant to charge relaxation as well as charge transport. Using the correlated disorder model (CDM), we estimated values of the carrier mobility for the pentacene samples. From these results, we observed the following: i) the transport site density appeared to be of the same order of magnitude as the carrier density; ii) it was possible to extract lower bound values on the materials parameters linked to the transport process; and iii) by matching the simulated charge decay to the transient photoconductivity data, we were able to refine estimates on the materials parameters. The data also allowed us to simulate the stretched exponential decay. Our observations suggested that the stretching index and the carrier mobility were related. Physically, such interdependence would allow one to demarcate between localized molecular interactions and distant coulomb interactions.

  9. Tailorable Exciton Transport in Doped Peptide–Amphiphile Assemblies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solomon, Lee A.; Sykes, Matthew E.; Wu, Yimin A.

    Light-harvesting biomaterials are an attractive target in photovoltaics, photocatalysis, and artificial photosynthesis. Through peptide self-assembly, complex nanostructures can be engineered to study the role of chromophore organization during light absorption and energy transport. To this end, we demonstrate the one-dimensional transport of excitons along naturally occurring, light-harvesting, Zn-protoporphyrin IX chromophores within self-assembled peptide-amphiphile nanofibers. The internal structure of the nanofibers induces packing of the porphyrins into linear chains. We find that this peptide assembly can enable long-range exciton diffusion, yet it also induces the formation of excimers between adjacent molecules, which serve as exciton traps. Electronic coupling between neighboring porphyrinmore » molecules is confirmed by various spectroscopic methods. The exciton diffusion process is then probed through transient photoluminescence and absorption measurements and fit to a model for one-dimensional hopping. Because excimer formation impedes exciton hopping, increasing the interchromophore spacing allows for improved diffusivity, which we control through porphyrin doping levels. We show that diffusion lengths of over 60 nm are possible at low porphyrin doping, representing an order of magnitude improvement over the highest doping fractions.« less

  10. Tailorable Exciton Transport in Doped Peptide-Amphiphile Assemblies.

    PubMed

    Solomon, Lee A; Sykes, Matthew E; Wu, Yimin A; Schaller, Richard D; Wiederrecht, Gary P; Fry, H Christopher

    2017-09-26

    Light-harvesting biomaterials are an attractive target in photovoltaics, photocatalysis, and artificial photosynthesis. Through peptide self-assembly, complex nanostructures can be engineered to study the role of chromophore organization during light absorption and energy transport. To this end, we demonstrate the one-dimensional transport of excitons along naturally occurring, light-harvesting, Zn-protoporphyrin IX chromophores within self-assembled peptide-amphiphile nanofibers. The internal structure of the nanofibers induces packing of the porphyrins into linear chains. We find that this peptide assembly can enable long-range exciton diffusion, yet it also induces the formation of excimers between adjacent molecules, which serve as exciton traps. Electronic coupling between neighboring porphyrin molecules is confirmed by various spectroscopic methods. The exciton diffusion process is then probed through transient photoluminescence and absorption measurements and fit to a model for one-dimensional hopping. Because excimer formation impedes exciton hopping, increasing the interchromophore spacing allows for improved diffusivity, which we control through porphyrin doping levels. We show that diffusion lengths of over 60 nm are possible at low porphyrin doping, representing an order of magnitude improvement over the highest doping fractions.

  11. Characteristics of dielectric properties and conduction mechanism of TlInS2:Cu single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Zaidia, E. F. M.

    2013-12-01

    Single crystals of TlInS2:Cu were grown by the modified Bridgman method. The dielectric behavior of TlInS2:Cu was investigated using the impedance spectroscopy technique. The real (ε1), imaginary (ε2) parts of complex dielectric permittivity and ac conductivity were measured in the frequency range (42-2×105) Hz with a variation of temperature in the range from 291 K to 483 K. The impedance data were presented in Nyquist diagrams for different temperatures. The frequency dependence of σtot (ω) follows the Jonscher's universal dynamic law with the relation σtot (ω)=σdc+Aωs, (where s is the frequency exponent). The mechanism of the ac charge transport across the layers of TlInS2:Cu single crystals was referred to the hopping over localized states near the Fermi level. The examined system exhibits temperature dependence of σac (ω), which showed a linear increase with the increase in temperature at different frequencies. Some parameters were calculated as: the density of localized states near the Fermi level, NF, the average time of charge carrier hopping between localized states, τ, and the average hopping distance, R.

  12. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

    PubMed

    Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

    2016-04-15

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

  13. Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

    PubMed Central

    Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

    2016-01-01

    Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

  14. Balancing the competing requirements of saltatorial and fossorial specialisation: burrowing costs in the spinifex hopping mouse, Notomys alexis.

    PubMed

    White, Craig R; Matthews, Philip G D; Seymour, Roger S

    2006-06-01

    Semi-fossorial animals (burrowing surface foragers) need to balance the competing morphological requirements of terrestrial and burrowing locomotion. These species rarely show the same degree of claw, forelimb and pectoral girdle structural development that fully fossorial forms (burrowing subterranean foragers) do, but nevertheless invest considerable amounts of energy in burrow systems. The compromise between terrestrial and burrowing locomotion was investigated by measuring net costs of burrowing and pedestrian transport in the spinifex hopping mouse, Notomys alexis, a species that forages in open areas in arid environments and is adapted for saltatorial locomotion. The net cost of transport by burrowing of hopping mice was found to be more expensive than for specialised fossorial species, and burrows were estimated to represent an energy investment equivalent to the terrestrial locomotion expected to be incurred in 17-100 days. A phylogenetically independent-contrasts approach revealed that morphological specialisation for burrowing was associated with low maximum running speeds in fossorial mammals and, for non-fossorial rodents and marsupials, maximum running speed was positively correlated with an index of habitat structure that ranged from arboreal to open desert. The high terrestrial speeds attainable by this semi-fossorial species by saltatory locomotion apparently outweigh the energetic savings that would be associated with burrowing specialisation.

  15. The acute effects of heavy back squats on mechanical variables during a series of bilateral hops.

    PubMed

    Moir, Gavin L; Dale, Jonathan R; Dietrich, Wendy W

    2009-07-01

    The purpose of the present study was to investigate the acute effects of performing a heavy resistance exercise (HRE) protocol on the mechanical variables during a series of bilateral hops. In a block-randomized design, 10 strength trained men performed an HRE or a control treatment before performing 5 series of bilateral hops separated by 2 minutes of passive recovery. Each series of bilateral hops was performed for 15 seconds on a force platform with the subject hopping at a frequency of 2.0 Hz. From the vertical force trace, the vertical force during the countermovement phase of each hop, the negative displacement during the countermovement phase, and the vertical stiffness were calculated. The HRE treatment consisted of performing parallel back squats with 40, 50, 60, and 80% of each subject's 1-repetition maximum after a series of dynamic stretches. The control treatment consisted of the dynamic stretches only. No significant differences in any of the mechanical variables were reported after the 2 treatments (p > 0.05). There were no significant correlations between the absolute maximal strength values and the percent change in any of the mechanical variables after the 2 treatments. Despite the lack of significant changes reported for the group, there were some notable individual responses. It is possible that increases in vertical stiffness during bilateral hops can be achieved after an HRE protocol in certain individuals. However, practitioners should be aware of the specificity issues and the individual nature of the responses to such protocols.

  16. Evolution of structural, electronic and magneto-transport properties of Sr2Ir1-xTixO4 5d based oxide

    NASA Astrophysics Data System (ADS)

    Bhatti, Imtiaz Noor; Pramanik, A. K.

    2018-05-01

    To investigate the effect of chemical doping on structural and transport properties in Sr2IrO4, in this study we have doped Ti4+ (3d0) at Ir4+ (5d5) site. Thus Ti doping introduces hole in the electronic band moreover, it also weaken the spin orbital coupling (SOC) and enhance electronic correlation (U). We have prepared the polycrystalline samples of Sr2Ir1-xTixO4 with x = 0.0 0.05 and 0.10 with solid state reaction method. Single phase and chemically pure samples were obtained. All samples crystalizes in tetragonal structure and I41/acd symmetry. The structural analysis shows the evolution of lattice parameter with doping. The temperature dependent resistivity is measured using four probe technique down in the temperature range 5 K-300 K. The resistivity increases with Ti doping. Temperature dependency of resistivity is explained by thermal activated 2-dimensional Mott Variable Hopping range model. To further understand the transport behavior both temperature and field dependent magneto-resistance is also studied. Negative magneto-resistance (MR) has been observed for all samples at 50 K. The MR shows quadratic field dependence at high field, implies a relevance of a quantum interference effect in this spin orbital coupled insulator.

  17. Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

    NASA Astrophysics Data System (ADS)

    Kim, Jong Beom; Lee, Dong Ryeol

    2018-04-01

    We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

  18. Hopping and trapping mechanisms in organic field-effect transistors

    NASA Astrophysics Data System (ADS)

    Konezny, S. J.; Bussac, M. N.; Zuppiroli, L.

    2010-01-01

    A charge carrier in the channel of an organic field-effect transistor (OFET) is coupled to the electric polarization of the gate in the form of a surface Fröhlich polaron [N. Kirova and M. N. Bussac, Phys. Rev. B 68, 235312 (2003)]. We study the effects of the dynamical field of polarization on both small-polaron hopping and trap-limited transport mechanisms. We present numerical calculations of polarization energies, band-narrowing effects due to polarization, hopping barriers, and interface trap depths in pentacene and rubrene transistors as functions of the dielectric constant of the gate insulator and demonstrate that a trap-and-release mechanism more appropriately describes transport in high-mobility OFETs. For mobilities on the order 0.1cm2/Vs and below, all states are highly localized and hopping becomes the predominant mechanism.

  19. Solvent Dependence of Lateral Charge Transfer in a Porphyrin Monolayer

    DOE PAGES

    Brennan, Bradley J.; Regan, Kevin P.; Durrell, Alec C.; ...

    2016-12-19

    Lateral charge transport in a redox)active monolayer can be utilized for solar energy harvesting. We chose the porphyrin system to study the influence of the solvent on lateral hole hopping, which plays a crucial role in the charge)transfer kinetics. We also examined the influence of water, acetonitrile, and propylene carbonate as solvents. Hole)hopping lifetimes varied by nearly three orders of magnitude among solvents, ranging from 3 ns in water to 2800 ns in propylene carbonate, and increased nonlinearly as a function of added acetonitrile in aqueous solvent mixtures. Our results elucidate the important roles of solvation, molecular packing dynamics, andmore » lateral charge)transfer mechanisms that have implications for all dye)sensitized photoelectrochemical device designs.« less

  20. Single-legged Hop Tests as Predictors of Self-reported Knee Function After Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Logerstedt, David; Grindem, Hege; Lynch, Andrew; Eitzen, Ingrid; Engebretsen, Lars; Risberg, May Arna; Axe, Michael J.; Snyder-Mackler, Lynn

    2012-01-01

    Background Single-legged hop tests are commonly used functional performance measures that can capture limb asymmetries in patients after anterior cruciate ligament (ACL) reconstruction. Hop tests hold potential as predictive factors of self-reported knee function in individuals after ACL reconstruction. Hypothesis Single-legged hop tests conducted preoperatively would not and 6 months after ACL reconstruction would predict self-reported knee function (International Knee Documentation Committee [IKDC] 2000) 1 year after ACL reconstruction. Study Design Cohort study (prognosis); Level of evidence, 2. Methods One hundred twenty patients who were treated with ACL reconstruction performed 4 single-legged hop tests preoperatively and 6 months after ACL reconstruction. Self-reported knee function within normal ranges was defined as IKDC 2000 scores greater than or equal to the age- and sex-specific normative 15th percentile score 1 year after surgery. Logistic regression analyses were performed to identify predictors of self-reported knee function within normal ranges. The area under the curve (AUC) from receiver operating characteristic curves was used as a measure of discriminative accuracy. Results Eighty-five patients completed single-legged hop tests 6 months after surgery and the 1-year follow-up with 68 patients classified as having self-reported knee function within normal ranges 1 year after reconstruction. The crossover hop and 6-m timed hop limb symmetry index (LSI) 6 months after ACL reconstruction were the strongest individual predictors of self-reported knee function (odds ratio, 1.09 and 1.10) and the only 2 tests in which the confidence intervals of the discriminatory accuracy (AUC) were above 0.5 (AUC = 0.68). Patients with knee function below normal ranges were over 5 times more likely of having a 6-m timed hop LSI lower than the 88% cutoff than those with knee function within normal ranges. Patients with knee function within normal ranges were 4 times more likely to have a crossover hop LSI greater than the 95% cutoff than those with knee function below normal ranges. No preoperative single-legged hop test predicted self-reported knee function within normal ranges 1 year after ACL reconstruction (all P > .353). Conclusion Single-legged hop tests conducted 6 months after ACL reconstruction can predict the likelihood of successful and unsuccessful outcome 1 year after ACL reconstruction. Patients demonstrating less than the 88% cutoff score on the 6-m timed hop test at 6 months may benefit from targeted training to improve limb symmetry in an attempt to normalize function. Patients with minimal side-to-side differences on the crossover hop test at 6 months possibly will have good knee function at 1 year if they continue with their current training regimen. Preoperative single-legged hop tests are not able to predict postoperative outcomes. PMID:22926749

  1. Resistivity of the insulating phase approaching the 2D metal-insulator transition: the effect of spin polarization

    NASA Astrophysics Data System (ADS)

    Li, Shiqi; Sarachik, Myriam

    We compare the resistivity of the dilute, strongly-interacting 2D electron system in the insulating phase of a silicon MOSFET for unpolarized electrons in the absence of magnetic field and in the presence of an in-plane magnetic field sufficient to fully polarize the electrons. In both cases the resistivity obeys Efros-Shklovskii variable range hopping ρ (T) =ρ0exp [(TES / T) 1 / 2 ] , with TES and 1 /ρ0 mapping onto each other provided one applies a shift reported earlier of the critical density nc with magnetic field: the transport properties of the insulator are the same for unpolarized and fully polarized electron spins. Interestingly, the parameters TES and 1 /ρ0 =σ0 are consistent with critical behavior approaching a metal-insulator transition. This work was supported by the National Science Foundation Grant DMR-1309008 and the Binational Science Foundation Grant 2012210.

  2. Single-leg hop testing following fatiguing exercise: reliability and biomechanical analysis.

    PubMed

    Augustsson, J; Thomeé, R; Lindén, C; Folkesson, M; Tranberg, R; Karlsson, J

    2006-04-01

    A fatiguing exercise protocol was combined with single-leg hop testing to improve the possibilities of evaluating the effects of training or rehabilitation interventions. In the first test-retest experiment, 11 healthy male subjects performed two trials of single-leg hops under three different test conditions: non-fatigued and following fatiguing exercise, which consisted of unilateral weight machine knee extensions at 80% and 50%, respectively, of 1 repetition maximum (1 RM) strength. Intraclass correlation coefficients ranged from 0.75 to 0.98 for different hop test conditions, indicating that all tests were reliable. For the second experiment, eight healthy male subjects performed the fatiguing exercise protocol to investigate how fatigue influences lower-extremity joint kinematics and kinetics during single-leg hops. Hip, knee and ankle joint angles, moments and powers, as well as ground-reaction forces were recorded with a six-camera, motion-capture system and a force platform. Recovery of hop performance following the fatiguing exercise was also measured. During the take-off for the single-leg hops, hip and knee flexion angles, generated powers for the knee and ankle joints, and ground-reaction forces decreased for the fatigued hop conditions compared with the non-fatigued condition (P<0.05). Compared with landing during the non-fatigued condition, hip moments and ground-reaction forces were lower for the fatigued hop conditions (P<0.05). The negative joint power was two to three times greater for the knee than for the hip and five to 10 times greater for the knee than for the ankle during landing for all test conditions (P<0.05). Most measured variables had recovered three minutes post-exercise. It is concluded that the fatiguing exercise protocol combined with single-leg hop testing was a reliable method for investigating functional performance under fatigued test conditions. Further, subjects utilized an adapted hop strategy, which employed less hip and knee flexion and generated powers for the knee and ankle joints during take-off, and less hip joint moments during landing under fatigued conditions. The large negative power values observed at the knee joint during the landing phase of the single-leg hop, during which the quadriceps muscle activates eccentrically, indicate that not only hop distance but also the ability to perform successful landings should be investigated when assessing dynamic knee function.

  3. Polaron conductivity mechanism in oxalic acid dihydrate: ac conductivity experiment

    NASA Astrophysics Data System (ADS)

    Levstik, Adrijan; Filipič, Cene; Bobnar, Vid; Levstik, Iva; Hadži, Dušan

    2006-10-01

    The ac electrical conductivity of the oxalic acid dihydrate ( α -POX) was investigated as a function of the frequency and temperature. The real part of the complex ac electrical conductivity was found to follow the universal dielectric response σ'∝νs , indicating that hopping or tunneling of localized charge carriers governs the electrical transport. A detailed analysis of the temperature dependence of the exponent s revealed that in a broad temperature range 50-200K the tunneling of polarons is the dominating charge transport mechanism.

  4. Structural, transport and thermoelectric properties of Nb-doped CaLaMnO perovskite

    NASA Astrophysics Data System (ADS)

    Villa, J. I.; Rodríguez, J. E.

    2014-12-01

    Poly-crystalline perovskite-type (CaLaMnO) Ca0.95La0.05Mn1-xNbxO3 (0.0 ≤ x ≤ 0.10) was synthesized using the conventional solid-state reaction method. Structural and morphological properties were studied by X-ray diffraction analysis (XRD) and scanning electron microscopy (SEM), respectively. Their transport and thermoelectric properties were studied from electrical resistivity ρ(T) and Seebeck coefficient S(T) measurements as a function of temperature and niobium content. The Rietveld analysis revealed a compound with orthorhombic structure, where their lattice parameters increase with the niobium content which is given by a distortion in octahedra MnO6. Electrical resistivity exhibits a semiconducting-like behavior, for low niobium contents (Nb ≤ 0.03) the magnitude of the electrical resistivity decreases, reaching minimum values close to 0.1 Ω - cm. Seebeck coefficient is negative in all studied temperature range. The temperature behavior of S(T) is interpreted in terms of variable range hopping (VRH) and Heikes model. From ρ(T) and S(T) measurements it was possible to calculate the thermoelectric power factor (PF), which reaches maximum values around 0.4 μW /K2 -cm. These values make these ceramics promising electronic thermoelectric materials.

  5. IMPLICATIONS OF NON-LOCALITY OF TRANSPORT IN GEOMORPHIC TRANSPORT LAWS: HILLSLOPES AND LANDSCAPE EVOLUTION MODELING

    NASA Astrophysics Data System (ADS)

    Foufoula-Georgiou, E.; Ganti, V. K.; Dietrich, W. E.

    2009-12-01

    Sediment transport on hillslopes can be thought of as a hopping process, where the sediment moves in a series of jumps. A wide range of processes shape the hillslopes which can move sediment to a large distance in the downslope direction, thus, resulting in a broad-tail in the probability density function (PDF) of hopping lengths. Here, we argue that such a broad-tailed distribution calls for a non-local computation of sediment flux, where the sediment flux is not only a function of local topographic quantities but is an integral flux which takes into account the upslope topographic “memory” of the point of interest. We encapsulate this non-local behavior into a simple fractional diffusive model that involves fractional (non-integer) derivatives. We present theoretical predictions from this nonlocal model and demonstrate a nonlinear dependence of sediment flux on local gradient, consistent with observations. Further, we demonstrate that the non-local model naturally eliminates the scale-dependence exhibited by any local (linear or nonlinear) sediment transport model. An extension to a 2-D framework, where the fractional derivative can be cast into a mixture of directional derivatives, is discussed together with the implications of introducing non-locality into existing landscape evolution models.

  6. A 10-Year Prospective Trial of a Patient Management Algorithm and Screening Examination for Highly Active Individuals with ACL Injury. Part II: Determinants of Dynamic Knee Stability

    PubMed Central

    Hurd, Wendy J.; Axe, Michael J.; Snyder-Mackler, Lynn

    2010-01-01

    Objectives To clarify the determinants of dynamic knee stability early after anterior cruciate ligament (ACL) injury. Materials and Methods 345 consecutive patients who were regular participants in IKDC level I/II sports before injury and had an acute isolated ACL injury from the practice of a single orthopaedic surgeon underwent a screening examination including clinical measures, knee laxity, quadriceps strength, hop testing, and patient self-reported knee function an average of 6 weeks after injury when impairments were resolved. Independent t-tests were performed to evaluate differences in quadriceps strength and anterior knee laxity between potential copers and noncopers. Hierarchical regression was performed to determine the influence of quadriceps strength, pre-injury activity level, and anterior knee laxity on hop test performance, as well as the influence of timed hop, cross-over hop, quadriceps strength, pre-injury activity level, and anterior knee laxity on self-assessed global function. Results Neither anterior knee laxity nor quadriceps strength differed between potential copers and non-copers. Quadriceps strength influenced hop test performance more significantly than pre-injury activity level or anterior knee laxity, but the variance accounted for by quadriceps strength was low (Range: 4-8%). Timed hop performance was the only variable that impacted self-assessed global function. Conclusions Traditional surgical decision making based on passive anterior knee laxity and pre-injury activity level is not supported by the results, as neither are good predictors of dynamic knee stability. Clinical tests that capture neuromuscular adaptations, including the timed hop test, may be useful in predicting function and guiding individualized patient management after ACL injury. PMID:17932399

  7. Go with your gut: Digestibility and digestive function of two arid-zone Australian murids, Pseudomys australis and Notomys alexis.

    PubMed

    Stannard, Hayley J; Tulk, Melissa L; Bortolazzo, Melissa J; Old, Julie M

    2018-06-01

    Spinifex hopping-mice (Notomys alexis) and plains mice (Pseudomys australis) are able to successfully occupy arid zones of Australia. We studied the digestive parameters and energy assimilation of captive spinifex hopping-mice and plains mice. The experiment consisted of six diets fed to the animals for periods of 12days per food type. On a dry matter basis, the plains mice consumed between 2.5 and 7.2% and the hopping-mice between 5.8 and 9.3% of their body mass in food per day. The body mass of the spinifex hopping-mice increased significantly on the sunflower seed diet, while body mass did not change significantly for the plains mice on any diet. Apparent digestibility of macronutrients was similar in the hopping-mice and plains mice when maintained on the same diet, however digestibility of total micronutrients differed. Maintenance energy requirements for the plains mice were 529kJkg -0.75 d -1 and spinifex hopping-mice 550kJkg -0.75 d -1 . Spinifex hopping-mice and plains mice are able to exploit a range of food items and efficiently digest macronutrients, to ensure they meet their nutritional needs, an ability they require in the variable arid environment. The information gained in this study increases the paucity of information on Australian native murids, specifically their digestive function and energy requirements, and will aid captive murid management. The study will allow future expansion into field studies, to aid the conservation of wild rodent diets and nutrition of arid zone murids. Copyright © 2018 Elsevier GmbH. All rights reserved.

  8. A numerical study of Coulomb interaction effects on 2D hopping transport.

    PubMed

    Kinkhabwala, Yusuf A; Sverdlov, Viktor A; Likharev, Konstantin K

    2006-02-15

    We have extended our supercomputer-enabled Monte Carlo simulations of hopping transport in completely disordered 2D conductors to the case of substantial electron-electron Coulomb interaction. Such interaction may not only suppress the average value of hopping current, but also affect its fluctuations rather substantially. In particular, the spectral density S(I)(f) of current fluctuations exhibits, at sufficiently low frequencies, a 1/f-like increase which approximately follows the Hooge scaling, even at vanishing temperature. At higher f, there is a crossover to a broad range of frequencies in which S(I)(f) is nearly constant, hence allowing characterization of the current noise by the effective Fano factor [Formula: see text]. For sufficiently large conductor samples and low temperatures, the Fano factor is suppressed below the Schottky value (F = 1), scaling with the length L of the conductor as F = (L(c)/L)(α). The exponent α is significantly affected by the Coulomb interaction effects, changing from α = 0.76 ± 0.08 when such effects are negligible to virtually unity when they are substantial. The scaling parameter L(c), interpreted as the average percolation cluster length along the electric field direction, scales as [Formula: see text] when Coulomb interaction effects are negligible and [Formula: see text] when such effects are substantial, in good agreement with estimates based on the theory of directed percolation.

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. Unusual Thermoelectric Behavior Indicating a Hopping to Bandlike Transport Transition in Pentacene

    NASA Astrophysics Data System (ADS)

    Germs, W. Chr.; Guo, K.; Janssen, R. A. J.; Kemerink, M.

    2012-07-01

    An unusual increase in the Seebeck coefficient with increasing charge carrier density is observed in pentacene thin film transistors. This behavior is interpreted as being due to a transition from hopping transport in static localized states to bandlike transport, occurring at temperatures below ˜250K. Such a transition can be expected for organic materials in which both static energetic disorder and dynamic positional disorder are important. While clearly visible in the temperature and density dependent Seebeck coefficient, the transition hardly shows up in the charge carrier mobility.

  11. The Helicopter Observation Platform for Marine and Continental Boundary Layer Studies

    NASA Astrophysics Data System (ADS)

    Avissar, R.; Broad, K.; Walko, R. L.; Drennan, W. M.; Williams, N. J.

    2016-02-01

    The University of Miami has acquired a commercial helicopter (Airbus H125) that was transformed into a one-of-a-kind Helicopter Observation Platform (HOP) that fills critical gaps in physical, chemical and biological observations of the environment. This new research facility is designed to carry sensors and instrument inlets in the undisturbed air in front of the helicopter nose at low airspeed and at various altitudes, from a few feet above the Earth's surface (where much of the climate and weather "action" takes place, and where we live) and up through the atmospheric boundary layer and the mid troposphere. The HOP, with its hovering capability, is also ideal for conducting various types of remote-sensing observations. It provides a unique and essential component of airborne measurement whose purpose, among others, is to quantify the exchanges of gases and energy at the Earth surface, as well as aerosol properties that affect the environment, the climate system, and human health. For its first scientific mission, an eddy-correlation system is being mounted in front of its nose to conduct high-frequency measurements of turbulence variables relevant to atmospheric boundary layer studies.Fully fueled and with both pilot and co-pilot on board, the HOP can carry a scientific payload of up to about 1,000 lbs internally (about 3,000 lbs externally) and fly for nearly 4 hours without refueling at an airspeed of 65 knots ( 30 m/s) that is ideal for in-situ observations. Its fast cruising speed is about 140 knots andits range, at that speed, is about 350 nautical miles. This specific helicopter was chosen because of its flat floor design, which is particularly convenient for installing scientific payload and also because of its high-altitude capability (it is the only commercial helicopter that ever landed at the top of Mt Everest).The HOP is available to the entire scientific community for any project that is feasible from a flight safety point of view and that fulfills the flight regulations of the country that it is flown in. It can be easily transported anywhere in the world and can also be operated from a properly equipped ship at sea foroceanographic research.

  12. Spin-orbit interaction and negative magnetoresistance for localized electrons in InSb quantum wells

    NASA Astrophysics Data System (ADS)

    Ishida, S.; Manago, T.; Nishizako, N.; Geka, H.; Shibasaki, I.

    2010-02-01

    Weak-field magnetoresistance (MR) in the variable-range hopping (VRH) in the presence of spin-orbit interaction (SOI) for 2DEGs at the hetero-interface of InSb quantum wells was examined in view of the quantum interference (QI) effect. Samples with the sheet resistance, ρ> ρc= h/ e2, exhibit VRH, while those with ρ< ρc exhibit weak localiz ation (WL) at low temperatures, where h/ e2 is the quantum resistance. In the WL regime, a positive magnetoresistance (MR) peak due to the weak anti-localization (WAL) with SOI is clearly observed in low magnetic field. In contrast, the low-field hopping MR remains entirely negative surviving the SOI, indicating that the hopping MR due to the QI is completely negative regardless of the SOI. This result supports the predictions based on the directed-path approach for forward-scattering paths ignoring the back-scattering return loops for the QI in the VRH.

  13. Conduction mechanism in bismuth silicate glasses containing titanium

    NASA Astrophysics Data System (ADS)

    Dult, Meenakshi; Kundu, R. S.; Murugavel, S.; Punia, R.; Kishore, N.

    2014-11-01

    Bismuth silicate glasses mixed with different concentrations of titanium dioxide having compositions xTiO2-(60-x)Bi2O3-40SiO2 with x=0, 5, 10, 15 and 20 were prepared by the normal melt quench technique. The frequency dependence of the ac electrical conductivity of different compositions of titanium bismuth silicate glasses has been studied in the frequency range 10-1 Hz to 10 MHz and in the temperature range 623-703 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of titanium bismuth silicate glass system. The dc conductivity (σdc), so called crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. The conductivity data have been analyzed in terms of different theoretical models to determine the possible conduction mechanism. Analysis of the conductivity data and the frequency exponent shows that the correlated barrier hopping of electrons between Ti3+ and Ti4+ ions in the glasses is the most favorable mechanism for ac conduction. The temperature dependent dc conductivity has been analyzed in the framework of theoretical variable range hopping model (VRH) proposed by Mott which describe the hopping conduction in disordered semiconducting systems. The various polaron hopping parameters have also been deduced. Mott's VRH model is found to be in good agreement with experimental data and the values of inverse localization length of s-like wave function (α) obtained by this model with modifications suggested by Punia et al. are close to the ones reported for a number of oxide glasses.

  14. Nonadiabatic small-polaron hopping electron transport in diphenoquinone-doped polycarbonate

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Yasuhiro; Yokoyama, Masaaki

    1991-10-01

    The dependences of electron mobility on the electric field F, temperature T, and hopping site distance R have been characterized in 3,5-dimethyl-3',5'-di-tert-butyl-4,4'-diphenoquinone dispersed molecularly in a polycarbonate according to Schein's analytical technique. The electron mobility can be described in the form a0R2 exp(-2R/R0) exp(-E0/kT) × exp[β(1/kT-1/kT0)F1/2], where a0, R0, β, and T0 are constants. Moreover, it is found that the zero-field activation energy E0 is independent of R. The invariable E0 and the exponential dependence of the Arrhenius prefactor on R strongly suggest that the electron transport therein is due to nonadiabatic small-polaron hopping. Based on the small-polaron theory, the transport properties are qualitatively discussed in terms of molecular properties.

  15. Development of NTD Ge Sensors for Superconducting Bolometer

    NASA Astrophysics Data System (ADS)

    Garai, A.; Mathimalar, S.; Singh, V.; Dokania, N.; Nanal, V.; Pillay, R. G.; Ramakrishnan, S.; Shrivastava, A.; Jagadeesan, K. C.; Thakare, S. V.

    2016-08-01

    Neutron transmutation-doped (NTD) Ge sensors have been prepared by irradiating device-grade Ge with thermal neutrons at Dhruva reactor, BARC, Mumbai. These sensors are intended to be used for the study of neutrinoless double beta decay in ^{124}Sn with a superconducting Tin bolometer. Resistance measurements are performed on NTD Ge sensors in the temperature range 100-350 mK. The observed temperature dependence is found to be consistent with the variable-range hopping mechanism.

  16. Origin of anomalies and phase competitions around magnetic transition temperature in Pr0.7Ca0.3MnO3

    NASA Astrophysics Data System (ADS)

    Shah, Matiullah; Nadeem, M.; Atif, M.

    2013-03-01

    A polycrystalline sample of Pr0.7Ca0.3MnO3 is synthesized by the conventional solid-state reaction method and the phase formation is confirmed by x-ray diffraction. In this work, we addressed the phase competition issues in the vicinity of magnetic transition temperature and also established its correlation with oxygen contents of domains, disorder effects and heterogeneity in the material. The appearance and disappearance of anomaly in the vicinity of TC (128 K) with magnetic field is discussed in terms of establishment of short- and long-range networks between Mn3+ and Mn4+. Switching behaviour of two competing phases is analysed qualitatively and quantitatively, using an equivalent circuit model and magnetization analysis. The issue of coexisting phases is further substantiated using a simple depression angle approach of impedance plane plots. variable range hopping is found to be a better model than polaronic for explaining the transport properties of both competing phases below the magnetic transition temperature, 128 K.

  17. Hydrogenation effects on carrier transport in boron-doped ultrananocrystalline diamond/amorphous carbon films prepared by coaxial arc plasma deposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Katamune, Yūki, E-mail: yuki-katamune@kyudai.jp; Takeichi, Satoshi; Ohmagari, Shinya

    2015-11-15

    Boron-doped ultrananocrystalline diamond/hydrogenated amorphous carbon composite (UNCD/a-C:H) films were deposited by coaxial arc plasma deposition with a boron-blended graphite target at a base pressure of <10{sup −3} Pa and at hydrogen pressures of ≤53.3 Pa. The hydrogenation effects on the electrical properties of the films were investigated in terms of chemical bonding. Hydrogen-scattering spectrometry showed that the maximum hydrogen content was 35 at. % for the film produced at 53.3-Pa hydrogen pressure. The Fourier-transform infrared spectra showed strong absorptions by sp{sup 3} C–H bonds, which were specific to the UNCD/a-C:H, and can be attributed to hydrogen atoms terminating the dangling bondsmore » at ultrananocrystalline diamond grain boundaries. Temperature-dependence of the electrical conductivity showed that the films changed from semimetallic to semiconducting with increasing hydrogen pressure, i.e., with enhanced hydrogenation, probably due to hydrogenation suppressing the formation of graphitic bonds, which are a source of carriers. Carrier transport in semiconducting hydrogenated films can be explained by a variable-range hopping model. The rectifying action of heterojunctions comprising the hydrogenated films and n-type Si substrates implies carrier transport in tunneling.« less

  18. Electron transport within transparent assemblies of tin-doped indium oxide colloidal nanocrystals

    NASA Astrophysics Data System (ADS)

    Grisolia, J.; Decorde, N.; Gauvin, M.; Sangeetha, N. M.; Viallet, B.; Ressier, L.

    2015-08-01

    Stripe-like compact assemblies of tin-doped indium oxide (ITO) colloidal nanocrystals (NCs) are fabricated by stop-and-go convective self-assembly (CSA). Systematic evaluation of the electron transport mechanisms in these systems is carried out by varying the length of carboxylate ligands protecting the NCs: butanoate (C4), octanoate (C8) and oleate (C18). The interparticle edge-to-edge distance L0, along with a number of carbon atoms in the alkyl chain of the coating ligand, are deduced from small-angle x-ray scattering (SAXS) measurements and exhibit a linear relationship with a slope of 0.11 nm per carbon pair unit. Temperature-dependent resistance characteristics are analyzed using several electron transport models: Efros-Shklovskii variable range hopping (ES-VRH), inelastic cotunneling (IC), regular island array and percolation. The analysis indicated that the first two models (ES-VRH and IC) fail to explain the observed behavior, and that only simple activated transport takes place in these systems under the experimental conditions studied (T = 300 K to 77 K). Related transport parameters were then extracted using the regular island array and percolation models. The effective tunneling decay constant βeff of the ligands and the Coulomb charging energy EC are found to be around 5.5 nm-1 and 25 meV, respectively, irrespective of ligand lengths. The theoretical tunneling decay constant β calculated using the percolation model is in the range 9 nm-1. Electromechanical tests on the ITO nanoparticle assemblies indicate that their sensitivities are as high as ˜30 and remain the same regardless of ligand lengths, which is in agreement with the constant effective βeff extracted from regular island array and percolation models.

  19. Study of conduction behavior in Pr0.67Sr0.03Ag0.30MnO3

    NASA Astrophysics Data System (ADS)

    Bhat, Masroor Ahmad; Modi, Anchit; Pandey, Devendra K.; Gaur, N. K.

    2018-05-01

    In this paper, we report the conduction mechanism in Pr0.67Sr0.03Ag0.30MnO3 system synthesized via conventional solid state reaction route. The structural information was carried by X - Ray diffraction using Rietveld refinement which confirms the secondary phase of the sample. The SEM image shows the formation of double phase composite because of limited reaction of silver with parent compound. The resistivity behavior indicates the semiconducting behavior. The electronic nature can be estimated by means of variable range hopping (VRH) and small polaron hopping (SPH) model showing that the enhancement of double exchange interaction suppress the band gap and boost the carrier delocalization of charge carriers.

  20. Temperature Dependence of Field-Effect Mobility in Organic Thin-Film Transistors: Similarity to Inorganic Transistors.

    PubMed

    Okada, Jun; Nagase, Takashi; Kobayashi, Takashi; Naito, Hiroyoshi

    2016-04-01

    Carrier transport in solution-processed organic thin-film transistors (OTFTs) based on dioctylbenzothienobenzothiophene (C8-BTBT) has been investigated in a wide temperature range from 296 to 10 K. The field-effect mobility shows thermally activated behavior whose activation energy becomes smaller with decreasing temperature. The temperature dependence of field-effect mobility found in C8-BTBT is similar to that of others materials: organic semiconducting polymers, amorphous oxide semiconductors and hydrogenated amorphous silicon. These results indicate that hopping transport between isoenergetic localized states becomes dominated in a low temperature regime in these materials.

  1. An efficient solution to the decoherence enhanced trivial crossing problem in surface hopping

    NASA Astrophysics Data System (ADS)

    Bai, Xin; Qiu, Jing; Wang, Linjun

    2018-03-01

    We provide an in-depth investigation of the time interval convergence when both trivial crossing and decoherence corrections are applied to Tully's fewest switches surface hopping (FSSH) algorithm. Using one force-based and one energy-based decoherence strategies as examples, we show decoherence corrections intrinsically enhance the trivial crossing problem. We propose a restricted decoherence (RD) strategy and incorporate it into the self-consistent (SC) fewest switches surface hopping algorithm [L. Wang and O. V. Prezhdo, J. Phys. Chem. Lett. 5, 713 (2014)]. The resulting SC-FSSH-RD approach is applied to general Hamiltonians with different electronic couplings and electron-phonon couplings to mimic charge transport in tens to hundreds of molecules. In all cases, SC-FSSH-RD allows us to use a large time interval of 0.1 fs for convergence and the simulation time is reduced by over one order of magnitude. Both the band and hopping mechanisms of charge transport have been captured perfectly. SC-FSSH-RD makes surface hops in the adiabatic representation and can be implemented in both diabatic and locally diabatic representations for wave function propagation. SC-FSSH-RD can potentially describe general nonadiabatic dynamics of electrons and excitons in organics and other materials.

  2. The frequency hopping pattern design for random hopping frequency signal based on stationary phase principle

    NASA Astrophysics Data System (ADS)

    Liao, Zhikun; Lu, Dawei; Hu, Jiemin; Zhang, Jun

    2018-04-01

    For the random hopping frequency signal, the modulated frequencies are randomly distributed over given bandwidth. The randomness of modulated frequency not only improves the electronic counter countermeasure capability for radar systems, but also determines its performance of range compression. In this paper, the range ambiguity function of RHF signal is firstly derived. Then, a design method of frequency hopping pattern based on stationary phase principle to improve the peak to side-lobe ratio is proposed. Finally, the simulated experiments show a good effectiveness of the presented design method.

  3. Cooperative Activated Transport of Dilute Penetrants in Viscous Molecular and Polymer Liquids

    NASA Astrophysics Data System (ADS)

    Schweizer, Kenneth; Zhang, Rui

    We generalize the force-level Elastically Collective Nonlinear Langevin Equation theory of activated relaxation in one-component supercooled liquids to treat the hopping transport of a dilute penetrant in a dense hard sphere fluid. The new idea is to explicitly account for the coupling between penetrant displacement and a local matrix cage re-arrangement which facilitates its hopping. A temporal casuality condition is employed to self-consistently determine a dimensionless degree of matrix distortion relative to the penetrant jump distance using the dynamic free energy concept. Penetrant diffusion becomes increasingly coupled to the correlated matrix displacements for larger penetrant to matrix particle size ratio (R) and/or attraction strength (physical bonds), but depends weakly on matrix packing fraction. In the absence of attractions, a nearly exponential dependence of penetrant diffusivity on R is predicted in the intermediate range of 0.2

  4. Transport of hop aroma compounds across Caco-2 monolayers.

    PubMed

    Heinlein, A; Metzger, M; Walles, H; Buettner, A

    2014-11-01

    Although being reported and used as a sedative remedy for several years, the bioactive principle of hop preparations is still not decisively clarified. Understanding absorption and transformation processes of potential physiologically active constituents is essential to evaluate the likeliness of biological effects on humans. Therefore, single hop aroma compounds as well as digestive transformation products thereof have been investigated in view of their human intestinal absorption, applying Caco-2 transport experiments as well as investigations on potential biotransformation processes. Selective and sensitive identification and quantification were thereby achieved by application of two-dimensional high resolution gas chromatography-mass spectrometry in conjunction with stable isotope dilution analysis, leading to the determination of apparent permeability values by different mathematical approaches considering sink and non-sink conditions. Overall, calculated permeability values ranged from 2.6 × 10(-6) to 1.8 × 10(-4) cm s(-1) with all mathematical approaches, indicating high absorption potential and almost complete bioavailability for all tested compounds with hydroxyl-functionalities. Considering this high permeability together with the high lipophilicity of these substances, a passive transcellular uptake route can be speculated. Investigated sesquiterpenes and β-myrcene showed flat absorption profiles while the investigated esters showed decreasing profiles. In view of the lipophilic and volatile nature of the investigated substances, special attention was paid to recovery and mass balance determination. Furthermore, in the course of the transport experiments of 1-octen-3-ol and 3-methyl-2-buten-1-ol, additional biotransformation products were observed, namely 3-octanone and 3-methyl-2-butenal, respectively. The absence of these additional substances in control experiments strongly indicates an intestinal first-pass metabolism of the α,β-unsaturated alcohols 1-octen-3-ol and 3-methyl-2-buten-1-ol in Caco-2 cells.

  5. Hopping Conduction and Bacteria: Transport Properties of Disordered Reaction-Diffusion Systems

    NASA Astrophysics Data System (ADS)

    Missel, Andrew; Dahmen, Karin

    2008-03-01

    Reaction-diffusion (RD) systems are used to model everything from the formation of animal coat patterns to the spread of genes in a population to the seasonal variation of plankton density in the ocean. In all of these problems, disorder plays a large role, but determining its effects on transport properties in RD systems has been a challenge. We present here both analytical and numerical studies of a particular disordered RD system consisting of particles which are allowed to diffuse and compete for resources (2A->A) with spatially homogeneous rates, reproduce (A->2A) in certain areas (``oases''), and die (A->0) everywhere else (the ``desert''). In the low oasis density regime, transport is mediated through rare ``hopping events'' in which a small number of particles diffuse through the desert from one oasis to another; the situation is mathematically analogous to hopping conduction in doped semiconductors, and this analogy, along with some ideas from first passage percolation theory, allows us to make some quantitative predictions about the transport properties of the system on a large scale.

  6. A Hybrid DV-Hop Algorithm Using RSSI for Localization in Large-Scale Wireless Sensor Networks.

    PubMed

    Cheikhrouhou, Omar; M Bhatti, Ghulam; Alroobaea, Roobaea

    2018-05-08

    With the increasing realization of the Internet-of-Things (IoT) and rapid proliferation of wireless sensor networks (WSN), estimating the location of wireless sensor nodes is emerging as an important issue. Traditional ranging based localization algorithms use triangulation for estimating the physical location of only those wireless nodes that are within one-hop distance from the anchor nodes. Multi-hop localization algorithms, on the other hand, aim at localizing the wireless nodes that can physically be residing at multiple hops away from anchor nodes. These latter algorithms have attracted a growing interest from research community due to the smaller number of required anchor nodes. One such algorithm, known as DV-Hop (Distance Vector Hop), has gained popularity due to its simplicity and lower cost. However, DV-Hop suffers from reduced accuracy due to the fact that it exploits only the network topology (i.e., number of hops to anchors) rather than the distances between pairs of nodes. In this paper, we propose an enhanced DV-Hop localization algorithm that also uses the RSSI values associated with links between one-hop neighbors. Moreover, we exploit already localized nodes by promoting them to become additional anchor nodes. Our simulations have shown that the proposed algorithm significantly outperforms the original DV-Hop localization algorithm and two of its recently published variants, namely RSSI Auxiliary Ranging and the Selective 3-Anchor DV-hop algorithm. More precisely, in some scenarios, the proposed algorithm improves the localization accuracy by almost 95%, 90% and 70% as compared to the basic DV-Hop, Selective 3-Anchor, and RSSI DV-Hop algorithms, respectively.

  7. Low-temperature thermal transport and thermopower of monolayer transition metal dichalcogenide semiconductors

    NASA Astrophysics Data System (ADS)

    Sengupta, Parijat; Tan, Yaohua; Klimeck, Gerhard; Shi, Junxia

    2017-10-01

    We study the low temperature thermal conductivity of single-layer transition metal dichalcogenides (TMDCs). In the low temperature regime where heat is carried primarily through transport of electrons, thermal conductivity is linked to electrical conductivity through the Wiedemann-Franz law (WFL). Using a k.p Hamiltonian that describes the K and K{\\prime} valley edges, we compute the zero-frequency electric (Drude) conductivity using the Kubo formula to obtain a numerical estimate for the thermal conductivity. The impurity scattering determined transit time of electrons which enters the Drude expression is evaluated within the self-consistent Born approximation. The analytic expressions derived show that low temperature thermal conductivity (1) is determined by the band gap at the valley edges in monolayer TMDCs and (2) in presence of disorder which can give rise to the variable range hopping regime, there is a distinct reduction. Additionally, we compute the Mott thermopower and demonstrate that under a high frequency light beam, a valley-resolved thermopower can be obtained. A closing summary reviews the implications of results followed by a brief discussion on applicability of the WFL and its breakdown in context of the presented calculations.

  8. A New One-dimensional Quantum Material - Ta2Pd3Se8 Atomic Chain

    NASA Astrophysics Data System (ADS)

    Liu, Xue; Liu, Jinyu; Hu, Jin; Yue, Chunlei; Mao, Zhiqiang; Wei, Jiang; Antipina, Liubov; Sorokin, Pavel; Sanchez, Ana

    Since the discovery of carbon nanotube, there has been a persistent effort to search for other one dimensional (1D) quantum systems. However, only a few examples have been found. We report a new 1D example - semiconducting Ta2Pd3Se8. We demonstrate that the Ta2Pd3Se8 nanowire as thin as 1.3nm can be easily obtained by applying simple mechanical exfoliation from its bulk counterpart. High resolution TEM shows an intrinsic 1D chain-like crystalline morphology on these nano wires, indicating weak bonding between these atomic chains. Theoretical calculation shows a direct bandgap structure, which evolves from 0.53eV in the bulk to 1.04eV in single atomic chain. The field effect transistor based on Ta2Pd3Se8 nanowire achieved a promising performance with 104On/Off ratio and 80 cm2V-1s-1 mobility. Low temperature transport study reflects two different mechanisms, variable range hopping and thermal activation, which dominate the transport properties at different temperature regimes. Ta2Pd3Se8 nanowire provides an intrinsic 1D material system for the study low dimensional condensed matter physics.

  9. Beer spoilage bacteria and hop resistance.

    PubMed

    Sakamoto, Kanta; Konings, Wil N

    2003-12-31

    For brewing industry, beer spoilage bacteria have been problematic for centuries. They include some lactic acid bacteria such as Lactobacillus brevis, Lactobacillus lindneri and Pediococcus damnosus, and some Gram-negative bacteria such as Pectinatus cerevisiiphilus, Pectinatus frisingensis and Megasphaera cerevisiae. They can spoil beer by turbidity, acidity and the production of unfavorable smell such as diacetyl or hydrogen sulfide. For the microbiological control, many advanced biotechnological techniques such as immunoassay and polymerase chain reaction (PCR) have been applied in place of the conventional and time-consuming method of incubation on culture media. Subsequently, a method is needed to determine whether the detected bacterium is capable of growing in beer or not. In lactic acid bacteria, hop resistance is crucial for their ability to grow in beer. Hop compounds, mainly iso-alpha-acids in beer, have antibacterial activity against Gram-positive bacteria. They act as ionophores which dissipate the pH gradient across the cytoplasmic membrane and reduce the proton motive force (pmf). Consequently, the pmf-dependent nutrient uptake is hampered, resulting in cell death. The hop-resistance mechanisms in lactic acid bacteria have been investigated. HorA was found to excrete hop compounds in an ATP-dependent manner from the cell membrane to outer medium. Additionally, increased proton pumping by the membrane bound H(+)-ATPase contributes to hop resistance. To energize such ATP-dependent transporters hop-resistant cells contain larger ATP pools than hop-sensitive cells. Furthermore, a pmf-dependent hop transporter was recently presented. Understanding the hop-resistance mechanisms has enabled the development of rapid methods to discriminate beer spoilage strains from nonspoilers. The horA-PCR method has been applied for bacterial control in breweries. Also, a discrimination method was developed based on ATP pool measurement in lactobacillus cells. However, some potential hop-resistant strains cannot grow in beer unless they have first been exposed to subinhibitory concentration of hop compounds. The beer spoilage ability of Pectinatus spp. and M. cerevisiae has been poorly studied. Since all the strains have been reported to be capable of beer spoiling, species identification is sufficient for the breweries. However, with the current trend of beer flavor (lower alcohol and bitterness), there is the potential risk that not yet reported bacteria will contribute to beer spoilage. Investigation of the beer spoilage ability of especially Gram-negative bacteria may be useful to reduce this risk.

  10. First report of hop stunt viroid from sweet cherry with dapple apple fruit symptoms in China

    USDA-ARS?s Scientific Manuscript database

    Hop stunt viroid (HSVd), the type member of the genus Hostuviroid, family Pospiviroidae, was first described from hops with stunt disease in Japan. HSVd has a wide host range that includes hop, cucumber, citrus, grapevine, plum, pear, peach, apricot and almond and is the causal agent of serious dis...

  11. Dominant source of disorder in graphene: charged impurities or ripples?

    NASA Astrophysics Data System (ADS)

    Fan, Zheyong; Uppstu, Andreas; Harju, Ari

    2017-06-01

    Experimentally produced graphene sheets exhibit a wide range of mobility values. Both extrinsic charged impurities and intrinsic ripples (corrugations) have been suggested to induce long-range disorder in graphene and could be a candidate for the dominant source of disorder. Here, using large-scale molecular dynamics and quantum transport simulations, we find that the hopping disorder and the gauge and scalar potentials induced by the ripples are short-ranged, in strong contrast with predictions by continuous models, and the transport fingerprints of the ripple disorder are very different from those of charged impurities. We conclude that charged impurities are the dominant source of disorder in most graphene samples, whereas scattering by ripples is mainly relevant in the high carrier density limit of ultraclean graphene samples (with a charged impurity concentration less than about 10 ppm) at room and higher temperatures. Our finding is valuable to theoretical modelling of transport properties of not only graphene, but also other two-dimensional materials, as the thermal ripples are universal.

  12. Direct Imaging of Exciton Transport in Tubular Porphyrin Aggregates by Ultrafast Microscopy.

    PubMed

    Wan, Yan; Stradomska, Anna; Knoester, Jasper; Huang, Libai

    2017-05-31

    Long-range exciton transport is a key challenge in achieving efficient solar energy harvesting in both organic solar cells and photosynthetic systems. Self-assembled molecular aggregates provide the potential for attaining long-range exciton transport through strong intermolecular coupling. However, there currently lacks an experimental tool to directly characterize exciton transport in space and in time to elucidate mechanisms. Here we report a direct visualization of exciton diffusion in tubular molecular aggregates by transient absorption microscopy with ∼200 fs time resolution and ∼50 nm spatial precision. These direct measurements provide exciton diffusion constants of 3-6 cm 2 s -1 for the tubular molecular aggregates, which are 3-5 times higher than a theoretical lower bound obtained by assuming incoherent hopping. These results suggest that coherent effects play a role, despite the fact that exciton states near the band bottom crucial for transport are only weakly delocalized (over <10 molecules). The methods presented here establish a direct approach for unraveling the mechanisms and main parameters underlying exciton transport in large molecular assemblies.

  13. Music Genre as a Predictor of Resource Utilization at Outdoor Music Concerts.

    PubMed

    Westrol, Michael S; Koneru, Susmith; McIntyre, Norah; Caruso, Andrew T; Arshad, Faizan H; Merlin, Mark A

    2017-06-01

    The aim of this study was to examine the various modern music genres and their effect on the utilization of medical resources with analysis and adjustment for potential confounders. A retrospective review of patient logs from an open-air, contemporary amphitheater over a period of 10 years was performed. Variables recorded by the medical personnel for each concert included the attendance, description of the weather, and a patient log in which nature and outcome were recorded. The primary outcomes were associations of genres with the medical usage rate (MUR). Secondary outcomes investigated were the association of confounders and the influences on the level of care provided, the transport rate, and the nature of medical complaint. A total of 2,399,864 concert attendees, of which 4,546 patients presented to venue Emergency Medical Services (EMS) during 403 concerts with an average of 11.4 patients (annual range 7.1-17.4) each concert. Of potential confounders, only the heat index ≥90°F (32.2°C) and whether the event was a festival were significant (P=.027 and .001, respectively). After adjustment, the genres with significantly increased MUR in decreasing order were: alternative rock, hip-hop/rap, modern rock, heavy metal/hard rock, and country music (P<.05). Medical complaints were significantly increased with alternative rock or when the heat index was ≥90°F (32.2°C; P<.001). Traumatic injuries were most significantly increased with alternative rock (P<.001). Alcohol or drug intoxication was significantly more common in hip-hop/rap (P<.001). Transport rates were highest with alcohol/drug intoxicated patients (P<.001), lowest with traumatic injuries (P=.004), and negatively affected by heat index ≥90°F (32.2°C; P=.008), alternative rock (P=.017), and country music (P=.033). Alternative rock, hip-hop/rap, modern rock, heavy metal/hard rock, and country music concerts had higher levels of medical resource utilization. High heat indices and music festivals also increase the MUR. This information can assist event planners with preparation and resource utilization. Future research should focus on prospective validation of the regression equation. Westrol MS , Koneru S , McIntyre N , Caruso AT , Arshad FH , Merlin MA . Music genre as a predictor of resource utilization at outdoor music concerts. Prehosp Disaster Med. 2017;32(3):289-296.

  14. Structural characterization and observation of variable range hopping conduction mechanism at high temperature in CdSe quantum dot solids

    NASA Astrophysics Data System (ADS)

    Sinha, Subhojyoti; Kumar Chatterjee, Sanat; Ghosh, Jiten; Kumar Meikap, Ajit

    2013-03-01

    We have used Rietveld refinement technique to extract the microstructural parameters of thioglycolic acid capped CdSe quantum dots. The quantum dot formation and its efficient capping are further confirmed by HR-TEM, UV-visible and FT-IR spectroscopy. Comparative study of the variation of dc conductivity with temperature (298 K ≤ T ≤ 460 K) is given considering Arrhenius formalism, small polaron hopping and Schnakenberg model. We observe that only Schnakenberg model provides good fit to the non-linear region of the variation of dc conductivity with temperature. Experimental variation of ac conductivity and dielectric parameters with temperature (298 K ≤ T ≤ 460 K) and frequency (80 Hz ≤ f ≤ 2 MHz) are discussed in the light of hopping theory and quantum confinement effect. We have elucidated the observed non-linearity in the I-V curves (measured within ±50 V), at dark and at ambient light, in view of tunneling mechanism. Tunnel exponents and non-linearity weight factors have also been evaluated in this regard.

  15. Crowding and hopping in a protein’s diffusive transport on DNA

    NASA Astrophysics Data System (ADS)

    Koslover, Elena F.; Díaz de la Rosa, Mario; Spakowitz, Andrew J.

    2017-02-01

    Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work.

  16. Molybdenum Carbamate Nanosheets as a New Class of Potential Phase Change Materials.

    PubMed

    Zhukovskyi, Maksym; Plashnitsa, Vladimir; Petchsang, Nattasamon; Ruth, Anthony; Bajpai, Anshumaan; Vietmeyer, Felix; Wang, Yuanxing; Brennan, Michael; Pang, Yunsong; Werellapatha, Kalpani; Bunker, Bruce; Chattopadhyay, Soma; Luo, Tengfei; Janko, Boldizsar; Fay, Patrick; Kuno, Masaru

    2017-06-14

    We report for the first time the synthesis of large, free-standing, Mo 2 O 2 (μ-S) 2 (Et 2 dtc) 2 (MoDTC) nanosheets (NSs), which exhibit an electron-beam induced crystalline-to-amorphous phase transition. Both electron beam ionization and femtosecond (fs) optical excitation induce the phase transition, which is size-, morphology-, and composition-preserving. Resulting NSs are the largest, free-standing regularly shaped two-dimensional amorphous nanostructures made to date. More importantly, amorphization is accompanied by dramatic changes to the NS electrical and optical response wherein resulting amorphous species exhibit room-temperature conductivities 5 orders of magnitude larger than those of their crystalline counterparts. This enhancement likely stems from the amorphization-induced formation of sulfur vacancy-related defects and is supported by temperature-dependent transport measurements, which reveal efficient variable range hopping. MoDTC NSs represent one instance of a broader class of transition metal carbamates likely having applications because of their intriguing electrical properties as well as demonstrated ability to toggle metal oxidation states.

  17. Conduction mechanism and dielectric relaxation in high dielectric KxTiyNi1-x-yO

    NASA Astrophysics Data System (ADS)

    Jana, Pradip Kumar; Sarkar, Sudipta; Karmakar, Shilpi; Chaudhuri, B. K.

    2007-10-01

    Complex impedance spectroscopic study has been made to elucidate the conductivity mechanism and dielectric relaxations in a low loss giant dielectric (ɛ'˜104) KxTiyNi1-x-yO (KTNO) system with x =0.05-0.30 and y =0.02 over a wide temperature range (200-400K). Below ambient temperature (300K), dc conductivity follows variable range hopping mechanism. The estimated activation energy for dielectric relaxation is found to be higher than the corresponding polaron hopping energy, which is attributed to the combined effect of K-doped grains and highly disordered grain boundary (GB) contributions in KTNO. Observed sharp fall of ɛ' below ˜270K is ascribed to the freezing of charge carriers. Comparatively lower value of relaxation time distribution parameter β of KTNO than that of the CaCu3Ti4O12 (CCTO) system reveals more disorder in KTNO. It is also found that KTNO is structurally more stable compared to the CCTO system, both having giant ɛ' value.

  18. AC and DC conductivity study on Ca substituted bismuth ferrite

    NASA Astrophysics Data System (ADS)

    Pandey, Rabichandra; Pradhan, Lagen Kumar; Kumar, Sunil; Kar, Manoranjan

    2018-05-01

    Bi0.95Ca0.05FeO3 multiferroic compound was synthesized by the citric acid modified sol-gel method. Crystal structure of Bi0.95Ca0.05FeO3 is studied by the X-ray diffraction (XRD) technique. The ac impedance analysis of the compound has been carried out in a wide range of frequency (100 Hz - 1MHz) as well as temperature (40-2500C). Frequency variation of dielectric constant at different temperatures can be understood by the modified Debye formula. The activation energy was found to be 0.48eV, which was obtained by employing Arrhenius equation. The AC conductivity of the sample follows the Johnscher's power law which indicates the presence of hopping type conduction in localized charged states. To understand the conduction mechanism with localized charge states, the DC resistivity data were analyzed by Mott's variable range hopping (VRH) model. The activation energy calculated from Debye relaxation time, AC conductivity and DC resistivity are comparable to each other.

  19. Crowding-facilitated macromolecular transport in attractive micropost arrays.

    PubMed

    Chien, Fan-Tso; Lin, Po-Keng; Chien, Wei; Hung, Cheng-Hsiang; Yu, Ming-Hung; Chou, Chia-Fu; Chen, Yeng-Long

    2017-05-02

    Our study of DNA dynamics in weakly attractive nanofabricated post arrays revealed crowding enhances polymer transport, contrary to hindered transport in repulsive medium. The coupling of DNA diffusion and adsorption to the microposts results in more frequent cross-post hopping and increased long-term diffusivity with increased crowding density. We performed Langevin dynamics simulations and found maximum long-term diffusivity in post arrays with gap sizes comparable to the polymer radius of gyration. We found that macromolecular transport in weakly attractive post arrays is faster than in non-attractive dense medium. Furthermore, we employed hidden Markov analysis to determine the transition of macromolecular adsorption-desorption on posts and hopping between posts. The apparent free energy barriers are comparable to theoretical estimates determined from polymer conformational fluctuations.

  20. Impedance Spectroscopy and AC Conductivity Studies of Bulk 3-Amino-7-(dimethylamino)-2-methyl-hydrochloride

    NASA Astrophysics Data System (ADS)

    El-Shabaan, M. M.

    2018-02-01

    Impedance spectroscopy and alternating-current (AC) conductivity (σ AC) studies of bulk 3-amino-7-(dimethylamino)-2-methyl-hydrochloride (neutral red, NR) have been carried out over the temperature (T) range from 303 K to 383 K and frequency (f) range from 0.5 kHz to 5 MHz. Dielectric data were analyzed using the complex impedance (Z *) and complex electric modulus (M *) for bulk NR at various temperatures. The impedance loss peaks were found to shift towards high frequencies, indicating an increase in the relaxation time (τ 0) and loss in the material, with increasing temperature. For each temperature, a single depressed semicircle was observed at high frequencies, originating from the bulk transport, and a spike in the low-frequency region, resulting from the electrode effect. Fitting of these curves yielded an equivalent circuit containing a parallel combination of a resistance R and constant-phase element (CPE) Q. The carrier transport in bulk NR is governed by the correlated barrier hopping (CBH) mechanism, some parameters of which, such as the maximum barrier height (W M), charge density (N), and hopping distance (r), were determined as functions of both temperature and frequency. The frequency dependence of σ AC at different temperatures indicated that the conduction in bulk NR is a thermally activated process. The σ AC value at different frequencies increased linearly with temperature.

  1. Climate, weather, and hops

    USDA-ARS?s Scientific Manuscript database

    As climate and weather become more variable, hop growers face increased uncertainty in making decisions about their crop. Given the unprecedented nature of these changes, growers may no longer have enough information and intuitive understanding to adequately assess the situation and evaluate their m...

  2. Field-dependent hopping conduction

    NASA Astrophysics Data System (ADS)

    Hayashi, T.; Tokura, Y.; Fujiwara, A.

    2018-07-01

    We have numerically calculated transport characteristics on a Miller-Abraham network in a non-linear regime by solving the Kirchhoff's current law at each site. Assuming the Mott model, we obtained the relation between current density and electric field, J ∝exp(γ√{ E}) , which has often been observed in low-mobility materials and whose mechanism has been a source of controversy for over half a century. Our numerical calculation makes it possible to analyze the energy configuration of relevant hopping sites and visualize percolation networks. Following the percolation theory proposed by Shklovskii [Shklovskii, Sov. Phys. Semicond. 10, 855 (1976)], we show that the main mechanism of the field dependence is the replacement of dominating resistances accompanied by the geometrical evolution of the percolation networks. Our calculation is so general that it can be applied to hopping transport in a variety of systems.

  3. Long-range energy transport in single supramolecular nanofibres at room temperature

    NASA Astrophysics Data System (ADS)

    Haedler, Andreas T.; Kreger, Klaus; Issac, Abey; Wittmann, Bernd; Kivala, Milan; Hammer, Natalie; Köhler, Jürgen; Schmidt, Hans-Werner; Hildner, Richard

    2015-07-01

    Efficient transport of excitation energy over long distances is a key process in light-harvesting systems, as well as in molecular electronics. However, in synthetic disordered organic materials, the exciton diffusion length is typically only around 10 nanometres (refs 4, 5), or about 50 nanometres in exceptional cases, a distance that is largely determined by the probability laws of incoherent exciton hopping. Only for highly ordered organic systems has the transport of excitation energy over macroscopic distances been reported--for example, for triplet excitons in anthracene single crystals at room temperature, as well as along single polydiacetylene chains embedded in their monomer crystalline matrix at cryogenic temperatures (at 10 kelvin, or -263 degrees Celsius). For supramolecular nanostructures, uniaxial long-range transport has not been demonstrated at room temperature. Here we show that individual self-assembled nanofibres with molecular-scale diameter efficiently transport singlet excitons at ambient conditions over more than four micrometres, a distance that is limited only by the fibre length. Our data suggest that this remarkable long-range transport is predominantly coherent. Such coherent long-range transport is achieved by one-dimensional self-assembly of supramolecular building blocks, based on carbonyl-bridged triarylamines, into well defined H-type aggregates (in which individual monomers are aligned cofacially) with substantial electronic interactions. These findings may facilitate the development of organic nanophotonic devices and quantum information technology.

  4. Identification of Mott insulators and Anderson insulators in self-assembled gold nanoparticles thin films

    NASA Astrophysics Data System (ADS)

    Jiang, Cheng-Wei; Ni, I.-Chih; Tzeng, Shien-Der; Wu, Cen-Shawn; Kuo, Watson

    2014-05-01

    How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction.How the interparticle tunnelling affects the charge conduction of self-assembled gold nanoparticles is studied by three means: tuning the tunnel barrier width by different molecule modification and by substrate bending, and tuning the barrier height by high-dose electron beam exposure. All approaches indicate that the metal-Mott insulator transition is governed predominantly by the interparticle coupling strength, which can be quantified by the room temperature sheet resistance. The Hubbard gap, following the prediction of quantum fluctuation theory, reduces to zero rapidly as the sheet resistance decreases to the quantum resistance. At very low temperature, the fate of devices near the Mott transition depends on the strength of disorder. The charge conduction is from nearest-neighbour hopping to co-tunnelling between nanoparticles in Mott insulators whereas it is from variable-range hopping through charge puddles in Anderson insulators. When the two-dimensional nanoparticle network is under a unidirectional strain, the interparticle coupling becomes anisotropic so the average sheet resistance is required to describe the charge conduction. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr06627d

  5. Hopping Conduction in Polymers

    NASA Astrophysics Data System (ADS)

    Bässler, Heinz

    The concept of hopping within a Gaussian density of localized states introduced earlier to rationalize charge transport in random organic photoconductors is developed further to account for temporal features of time of flight (TOF) signals. At moderate degree of energetic disorder (σ/kT~3.5…4.5) there is a transport regime intermediate between dispersive and quasi-Gaussian type whose signatures are (i) universal TOF signals that can appear weakly dispersive despite yielding a well defined carrier mobility and (ii) an asymmetric propagator of the carrier packet yielding a time dependent diffusivity.

  6. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn; School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ

    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loadingmore » concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.« less

  7. Wheeled hopping robot

    DOEpatents

    Fischer, Gary J [Albuquerque, NM

    2010-08-17

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  8. Temperature dependent simulation of diamond depleted Schottky PIN diodes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hathwar, Raghuraj; Dutta, Maitreya; Chowdhury, Srabanti

    2016-06-14

    Diamond is considered as an ideal material for high field and high power devices due to its high breakdown field, high lightly doped carrier mobility, and high thermal conductivity. The modeling and simulation of diamond devices are therefore important to predict the performances of diamond based devices. In this context, we use Silvaco{sup ®} Atlas, a drift-diffusion based commercial software, to model diamond based power devices. The models used in Atlas were modified to account for both variable range and nearest neighbor hopping transport in the impurity bands associated with high activation energies for boron doped and phosphorus doped diamond.more » The models were fit to experimentally reported resistivity data over a wide range of doping concentrations and temperatures. We compare to recent data on depleted diamond Schottky PIN diodes demonstrating low turn-on voltages and high reverse breakdown voltages, which could be useful for high power rectifying applications due to the low turn-on voltage enabling high forward current densities. Three dimensional simulations of the depleted Schottky PIN diamond devices were performed and the results are verified with experimental data at different operating temperatures.« less

  9. A study of H and D doped ZnO epitaxial films grown by pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Li, Y. J.; Kaspar, T. C.; Droubay, T. C.; Joly, A. G.; Nachimuthu, P.; Zhu, Z.; Shutthanandan, V.; Chambers, S. A.

    2008-09-01

    We examine the crystal structure and electrical and optical properties of ZnO epitaxial films grown by pulsed laser deposition in a H2 or D2 ambient. n-type electrical conductivity is enhanced by three orders of magnitude as a result of growing in H2 (D2) compared to ZnO films grown in O2. Hall effect measurements reveal very small carrier activation energies and carrier concentrations in the mid-1018 cm-3 range. Optical absorption measurements show that the enhanced conductivity is not a result of ZnO reduction and interstitial Zn formation. Photoluminescence spectra suggest excitonic emission associated with exciton-hydrogen donor complex formation and show no evidence for midgap emission resulting from defects. We have modeled the transport properties of H (D) doped ZnO films using variable range hopping and surface layer conductivity models, but our data do not fit well with these models. Rather, it appears that growth in H2 (D2) promotes the formation of an exceedingly shallow donor state not seen in ZnO crystals annealed in H2 after growth. This new state may be associated with H (D) substitution at O sites in the lattice.

  10. Magnetic, Electrical and Dielectric Properties of LaMnO3+η Perovskite Manganite.

    NASA Astrophysics Data System (ADS)

    v, Punith Kumar; Dayal, Vijaylakshmi

    The high pure polycrystalline LaMnO3+η perovskite manganite has been synthesized using conventional solid state reaction method. The studied sample crystallizes into orthorhombic O', phase indexed with Pbnm space group. The magnetization measurement exhibits that the studied sample shows paramagnetic (PM) to ferromagnetic (FM) phase transition at TC = 191.6K followed with a frustration due to antiferromagnetic (AFM) kind of spin ordering at low temperature, Tf = 85.8K. The electrical resistivity measurements carried out at 0 tesla and 8 tesla magnetic field exhibits insulating kind of behavior throughout the measured temperature range. The resistivity at 0 tesla exhibits low temperature FM insulator to high temperature PM insulator type phase transition at TC = 191.6K similarly as observed from magnetization measurement. The application of the magnetic field (8 tesla) shifts TC to higher temperature side and the charge transport follows Shklovskii Efros variable range hopping (SE VRH) mechanism. The temperature and frequency dependent dielectric permittivity studied for the sample exhibits relaxation process explained based on Debye +Maxwell-Wagner relaxation mechanism. Department of Atomic Energy-Board of Research in Nuclear Sciences, Government of INDIA.

  11. Gap state analysis in electric-field-induced band gap for bilayer graphene.

    PubMed

    Kanayama, Kaoru; Nagashio, Kosuke

    2015-10-29

    The origin of the low current on/off ratio at room temperature in dual-gated bilayer graphene field-effect transistors is considered to be the variable range hopping in gap states. However, the quantitative estimation of gap states has not been conducted. Here, we report the systematic estimation of the energy gap by both quantum capacitance and transport measurements and the density of states for gap states by the conductance method. An energy gap of ~ 250 meV is obtained at the maximum displacement field of ~ 3.1 V/nm, where the current on/off ratio of ~ 3 × 10(3) is demonstrated at 20 K. The density of states for the gap states are in the range from the latter half of 10(12) to 10(13) eV(-1) cm(-2). Although the large amount of gap states at the interface of high-k oxide/bilayer graphene limits the current on/off ratio at present, our results suggest that the reduction of gap states below ~ 10(11) eV(-1) cm(-2) by continual improvement of the gate stack makes bilayer graphene a promising candidate for future nanoelectronic device applications.

  12. Variable-range-hopping magnetoresistance

    NASA Astrophysics Data System (ADS)

    Azbel, Mark Ya

    1991-03-01

    The hopping magnetoresistance R of a two-dimensional insulator with metallic impurities is considered. In sufficiently weak magnetic fields it increases or decreases depending on the impurity density n: It decreases if n is low and increases if n is high. In high magnetic fields B, it always exponentially increases with √B . Such fields yield a one-dimensional temperature dependence: lnR~1/ √T . The calculation provides an accurate leading approximation for small impurities with one eigenstate in their potential well. In the limit of infinitesimally small impurities, an impurity potential is described by a generalized function. This function, similar to a δ function, is localized at a point, but, contrary to a δ function in the dimensionality above 1, it has finite eigenenergies. Such functions may be helpful in the study of scattering and localization of any waves.

  13. Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

    NASA Astrophysics Data System (ADS)

    K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

    2017-10-01

    The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

  14. Length-Dependent Nanotransport and Charge Hopping Bottlenecks in Long Thiophene-Containing π-Conjugated Molecular Wires.

    PubMed

    Smith, Christopher E; Odoh, Samuel O; Ghosh, Soumen; Gagliardi, Laura; Cramer, Christopher J; Frisbie, C Daniel

    2015-12-23

    Self-assembled conjugated molecular wires containing thiophene up to 6 nm in length were grown layer-by-layer using click chemistry. Reflection-absorption infrared spectroscopy, ellipsometry and X-ray photoelectron spectroscopy were used to follow the stepwise growth. The electronic structure of the conjugated wires was studied with cyclic voltammetry and UV-vis spectroscopy as well as computationally with density functional theory (DFT). The current-voltage curves (±1 V) of the conjugated molecular wires were measured with conducting probe atomic force microscopy (CP-AFM) in which the molecular wire film bound to a gold substrate was contacted with a conductive AFM probe. By systematically measuring the low bias junction resistance as a function of length for molecules 1-4 nm long, we extracted the structure dependent tunneling attenuation factor (β) of 3.4 nm(-1) and a contact resistance of 220 kΩ. The crossover from tunneling to hopping transport was observed at a molecular length of 4-5 nm with an activation energy of 0.35 eV extracted from Arrhenius plots of resistance versus temperature. DFT calculations revealed localizations of spin densities (polarons) on molecular wire radical cations. The calculations were employed to gauge transition state energies for hopping of polarons along wire segments. Individual estimated transition state energies were 0.2-0.4 eV, in good agreement with the experimental activation energy. The transition states correspond to flattening of dihedral angles about specific imine bonds. These results open up possibilities to further explore the influence of molecular architecture on hopping transport in molecular junctions, and highlight the utility of DFT to understand charge localization and associated hopping-based transport.

  15. Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States

    NASA Astrophysics Data System (ADS)

    Mendels, Dan; Organic Electronics Group Technion Team

    2014-03-01

    An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

  16. Leg kinematics and kinetics in landing from a single-leg hop for distance. A comparison between dominant and non-dominant leg.

    PubMed

    van der Harst, J J; Gokeler, A; Hof, A L

    2007-07-01

    Anterior cruciate ligament (ACL) deficiency can be a major problem for athletes and subsequent reconstruction of the ACL may be indicated if a conservative regimen has failed. After ACL reconstruction signs of abnormality in the use of the leg remain for a long time. It is expected that the landing after a single-leg hop for distance (horizontal hop) might give insight in the differences in kinematics and kinetics between uninjured legs and ACL-reconstructed legs. Before the ACL-reconstructed leg can be compared with the contralateral leg, knowledge of differences between legs of uninjured subjects is needed. Kinematic and kinetic variables of both legs were measured with an optoelectronic system and a force plate and calculated by inverse dynamics. The dominant leg (the leg with biggest horizontal hop distance) and the contralateral leg of nine uninjured subjects were compared. No significant differences were found in most of the kinematic and kinetic variables between dominant leg and contralateral leg of uninjured subjects. Only hop distance and hip extension angles differed significantly. This study suggests that there are no important differences between dominant leg and contralateral leg in healthy subjects. As a consequence, the uninvolved leg of ACL-reconstructed patients can be used as a reference. The observed variables of this study can be used as a reference of normal values and normal differences between legs in healthy subjects.

  17. Polaronic conductivity and scaling behavior of lithium iron phosphate glass

    NASA Astrophysics Data System (ADS)

    Banday, Azeem; Murugavel, Sevi

    2018-05-01

    Charge transport properties of the Lithium Iron Phosphate (LFP) glass has been investigated in a wide frequency and temperature range by means of broadband dielectric spectroscopy. The conductivity spectra has been studied on the basis of Jonscher power law for characterizing the hopping dynamics of charge carriers. The ac conductivity and scaling behavior of the LFP glass has been studied in the temperature range from 333K to 573K and frequency range from 100 mHz to 1 MHz. The conductivity isotherms of LFP glass do not superimpose upon each other by using Summerfield scaling. The structural peculiarities in the material could result in different conduction pathways giving rise to the deviation from Summerfield scaling.

  18. Intensity-level assessment of lower body plyometric exercises based on mechanical output of lower limb joints.

    PubMed

    Sugisaki, Norihide; Okada, Junichi; Kanehisa, Hiroaki

    2013-01-01

    The present study aimed to quantify the intensity of lower extremity plyometric exercises by determining joint mechanical output. Ten men (age, 27.3 ± 4.1 years; height, 173.6 ± 5.4 cm; weight, 69.4 ± 6.0 kg; 1-repetition maximum [1RM] load in back squat 118.5 ± 12.0 kg) performed the following seven plyometric exercises: two-foot ankle hop, repeated squat jump, double-leg hop, depth jumps from 30 and 60 cm, and single-leg and double-leg tuck jumps. Mechanical output variables (torque, angular impulse, power, and work) at the lower limb joints were determined using inverse-dynamics analysis. For all measured variables, ANOVA revealed significant main effects of exercise type for all joints (P < 0.05) along with significant interactions between joint and exercise (P < 0.01), indicating that the influence of exercise type on mechanical output varied among joints. Paired comparisons revealed that there were marked differences in mechanical output at the ankle and hip joints; most of the variables at the ankle joint were greatest for two-foot ankle hop and tuck jumps, while most hip joint variables were greatest for repeated squat jump or double-leg hop. The present results indicate the necessity for determining mechanical output for each joint when evaluating the intensity of plyometric exercises.

  19. Energetics and biomechanics of locomotion by red kangaroos (Macropus rufus).

    PubMed

    Kram, R; Dawson, T J

    1998-05-01

    As red kangaroos hop faster over level ground, their rate of oxygen consumption (indicating metabolic energy consumption) remains nearly the same. This phenomenon has been attributed to exceptional elastic energy storage and recovery via long compliant tendons in the legs. Alternatively, red kangaroos may have exceptionally efficient muscles. To estimate efficiency, we measured the metabolic cost of uphill hopping, where muscle fibers must perform mechanical work against gravity. We found that uphill hopping was much more expensive than level hopping. The maximal rate of oxygen consumption measured (3 ml O2 kg-1 s-1) exceeds all but a few vertebrate species. However, efficiency values were normal, approximately 30%. At faster level hopping speeds the effective mechanical advantage of the extensor muscles of the ankle joint remained the same. Thus, kangaroos generate the same muscular force at all speeds but do so more rapidly at faster hopping speeds. This contradicts a recent hypothesis for what sets the cost of locomotion. The cost of transport (J kg-1 m-1) decreases at faster hopping speeds, yet red kangaroos prefer to use relatively slow speeds that avoid high levels of tendon stress.

  20. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    NASA Astrophysics Data System (ADS)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  1. Mechanisms of Hop Inhibition Include the Transmembrane Redox Reaction▿

    PubMed Central

    Behr, Jürgen; Vogel, Rudi F.

    2010-01-01

    In this work, a novel mechanistic model of hop inhibition beyond the proton ionophore action toward (beer spoiling) bacteria was developed. Investigations were performed with model systems using cyclic voltammetry for the determination of redox processes/conditions in connection with growth challenges with hop-sensitive and -resistant Lactobacillus brevis strains in the presence of oxidants. Cyclic voltammetry identified a transmembrane redox reaction of hop compounds at low pH (common in beer) and in the presence of manganese (present in millimolar levels in lactic acid bacteria). The antibacterial action of hop compounds could be extended from the described proton ionophore activity, lowering the intracellular pH, to pronounced redox reactivity, causing cellular oxidative damage. Accordingly, a correlation between the resistance of L. brevis strains to a sole oxidant to their resistance to hop could not be expected and was not detected. However, in connection with our recent study concerning hop ionophore properties and the resistance of hop-sensitive and -tolerant L. brevis strains toward proton ionophores (J. Behr and R. F. Vogel, J. Agric. Food Chem. 57:6074-6081, 2009), we suggest that both ionophore and oxidant resistance are required for survival under hop stress conditions and confirmed this correlation according to the novel mechanistic model. In consequence, the expression of several published hop resistance mechanisms involved in manganese binding/transport and intracellular redox balance, as well as that of proteins involved in oxidative stress under “highly reducing” conditions (cf. anaerobic cultivation and “antioxidative” hop compounds in the growth medium), is now comprehensible. Accordingly, hop resistance as a multifactorial dynamic property at least implies distinct resistance levels against two different mechanisms of hop inhibition, namely, proton ionophore-induced and oxidative stress-induced mechanisms. Beyond this specific model of hop inhibition, these investigations provide general insight on the role of electrophysiology and ion homeostasis in bacterial stress responses to membrane-active drugs. PMID:19880646

  2. Structure, magnetism and electronic properties in 3d-5d based double perovskite ({Sr_{1-x}} Y x )2FeIrO6

    NASA Astrophysics Data System (ADS)

    Kharkwal, K. C.; Pramanik, A. K.

    2017-12-01

    The 3d-5d based double perovskites are of current interest as they provide model systems to study the interplay between electronic correlation (U) and spin-orbit coupling (SOC). Here, we report detailed structural, magnetic and transport properties of doped double perovskite material (Sr1-x Y x )2FeIrO6 with x ≤slant 0.2 . With substitution of Y, the system retains its original crystal structure but structural parameters change with x in nonmonotonic fashion. The magnetization data for Sr2FeIrO6 show antiferromagnetic type magnetic transition around 45 K however, a close inspection of the data indicates a weak magnetic phase transition around 120 K. No change of structural symmetry has been observed down to low temperature, although the lattice parameters show sudden changes around the magnetic transitions. Sr2FeIrO6 shows an insulating behavior over the whole temperature range, which nevertheless does not change with Y substitution. The nature of charge conduction is found to follow thermally activated Mott’s variable range hopping and power law behavior for parent and doped samples, respectively. Interestingly, evolution of structural, magnetic and transport behavior in (Sr1-x Y x )2FeIrO6 is observed to reverse with x > 0.1 , which is believed to arise due to a change in the transition metal ionic state.

  3. Structure, magnetism and electronic properties in 3d-5d based double perovskite ([Formula: see text]Y x )2FeIrO6.

    PubMed

    Kharkwal, K C; Pramanik, A K

    2017-11-13

    The 3d-5d based double perovskites are of current interest as they provide model systems to study the interplay between electronic correlation (U) and spin-orbit coupling (SOC). Here, we report detailed structural, magnetic and transport properties of doped double perovskite material ([Formula: see text]Y x ) 2 FeIrO 6 with [Formula: see text]. With substitution of Y, the system retains its original crystal structure but structural parameters change with x in nonmonotonic fashion. The magnetization data for Sr 2 FeIrO 6 show antiferromagnetic type magnetic transition around 45 K; however, a close inspection of the data indicates a weak magnetic phase transition around 120 K. No change of structural symmetry has been observed down to low temperature, although the lattice parameters show sudden changes around the magnetic transitions. Sr 2 FeIrO 6 shows an insulating behavior over the whole temperature range, which nevertheless does not change with Y substitution. The nature of charge conduction is found to follow thermally activated Mott's variable range hopping and power law behavior for parent and doped samples, respectively. Interestingly, evolution of structural, magnetic and transport behavior in ([Formula: see text]Y x ) 2 FeIrO 6 is observed to reverse with [Formula: see text], which is believed to arise due to a change in the transition metal ionic state.

  4. Study of structural, electronic and magneto transport properties of La0.7Ca0.2-xSrxAg0.1MnO3

    NASA Astrophysics Data System (ADS)

    Subhashini, P.; Munirathinum, B.; Krishnaiah, M.; Venkatesh, R.; Venkateswarlu, D.; Ganesan, V.

    2016-10-01

    Structural, electrical and magneto transport properties of Lanthanum based manganites La0.7Ca0.2-xSrxAg0.1MnO3 (x=0 & 0.1) synthesized by low temperature nitrate route is studied systematically. The X-ray Diffraction patterns confirm the presence of orthorhombic structure with Pnma space group. The temperature dependence of MR (-35%) from 233-272K for x=0 and an MR (-26%) from 281-309K for x=0.1composition with an overall variation of 1% is very much advantageous for device application. Interestingly, in low temperature regime, the MR value of -47% obtained in x=0.1 composition at 10T around 5K is 20% higher than the MR obtained at 10T around the metal insulator transition. Significant changes happening in the low temperature MR measurements is discussed in the light of electron-electron interactions and weak localization mechanisms while the additional broad hump responsible for flat MR is attributed to the intrinsic electronic in homogeneity driven phase competition created due to the presence of mono valent Ag ions. The complex localization mechanism associated with insulating regime is in accordance with Variable range hopping of small polarons.

  5. Electron transport in reduced graphene oxides in high electric field

    NASA Astrophysics Data System (ADS)

    Jian, Wen-Bin; Lai, Jian-Jhong; Wang, Sheng-Tsung; Tsao, Rui-Wen; Su, Min-Chia; Tsai, Wei-Yu; Rosenstein, Baruch; Zhou, Xufeng; Liu, Zhaoping

    Due to a honeycomb structure, charge carriers in graphene exhibit quasiparticles of linear energy-momentum dispersion and phenomena of Schwinger pair creation may be explored. Because graphene is easily broken in high electric fields, single-layer reduced graphene oxides (rGO) are used instead. The rGO shows a small band gap while it reveals a graphene like behavior in high electric fields. Electron transport in rGO exhibits two-dimensional Mott's variable range hopping. The temperature behavior of resistance in low electric fields and the electric field behavior of resistance at low temperatures are all well explained by the Mott model. At temperatures higher than 200 K, the electric field behavior does not agree with the model while it shows a power law behavior with an exponent of 3/2, being in agreement with the Schwinger model. Comparing with graphene, the rGO is more sustainable to high electric field thus presenting a complete high-electric field behavior. When the rGO is gated away from the charge neutral point, the turn-on electric field of Schwinger phenomena is increased. A summary figure is given to present electric field behaviors and power law variations of resistances of single-layer rGO, graphene, and MoS2.

  6. Measuring long-range carrier diffusion across multiple grains in polycrystalline semiconductors by photoluminescence imaging

    PubMed Central

    Alberi, K.; Fluegel, B.; Moutinho, H.; Dhere, R. G.; Li, J. V.; Mascarenhas, A.

    2013-01-01

    Thin-film polycrystalline semiconductors are currently at the forefront of inexpensive large-area solar cell and integrated circuit technologies because of their reduced processing and substrate selection constraints. Understanding the extent to which structural and electronic defects influence carrier transport in these materials is critical to controlling the optoelectronic properties, yet many measurement techniques are only capable of indirectly probing their effects. Here we apply a novel photoluminescence imaging technique to directly observe the low temperature diffusion of photocarriers through and across defect states in polycrystalline CdTe thin films. Our measurements show that an inhomogeneous distribution of localized defect states mediates long-range hole transport across multiple grain boundaries to locations exceeding 10 μm from the point of photogeneration. These results provide new insight into the key role deep trap states have in low temperature carrier transport in polycrystalline CdTe by revealing their propensity to act as networks for hopping conduction. PMID:24158163

  7. Hop Distance Symmetry Does Not Indicate Normal Landing Biomechanics in Adolescent Athletes With Recent Anterior Cruciate Ligament Reconstruction.

    PubMed

    Wren, Tishya A L; Mueske, Nicole M; Brophy, Christopher H; Pace, J Lee; Katzel, Mia J; Edison, Bianca R; VandenBerg, Curtis D; Zaslow, Tracy L

    2018-03-30

    Study Design Retrospective cohort. Background Return to sport (RTS) protocols after anterior cruciate ligament reconstruction (ACLR) often include assessment of hop distance symmetry. However, it is unclear if movement deficits are present regardless of hop symmetry. Objectives To assess biomechanics and symmetry of adolescent athletes following ACLR during a single leg hop for distance. Methods Forty-six patients with ACLR (5-12 months post-surgery; 27 female; age 15.6, SD 1.7 years) were classified as asymmetric (operative limb hop distance <90% of non-operative limb; n=17) or symmetric (n=29). Lower extremity biomechanics were compared among operative and contralateral limbs and 24 symmetric controls (12 female; age 14.7, SD 1.5 years) using ANOVA. Results Compared to controls, asymmetric patients hopped a shorter distance on their operative limb (P<0.001), while symmetric patients hopped an intermediate distance on both sides (P≥0.12). During landing, operative limbs, regardless of hop distance, exhibited lower knee flexion moments compared to controls and the contralateral side (P≤0.04) with lower knee energy absorption than the contralateral side (P≤0.006). During take-off, both symmetric and asymmetric patients had less hip extension and smaller ankle range of motion on the operative side compared with controls (P≤0.05). Asymmetric patients also had lower hip range of motion on the operative, compared with the contralateral, side (P=0.001). Conclusion Both symmetric and asymmetric patients offloaded the operative knee; symmetric patients achieved symmetry in part by hopping a shorter distance on the contralateral side. Therefore, hop distance symmetry may not be an adequate test of single limb function and RTS readiness. Level of Evidence 2b. J Orthop Sports Phys Ther, Epub 30 Mar 2018. doi:10.2519/jospt.2018.7817.

  8. Hopping robot

    DOEpatents

    Spletzer, Barry L.; Fischer, Gary J.; Marron, Lisa C.; Martinez, Michael A.; Kuehl, Michael A.; Feddema, John T.

    2001-01-01

    The present invention provides a hopping robot that includes a misfire tolerant linear actuator suitable for long trips, low energy steering and control, reliable low energy righting, miniature low energy fuel control. The present invention provides a robot with hopping mobility, capable of traversing obstacles significant in size relative to the robot and capable of operation on unpredictable terrain over long range. The present invention further provides a hopping robot with misfire-tolerant combustion actuation, and with combustion actuation suitable for use in oxygen-poor environments.

  9. Reverse leakage current characteristics of InGaN/GaN multiple quantum well ultraviolet/blue/green light-emitting diodes

    NASA Astrophysics Data System (ADS)

    Zhou, Shengjun; Lv, Jiajiang; Wu, Yini; Zhang, Yuan; Zheng, Chenju; Liu, Sheng

    2018-05-01

    We investigated the reverse leakage current characteristics of InGaN/GaN multiple quantum well (MQW) near-ultraviolet (NUV)/blue/green light-emitting diodes (LEDs). Experimental results showed that the NUV LED has the smallest reverse leakage current whereas the green LED has the largest. The reason is that the number of defects increases with increasing nominal indium content in InGaN/GaN MQWs. The mechanism of the reverse leakage current was analyzed by temperature-dependent current–voltage measurement and capacitance–voltage measurement. The reverse leakage currents of NUV/blue/green LEDs show similar conduction mechanisms: at low temperatures, the reverse leakage current of these LEDs is attributed to variable-range hopping (VRH) conduction; at high temperatures, the reverse leakage current of these LEDs is attributed to nearest-neighbor hopping (NNH) conduction, which is enhanced by the Poole–Frenkel effect.

  10. Effect of rare-earth substitution at La-site on structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds (x = 0, 0.2, 0.3; RE = Eu, Gd, Y)

    NASA Astrophysics Data System (ADS)

    Choudhary, Y. R. S.; Mangavati, Suraj; Patil, Siddanagouda; Rao, Ashok; Nagaraja, B. S.; Thomas, Riya; Okram, G. S.; Kini, Savitha G.

    2018-04-01

    In the present communication, we present results on the effect of rare-earth (RE) substitution at La-site on the structural, electrical and thermoelectric properties of La0.7-xRExSr0.3MnO3 compounds. The lattice parameters are observed to decrease with RE-doping which is attributed to the fact that the substituted RE ions (RE = Eu, Gd and Y) are smaller than that of La ion. In high temperature semiconducting regime, small polaron hopping (SPH) model is valid, whereas, variable hopping model is valid in low temperature metallic region. The resistivity in the entire temperature range follows percolation model. All the samples exhibit sign reversal in thermopower, S. From temperature dependent S data, it is seen that SPH model is applicable in high temperature regime.

  11. Variable tunneling barriers in FEBID based PtC metal-matrix nanocomposites as a transducing element for humidity sensing.

    PubMed

    Kolb, Florian; Schmoltner, Kerstin; Huth, Michael; Hohenau, Andreas; Krenn, Joachim; Klug, Andreas; List, Emil J W; Plank, Harald

    2013-08-02

    The development of simple gas sensing concepts is still of great interest for science and technology. The demands on an ideal device would be a single-step fabrication method providing a device which is sensitive, analyte-selective, quantitative, and reversible without special operating/reformation conditions such as high temperatures or special environments. In this study we demonstrate a new gas sensing concept based on a nanosized PtC metal-matrix system fabricated in a single step via focused electron beam induced deposition (FEBID). The sensors react selectively on polar H2O molecules quantitatively and reversibly without any special reformation conditions after detection events, whereas non-polar species (O2, CO2, N2) produce no response. The key elements are isolated Pt nanograins (2-3 nm) which are embedded in a dielectric carbon matrix. The electrical transport in such materials is based on tunneling effects in the correlated variable range hopping regime, where the dielectric carbon matrix screens the electric field between the particles, which governs the final conductivity. The specific change of these dielectric properties by the physisorption of polar gas molecules (H2O) can change the tunneling probability and thus the overall conductivity, allowing their application as a simple and straightforward sensing concept.

  12. Non-Hermitian bidirectional robust transport

    NASA Astrophysics Data System (ADS)

    Longhi, Stefano

    2017-01-01

    Transport of quantum or classical waves in open systems is known to be strongly affected by non-Hermitian terms that arise from an effective description of system-environment interaction. A simple and paradigmatic example of non-Hermitian transport, originally introduced by Hatano and Nelson two decades ago [N. Hatano and D. R. Nelson, Phys. Rev. Lett. 77, 570 (1996), 10.1103/PhysRevLett.77.570], is the hopping dynamics of a quantum particle on a one-dimensional tight-binding lattice in the presence of an imaginary vectorial potential. The imaginary gauge field can prevent Anderson localization via non-Hermitian delocalization, opening up a mobility region and realizing robust transport immune to disorder and backscattering. Like for robust transport of topologically protected edge states in quantum Hall and topological insulator systems, non-Hermitian robust transport in the Hatano-Nelson model is unidirectional. However, there is not any physical impediment to observe robust bidirectional non-Hermitian transport. Here it is shown that in a quasi-one-dimensional zigzag lattice, with non-Hermitian (imaginary) hopping amplitudes and a synthetic gauge field, robust transport immune to backscattering can occur bidirectionally along the lattice.

  13. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping.

    PubMed

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-09-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results.

  14. Correlation between hip function and knee kinematics evaluated by three-dimensional motion analysis during lateral and medial side-hopping

    PubMed Central

    Itoh, Hiromitsu; Takiguchi, Kohei; Shibata, Yohei; Okubo, Satoshi; Yoshiya, Shinichi; Kuroda, Ryosuke

    2016-01-01

    [Purpose] Kinematic and kinetic characteristics of the limb during side-hopping and hip/knee interaction during this motion have not been clarified. The purposes of this study were to examine the biomechanical parameters of the knee during side hop and analyze its relationship with clinical measurements of hip function. [Subjects and Methods] Eleven male college rugby players were included. A three-dimensional motion analysis system was used to assess motion characteristics of the knee during side hop. In addition, hip range of motion and muscle strength were evaluated. Subsequently, the relationship between knee motion and the clinical parameters of the hip was analyzed. [Results] In the lateral touchdown phase, the knee was positioned in an abducted and externally rotated position, and increasing abduction moment was applied to the knee. An analysis of the interaction between knee motion and hip function showed that range of motion for hip internal rotation was significantly correlated with external rotation angle and external rotation/abduction moments of the knee during the lateral touchdown phase. [Conclusion] Range of motion for hip internal rotation should be taken into consideration for identifying the biomechanical characteristics in the side hop test results. PMID:27799670

  15. The impact of hop bitter acid and polyphenol profiles on the perceived bitterness of beer.

    PubMed

    Oladokun, Olayide; Tarrega, Amparo; James, Sue; Smart, Katherine; Hort, Joanne; Cook, David

    2016-08-15

    Thirty-four commercial lager beers were analysed for their hop bitter acid, phenolic acid and polyphenol contents. Based on analytical data, it was evident that the beers had been produced using a range of different raw materials and hopping practices. Principal Components Analysis was used to select a sub-set of 10 beers that contained diverse concentrations of the analysed bitter compounds. These beers were appraised sensorially to determine the impacts of varying hop acid and polyphenolic profiles on perceived bitterness character. Beers high in polyphenol and hop acid contents were perceived as having 'harsh' and 'progressive' bitterness, whilst beers that had evidently been conventionally hopped were 'sharp' and 'instant' in their bitterness. Beers containing light-stable hop products (tetrahydro-iso-α-acids) were perceived as 'diminishing', 'rounded' and 'acidic' in bitterness. The hopping strategy adopted by brewers impacts on the nature, temporal profile and intensity of bitterness perception in beer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Exciton-Delocalizing Ligands Can Speed Up Energy Migration in Nanocrystal Solids.

    PubMed

    Azzaro, Michael S; Dodin, Amro; Zhang, Diana Y; Willard, Adam P; Roberts, Sean T

    2018-05-09

    Researchers have long sought to use surface ligands to enhance energy migration in nanocrystal solids by decreasing the physical separation between nanocrystals and strengthening their electronic coupling. Exciton-delocalizing ligands, which possess frontier molecular orbitals that strongly mix with nanocrystal band-edge states, are well-suited for this role because they can facilitate carrier-wave function extension beyond the nanocrystal core, reducing barriers for energy transfer. This report details the use of the exciton-delocalizing ligand phenyldithiocarbamate (PDTC) to tune the transport rate and diffusion length of excitons in CdSe nanocrystal solids. A film composed of oleate-terminated CdSe nanocrystals is subjected to a solid-state ligand exchange to replace oleate with PDTC. Exciton migration in the films is subsequently investigated by femtosecond transient absorption. Our experiments indicate that the treatment of nanocrystal films with PDTC leads to rapid (∼400 fs) downhill energy migration (∼80 meV), while no such migration occurs in oleate-capped films. Kinetic Monte Carlo simulations allow us to extract both rates and length scales for exciton diffusion in PDTC-treated films. These simulations reproduce dynamics observed in transient absorption measurements over a range of temperatures and confirm excitons hop via a Miller-Abrahams mechanism. Importantly, our experiments and simulations show PDTC treatment increases the exciton hopping rate to 200 fs, an improvement of 5 orders of magnitude relative to oleate-capped films. This exciton hopping rate stands as one of the fastest determined for CdSe solids. The facile, room-temperature processing and improved transport properties offered by the solid-state exchange of exciton-delocalizing ligands show they offer promise for the construction of strongly coupled nanocrystal arrays.

  17. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

    PubMed

    Liu, Zechang; Wang, Liping; Liu, Yumei

    2018-01-18

    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  18. Structural versus electrical properties of an organic-inorganic hybrid material based on sulfate

    NASA Astrophysics Data System (ADS)

    Ben Rached, Asma; Guionneau, Philippe; Lebraud, Eric; Mhiri, Tahar; Elaoud, Zakaria

    2017-01-01

    A new organo-sulfate compound is obtained by slow evaporation at room temperature and is characterized by powder and single-crystal X-ray diffraction (XRD) at variable temperatures. The benzylammonium monohydrogenosulfate of formula C6H5CH2NH3+. HSO4-, denoted (BAS), crystallizes in the monoclinic system P21/c space group with the following parameters at room temperature: a=5.623(5)Å, b=20.239(5) Å, c=8.188(5)Å, β=94.104(5)°. The crystal structure consists of infinite parallel two-dimensional planes built by HSO4- anions and C6H5CH2NH3+ cations interconnected by strong O-H….. O and N-H….. O hydrogen bonds. A phase transition is detected at 350 K by differential scanning calorimetry (DSC) and confirmed by powder XRD. Conductivity measurements using the impedance spectroscopy technique allow to determine the conductivity relaxation parameters associated with the H+ conduction from an analysis of the M"/M"max spectrum measured in a wide temperature range. Transport properties of this material appear to be due to an H+ ion hopping mechanism.

  19. Etching-free patterning method for electrical characterization of atomically thin MoSe2 films grown by chemical vapor deposition.

    PubMed

    Utama, M Iqbal Bakti; Lu, Xin; Zhan, Da; Ha, Son Tung; Yuan, Yanwen; Shen, Zexiang; Xiong, Qihua

    2014-11-07

    Patterning two-dimensional materials into specific spatial arrangements and geometries is essential for both fundamental studies of materials and practical applications in electronics. However, the currently available patterning methods generally require etching steps that rely on complicated and expensive procedures. We report here a facile patterning method for atomically thin MoSe2 films using stripping with an SU-8 negative resist layer exposed to electron beam lithography. Additional steps of chemical and physical etching were not necessary in this SU-8 patterning method. The SU-8 patterning was used to define a ribbon channel from a field effect transistor of MoSe2 film, which was grown by chemical vapor deposition. The narrowing of the conduction channel area with SU-8 patterning was crucial in suppressing the leakage current within the device, thereby allowing a more accurate interpretation of the electrical characterization results from the sample. An electrical transport study, enabled by the SU-8 patterning, showed a variable range hopping behavior at high temperatures.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, Jie; Yan, Jiaqiang; Aczel, Adam A.

    The structural, electrical, and magnetic properties of the double perovskite Ba 2LuReO 6 have been examined in this paper. It is an insulator whose temperature dependent conductivity is consistent with variable range hopping electrical transport. A transition to an antiferromagnet state with type I order occurs below T N = 31 K. High resolution time-of-flight neutron powder diffraction measurements show that it retains the cubic double perovskite structure down to 10 K. High intensity, low resolution neutron powder diffraction measurements confirm the antiferromagnetic order and indicate that cubic symmetry is still observed at 1.5 K. The small ordered moment ofmore » 0.34(4)μ B per Re is comparable to estimates of moments on 5d 2 ions in other antiferromagnetically ordered cubic double perovskites. Finally, comparisons with related double perovskites containing 5d 2 ions, such as Os 6+ and Re 5+, reveal that subtle changes in structure or electron configuration of the diamagnetic octahedral cations can have a large impact on the magnetic ground state, the size of the ordered moment, and the Néel temperature.« less

  1. Magnetoresistance in two-dimensional array of Ge/Si quantum dots

    NASA Astrophysics Data System (ADS)

    Stepina, N. P.; Koptev, E. S.; Pogosov, A. G.; Dvurechenskii, A. V.; Nikiforov, A. I.; Zhdanov, E. Yu

    2012-07-01

    Magnetoresistance in two-dimensional array of Ge/Si was studied for a wide range of the conductance, where the transport regime changes from hopping to diffusive one. The behavior of magnetoresistance is similar for all samples; it is negative in weak fields and becomes positive with increasing of magnetic field. Negative magnetoresistance can be described in the frame of weak localization approach with suggestion that quantum interference contribution to the conductance is restricted not only by the phase breaking length but also by the localization length.

  2. Staircase Quantum Dots Configuration in Nanowires for Optimized Thermoelectric Power

    PubMed Central

    Li, Lijie; Jiang, Jian-Hua

    2016-01-01

    The performance of thermoelectric energy harvesters can be improved by nanostructures that exploit inelastic transport processes. One prototype is the three-terminal hopping thermoelectric device where electron hopping between quantum-dots are driven by hot phonons. Such three-terminal hopping thermoelectric devices have potential in achieving high efficiency or power via inelastic transport and without relying on heavy-elements or toxic compounds. We show in this work how output power of the device can be optimized via tuning the number and energy configuration of the quantum-dots embedded in parallel nanowires. We find that the staircase energy configuration with constant energy-step can improve the power factor over a serial connection of a single pair of quantum-dots. Moreover, for a fixed energy-step, there is an optimal length for the nanowire. Similarly for a fixed number of quantum-dots there is an optimal energy-step for the output power. Our results are important for future developments of high-performance nanostructured thermoelectric devices. PMID:27550093

  3. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    PubMed

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  4. Polaron hopping in olivine phosphates studied by nuclear resonant scattering

    NASA Astrophysics Data System (ADS)

    Tracy, Sally June

    Valence fluctuations of Fe2+ and Fe3+ were studied in a solid solution of LixFePO4 by nuclear resonant forward scattering of synchrotron x rays while the sample was heated in a diamond-anvil pressure cell. The spectra acquired at different temperatures and pressures were analyzed for the frequencies of valence changes using the Blume-Tjon model of a system with a fluctuating Hamiltonian. These frequencies were analyzed to obtain activation energies and an activation volume for polaron hopping. There was a large suppression of hopping frequency with pressure, giving an anomalously large activation volume. This large, positive value is typical of ion diffusion, which indicates correlated motions of polarons, and Li+ ions that alter the dynamics of both. In a parallel study of NaxFePO4, the interplay between sodium ordering and electron mobility was investigated using a combination of synchrotron x-ray diffraction and nuclear resonant scattering. Conventional Mossbauer spectra were collected while the sample was heated in a resistive furnace. An analysis of the temperature evolution of the spectral shapes was used to identify the onset of fast electron hopping and determine the polaron hopping rate. Synchrotron x-ray diffraction measurements were carried out in the same temperature range. Reitveld analysis of the diffraction patterns was used to determine the temperature of sodium redistribution on the lattice. The diffraction analysis also provides new information about the phase stability of the system. The temperature evolution of the iron site occupancies from the Mossbauer measurements, combined with the synchrotron diffraction results give strong evidence for a relationship between the onset of fast electron dynamics and the redistribution of sodium in the lattice. Measurements of activation barriers for polaron hopping gave fundamental insights about the correlation between electronic carriers and mobile ions. This work established that polaron-ion interactions can alter the local dynamics of electron and ion transport. These types of coupled processes may be common in many materials used for battery electrodes, and new details concerning the influence of polaron-ion interactions on the charge dynamics are relevant to optimizing their electrochemical performance.

  5. Single-molecule tracking of tau reveals fast kiss-and-hop interaction with microtubules in living neurons

    PubMed Central

    Janning, Dennis; Igaev, Maxim; Sündermann, Frederik; Brühmann, Jörg; Beutel, Oliver; Heinisch, Jürgen J.; Bakota, Lidia; Piehler, Jacob; Junge, Wolfgang; Brandt, Roland

    2014-01-01

    The microtubule-associated phosphoprotein tau regulates microtubule dynamics and is involved in neurodegenerative diseases collectively called tauopathies. It is generally believed that the vast majority of tau molecules decorate axonal microtubules, thereby stabilizing them. However, it is an open question how tau can regulate microtubule dynamics without impeding microtubule-dependent transport and how tau is also available for interactions other than those with microtubules. Here we address this apparent paradox by fast single-molecule tracking of tau in living neurons and Monte Carlo simulations of tau dynamics. We find that tau dwells on a single microtubule for an unexpectedly short time of ∼40 ms before it hops to the next. This dwell time is 100-fold shorter than previously reported by ensemble measurements. Furthermore, we observed by quantitative imaging using fluorescence decay after photoactivation recordings of photoactivatable GFP–tagged tubulin that, despite this rapid dynamics, tau is capable of regulating the tubulin–microtubule balance. This indicates that tau's dwell time on microtubules is sufficiently long to influence the lifetime of a tubulin subunit in a GTP cap. Our data imply a novel kiss-and-hop mechanism by which tau promotes neuronal microtubule assembly. The rapid kiss-and-hop interaction explains why tau, although binding to microtubules, does not interfere with axonal transport. PMID:25165145

  6. Quantum Spin Dynamics with Pairwise-Tunable, Long-Range Interactions

    DTIC Science & Technology

    2016-08-05

    rection of the arrows. Dashed (dotted) lines mark the NNN hopping terms (coefficients ±t2). NNNN long -range hopping along curved lines are included to...Quantum spin dynamics with pairwise-tunable, long -range interactions C.-L. Hunga,b,1,2, Alejandro González-Tudelac,1,2, J. Ignacio Ciracc, and H. J...atoms) that interact by way of a variety of processes, such as atomic collisions. Such pro- cesses typically lead to short -range, nearest-neighbor

  7. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    DOE PAGES

    Ha, Dong -Gwang; Kim, Jang -Joo; Baldo, Marc A.

    2016-04-29

    Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl) amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl) benzene (BmPyPb)more » mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. Furthermore, the analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

  8. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ha, Dong-Gwang; Kim, Jang-Joo; Baldo, Marc A.

    2016-04-01

    Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs). Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenyl)amine (TCTA) :1,3-bis(3,5-dipyrid-3-yl-phenyl)benzene (BmPyPb) mixtures withmore » different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.« less

  9. Rapid differentiation of citrus Hop stunt viroid variants by use of real-time RT-PCR and high resolution melting analysis

    USDA-ARS?s Scientific Manuscript database

    The RNA genome of Hop stunt viroid (HSVd) contains five to six nucleotides in a variable (V) domain, called the cachexia expression motif, which is associated with pathogenic and non-pathogenic variants in citrus. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological i...

  10. Unity quantum yield of photogenerated charges and band-like transport in quantum-dot solids.

    PubMed

    Talgorn, Elise; Gao, Yunan; Aerts, Michiel; Kunneman, Lucas T; Schins, Juleon M; Savenije, T J; van Huis, Marijn A; van der Zant, Herre S J; Houtepen, Arjan J; Siebbeles, Laurens D A

    2011-09-25

    Solid films of colloidal quantum dots show promise in the manufacture of photodetectors and solar cells. These devices require high yields of photogenerated charges and high carrier mobilities, which are difficult to achieve in quantum-dot films owing to a strong electron-hole interaction and quantum confinement. Here, we show that the quantum yield of photogenerated charges in strongly coupled PbSe quantum-dot films is unity over a large temperature range. At high photoexcitation density, a transition takes place from hopping between localized states to band-like transport. These strongly coupled quantum-dot films have electrical properties that approach those of crystalline bulk semiconductors, while retaining the size tunability and cheap processing properties of colloidal quantum dots.

  11. Stepping stones in the electron transport from cells to electrodes in Geobacter sulfurreducens biofilms.

    PubMed

    Bonanni, Pablo Sebastián; Massazza, Diego; Busalmen, Juan Pablo

    2013-07-07

    Geobacter sulfurreducens bacteria grow on biofilms and have the particular ability of using polarized electrodes as the final electron acceptor of their respiratory chain. In these biofilms, electrons are transported through distances of more than 50 μm before reaching the electrode. The way in which electrons are transported across the biofilm matrix through such large distances remains under intense discussion. None of the two mechanisms proposed for explaining the process, electron hopping through outer membrane cytochromes and metallic like conduction through conductive PilA filaments, can account for all the experimental evidence collected so far. Aiming at providing new elements for understanding the basis for electron transport, in this perspective article we present a modelled structure of Geobacter pilus. Its analysis in combination with already existing experimental evidence gives support to the proposal of the "stepping stone" mechanism, in which the combined action of pili and cytochromes allows long range electron transport through the biofilm.

  12. Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d-dimensional regular lattices.

    PubMed

    Dias, W S; Bertrand, D; Lyra, M L

    2017-06-01

    Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d>4.

  13. Bose-Einstein condensation in chains with power-law hoppings: Exact mapping on the critical behavior in d -dimensional regular lattices

    NASA Astrophysics Data System (ADS)

    Dias, W. S.; Bertrand, D.; Lyra, M. L.

    2017-06-01

    Recent experimental progress on the realization of quantum systems with highly controllable long-range interactions has impelled the study of quantum phase transitions in low-dimensional systems with power-law couplings. Long-range couplings mimic higher-dimensional effects in several physical contexts. Here, we provide the exact relation between the spectral dimension d at the band bottom and the exponent α that tunes the range of power-law hoppings of a one-dimensional ideal lattice Bose gas. We also develop a finite-size scaling analysis to obtain some relevant critical exponents and the critical temperature of the BEC transition. In particular, an irrelevant dangerous scaling field has to be taken into account when the hopping range is sufficiently large to make the effective dimensionality d >4 .

  14. AC and DC conductivity due to hopping mechanism in double ion doped ceramics

    NASA Astrophysics Data System (ADS)

    Rizwana, Mahboob, Syed; Sarah, P.

    2018-04-01

    Sr1-2xNaxNdxBi4Ti4O15 (x = 0.1, 0.2 and 0.4) system is prepared by sol gel method involving Pechini process of modified polymeric precursor method. Phase identification is done using X-ray diffraction. Conduction in prepared materials involves different mechanisms and is explained through detailed AC and DC conductivity studies. AC conductivity studies carried out on the samples at different frequencies and different temperatures gives more information about electrical transport. Exponents used in two term power relation helps us to understand the different hopping mechanism involved at low as well as high frequencies. Activation energies calculated from the Arrhenius plots are used to calculate activation energies at different temperatures and frequencies. Hopping frequency calculated from the measured data explains hopping of charge carriers at different temperatures. DC conductivity studies help us to know the role of oxygen vacancies in conduction.

  15. Effect of Carbon on the Electrical Properties of Copper Oxide-Based Bulk Composites

    NASA Astrophysics Data System (ADS)

    Kalinin, Yu. E.; Kashirin, M. A.; Makagonov, V. A.; Pankov, S. Yu.; Sitnikov, A. V.

    2018-04-01

    The effect of carbon filler on the electrical resistance and the thermopower of copper oxide-based composites produced by ceramic technology by hot pressing has been studied. It is found that the dependences of the electrical resistivity on the filler concentration are characteristic by S-like curves that are typical of percolation systems; in this case, the resistivity decreases more substantially as the carbon content increases as compared to the decrease in thermopower value, which is accompanied by the existence of the maximum of the factor of thermoelectric power near the percolation threshold. The studies of the temperature dependences of the resistivity and the thermopower at low temperatures show that, in the range 240-300 K, the predominant mechanism of the electrotransfer of all the composites under study is the hopping mechanism. At temperatures lower than 240 K, the composites with a nanocrystalline CuO matrix have a hopping conductivity with a variable hopping distance over localized states of the matrix near the Fermi level, which is related to the conductivity over intergrain CuO boundaries. A schematic model of the band structure of nanocrystalline CuO with carbon filler is proposed on the base of the analysis of the found experimental regularities of the electrotransfer.

  16. Nanowire-based thermoelectric ratchet in the hopping regime

    NASA Astrophysics Data System (ADS)

    Bosisio, Riccardo; Fleury, Geneviève; Pichard, Jean-Louis; Gorini, Cosimo

    2016-04-01

    We study a thermoelectric ratchet consisting of an array of disordered nanowires arranged in parallel on top of an insulating substrate and contacted asymmetrically to two electrodes. Transport is investigated in the Mott hopping regime, when localized electrons can propagate through the nanowires via thermally assisted hops. When the electronic temperature in the nanowires is different from the phononic one in the substrate, we show that a finite electrical current is generated even in the absence of driving forces between the electrodes. We discuss the device performance both as an energy harvester, when an excess heat from the substrate is converted into useful power, and as a refrigerator, when an external power is supplied to cool down the substrate.

  17. Three-Dimensional Tracking of Interfacial Hopping Diffusion

    NASA Astrophysics Data System (ADS)

    Wang, Dapeng; Wu, Haichao; Schwartz, Daniel K.

    2017-12-01

    Theoretical predictions have suggested that molecular motion at interfaces—which influences processes including heterogeneous catalysis, (bio)chemical sensing, lubrication and adhesion, and nanomaterial self-assembly—may be dominated by hypothetical "hops" through the adjacent liquid phase, where a diffusing molecule readsorbs after a given hop according to a probabilistic "sticking coefficient." Here, we use three-dimensional (3D) single-molecule tracking to explicitly visualize this process for human serum albumin at solid-liquid interfaces that exert varying electrostatic interactions on the biomacromolecule. Following desorption from the interface, a molecule experiences multiple unproductive surface encounters before readsorption. An average of approximately seven surface collisions is required for the repulsive surfaces, decreasing to approximately two and a half for surfaces that are more attractive. The hops themselves are also influenced by long-range interactions, with increased electrostatic repulsion causing hops of longer duration and distance. These findings explicitly demonstrate that interfacial diffusion is dominated by biased 3D Brownian motion involving bulk-surface coupling and that it can be controlled by influencing short- and long-range adsorbate-surface interactions.

  18. The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

    NASA Astrophysics Data System (ADS)

    Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong

    2013-06-01

    The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.

  19. Use of the Homeland-Defense Operational Planning System (HOPS) for Emergency Management

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Durling, Jr., R L; Price, D E

    2005-12-16

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less

  20. Risk Assessment Using The Homeland-Defense Operational Planning System (HOPS)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Price, D E; Durling, R L

    2005-10-10

    The Homeland-Defense Operational Planning System (HOPS), is a new operational planning tool leveraging Lawrence Livermore National Laboratory's expertise in weapons systems and in sparse information analysis to support the defense of the U.S. homeland. HOPS provides planners with a basis to make decisions to protect against acts of terrorism, focusing on the defense of facilities critical to U.S. infrastructure. Criticality of facilities, structures, and systems is evaluated on a composite matrix of specific projected casualty, economic, and sociopolitical impact bins. Based on these criteria, significant unidentified vulnerabilities are identified and secured. To provide insight into potential successes by malevolent actors,more » HOPS analysts strive to base their efforts mainly on unclassified open-source data. However, more cooperation is needed between HOPS analysts and facility representatives to provide an advantage to those whose task is to defend these facilities. Evaluated facilities include: refineries, major ports, nuclear power plants and other nuclear licensees, dams, government installations, convention centers, sports stadiums, tourist venues, and public and freight transportation systems. A generalized summary of analyses of U.S. infrastructure facilities will be presented.« less

  1. Combustion powered linear actuator

    DOEpatents

    Fischer, Gary J.

    2007-09-04

    The present invention provides robotic vehicles having wheeled and hopping mobilities that are capable of traversing (e.g. by hopping over) obstacles that are large in size relative to the robot and, are capable of operation in unpredictable terrain over long range. The present invention further provides combustion powered linear actuators, which can include latching mechanisms to facilitate pressurized fueling of the actuators, as can be used to provide wheeled vehicles with a hopping mobility.

  2. Fully patterned p-channel SnO TFTs using transparent Al2O3 gate insulator and ITO as source and drain contacts

    NASA Astrophysics Data System (ADS)

    Guzmán-Caballero, D. E.; Quevedo-López, M. A.; De la Cruz, W.; Ramírez-Bon, R.

    2018-03-01

    SnO p-type was used as active layer to fabricate thin film transistors (TFTs) through photolithography and dry etching processes. The SnO p-type thin films (25 nm) were deposited by DC reactive sputtering with variable oxygen (O2) flow rate to then be annealed in air at 250 ◦C. Al2O3 gate dielectric (15 nm) was deposited by atomic layer deposition. Hall measurements showed p-type carrier concentration (N h ) of around 1 × 1018 cm-3 and Hall mobilities (μ Hall) between 0.35 and 2.64 cm2 V-1 s-1, depending on the O2 flow rate during deposition. The hole transport was dominated by variable-range hopping conduction. A change in the preferred crystalline orientation in the SnO films from (101) to (110) was associated with the increase in μ Hall. In addition, Raman vibrational modes at 110 and 209 cm-1 of polycrystalline SnO films showed certain dependence with the grain orientation. The SnO-based TFTs showed p-type behavior with low threshold voltages (V T ) and low sub threshold swing (SS) in the range from 1.76 to 3.50 V and 1.63 to 3.24 V/dec., respectively. The TFTs mobilities in the saturation regime (μ sat) were in the range of 0.12 and 1.32 cm2 V-1 s-1. The current on/off ratio (I ON/I OFF) was in the order of 102, approximately. The large values of the interface trap density (D IT) contributed to the high I OFF and the low I ON/I OFF of the TFTs.

  3. Electrical Transport Signature of the Magnetic Fluctuation-Structure Relation in α-RuCl3 Nanoflakes.

    PubMed

    Mashhadi, Soudabeh; Weber, Daniel; Schoop, Leslie M; Schulz, Armin; Lotsch, Bettina V; Burghard, Marko; Kern, Klaus

    2018-05-09

    The small gap semiconductor α-RuCl 3 has emerged as a promising candidate for quantum spin liquid materials. Thus far, Raman spectroscopy, neutron scattering, and magnetization measurements have provided valuable hints for collective spin behavior in α-RuCl 3 bulk crystals. However, the goal of implementing α-RuCl 3 into spintronic devices would strongly benefit from the possibility of electrically probing these phenomena. To address this, we first investigated nanoflakes of α-RuCl 3 by Raman spectroscopy and observed similar behavior as in the case of the bulk material, including the signatures of possible fractionalized excitations. In complementary experiments, we investigated the electrical charge transport properties of individual α-RuCl 3 nanoflakes in the temperature range between 120 and 290 K. The observed temperature-dependent electrical resistivity is consistent with variable range hopping behavior and exhibits a transition at about 180 K, close to the onset temperature observed in our Raman measurements. In conjunction with the established relation between structure and magnetism in the bulk, we interpret this transition to coincide with the emergence of fractionalized excitations due to the Kitaev interactions in the nanoflakes. Compared to the bulk samples, the transition temperature of the underlying structural change is larger in the nanoflakes. This difference is tentatively attributed to the dimensionality of the nanoflakes as well as the formation of stacking faults during mechanical exfoliation. The demonstrated devices open up novel perspectives toward manipulating the Kitaev-phase in α-RuCl 3 via electrical means.

  4. BLUECOM+ project: Connecting Humans and Systems at Ocean Remote Areas using Cost-effective Broadband Communications field

    NASA Astrophysics Data System (ADS)

    Brito, Pedro; Terrinha, Pedro; Magalhães, Vitor; Santos, Joana; Duarte, Débora; Campos, Rui

    2017-04-01

    The BLUECOM + project (Connecting Humans and Systems at Remote Ocean Areas using Cost-effective Broadband Communications) aims at developing an innovative communications solution that will enable broadband, cost-effective Internet access in remote ocean areas (ideally beyond 100 km from shore), using standard wireless access technologies - e.g., Wi-Fi and LTE. BLUECOM+ is an EEA Grants PT02 project developed by INESC TEC (Institute for Systems and Computer Engineering, Technology and Science), IPMA (Portuguese Institute for the Sea and the Atmosphere), and MARLO (Transport and Logistics Consultants). The BLUECOM+ key idea and innovation lies on deploying a long-term communications infrastructure, which will extend broadband communications from shore to remote ocean areas by leveraging (1) Helikites - a combination of a helium balloon and kite - that can be tethered to existing or new land and ocean platforms, (2) long range line of sight wireless communications using TV white spaces, and (3) multi-hop relaying techniques to further increase range. At this stage the communications protocols were defined and tested in lab conditions and two sea trials for demonstration of the system were carried out in July/2016 and September/2016 using research vessels. Results of the cruises: 1st cruise corresponded to the first sea-trials of the project. Single-hop communications were established between a land base station deployed at Cabo Espichel lighthouse and the Sea Station deployed in a Helikite launched from the vessel and flying at an altitude of 120m. Successful communications between the two stations were established at a maximum distance of 40km with a data rate in excess of 1Mbit/s. 2nd cruise corresponded to the second sea-trials. During this trial single-hop and two-hop land-sea communications were tested. For two-hop communications tests two Helikites were launched at 120m from two vessels. The first was launched from a vessel closer to shore; the other was launched from the second vessel and connected to the first to have Internet access. The tests were performed at increasing distances up to a maximum distance of 45km from the land station and the first hop, and up to 10km between the two Helikites. The main results achieved were: • Single-hop data rates in excess of 1Mbit/s up to 45km; • Two-hop data rates in excess of 500kbit/s up to 55km; • Video conference with land at 42km offshore without a glitch; • Real-time upload of data collected by an autonomous vehicle offshore to the cloud. A 3rd cruise will be done this year to test video streaming to shore of sea bottom images acquired from the ship with a drop down video system. This will include the integration of the BLUECOM+ network with the drop down video system, in order to demonstrate real-time underwater video transmission offshore. Acknowledgements: This work was developed as part of the BLUECOM+ project (PT02_Aviso4_0005) funded by the EEA Grants and Norway Grants.

  5. Reentrant Metal-Insulator Transitions in Silicon -

    NASA Astrophysics Data System (ADS)

    Campbell, John William M.

    This thesis describes a study of reentrant metal -insulator transitions observed in the inversion layer of extremely high mobility Si-MOSFETs. Magneto-transport measurements were carried out in the temperature range 20mK-4.2 K in a ^3He/^4 He dilution refrigerator which was surrounded by a 15 Tesla superconducting magnet. Below a melting temperature (T_{M}~500 mK) and a critical electron density (n_{s }~9times10^{10} cm^{-2}), the Shubnikov -de Haas oscillations in the diagonal resistivity enormous maximum values at the half filled Landau levels while maintaining deep minima corresponding to the quantum Hall effect at filled Landau levels. At even lower electron densities the insulating regions began to spread and eventually a metal-insulator transition could be induced at zero magnetic field. The measurement of extremely large resistances in the milliKelvin temperature range required the use of very low currents (typically in the 10^ {-12} A range) and in certain measurements minimizing the noise was also a consideration. The improvements achieved in these areas through the use of shielding, optical decouplers and battery operated instruments are described. The transport signatures of the insulating state are considered in terms of two basic mechanisms: single particle localization with transport by variable range hopping and the formation of a collective state such as a pinned Wigner crystal or electron solid with transport through the motion of bound dislocation pairs. The experimental data is best described by the latter model. Thus the two dimensional electron system in these high mobility Si-MOSFETs provides the first and only experimental demonstration to date of the formation of an electron solid at zero and low magnetic fields in the quantum limit where the Coulomb interaction energy dominates over the zero point oscillation energy. The role of disorder in favouring either single particle localization or the formation of a Wigner crystal is explored by considering a variety of samples with a wide range of mobilities and by varying the ratio of the carrier density (controlled by the applied gate voltage) to the impurity density (fixed during sample growth). A phase diagram showing the boundaries between the two dimensional electron gas, the Wigner solid, and the single particle localization induced insulator is established in terms of carrier density and sample mobility.

  6. The Effect of Rician Fading and Partial-Band Interference on Noise- Normalized Fast Frequency-Hopped MFSK Receivers

    DTIC Science & Technology

    1994-03-01

    FSK 16. PmCI coot 17. SECURITY CLASSWsAI1OW IL SICUURW CLA$SIICATION SECURITY CLASSIICATION 20. LIMIATION Of ABSTRACT CW REPOW ? OF TiNS PAU OF ...hop k of a symbol when partial-band interference is present is obtained from (11) and the linear transformation of random variables given by (3) as...from (13) and the transformation of random variables indicated by (9) as [16] fzwjm(zwik) = f cTak!X. (Xmk, = ZmkOkI17) f~(0,kdo . -- (,.U(zk’ )fE2

  7. Bluetooth Low Power Modes Applied to the Data Transportation Network in Home Automation Systems.

    PubMed

    Etxaniz, Josu; Aranguren, Gerardo

    2017-04-30

    Even though home automation is a well-known research and development area, recent technological improvements in different areas such as context recognition, sensing, wireless communications or embedded systems have boosted wireless smart homes. This paper focuses on some of those areas related to home automation. The paper draws attention to wireless communications issues on embedded systems. Specifically, the paper discusses the multi-hop networking together with Bluetooth technology and latency, as a quality of service (QoS) metric. Bluetooth is a worldwide standard that provides low power multi-hop networking. It is a radio license free technology and establishes point-to-point and point-to-multipoint links, known as piconets, or multi-hop networks, known as scatternets. This way, many Bluetooth nodes can be interconnected to deploy ambient intelligent networks. This paper introduces the research on multi-hop latency done with park and sniff low power modes of Bluetooth over the test platform developed. Besides, an empirical model is obtained to calculate the latency of Bluetooth multi-hop communications over asynchronous links when links in scatternets are always in sniff or the park mode. Smart home devices and networks designers would take advantage of the models and the estimation of the delay they provide in communications along Bluetooth multi-hop networks.

  8. Bluetooth Low Power Modes Applied to the Data Transportation Network in Home Automation Systems

    PubMed Central

    Etxaniz, Josu; Aranguren, Gerardo

    2017-01-01

    Even though home automation is a well-known research and development area, recent technological improvements in different areas such as context recognition, sensing, wireless communications or embedded systems have boosted wireless smart homes. This paper focuses on some of those areas related to home automation. The paper draws attention to wireless communications issues on embedded systems. Specifically, the paper discusses the multi-hop networking together with Bluetooth technology and latency, as a quality of service (QoS) metric. Bluetooth is a worldwide standard that provides low power multi-hop networking. It is a radio license free technology and establishes point-to-point and point-to-multipoint links, known as piconets, or multi-hop networks, known as scatternets. This way, many Bluetooth nodes can be interconnected to deploy ambient intelligent networks. This paper introduces the research on multi-hop latency done with park and sniff low power modes of Bluetooth over the test platform developed. Besides, an empirical model is obtained to calculate the latency of Bluetooth multi-hop communications over asynchronous links when links in scatternets are always in sniff or the park mode. Smart home devices and networks designers would take advantage of the models and the estimation of the delay they provide in communications along Bluetooth multi-hop networks. PMID:28468294

  9. Ultrasonic Multiple-Access Ranging System Using Spread Spectrum and MEMS Technology for Indoor Localization

    PubMed Central

    Segers, Laurent; Tiete, Jelmer; Braeken, An; Touhafi, Abdellah

    2014-01-01

    Indoor localization of persons and objects poses a great engineering challenge. Previously developed localization systems demonstrate the use of wideband techniques in ultrasound ranging systems. Direct sequence and frequency hopping spread spectrum ultrasound signals have been proven to achieve a high level of accuracy. A novel ranging method using the frequency hopping spread spectrum with finite impulse response filtering will be investigated and compared against the direct sequence spread spectrum. In the first setup, distances are estimated in a single-access environment, while in the second setup, two senders and one receiver are used. During the experiments, the micro-electromechanical systems are used as ultrasonic sensors, while the senders were implemented using field programmable gate arrays. Results show that in a single-access environment, the direct sequence spread spectrum method offers slightly better accuracy and precision performance compared to the frequency hopping spread spectrum. When two senders are used, measurements point out that the frequency hopping spread spectrum is more robust to near-far effects than the direct sequence spread spectrum. PMID:24553084

  10. Anomalous diffusion for bed load transport with a physically-based model

    NASA Astrophysics Data System (ADS)

    Fan, N.; Singh, A.; Foufoula-Georgiou, E.; Wu, B.

    2013-12-01

    Diffusion of bed load particles shows both normal and anomalous behavior for different spatial-temporal scales. Understanding and quantifying these different types of diffusion is important not only for the development of theoretical models of particle transport but also for practical purposes, e.g., river management. Here we extend a recently proposed physically-based model of particle transport by Fan et al. [2013] to further develop an Episodic Langevin equation (ELE) for individual particle motion which reproduces the episodic movement (start and stop) of sediment particles. Using the proposed ELE we simulate particle movements for a large number of uniform size particles, incorporating different probability distribution functions (PDFs) of particle waiting time. For exponential PDFs of waiting times, particles reveal ballistic motion in short time scales and turn to normal diffusion at long time scales. The PDF of simulated particle travel distances also shows a change in its shape from exponential to Gamma to Gaussian with a change in timescale implying different diffusion scaling regimes. For power-law PDF (with power - μ) of waiting times, the asymptotic behavior of particles at long time scales reveals both super-diffusion and sub-diffusion, however, only very heavy tailed waiting times (i.e. 1.0 < μ < 1.5) could result in sub-diffusion. We suggest that the contrast between our results and previous studies (for e.g., studies based on fractional advection-diffusion models of thin/heavy tailed particle hops and waiting times) results could be due the assumption in those studies that the hops are achieved instantaneously, but in reality, particles achieve their hops within finite times (as we simulate here) instead of instantaneously, even if the hop times are much shorter than waiting times. In summary, this study stresses on the need to rethink the alternative models to the previous models, such as, fractional advection-diffusion equations, for studying the anomalous diffusion of bed load particles. The implications of these results for modeling sediment transport are discussed.

  11. Trapping time statistics and efficiency of transport of optical excitations in dendrimers

    NASA Astrophysics Data System (ADS)

    Heijs, Dirk-Jan; Malyshev, Victor A.; Knoester, Jasper

    2004-09-01

    We theoretically study the trapping time distribution and the efficiency of the excitation energy transport in dendritic systems. Trapping of excitations, created at the periphery of the dendrimer, on a trap located at its core, is used as a probe of the efficiency of the energy transport across the dendrimer. The transport process is treated as incoherent hopping of excitations between nearest-neighbor dendrimer units and is described using a rate equation. We account for radiative and nonradiative decay of the excitations while diffusing across the dendrimer. We derive exact expressions for the Laplace transform of the trapping time distribution and the efficiency of trapping, and analyze those for various realizations of the energy bias, number of dendrimer generations, and relative rates for decay and hopping. We show that the essential parameter that governs the trapping efficiency is the product of the on-site excitation decay rate and the trapping time (mean first passage time) in the absence of decay.

  12. Comparative study of hop-containing products on human cytochrome p450-mediated metabolism.

    PubMed

    Foster, Brian C; Kearns, Nikia; Arnason, John T; Saleem, Ammar; Ogrodowczyk, Carolina; Desjardins, Suzanne

    2009-06-10

    Thirty-five national and international brands of beer were examined for their potential to affect human cytochrome P450 (CYP)-mediated metabolism. They represented the two main categories of beer, ales and lagers, and included a number of specialty products including bitter (porter, stout), coffee, ice, wheat, Pilsner, and hemp seed. Aliquots were examined for nonvolatile soluble solids, effect on CYP metabolism and P-glycoprotein (Pgp) transport, and major alpha- and beta-hop acids. Wide variance was detected in contents of alcohol, nonvolatile suspended solids, and hop acids and in the potential to affect CYP-mediated metabolism and Pgp-mediated efflux transport. Many of the products affected CYP2C9-mediated metabolism, and only two (NRP 306 and 307) markedly affected CYP3A4; hence, some products have the capacity to affect drug safety. CYP3A4, CYP3A5, CYP3A7, and CYP19 (aromatase) inhibition to the log concentration of beta-acid content was significant with r(2) > 0.37, suggesting that these components can account for some of the variation in inhibition of CYP metabolism.

  13. Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities.

    PubMed

    Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

    2015-08-11

    To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott's variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics.

  14. Nanocontact Disorder in Nanoelectronics for Modulation of Light and Gas Sensitivities

    PubMed Central

    Lin, Yen-Fu; Chang, Chia-Hung; Hung, Tsu-Chang; Jian, Wen-Bin; Tsukagoshi, Kazuhito; Wu, Yue-Han; Chang, Li; Liu, Zhaoping; Fang, Jiye

    2015-01-01

    To fabricate reliable nanoelectronics, whether by top-down or bottom-up processes, it is necessary to study the electrical properties of nanocontacts. The effect of nanocontact disorder on device properties has been discussed but not quantitatively studied. Here, by carefully analyzing the temperature dependence of device electrical characteristics and by inspecting them with a microscope, we investigated the Schottky contact and Mott’s variable-range-hopping resistances connected in parallel in the nanocontact. To interpret these parallel resistances, we proposed a model of Ti/TiOx in the interface between the metal electrodes and nanowires. The hopping resistance as well as the nanocontact disorder dominated the total device resistance for high-resistance devices, especially at low temperatures. Furthermore, we introduced nanocontact disorder to modulate the light and gas responsivities of the device; unexpectedly, it multiplied the sensitivities compared with the intrinsic sensitivity of the nanowires. Our results improve the collective understanding of electrical contacts to low-dimensional semiconductor devices and will aid performance optimization in future nanoelectronics. PMID:26260674

  15. Localization in a random XY model with long-range interactions: Intermediate case between single-particle and many-body problems

    NASA Astrophysics Data System (ADS)

    Burin, Alexander L.

    2015-09-01

    Many-body localization in an XY model with a long-range interaction is investigated. We show that in the regime of a high strength of disordering compared to the interaction an off-resonant flip-flop spin-spin interaction (hopping) generates the effective Ising interactions of spins in the third order of perturbation theory in a hopping. The combination of hopping and induced Ising interactions for the power-law distance dependent hopping V (R ) ∝R-α always leads to the localization breakdown in a thermodynamic limit of an infinite system at α <3 d /2 where d is a system dimension. The delocalization takes place due to the induced Ising interactions U (R ) ∝R-2 α of "extended" resonant pairs. This prediction is consistent with the numerical finite size scaling in one-dimensional systems. Many-body localization in an XY model is more stable with respect to the long-range interaction compared to a many-body problem with similar Ising and Heisenberg interactions requiring α ≥2 d which makes the practical implementations of this model more attractive for quantum information applications. The full summary of dimension constraints and localization threshold size dependencies for many-body localization in the case of combined Ising and hopping interactions is obtained using this and previous work and it is the subject for the future experimental verification using cold atomic systems.

  16. Carryover effect of hip and knee exercises program on functional performance in individuals with patellofemoral pain syndrome

    PubMed Central

    Ahmed Hamada, Hamada; Hussein Draz, Amira; Koura, Ghada Mohamed; Saab, Ibtissam M.

    2017-01-01

    [Purpose] This study was carried out to investigate the carryover effect of hip and knee exercises program on functional performance (single legged hop test as functional performance test and Kujala score for functional activities). [Subjects and Methods] Thirty patients with patellofemoral pain syndrome were randomly assigned into two equal groups. Group (A) consisted of 15 patients undergoing hip strengthening exercises for four weeks then measuring all variables followed by additional four weeks of knee exercises program then measuring all variables again. Group (B): consisted of 15 patients undergoing knee exercises program for four weeks then measuring all variables followed by additional four weeks of hip strengthening exercises then measuring all variables. Functional abilities and knee muscles performance were assessed using Kujala questionnaire and single legged hop test respectively pre and after the completion of the first 4 weeks then after 8 weeks for both groups. [Results] Significantly increase in Kujala questionnaire in group A compared with group B was observed. While, there were significant increase in single legged hop performance test in group B compared with group A. [Conclusion] Starting with hip exercises improve the performance of subjects more than functional activities while starting with knee exercises improve the functional activities of subjects more than performance. PMID:28878459

  17. Carryover effect of hip and knee exercises program on functional performance in individuals with patellofemoral pain syndrome.

    PubMed

    Ahmed Hamada, Hamada; Hussein Draz, Amira; Koura, Ghada Mohamed; Saab, Ibtissam M

    2017-08-01

    [Purpose] This study was carried out to investigate the carryover effect of hip and knee exercises program on functional performance (single legged hop test as functional performance test and Kujala score for functional activities). [Subjects and Methods] Thirty patients with patellofemoral pain syndrome were randomly assigned into two equal groups. Group (A) consisted of 15 patients undergoing hip strengthening exercises for four weeks then measuring all variables followed by additional four weeks of knee exercises program then measuring all variables again. Group (B): consisted of 15 patients undergoing knee exercises program for four weeks then measuring all variables followed by additional four weeks of hip strengthening exercises then measuring all variables. Functional abilities and knee muscles performance were assessed using Kujala questionnaire and single legged hop test respectively pre and after the completion of the first 4 weeks then after 8 weeks for both groups. [Results] Significantly increase in Kujala questionnaire in group A compared with group B was observed. While, there were significant increase in single legged hop performance test in group B compared with group A. [Conclusion] Starting with hip exercises improve the performance of subjects more than functional activities while starting with knee exercises improve the functional activities of subjects more than performance.

  18. Dielectric Measurements on Sol-Gel Derived Titania Films

    NASA Astrophysics Data System (ADS)

    Capan, Rifat; Ray, Asim K.

    2017-11-01

    Alternating current (AC) impedance measurements were performed on 37 nm thick nanostructured sol-gel derived anatase titania films on ultrasonically cleaned (100) p-silicon substrates at temperatures T ranging from 100 K to 300 K over a frequency range between 20 Hz and 1 MHz. The frequency-dependent behavior of the AC conductivity σ ac( f, T) obeys the universal power law, and the values of the effective hopping barrier and hopping distance were found to be 0.79 eV and 6.7 × 10-11 m from an analysis due to the correlated barrier-hopping model. The dielectric relaxation was identified as a thermally activated non-Debye process involving an activation energy of 41.5 meV.

  19. Microscopic Simulations of Charge Transport in Disordered Organic Semiconductors

    PubMed Central

    2011-01-01

    Charge carrier dynamics in an organic semiconductor can often be described in terms of charge hopping between localized states. The hopping rates depend on electronic coupling elements, reorganization energies, and driving forces, which vary as a function of position and orientation of the molecules. The exact evaluation of these contributions in a molecular assembly is computationally prohibitive. Various, often semiempirical, approximations are employed instead. In this work, we review some of these approaches and introduce a software toolkit which implements them. The purpose of the toolkit is to simplify the workflow for charge transport simulations, provide a uniform error control for the methods and a flexible platform for their development, and eventually allow in silico prescreening of organic semiconductors for specific applications. All implemented methods are illustrated by studying charge transport in amorphous films of tris-(8-hydroxyquinoline)aluminum, a common organic semiconductor. PMID:22076120

  20. Single-Step Electrophoretic Deposition of Non-noble Metal Catalyst Layer with Low Onset Voltage for Ethanol Electro-oxidation.

    PubMed

    Ahmadi Daryakenari, Ahmad; Hosseini, Davood; Ho, Ya-Lun; Saito, Takumi; Apostoluk, Aleksandra; Müller, Christoph R; Delaunay, Jean-Jacques

    2016-06-29

    A single-step electrophoretic deposition (EPD) process is used to fabricate catalyst layers which consist of nickel oxide nanoparticles attached on the surface of nanographitic flakes. Magnesium ions present in the colloid charge positively the flake's surface as they attach on it and are also used to bind nanographitic flakes together. The fabricated catalyst layers showed a very low onset voltage (-0.2 V vs Ag/AgCl) in the electro-oxidation of ethanol. To clarify the occurring catalytic mechanism, we performed annealing treatment to produce samples having a different electrochemical behavior with a large onset voltage. Temperature dependence measurements of the layer conductivity pointed toward a charge transport mechanism based on hopping for the nonannealed layers, while the drift transport is observed in the annealed layers. The hopping charge transport is responsible for the appearance of the low onset voltage in ethanol electro-oxidation.

  1. Electrical conductivity and dielectric properties of TlInS2 single crystals

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.; Hassan, A.

    2011-07-01

    TlInS2 single crystals were grown by using Bridgman-Stockbauer technique. Measurements of DC conductivity were carried out in parallel (σ//) and perpendicular (σ⊥) directions to the c-axis over a temperature range from 303 to 463 K. The anisotropic behaviour of the electrical conductivity was also detected. AC conductivity and dielectric measurements were studied as a function of both frequency (102-106 Hz) and temperature (297-375 K). The frequency dependence of the AC conductivity revealed that σac(ω) obeys the universal law: σac(ω) = Aωs. The mechanism of the ac charge transport across the layers of TlInS2 single crystals was referred to the hopping over localized states near the Fermi level in the frequency range >3.5 × 103 Hz. The temperature dependence of σac(ω) for TlInS2 showed that σac is thermally activated process. Both of ɛ1 and ɛ2 decrease by increasing frequency and increase by increasing temperature. Some parameters were calculated as: the density of localized states near the Fermi level NF = 1.5 × 1020 eV-1 cm-3, the average time of charge carrier hoping between localized states τ = 3.79 μs and the average hopping distance R = 6.07 nm.

  2. Mn Impurity in Bulk GaAs Crystals

    NASA Astrophysics Data System (ADS)

    Pawłowski, M.; Piersa, M.; Wołoś, A.; Palczewska, M.; Strzelecka, G.; Hruban, A.; Gosk, J.; Kamińska, M.; Twardowski, A.

    2006-11-01

    Magnetic and electron transport properties of GaAs:Mn crystals grown by Czochralski method were studied. Electron spin resonance showed the presence of Mn acceptor A in two charge states: singly ionized A- in the form of Mn2+(d5), and neutral A0 in the form of Mn2+(d5) plus a bound hole (h). It was possible to determine the relative concentration of both types of centers from intensity of the corresponding electron spin resonance lines. Magnetization measured as a function of magnetic field (up to 6 T) in the temperature range of 2-300 K revealed overall paramagnetic behavior of the samples. Effective spin was found to be about 1.5 value, which was consistent with the presence of two types of Mn configurations. In most of the studied samples the dominance of Mn2+(d5)+h configuration was established and it increased after annealing of native donors. The total value of Mn content was obtained from fitting of magnetization curves with the use of parameters obtained from electron spin resonance. In electron transport, two mechanisms of conductivity were observed: valence band transport dominated above 70 K, and hopping conductivity within Mn impurity band at lower temperatures. From the analysis of the hopping conductivity and using the obtained values of the total Mn content, the effective radius of Mn acceptor in GaAs was estimated as a = 11 ± 3 Å.

  3. Strain effects on oxygen migration in perovskites.

    PubMed

    Mayeshiba, Tam; Morgan, Dane

    2015-01-28

    Fast oxygen transport materials are necessary for a range of technologies, including efficient and cost-effective solid oxide fuel cells, gas separation membranes, oxygen sensors, chemical looping devices, and memristors. Strain is often proposed as a method to enhance the performance of oxygen transport materials, but the magnitude of its effect and its underlying mechanisms are not well-understood, particularly in the widely-used perovskite-structured oxygen conductors. This work reports on an ab initio prediction of strain effects on migration energetics for nine perovskite systems of the form LaBO3, where B = [Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Ga]. Biaxial strain, as might be easily produced in epitaxial systems, is predicted to lead to approximately linear changes in migration energy. We find that tensile biaxial strain reduces the oxygen vacancy migration barrier across the systems studied by an average of 66 meV per percent strain for a single selected hop, with a low of 36 and a high of 89 meV decrease in migration barrier per percent strain across all systems. The estimated range for the change in migration barrier within each system is ±25 meV per percent strain when considering all hops. These results suggest that strain can significantly impact transport in these materials, e.g., a 2% tensile strain can increase the diffusion coefficient by about three orders of magnitude at 300 K (one order of magnitude at 500 °C or 773 K) for one of the most strain-responsive materials calculated here (LaCrO3). We show that a simple elasticity model, which assumes only dilative or compressive strain in a cubic environment and a fixed migration volume, can qualitatively but not quantitatively model the strain dependence of the migration energy, suggesting that factors not captured by continuum elasticity play a significant role in the strain response.

  4. Probability distributions of bed load particle velocities, accelerations, hop distances, and travel times informed by Jaynes's principle of maximum entropy

    USGS Publications Warehouse

    Furbish, David; Schmeeckle, Mark; Schumer, Rina; Fathel, Siobhan

    2016-01-01

    We describe the most likely forms of the probability distributions of bed load particle velocities, accelerations, hop distances, and travel times, in a manner that formally appeals to inferential statistics while honoring mechanical and kinematic constraints imposed by equilibrium transport conditions. The analysis is based on E. Jaynes's elaboration of the implications of the similarity between the Gibbs entropy in statistical mechanics and the Shannon entropy in information theory. By maximizing the information entropy of a distribution subject to known constraints on its moments, our choice of the form of the distribution is unbiased. The analysis suggests that particle velocities and travel times are exponentially distributed and that particle accelerations follow a Laplace distribution with zero mean. Particle hop distances, viewed alone, ought to be distributed exponentially. However, the covariance between hop distances and travel times precludes this result. Instead, the covariance structure suggests that hop distances follow a Weibull distribution. These distributions are consistent with high-resolution measurements obtained from high-speed imaging of bed load particle motions. The analysis brings us closer to choosing distributions based on our mechanical insight.

  5. Hopping Diffusion of Nanoparticles in Polymer Matrices

    PubMed Central

    2016-01-01

    We propose a hopping mechanism for diffusion of large nonsticky nanoparticles subjected to topological constraints in both unentangled and entangled polymer solids (networks and gels) and entangled polymer liquids (melts and solutions). Probe particles with size larger than the mesh size ax of unentangled polymer networks or tube diameter ae of entangled polymer liquids are trapped by the network or entanglement cells. At long time scales, however, these particles can diffuse by overcoming free energy barrier between neighboring confinement cells. The terminal particle diffusion coefficient dominated by this hopping diffusion is appreciable for particles with size moderately larger than the network mesh size ax or tube diameter ae. Much larger particles in polymer solids will be permanently trapped by local network cells, whereas they can still move in polymer liquids by waiting for entanglement cells to rearrange on the relaxation time scales of these liquids. Hopping diffusion in entangled polymer liquids and networks has a weaker dependence on particle size than that in unentangled networks as entanglements can slide along chains under polymer deformation. The proposed novel hopping model enables understanding the motion of large nanoparticles in polymeric nanocomposites and the transport of nano drug carriers in complex biological gels such as mucus. PMID:25691803

  6. The Effect of Rap/Hip-Hop Music on Young Adult Smoking: An Experimental Study.

    PubMed

    Harakeh, Zeena; Bogt, Tom F M Ter

    2018-02-16

    Music may influence young people's behavior through its lyrics. Substance use references occur more frequently in rap/hip-hop than in other music genres. The aim was to examine whether the exposure to rap/hip-hop lyrics referring to substance use affected cigarette smoking. An experiment with a 3-group between subject design was conducted among 74 daily-smoking young adults ranging in age from 17 to 25 years old. Three conditions were tested in a mobile lab (camper vehicle) from May to December 2011, i.e., regular chart pop music (N = 28), rap/hip-hop with non-frequent references to substance use (N = 24), and rap/hip-hop with frequent references to substance use (N = 22). One-way ANOVA showed that participants listening to substance use infused rap/hip-hop songs felt significantly less pleasant, liked the songs less, and comprehended the songs less compared to participants listening to pop songs. Poisson loglinear analyses revealed that compared to the pop music condition, none of the two rap/hip-hop music conditions had a significant effect on acute smoking. Thus, contrary to expectations, the two different rap/hip-hop conditions did not have a significantly different effect on acute smoking. Listening to rap/hip-hop, even rap hip/hop with frequent referrals to substance use (primarily alcohol and drug use, and general smoking referrals), does not seem to encourage cigarette smoking among Dutch daily-smoking young adults, at least short term.

  7. Relationships between Xanthohumol and Polyphenol Content in Hop Leaves and Hop Cones with Regard to Water Supply and Cultivar

    PubMed Central

    Čeh, Barbara; Kač, Milica; Košir, Iztok J.; Abram, Veronika

    2007-01-01

    The effect of water supply – especially of drought stress – on the content of some secondary metabolites in hops (Humulus lupulus L.) was studied. The experiment took place in 2006. Some relevant data from 2005 were included for comparison. Leaves and cones of nine hop cultivars grown under field conditions as well as in a pot experiment under three water regimes were analyzed. The cultivars ranged from those most grown in Slovenia to promising crossbreed being tested. Leaves were sampled from July 18, 2006 to August 18, 2006, while cones were picked in the time of technological maturity. Standard analytical methods were applied to determine the contents of xanthohumol, polyphenols and α-acids in hop leaves and hop cones. The contents of the secondary metabolites in question depended more on the cultivar under investigation than on the water supply, at least as far the growing conditions for a relatively normal development of the plant were met.

  8. Odor-Active Compounds in the Special Flavor Hops Huell Melon and Polaris.

    PubMed

    Neiens, Silva D; Steinhaus, Martin

    2018-02-14

    The volatiles isolated from samples of the special flavor hop varieties, Huell Melon and Polaris, and from the aroma hop variety, Hallertau Tradition, by solvent extraction and solvent-assisted flavor evaporation (SAFE) were subjected to a comparative aroma extract dilution analysis (cAEDA), which resulted in 46 odor-active compounds in the flavor dilution (FD) factor range of 16 to 2048. On the basis of high FD factors, myrcene, (3R)-linalool, and 2- and 3-methylbutanoic acid were confirmed as important variety-independent hop odorants. (1R,4S)-Calamenene was identified for the first time as an odor-active compound in hops. Clear differences in the FD factors and their subsequent objectification by stable isotope dilution quantitation suggested that high concentrations of the esters ethyl 2-methylbutanoate, ethyl 2-methylpropanoate, and propyl 2-methylbutanoate cause the characteristic fruity, cantaloupe-like odor note in Huell Melon hops, whereas the fruity and minty odor notes in Polaris are associated with high amounts of 3-methylbutyl acetate and 1,8-cineole.

  9. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs

    PubMed Central

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-01-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network. PMID:28763014

  10. Two Hop Adaptive Vector Based Quality Forwarding for Void Hole Avoidance in Underwater WSNs.

    PubMed

    Javaid, Nadeem; Ahmed, Farwa; Wadud, Zahid; Alrajeh, Nabil; Alabed, Mohamad Souheil; Ilahi, Manzoor

    2017-08-01

    Underwater wireless sensor networks (UWSNs) facilitate a wide range of aquatic applications in various domains. However, the harsh underwater environment poses challenges like low bandwidth, long propagation delay, high bit error rate, high deployment cost, irregular topological structure, etc. Node mobility and the uneven distribution of sensor nodes create void holes in UWSNs. Void hole creation has become a critical issue in UWSNs, as it severely affects the network performance. Avoiding void hole creation benefits better coverage over an area, less energy consumption in the network and high throughput. For this purpose, minimization of void hole probability particularly in local sparse regions is focused on in this paper. The two-hop adaptive hop by hop vector-based forwarding (2hop-AHH-VBF) protocol aims to avoid the void hole with the help of two-hop neighbor node information. The other protocol, quality forwarding adaptive hop by hop vector-based forwarding (QF-AHH-VBF), selects an optimal forwarder based on the composite priority function. QF-AHH-VBF improves network good-put because of optimal forwarder selection. QF-AHH-VBF aims to reduce void hole probability by optimally selecting next hop forwarders. To attain better network performance, mathematical problem formulation based on linear programming is performed. Simulation results show that by opting these mechanisms, significant reduction in end-to-end delay and better throughput are achieved in the network.

  11. Performance of multi-hop parallel free-space optical communication over gamma-gamma fading channel with pointing errors.

    PubMed

    Gao, Zhengguang; Liu, Hongzhan; Ma, Xiaoping; Lu, Wei

    2016-11-10

    Multi-hop parallel relaying is considered in a free-space optical (FSO) communication system deploying binary phase-shift keying (BPSK) modulation under the combined effects of a gamma-gamma (GG) distribution and misalignment fading. Based on the best path selection criterion, the cumulative distribution function (CDF) of this cooperative random variable is derived. Then the performance of this optical mesh network is analyzed in detail. A Monte Carlo simulation is also conducted to demonstrate the effectiveness of the results for the average bit error rate (ABER) and outage probability. The numerical result proves that it needs a smaller average transmitted optical power to achieve the same ABER and outage probability when using the multi-hop parallel network in FSO links. Furthermore, the system use of more number of hops and cooperative paths can improve the quality of the communication.

  12. Electronic correlation effects and the Coulomb gap at finite temperature.

    PubMed

    Sandow, B; Gloos, K; Rentzsch, R; Ionov, A N; Schirmacher, W

    2001-02-26

    We have investigated the effect of the long-range Coulomb interaction on the one-particle excitation spectrum of n-type germanium, using tunneling spectroscopy on mechanically controllable break junctions. At low temperatures, the tunnel conductance shows a minimum at zero bias voltage due to the Coulomb gap. Above 1 K, the gap is filled by thermal excitations. This behavior is reflected in the variable-range hopping resistivity measured on the same samples: up to a few degrees Kelvin the Efros-Shklovskii lnR infinity T(-1/2) law is obeyed, whereas at higher temperatures deviations from this law occur. The type of crossover differs from that considered previously in the literature.

  13. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT.

    PubMed

    Kivlan, Benjamin R; Carcia, Christopher R; Christoforetti, John J; Martin, RobRoy L

    2016-08-01

    Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Quasi-experimental, cohort comparison. Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. 3B, non-consectutive cohort study.

  14. COMPARISON OF RANGE OF MOTION, STRENGTH, AND HOP TEST PERFORMANCE OF DANCERS WITH AND WITHOUT A CLINICAL DIAGNOSIS OF FEMOROACETABULAR IMPINGEMENT

    PubMed Central

    Carcia, Christopher R.; Christoforetti, John J.; Martin, RobRoy L.

    2016-01-01

    ABSTRACT Background Dancers commonly experience anterior hip pain caused by femoroacetabular impingement (FAI) that interrupts training and performance in dance. A paucity of literature exists to guide appropriate evaluation and management of FAI among dancers. Purpose The purpose of this study was to determine if dancers with clinical signs of FAI have differences in hip range of motion, strength, and hop test performance compared to healthy dancers. Study Design Quasi-experimental, cohort comparison. Methods Fifteen dancers aged between 18- 21 years with clinical signs of FAI that included anterior hip pain and provocative impingement tests were compared to 13 age-matched dancers for passive hip joint range of motion, isometric hip strength, and performance of the medial triple hop, lateral triple hop, and cross-over hop tests. Results No statistically significant differences in range of motion were noted for flexion (Healthy = 145° + 7°; FAI = 147° + 10°; p=0.59), internal rotation (Healthy = 63° + 7°; FAI = 61° + 11°; p=0.50), and external rotation (Healthy = 37° + 9°; FAI = 34° + 12°; p=0.68) between the two groups. Hip extension strength was significantly less in the dancers with FAI (224 + 55 Newtons) compared to the healthy group (293 ± 58 Newtons; F(1,26) = 10.2; p=0.004). No statistically significant differences were noted for flexion, internal rotation, external rotation, abduction, or adduction isometric strength. The medial triple hop test was significantly less in the FAI group (354 ± 43 cm) compared to the healthy group (410 ± 50 cm; F(1,26) = 10.3; p = 0.004). Similar results were observed for the lateral hop test, as the FAI group (294 ± 38 cm) performed worse than the healthy controls (344 ± 54cm; F(1,26) = 7.8; p = 0.01). There was no statistically significant difference between the FAI group (2.7 ± 0.92 seconds) and the healthy group (2.5 ± 0.75 seconds) on the crossover hop test. Conclusion Dancers with FAI have less strength of the hip extensors and perform worse during medial and lateral hop triple tests compared to healthy dancers. Clinicians may use this information to assist in screening of dancers with complaints of hip pain and to measure their progress for return to dance. Level of Evidence 3B, non-consectutive cohort study PMID:27525177

  15. From hopping to ballistic transport in graphene-based electronic devices

    NASA Astrophysics Data System (ADS)

    Taychatanapat, Thiti

    This thesis describes electronic transport experiments in graphene from the hopping to the ballistic regime. The first experiment studies dual-gated bilayer graphene devices. By applying an electric field with these dual gates, we can open a band gap in bilayer graphene and observe an increase in resistance of over six orders of magnitude as well as a strongly non-linear behavior in the transport characteristics. A temperature-dependence study of resistance at large electric field at the charge neutrality point shows the change in the transport mechanism from a hopping dominated regime at low temperature to a diffusive regime at high temperature. The second experiment examines electronic properties of Bernal-stacked trilayer graphene. Due to the low mobility of trilayer graphene on SiO 2substrates, we employ hexagonal boron nitride as a local substrate to improve its mobility. This led us to observe a quantum Hall effect with multiple Landau level crossings, proving the coexistence of massless and massive Dirac fermions in Bernal-stacked trilayer graphene. From the position of these crossing points in magnetic field and electron density, we can deduce the band parameters used to model its band structure. At high magnetic field, we observe broken symmetry states via Landau level splittings as well as crossings among these broken-symmetry states. In the third experiment, we investigate transverse magnetic focusing (TMF) in mono-, bi-, and tri-layer graphene. The ability to tune density allows us to electronically modify focal points and investigate TMF continuously from hole to electron regimes. This also allows us to observe the change in band structure of trilayer graphene as a function of applied electric field. Finally, we also observe TMF at room temperature in monolayer graphene which unambiguously proves the existence of ballistic transport at room temperature.

  16. Theoretical study on the charge transport in single crystals of TCNQ, F2-TCNQ and F4-TCNQ.

    PubMed

    Ji, Li-Fei; Fan, Jian-Xun; Zhang, Shou-Feng; Ren, Ai-Min

    2018-01-31

    2,5-Difluoro-7,7,8,8-tetracyanoquinodimethane (F 2 -TCNQ) was recently reported to display excellent electron transport properties in single crystal field-effect transistors (FETs). Its carrier mobility can reach 25 cm 2 V -1 s -1 in devices. However, its counterparts TCNQ and F 4 -TCNQ (tetrafluoro-7,7,8,8-tetracyanoquinodimethane) do not exhibit the same highly efficient behavior. To better understand this significant difference in charge carrier mobility, a multiscale approach combining semiclassical Marcus hopping theory, a quantum nuclear enabled hopping model and molecular dynamics simulations was performed to assess the electron mobilities of the F n -TCNQ (n = 0, 2, 4) systems in this work. The results indicated that the outstanding electron transport behavior of F 2 -TCNQ arises from its effective 3D charge carrier percolation network due to its special packing motif and the nuclear tunneling effect. Moreover, the poor transport properties of TCNQ and F 4 -TCNQ stem from their invalid packing and strong thermal disorder. It was found that Marcus theory underestimated the mobilities for all the systems, while the quantum model with the nuclear tunneling effect provided reasonable results compared to experiments. Moreover, the band-like transport behavior of F 2 -TCNQ was well described by the quantum nuclear enabled hopping model. In addition, quantum theory of atoms in molecules (QTAIM) analysis and symmetry-adapted perturbation theory (SAPT) were used to characterize the intermolecular interactions in TCNQ, F 2 -TCNQ and F 4 -TCNQ crystals. A primary understanding of various noncovalent interaction responses for crystal formation is crucial to understand the structure-property relationships in organic molecular materials.

  17. Matrix-valued Boltzmann equation for the nonintegrable Hubbard chain.

    PubMed

    Fürst, Martin L R; Mendl, Christian B; Spohn, Herbert

    2013-07-01

    The standard Fermi-Hubbard chain becomes nonintegrable by adding to the nearest neighbor hopping additional longer range hopping amplitudes. We assume that the quartic interaction is weak and investigate numerically the dynamics of the chain on the level of the Boltzmann type kinetic equation. Only the spatially homogeneous case is considered. We observe that the huge degeneracy of stationary states in the case of nearest neighbor hopping is lost and the convergence to the thermal Fermi-Dirac distribution is restored. The convergence to equilibrium is exponentially fast. However for small next-nearest neighbor hopping amplitudes one has a rapid relaxation towards the manifold of quasistationary states and slow relaxation to the final equilibrium state.

  18. Colossal dielectric behavior of semiconducting Sr2TiMnO6 ceramics

    NASA Astrophysics Data System (ADS)

    Meher, K. R. S. Preethi; Varma, K. B. R.

    2009-02-01

    Manganitelike double perovskite Sr2TiMnO6 (STMO) ceramics fabricated from the powders synthesized via the solid-state reaction route, exhibited dielectric constants as high as ˜105 in the low frequency range (100 Hz-10 kHz) at room temperature. The Maxwell-Wagner type of relaxation mechanism was found to be more appropriate to rationalize such high dielectric constant values akin to that observed in materials such as KxTiyNi(1-x-y)O and CaCu3Ti4O12. The dielectric measurements carried out on the samples with different thicknesses and electrode materials reflected the influence of extrinsic effects. The impedance studies (100 Hz-10 MHz) in the 180-300 K temperature range revealed the presence of two dielectric relaxations corresponding to the grain boundary and the electrode. The dielectric response of the grain boundary was found to be weakly dependent on the dc bias field (up to 11 V/cm). However, owing to the electrode polarization, the applied ac/dc field had significant effect on the low frequency dielectric response. At low temperatures (100-180 K), the dc conductivity of STMO followed a variable range hopping behavior. Above 180 K, it followed the Arrhenius behavior because of the thermally activated conduction process. The bulk conductivity relaxation owing to the localized hopping of charge carriers obeyed the typical universal dielectric response.

  19. Role of antimony in the charge transport mechanisms for La0.67Ca0.33Mn1-xSbxO3 manganites

    NASA Astrophysics Data System (ADS)

    Kataria, B. R.; Solanki, Pankaj; Pandya, D. D.; Solanki, P. S.; Shah, N. A.

    2018-07-01

    Single phasic La0.67Ca0.33Mn1-xSbxO3 (LCMSO; x = 0.00, 0.02, 0.04, 0.06, 0.08 and 0.10) samples were characterized by performing temperature and magnetic field dependent resistance measurements. Present study, mainly, aims for the better understanding of possible charge conduction mechanisms responsible for the low temperature resistivity and high temperature [well above metal to insulator transition temperature (TP)] semiconducting regions. Variation in resistivity and TP with Sb5+ content (x) and applied magnetic field has been discussed in the light of the modifications in structural and magnetic lattices of smaller diamagnetic Sb5+ doped LCMSO system. Various models and mechanisms have been theoretical employed to fit obtained experimental resistivity data for the low temperature resistivity and semiconducting regions of all LCMSO manganites. It is found that low temperature resistivity minima follows the coulomb blockade model while charge conduction in the semiconducting region obeys the variable range hopping (VRH) mechanism. Variation in low temperature blocking energy, activation energy in semiconducting region and magnetoresistance (MR) with Sb5+ content (x) and applied magnetic field has been discussed in detail.

  20. Mechanism of leakage of ion-implantation isolated AlGaN/GaN MIS-high electron mobility transistors on Si substrate

    NASA Astrophysics Data System (ADS)

    Zhang, Zhili; Song, Liang; Li, Weiyi; Fu, Kai; Yu, Guohao; Zhang, Xiaodong; Fan, Yaming; Deng, Xuguang; Li, Shuiming; Sun, Shichuang; Li, Xiajun; Yuan, Jie; Sun, Qian; Dong, Zhihua; Cai, Yong; Zhang, Baoshun

    2017-08-01

    In this paper, we systematically investigated the leakage mechanism of the ion-implantation isolated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors (MIS-HEMTs) on Si substrate. By means of combined DC tests at different temperatures and electric field dependence, we demonstrated the following original results: (1) It is proved that gate leakage is the main contribution to OFF-state leakage of ion-implantation isolated AlGaN/GaN MIS-HEMTs, and the gate leakage path is a series connection of the gate dielectric Si3N4 and Si3N4-GaN interface. (2) The dominant mechanisms of the leakage current through LPCVD-Si3N4 gate dielectric and Si3N4-GaN interface are identified to be Frenkel-Poole emission and two-dimensional variable range hopping (2D-VRH), respectively. (3) A certain temperature annealing could reduce the density of the interface state that produced by ion implantation, and consequently suppress the interface leakage transport, which results in a decrease in OFF-state leakage current of ion-implantation isolated AlGaN/GaN MIS-HEMTs.

  1. Type I antiferromagnetic order in Ba 2LuReO 6: Exploring the role of structural distortions in double perovskites containing 5d 2 ions

    DOE PAGES

    Xiong, Jie; Yan, Jiaqiang; Aczel, Adam A.; ...

    2017-12-02

    The structural, electrical, and magnetic properties of the double perovskite Ba 2LuReO 6 have been examined in this paper. It is an insulator whose temperature dependent conductivity is consistent with variable range hopping electrical transport. A transition to an antiferromagnet state with type I order occurs below T N = 31 K. High resolution time-of-flight neutron powder diffraction measurements show that it retains the cubic double perovskite structure down to 10 K. High intensity, low resolution neutron powder diffraction measurements confirm the antiferromagnetic order and indicate that cubic symmetry is still observed at 1.5 K. The small ordered moment ofmore » 0.34(4)μ B per Re is comparable to estimates of moments on 5d 2 ions in other antiferromagnetically ordered cubic double perovskites. Finally, comparisons with related double perovskites containing 5d 2 ions, such as Os 6+ and Re 5+, reveal that subtle changes in structure or electron configuration of the diamagnetic octahedral cations can have a large impact on the magnetic ground state, the size of the ordered moment, and the Néel temperature.« less

  2. Landing Mechanics During Side Hopping and Crossover Hopping Maneuvers in Noninjured Women and Women With Anterior Cruciate Ligament Reconstruction

    PubMed Central

    Ortiz, Alexis; Olson, Sharon; Trudelle-Jackson, Elaine; Rosario, Martin; Venegas, Heidi L.

    2011-01-01

    Objective To compare, landing mechanics and electromyographic activity of the lower extremities during side hopping and crossover hopping maneuvers, in noninjured women and women with anterior cruciate ligament (ACL) reconstruction. Design A case-control study. Setting A 3-dimensional motion analysis laboratory. Participants Twenty-eight young women (range, 21–35 years) (15 control subjects and 13 subjects with ACL reconstruction). Patients and Methods All participants performed a side-to-side hopping task that consisted of hopping single-legged 10 times consecutively from side to side across 2 lines marked 30 cm apart on 2 individual force plates. The task was designated as a side hopping when the hop was to the opposite side of the stance leg and as crossover hopping when the hop was toward the side of the stance leg. Main Outcome Measurements Peak hip-/knee-joint angles; peak knee extension/abduction joint moments; electromyographic studies of the gluteus maximus, gluteus medius, rectus femoris, and hamstring muscles; and quadriceps/hamstring co-contraction ratio were compared between the groups by means of 2 × 2 multivariate analysis of variance tests (group × maneuver). Results Noninjured women and women with ACL reconstruction exhibited similar hip-and knee-joint angles during both types of hopping. Hip-joint angles were greater during the crossover hopping in both groups, and knee-joint angles did not differ between the groups or hops. Knee-joint moments demonstrated a significant group × maneuver interaction. Greater knee extension and valgus moments were noted in the control group during crossover hopping, and greater knee abduction moments were noted in the ACL group during side hopping. Electromyographic data revealed no statistically significantly differences between the groups. Conclusions Women with ACL reconstruction exhibited the restoration of functional biomechanical movements such as hip-/knee-joint angles and lower extremity neuromuscular activation during side-to-side athletic tasks. However, not all biomechanical strategies are restored years after surgery, and women who have undergone a procedure such as ACL reconstruction may continue to exhibit knee-joint abduction moments that increase the risk of additional knee injury. PMID:21257128

  3. Frequency and temperature dependent dielectric properties of TiO2-V2O5 nanocomposites

    NASA Astrophysics Data System (ADS)

    Ray, Apurba; Roy, Atanu; De, Sayan; Chatterjee, Souvik; Das, Sachindranath

    2018-03-01

    In this manuscript, we have reported the crystal structure, dielectric response, and transport phenomenon of TiO2-V2O5 nanocomposites. The nanocomposites were synthesized using a sol-gel technique having different molar ratios of Ti:V (10:10, 10:15, and 10:20). The phase composition and the morphology have been studied using X-ray diffraction and field emission scanning electron microscope, respectively. The impedance spectroscopy studies of the three samples over a wide range of temperature (50 K-300 K) have been extensively described using the internal barrier layer capacitor model. It is based on the contribution of domain and domain boundary, relaxations of the materials, which are the main crucial factors for the enhancement of the dielectric response. The frequency dependent ac conductivity of the ceramics strongly obeys the well-known Jonscher's power law, and it has been clearly explained using the theory of jump relaxation model. The temperature dependent bulk conductivity is fairly recognized to the variable-range hopping of localized polarons. The co-existence of mixed valence state of Ti ions (Ti3+ and Ti4+) in the sample significantly contributes to the change of dielectric property. The overall study of dielectric response explains that the dielectric constant and the dielectric loss are strongly dependent on temperature and frequency and decrease with an increase of frequency as well as temperature.

  4. Charge transport in organic molecular semiconductors from first principles: The bandlike hole mobility in a naphthalene crystal

    NASA Astrophysics Data System (ADS)

    Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco

    2018-03-01

    Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.

  5. Theory of dynamic barriers, activated hopping, and the glass transition in polymer melts

    NASA Astrophysics Data System (ADS)

    Schweizer, Kenneth S.; Saltzman, Erica J.

    2004-07-01

    A statistical mechanical theory of collective dynamic barriers, slow segmental relaxation, and the glass transition of polymer melts is developed by combining, and in some aspects extending, methods of mode coupling, density functional, and activated hopping transport theories. A coarse-grained description of polymer chains is adopted and the melt is treated as a liquid of segments. The theory is built on the idea that collective density fluctuations on length scales considerably longer than the local cage scale are of primary importance in the deeply supercooled regime. The barrier hopping or segmental relaxation time is predicted to be a function primarily of a single parameter that is chemical structure, temperature, and pressure dependent. This parameter depends on the material-specific dimensionless amplitude of thermal density fluctuations (compressibility) and a reduced segmental density determined by the packing length and backbone characteristic ratio. Analytic results are derived for a crossover temperature Tc, collective barrier, and glass transition temperature Tg. The relation of these quantities to structural and thermodynamic properties of the polymer melt is established. A universal power-law scaling behavior of the relaxation time below Tc is predicted based on identification of a reduced temperature variable that quantifies the breadth of the supercooled regime. Connections between the ratio Tc/Tg, two measures of dynamic fragility, and the magnitude of the local relaxation time at Tg logically follow. Excellent agreement with experiment is found for these generic aspects, and the crucial importance of the experimentally observed near universality of the dynamic crossover time is established. Extensions of the theory to treat the full chain dynamics, heterogeneity, barrier fluctuations, and nonpolymeric thermal glass forming liquids are briefly discussed.

  6. Simulations of optically switchable molecular machines for particle transport.

    PubMed

    Raeker, Tim; Jansen, Björn; Behrens, Dominik; Hartke, Bernd

    2018-03-24

    A promising application for design and deployment of molecular machines is nanoscale transport, driven by artificial cilia. In this contribution, we present several further steps toward this goal, beyond our first-generation artificial cilium (Raeker et al., J. Phys. Chem. A 2012, 116, 11241). Promising new azobenzene-derivatives were tested for use as cilium motors. Using a QM/MM partitioning in on-the-fly photodynamics, excited-state surface-hopping trajectories were calculated for each isomerization direction and each motor version. The methods used were reparametrized semiempirical quantum chemistry together with floating-occupation configuration interaction as the QM part and the OPLSAA-L forcefield as MM part. In addition, we simulated actual particle transport by a single cilium attached to a model surface, with varying attachment strengths and modes, and with transport targets ranging from single atoms to multi-molecule arrangements. Our results provide valuable design guidelines for cilia-driven nanoscale transport and emphasize the need to carefully select the whole setup (not just the cilium itself, but also its surface attachment and the dynamic cilium-target interaction) to achieve true transport. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  7. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    NASA Astrophysics Data System (ADS)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  8. The elusive role of NbLi bound polaron energy in hopping charge transport in Fe : LiNbO3.

    PubMed

    Guilbert, Laurent; Vittadello, Laura; Bazzan, Marco; Mhaouech, Imed; Messerschmidt, Simon; Imlau, M

    2018-02-06

    Charge transport due to small polarons hopping among defective (bound polarons) and regular (free polarons) sites is shown to depend in a non-trivial way from the value of the stabilization energy provided by the lattice distortion surrounding the charge carriers. This energy, normally not directly accessible for bound polarons by spectroscopic techniques, is here determined by a combination of experimental and numerical methods for the important case of small electron polarons bound to \\mathrm{Nb}_{\\mathrm{Li}} defects in the prototype ferroelectric oxide lithium niobate. Our findings provide an estimation of the \\mathrm{Nb}_{\\mathrm{Li}} polaron stabilization energy E_{GP}=\\unit[(0.75\\pm0.05)]{eV} and point out that in lithium niobate both free and bound polarons contributes to charge transport already at room temperature, explaining the fast decays of the light-induced bound polaron population observed by transient absorption spectroscopy. © 2018 IOP Publishing Ltd.

  9. Observation of hole hopping via dopant in MoOx-doped organic semiconductors: Mechanism analysis and application for high performance organic light-emitting devices

    NASA Astrophysics Data System (ADS)

    Qiao, Xianfeng; Chen, Jiangshan; Li, Xinglin; Ma, Dongge

    2010-05-01

    Conduction mechanism in molybdenum trioxide (MoOx)-doped hole- and electron-type organic semiconductors is investigated. The used hole-transporting materials are N ,N'-diphenyl-N ,N'-bis(1-naphthylphenyl)-1, 1'-biphen4, 4'-diamine, 4',4″-tri(N-carbazolyl)triphenylamine, 4, 4'-N,N-dicarbazole-biphenyl, and pentacene and the used electron-transporting material is (8-quinolinolato) aluminum (Alq3). It can be seen that the hole conductivity is significantly enhanced upon MoOx doping, and more importantly, dominant hole current could be realized in a typical electron-transport material Alq3 by doping MoOx. Hence, high efficiency organic light-emitting devices can also be achieved even using MoOx-doped Alq3 film as hole transporting layer. The mechanism investigation indicates that the MoOx plays an important role in the hole transport. It is showed that the MoOx serves as the hole hopping sites, whereas the used organic materials serve as the transport medium and determine the magnitude of transport current. Furthermore, it is found that doping MoOx into the organic materials also reduces the energy and position disorders of the doped organic films, which are well demonstrated by the study on transport characteristics of the doped films at various temperatures.

  10. Partially suppressed shot noise in hopping conduction: observation in SiGe quantum wells

    PubMed

    Kuznetsov; Mendez; Zuo; Snider; Croke

    2000-07-10

    We have observed shot noise in the hopping conduction of two-dimensional carriers confined in a p-type SiGe quantum well at a temperature of 4 K. Moreover, shot noise is suppressed relative to its "classical" value 2eI by an amount that depends on the length of the sample and the carrier density. We have found a suppression factor to the classical value of about one-half for a 2 &mgr;m long sample, and of one-fifth for a 5 &mgr;m sample. In each case, the factor decreased slightly as the density increased toward the insulator-metal transition. We explain these results in terms of the characteristic length ( approximately 1 &mgr;m in our case) of the inherent inhomogeneity of hopping transport, obtained from percolation theory.

  11. Positive magnetoresistance in Fe3Se4 nanowires

    NASA Astrophysics Data System (ADS)

    Li, D.; Jiang, J. J.; Liu, W.; Zhang, Z. D.

    2011-04-01

    We report the magnetotransport properties of Fe3Se4 nanowire arrays in anodic aluminum oxide (AAO) porous membrane. The temperature dependence of resistance of Fe3Se4 nanowires at a zero field shows thermal activated behavior below 295 K. The exponential relationship in resistance is consistent with the model of strong localization with variable-range hopping (VRH) for a finite one-dimensional wire. Resistance versus magnetic field curves below 100 K show small positive magnetoresistance (MR). The field dependencies of log[R(H)/R(0)] explain the positive MR as the effect of magnetic field on the VRH conduction.

  12. Experimental and Theoretical Demonstration on the Transport Properties of Fused Ring Host Materials for Organic Light-Emitting Diodes

    NASA Astrophysics Data System (ADS)

    Tse, S. C.; So, S. K.; Yeung, M. Y.; Lo, C. F.; Wen, S. W.; Chen, C. H.

    2006-01-01

    The charge transport properties of three tertiary-butyl (t-Bu) substituted anthracene derivatives (ADN), critical blue host materials for organic light-emitting diodes (OLEDs), have been investigated experimentally and computationally. From time-of-flight (TOF) measurements, all ADN compounds exhibit ambipolar characters. The hole and electron mobilities are in the range (1--5)× 10-7 cm2 V-1 s-1 under an external applied field of about 1 MV cm-1. Un-substituted ADN has the highest carrier mobilities while heavily t-Bu substituted ADN has the least. The electron and hole conducting properties of are consistent with ab initio calculation, which indicates that the frontier orbitals are localized mainly on the anthracene moiety. t-Bu substitutions in ADN increase the hopping path lengths among the molecules and hence reduce the electron and hole mobilities. The results demonstrate that t-Bu substitution is an effective means of engineering the conductivity of organic charge transporter for OLED applications.

  13. Electronic and transport properties of BCN alloy nanoribbons

    NASA Astrophysics Data System (ADS)

    Darvishi Gilan, Mahdi; Chegel, Raad

    2018-03-01

    The dependence of the carbon (C) concentration on the electronic and transport properties of boron carbonitride (BCN) alloy nanoribbons have been investigated using surface Green's functions technique and random Hamiltonian model by considering random hopping parameters including first and second nearest neighbors. Our calculations indicate that substituting boron (nitrogen) sites with carbon atoms induces a new band close to conduction (valence) band and carbon atoms behave like a donor (acceptor) dopants. Also, while both nitrogen and boron sites are substituted randomly by carbon atoms, new bands are induced close to both valence and conduction bands. The band gap decreases with C substituting and the number of charge carriers increases in low bias voltage. Far from Fermi level in the higher range of energy, transmission coefficient and current of the system are reduced by increasing the C concentration. Based on our results, tuning the electronic and transport properties of BCN alloy nanoribbons by random carbon dopants could be applicable to design nanoelectronics devices.

  14. Chicano Hip-Hop as Interethnic Contact Zone

    ERIC Educational Resources Information Center

    McFarland, Pancho

    2008-01-01

    Hip-hop is an interethnic contact zone that allows for the creation of new expressive cultures and new identities for young people. Its openness derives in part from the wide range of expression and interpretation allowed in 182 "McFarland" African musics. Moving beyond the often stifling options offered by an earlier generation that focused on…

  15. Frame error rate for single-hop and dual-hop transmissions in 802.15.4 LoWPANs

    NASA Astrophysics Data System (ADS)

    Biswas, Sankalita; Ghosh, Biswajit; Chandra, Aniruddha; Dhar Roy, Sanjay

    2017-08-01

    IEEE 802.15.4 is a popular standard for personal area networks used in different low-rate short-range applications. This paper examines the error rate performance of 802.15.4 in fading wireless channel. An analytical model is formulated for evaluating frame error rate (FER); first, for direct single-hop transmission between two sensor nodes, and second, for dual-hop (DH) transmission using an in-between relay node. During modeling the transceiver design parameters are chosen according to the specifications set for both the 2.45 GHz and 868/915 MHz bands. We have also developed a simulation test bed for evaluating FER. Some results showed expected trends, such as FER is higher for larger payloads. Other observations are not that intuitive. It is interesting to note that the error rates are significantly higher for the DH case and demands a signal-to-noise ratio (SNR) penalty of about 7 dB. Also, the FER shoots from zero to one within a very small range of SNR.

  16. Characterization of host-dependent mutations of apple fruit crinkle viroid replicating in newly identified experimental hosts suggests maintenance of stem-loop structures in the left-hand half of the molecule is important for replication.

    PubMed

    Suzuki, Takahiro; Fujibayashi, Misato; Hataya, Tatsuji; Taneda, Akito; He, Ying-Hong; Tsushima, Taro; Duraisamy, Ganesh Selvaraj; Siglová, Kristyna; Matoušek, Jaroslav; Sano, Teruo

    2017-03-01

    Apple fruit crinkle viroid (AFCVd) is a tentative member of the genus Apscaviroid, family Pospiviroidae. AFCVd has a narrow host range and is known to infect apple, hop and persimmon as natural hosts. In this study, tomato, cucumber and wild hop have been identified as new experimental herbaceous hosts. Foliar symptoms were very mild or virtually undetectable, but fruits of infected tomato were small, cracked and distorted. These symptoms resemble those observed on some AFCVd-sensitive apple cultivars. After transfer to tomato, cucumber and wild hop, sequence changes were detected in a natural AFCVd isolate from hop, and major variants in tomato, cucumber and wild hop differed in 10, 8 or 2 nucleotides, respectively, from the predominant one in the inoculum. The major variants in tomato and cucumber were almost identical, and the one in wild hop was very similar to the one in cultivated hop. Detailed analyses of the host-dependent sequence changes that appear in a naturally occurring AFCVd isolate from hop after transfer to tomato using small RNA deep sequence data and infectivity studies with dimeric RNA transcripts followed by progeny analysis indicate that the major AFCVd variant in tomato emerged by selection of a minor variant present in the inoculum (i.e. hop) followed by one to two host-dependent de novo mutations. Comparison of the secondary structures of major variants in hop, tomato and persimmon after transfer to tomato suggested that maintenance of stem-loop structures in the left-hand half of the molecule is critical for infection.

  17. Ionic Borate-Based Covalent Organic Frameworks: Lightweight Porous Materials for Lithium-Stable Solid State Electrolytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Black, Hayden T.; Harrison, Katharine Lee

    2016-10-01

    The synthesis and characterization of the first polyelectrolyte of intrinsic microporosity (PEIM) is described. The novel material was synthesized via reaction between the nitrile group in the polymer backbone and n-butyl lithium, effectively anchoring an imine anion to the porous framework while introducing a mobile lithium counterion. The PEIM was characterized by 13C, 1H, and 7Li NMR experiments, revealing quantitative conversion of the nitrile functionality to the anionic imine. Variable temperature 7Li NMR analysis of the dry PEIM and the electrolyteswollen PEIM revealed that lithium ion transport within the dry PEIM was largely due to interchain hopping of the Limore » + ions, and that the mobility of polymer associated Li + was reduced after swelling in electrolyte solution. Meanwhile, the swollen PEIM supported efficient transport of dissolved Li + within the expanded pores. These results are discussed in the context of developing novel solid or solid-like lithium ion electrolytes using the new PEIM material.« less

  18. Extreme Kinematics in Selected Hip Hop Dance Sequences.

    PubMed

    Bronner, Shaw; Ojofeitimi, Sheyi; Woo, Helen

    2015-09-01

    Hip hop dance has many styles including breakdance (breaking), house, popping and locking, funk, streetdance, krumping, Memphis jookin', and voguing. These movements combine the complexity of dance choreography with the challenges of gymnastics and acrobatic movements. Despite high injury rates in hip hop dance, particularly in breakdance, to date there are no published biomechanical studies in this population. The purpose of this study was to compare representative hip hop steps found in breakdance (toprock and breaking) and house and provide descriptive statistics of the angular displacements that occurred in these sequences. Six expert female hip hop dancers performed three choreographed dance sequences, top rock, breaking, and house, to standardized music-based tempos. Hip, knee, and ankle kinematics were collected during sequences that were 18 to 30 sec long. Hip, knee, and ankle three-dimensional peak joint angles were compared in repeated measures ANOVAs with post hoc tests where appropriate (p<0.01). Peak angles of the breaking sequence, which included floorwork, exceeded the other two sequences in the majority of planes and joints. Hip hop maximal joint angles exceeded reported activities of daily living and high injury sports such as gymnastics. Hip hop dancers work at weight-bearing joint end ranges where muscles are at a functional disadvantage. These results may explain why lower extremity injury rates are high in this population.

  19. Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components

    PubMed Central

    Pirbadian, Sahand; Barchinger, Sarah E.; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A.; Reed, Samantha B.; Romine, Margaret F.; Saffarini, Daad A.; Shi, Liang; Gorby, Yuri A.; Golbeck, John H.; El-Naggar, Mohamed Y.

    2014-01-01

    Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic–abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution. PMID:25143589

  20. Shewanella oneidensis MR-1 nanowires are outer membrane and periplasmic extensions of the extracellular electron transport components.

    PubMed

    Pirbadian, Sahand; Barchinger, Sarah E; Leung, Kar Man; Byun, Hye Suk; Jangir, Yamini; Bouhenni, Rachida A; Reed, Samantha B; Romine, Margaret F; Saffarini, Daad A; Shi, Liang; Gorby, Yuri A; Golbeck, John H; El-Naggar, Mohamed Y

    2014-09-02

    Bacterial nanowires offer an extracellular electron transport (EET) pathway for linking the respiratory chain of bacteria to external surfaces, including oxidized metals in the environment and engineered electrodes in renewable energy devices. Despite the global, environmental, and technological consequences of this biotic-abiotic interaction, the composition, physiological relevance, and electron transport mechanisms of bacterial nanowires remain unclear. We report, to our knowledge, the first in vivo observations of the formation and respiratory impact of nanowires in the model metal-reducing microbe Shewanella oneidensis MR-1. Live fluorescence measurements, immunolabeling, and quantitative gene expression analysis point to S. oneidensis MR-1 nanowires as extensions of the outer membrane and periplasm that include the multiheme cytochromes responsible for EET, rather than pilin-based structures as previously thought. These membrane extensions are associated with outer membrane vesicles, structures ubiquitous in Gram-negative bacteria, and are consistent with bacterial nanowires that mediate long-range EET by the previously proposed multistep redox hopping mechanism. Redox-functionalized membrane and vesicular extensions may represent a general microbial strategy for electron transport and energy distribution.

  1. Biomechanical symmetry in elite rugby union players during dynamic tasks: an investigation using discrete and continuous data analysis techniques.

    PubMed

    Marshall, Brendan; Franklyn-Miller, Andrew; Moran, Kieran; King, Enda; Richter, Chris; Gore, Shane; Strike, Siobhán; Falvey, Éanna

    2015-01-01

    While measures of asymmetry may provide a means of identifying individuals predisposed to injury, normative asymmetry values for challenging sport specific movements in elite athletes are currently lacking in the literature. In addition, previous studies have typically investigated symmetry using discrete point analyses alone. This study examined biomechanical symmetry in elite rugby union players using both discrete point and continuous data analysis techniques. Twenty elite injury free international rugby union players (mean ± SD: age 20.4 ± 1.0 years; height 1.86 ± 0.08 m; mass 98.4 ± 9.9 kg) underwent biomechanical assessment. A single leg drop landing, a single leg hurdle hop, and a running cut were analysed. Peak joint angles and moments were examined in the discrete point analysis while analysis of characterising phases (ACP) techniques were used to examine the continuous data. Dominant side was compared to non-dominant side using dependent t-tests for normally distributed data or Wilcoxon signed-rank test for non-normally distributed data. The significance level was set at α = 0.05. The majority of variables were found to be symmetrical with a total of 57/60 variables displaying symmetry in the discrete point analysis and 55/60 in the ACP. The five variables that were found to be asymmetrical were hip abductor moment in the drop landing (p = 0.02), pelvis lift/drop in the drop landing (p = 0.04) and hurdle hop (p = 0.02), ankle internal rotation moment in the cut (p = 0.04) and ankle dorsiflexion angle also in the cut (p = 0.01). The ACP identified two additional asymmetries not identified in the discrete point analysis. Elite injury free rugby union players tended to exhibit bi-lateral symmetry across a range of biomechanical variables in a drop landing, hurdle hop and cut. This study provides useful normative values for inter-limb symmetry in these movement tests. When examining symmetry it is recommended to incorporate continuous data analysis techniques rather than a discrete point analysis alone; a discrete point analysis was unable to detect two of the five asymmetries identified.

  2. Charge carrier transport in defective reduced graphene oxide as quantum dots and nanoplatelets in multilayer films

    NASA Astrophysics Data System (ADS)

    Jimenez, Mawin J. M.; Oliveira, Rafael F.; Almeida, Tiago P.; Hensel Ferreira, Rafael C.; Bufon, Carlos Cesar B.; Rodrigues, Varlei; Pereira-da-Silva, Marcelo A.; Gobbi, Ângelo L.; Piazzetta, Maria H. O.; Riul, Antonio, Jr.

    2017-12-01

    Graphene is a breakthrough 2D material due to its unique mechanical, electrical, and thermal properties, with considerable responsiveness in real applications. However, the coverage of large areas with pristine graphene is a challenge and graphene derivatives have been alternatively exploited to produce hybrid and composite materials that allow for new developments, considering also the handling of large areas using distinct methodologies. For electronic applications there is significant interest in the investigation of the electrical properties of graphene derivatives and related composites to determine whether the characteristic 2D charge transport of pristine graphene is preserved. Here, we report a systematic study of the charge transport mechanisms of reduced graphene oxide chemically functionalized with sodium polystyrene sulfonate (PSS), named as GPSS. GPSS was produced either as quantum dots (QDs) or nanoplatelets (NPLs), being further nanostructured with poly(diallyldimethylammonium chloride) through the layer-by-layer (LbL) assembly to produce graphene nanocomposites with molecular level control. Current-voltage (I-V) measurements indicated a meticulous growth of the LbL nanostructures onto gold interdigitated electrodes (IDEs), with a space-charge-limited current dominated by a Mott-variable range hopping mechanism. A 2D intra-planar conduction within the GPSS nanostructure was observed, which resulted in effective charge carrier mobility (μ) of 4.7 cm2 V-1 s-1 for the QDs and 34.7 cm2 V-1 s-1 for the NPLs. The LbL assemblies together with the dimension of the materials (QDs or NPLs) were favorably used for the fine tuning and control of the charge carrier mobility inside the LbL nanostructures. Such 2D charge conduction mechanism and high μ values inside an interlocked multilayered assembly containing graphene-based nanocomposites are of great interest for organic devices and functionalization of interfaces.

  3. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on themore » adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.« less

  4. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    NASA Astrophysics Data System (ADS)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  5. High-Speed Hopping: Time-Resolved Tomographic PIV Measurements of Water Flea Swimming

    NASA Astrophysics Data System (ADS)

    Murphy, D. W.; Webster, D. R.; Yen, J.

    2012-11-01

    Daphniids, also known as water fleas, are small, freshwater crustaceans that live in a low-to-intermediate Reynolds number regime. These plankters are equipped with a pair of branched, setae-bearing antennae that they beat to impulsively propel themselves, or ``hop,'' through the water. A typical hop carries the daphniid one body length forward and is followed by a period of sinking. We present time-resolved tomographic PIV measurements of swimming by Daphnia magna. The body kinematics and flow physics of the daphniid hop are quantified. It is shown that the flow generated by each stroking antenna resembles an asymmetric viscous vortex ring. It is proposed that the flow produced by the daphniid hop can be modeled as a double Stokeslet consisting of two impulsively applied point forces separated by the animal width. The flow physics are discussed in the context of other species operating in the same Reynolds number range of 10 to 100: sea butterfly swimming and flight by the smallest flying insects.

  6. Effect of impurities of selenium and iron on the Anderson localization of 1T-TaS 2

    NASA Astrophysics Data System (ADS)

    Ōnuki, Y.; Inada, R.; Tanuma, S.

    1980-01-01

    The temperature dependence of electrical resistivities θ( T) of 1T-TaS 2, 1T-TaS 2- xSe x and 1T-Fe xTa 1- xS 2 is found to be θ( T) ∝ exp( T0/ T) 1/n in the temperature range of 4 K to the measured lowest temperature, 0.1 K, showing the variable range hopping of Anderson localized states. The n-value is nearly 3 for selenium doping and nearly 2 for non-doping and iron doping. The positive magnetoresistance, which is sizable only in the temperature range of 2 K to 0.5 K in 1T-TaS 2, is found to be remarkably enhanced by the selenium doping, while the tendency is reversed by the iron doping.

  7. Systematic assessment of scaffold hopping versus activity cliff formation across bioactive compound classes following a molecular hierarchy.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2015-07-01

    Scaffold hopping and activity cliff formation define opposite ends of the activity landscape feature spectrum. To rationalize these events at the level of scaffolds, active compounds involved in scaffold hopping were required to contain topologically distinct scaffolds but have only limited differences in potency, whereas compounds involved in activity cliffs were required to share the same scaffold but have large differences in potency. A systematic search was carried out for compounds involved in scaffold hopping and/or activity cliff formation. Results obtained for compound data sets covering more than 300 human targets revealed clear trends. If scaffolds represented multiple but fewer than 10 active compounds, nearly 90% of all scaffolds were exclusively involved in hopping events. With increasing compound coverage, the fraction of scaffolds involved in both scaffold hopping and activity cliff formation significantly increased to more than 50%. However, ∼40% of the scaffolds representing large numbers of active compounds continued to be exclusively involved in scaffold hopping. More than 200 scaffolds with broad target coverage were identified that consistently represented potent compounds and yielded an abundance of scaffold hops in the low-nanomolar range. These and other subsets of scaffolds we characterized are of prime interest for structure-activity relationship (SAR) exploration and compound design. Therefore, the complete scaffold classification generated in the course of our analysis is made freely available. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Small polaronic hole hopping mechanism and Maxwell-Wagner relaxation in NdFeO3

    NASA Astrophysics Data System (ADS)

    Ahmad, I.; Akhtar, M. J.; Younas, M.; Siddique, M.; Hasan, M. M.

    2012-10-01

    In the modern micro-electronics, transition metal oxides due to their colossal values of dielectric permittivity possess huge potential for the development of capacitive energy storage devices. In the present work, the dielectric permittivity and the effects of temperature and frequency on the electrical transport properties of polycrystalline NdFeO3, prepared by solid state reaction method, are discussed. Room temperature Mossbauer spectrum confirms the phase purity, octahedral environment for Fe ion, and high spin state of Fe3+ ion. From the impedance spectroscopic measurements, three relaxation processes are observed, which are related to grains, grain boundaries (gbs), and electrode-semiconductor contact in the measured temperature and frequency ranges. Decrease in resistances and relaxation times of the grains and grain boundaries with temperature confirms the involvement of thermally activated conduction mechanisms. Same type of charge carriers (i.e., small polaron hole hopping) have been found responsible for conduction and relaxation processes through the grain and grain boundaries. The huge value of the dielectric constant (˜8 × 103) at high temperature and low frequency is correlated to the Maxwell-Wagner relaxation due to electrode-sample contact.

  9. Classical mapping for Hubbard operators: Application to the double-Anderson model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Bin; Miller, William H.; Levy, Tal J.

    A classical Cartesian mapping for Hubbard operators is developed to describe the nonequilibrium transport of an open quantum system with many electrons. The mapping of the Hubbard operators representing the many-body Hamiltonian is derived by using analogies from classical mappings of boson creation and annihilation operators vis-à-vis a coherent state representation. The approach provides qualitative results for a double quantum dot array (double Anderson impurity model) coupled to fermionic leads for a range of bias voltages, Coulomb couplings, and hopping terms. While the width and height of the conduction peaks show deviations from the master equation approach considered to bemore » accurate in the limit of weak system-leads couplings and high temperatures, the Hubbard mapping captures all transport channels involving transition between many electron states, some of which are not captured by approximate nonequilibrium Green function closures.« less

  10. Ohmic contact formation between metal and AlGaN/GaN heterostructure via graphene insertion

    NASA Astrophysics Data System (ADS)

    Sung Park, Pil; Reddy, Kongara M.; Nath, Digbijoy N.; Yang, Zhichao; Padture, Nitin P.; Rajan, Siddharth

    2013-04-01

    A simple method for the creation of Ohmic contact to 2D electron gas in AlGaN/GaN high electron-mobility transistors using Cr/graphene layer is demonstrated. A weak temperature dependence of this Ohmic contact observed in the range 77 to 300 K precludes thermionic emission or trap-assisted hopping as possible carrier-transport mechanisms. It is suggested that the Cr/graphene combination acts akin to a doped n-type semiconductor in contact with AlGaN/GaN heterostructure, and promotes carrier transport along percolating Al-lean paths through the AlGaN layer. This use of graphene offers a simple method for making Ohmic contacts to AlGaN/GaN heterostructures, circumventing complex additional processing steps involving high temperatures. These results could have important implications for the fabrication and manufacturing of AlGaN/GaN-based microelectronic and optoelectronic devices/sensors of the future.

  11. Design, testing, and performance of a hybrid micro vehicle---The Hopping Rotochute

    NASA Astrophysics Data System (ADS)

    Beyer, Eric W.

    The Hopping Rotochute is a new hybrid micro vehicle that has been developed to robustly explore environments with rough terrain while minimizing energy consumption over long periods of time. The device consists of a small coaxial rotor system housed inside a lightweight cage. The vehicle traverses an area by intermittently powering a small electric motor which drives the rotor system, allowing the vehicle to hop over obstacles of various shapes and sizes. A movable internal mass controls the direction of travel while the egg-like exterior shape and low mass center allows the vehicle to passively reorient itself to an upright attitude when in contact with the ground. This dissertation presents the design, fabrication, and testing of a radio-controlled Hopping Rotochute prototype as well as an analytical study of the flight performance of the device. The conceptual design iterations are first outlined which were driven by the mission and system requirements assigned to the vehicle. The aerodynamic, mechanical, and electrical design of a prototype is then described, based on the final conceptual design, with particular emphasis on the fundamental trades that must be negotiated for this type of hopping vehicle. The fabrication and testing of this prototype is detailed as well as experimental results obtained from a motion capture system. Basic flight performance of the prototype are reported which demonstrates that the Hopping Rotochute satisfies all appointed system requirements. A dynamic model of the Hopping Rotochute is also developed in this thesis and employed to predict the flight performance of the vehicle. The dynamic model includes aerodynamic loads from the body and rotor system as well as a soft contact model to estimate the forces and moments during ground contact. The experimental methods used to estimate the dynamic model parameters are described while comparisons between measured and simulated motion are presented. Good correlation between these motions is shown to validate the dynamic model. Using the validated dynamic model, simulations were performed to better understand the dynamics of the device. In addition, key parameters such as system weight, rotor speed, internal mass weight and location, as well as battery capacity are varied to explore and optimize flight performance characteristics such as single hop height and range, number of hops, and total achievable range. The sensitivity of the Hopping Rotochute to atmospheric winds is also investigated as is the ability of the device to perform trajectory shaping.

  12. Vacancy–Vacancy Interaction Induced Oxygen Diffusivity Enhancement in Undoped Nonstoichiometric Ceria

    DOE PAGES

    Yuan, Fenglin; Zhang, Yanwen; Weber, William J.

    2015-05-19

    In this paper, molecular dynamics simulations and molecular static calculations have been used to systematically study oxygen vacancy transport in undoped nonstoichiometric ceria. A strong oxygen diffusivity enhancement appears in the vacancy concentration range of 2–4% over the temperature range from 1000 to 2000 K. An Arrhenius ion diffusion mechanism by vacancy hopping along the (100) direction is unambiguously identified, and an increasing trend of both the oxygen migration barrier and the prefactor with increasing vacancy concentration is observed. Within the framework of classical diffusion theory, a weak concentration dependence of the prefactor in oxygen vacancy migration is shown tomore » be crucial for explaining the unusual fast oxygen ion migration in the low concentration range and consequently the appearance of a maximum in oxygen diffusivity. Finally, a representative (100) direction interaction model is constructed to identify long-range vacancy–vacancy interaction as the structural origin of the positive correlation between oxygen migration barrier and vacancy concentration.« less

  13. Electronic properties of high-temperature superconductors and novel carbon-based conductors and superconductors

    NASA Astrophysics Data System (ADS)

    Fuhrer, Michael Sears

    This thesis is divided into three sections. The first section discusses the electrical transport properties of a highly anisotropic high temperature superconductor, Bi2Sr2CaCu2O8, in magnetic fields. High temperature superconductivity has greatly expanded the study of vortex matter: the state of the quantized magnetic field excitations, or vortices, in a superconductor. The effects of tilted fields and fields parallel to the planes are studied: striking deviations from the expectations of a simple anisotropic superconductivity model are found, indicating that the layered structure of high temperature superconductors plays a significant role in determining the dynamics and phases of vortex matter. For the case of parallel magnetic fields, the Josephson vortex state, a new phase transition is identified, the melting of the Josephson vortex lattice. A mechanism for Josephson vortex lattice melting is proposed to explain the differences in the phase diagrams from the usual case of Abrikosov vortex lattice melting. The second section discusses experiments on C60-containing solids. A method for growing high quality single crystals of C60 is described. Isotopically pure single crystal samples of the fulleride superconductor Rb3C60 were synthesized in order to measure the carbon isotope effect on superconductivity. By measuring the superconducting transitions in the resistance of single crystals of Rb3C60, the carbon isotope effect was determined with unprecedented accuracy. Measurement of the isotope effect gives essential information for determination of the superconducting parameters, necessary for a complete theoretical picture of superconductivity in this material. New intercalated graphite compounds containing C60, and their electronic properties, are also discussed. The third section discusses the electrical transport and magnetotransport properties of mats of single-walled carbon nanotubes. Single-walled nanotubes are an intriguing new physical system: nanowires of pure carbon with nanometerscale diameters and lengths of microns. The previously unexplained low-temperature properties are shown to be due to localization. The radius of the localized states is determined, and the hopping conduction is found to be three-dimensional in nature. The magnetotransport also agrees with models of variable range hopping in two or greater dimensions, indicating that mats of single-walled nanotubes are well-connected metallic networks.

  14. Temperature and magnetic field effects on electron transport through DNA molecules in a two-dimensional four-channel system.

    PubMed

    Joe, Yong S; Lee, Sun H; Hedin, Eric R; Kim, Young D

    2013-06-01

    We utilize a two-dimensional four-channel DNA model, with a tight-binding (TB) Hamiltonian, and investigate the temperature and the magnetic field dependence of the transport behavior of a short DNA molecule. Random variation of the hopping integrals due to the thermal structural disorder, which partially destroy phase coherence of electrons and reduce quantum interference, leads to a reduction of the localization length and causes suppressed overall transmission. We also incorporate a variation of magnetic field flux density into the hopping integrals as a phase factor and observe Aharonov-Bohm (AB) oscillations in the transmission. It is shown that for non-zero magnetic flux, the transmission zero leaves the real-energy axis and moves up into the complex-energy plane. We also point out that the hydrogen bonds between the base pair with flux variations play a role to determine the periodicity of AB oscillations in the transmission.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Dong; Heidelberger, Philip; Sugawara, Yutaka

    An apparatus and method for extending the scalability and improving the partitionability of networks that contain all-to-all links for transporting packet traffic from a source endpoint to a destination endpoint with low per-endpoint (per-server) cost and a small number of hops. An all-to-all wiring in the baseline topology is decomposed into smaller all-to-all components in which each smaller all-to-all connection is replaced with star topology by using global switches. Stacking multiple copies of the star topology baseline network creates a multi-planed switching topology for transporting packet traffic. Point-to-point unified stacking method using global switch wiring methods connects multiple planes ofmore » a baseline topology by using the global switches to create a large network size with a low number of hops, i.e., low network latency. Grouped unified stacking method increases the scalability (network size) of a stacked topology.« less

  16. Theoretical study of electron transport along self-assembled graphitic nanowires

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Stafström, Sven

    2000-11-01

    Electron transport through stacks of polyaromatic hydrocarbons is studied theoretically using the Landauer formalism. The polyaromatic hydrocarbons can be synthesized in many different sizes and can form molecular stacks with a varying number of molecules and with a rather strong π-overlap along the stack. This allows for a large flexibility in the nanostructure of these materials and makes it possible to study the variation in the conductance with a number of different factors: a near-linear increase in the conductance as a function of the number of atoms in the individual molecule is observed. Furthermore, the conductance drops exponentially with the number of molecules in the stacks, from which it follows that an increase in the intermolecular hopping results in an increase in the conductance which is proportional to the intermolecular hopping to the power of 2(N-1), where N is the number of molecules in the stack.

  17. Present knowledge of electronic properties and charge transport of icosahedral boron-rich solids

    NASA Astrophysics Data System (ADS)

    Werheit, Helmut

    2009-06-01

    B12 icosahedra or related structure elements determine the different modifications of elementary boron and numerous boron-rich compounds from α-rhombohedral boron with 12 to YB66 type with about 1584 atoms per unit cell. Typical are well-defined high density intrinsic defects: Jahn-Teller distorted icosahedra, vacancies, incomplete occupancies, statistical occupancies and antisite defects. The correlation between intrinsic point defects and electron deficiencies solves the discrepancy between theoretically predicted metal and experimentally proved semiconducting character. The electron deficiencies generate split-off valence states, which are decisive for the electronic transport, a superposition of band-type and hopping-type conduction. Their share depends on actual conditions like temperature or pre-excitation. The theoretical model of bipolaron hopping is incompatible with numerous experiments. Technical application of the typically p-type icosahedral boron-rich solids requires suitable n-type counterparts; doping and other possibilities are discussed.

  18. The Effect of Holder Pasteurization on Nutrients and Biologically-Active Components in Donor Human Milk: A Review

    PubMed Central

    Peila, Chiara; Moro, Guido E.; Bertino, Enrico; Cavallarin, Laura; Giribaldi, Marzia; Giuliani, Francesca; Cresi, Francesco; Coscia, Alessandra

    2016-01-01

    When a mother’s milk is unavailable, the best alternative is donor milk (DM). Milk delivered to Human Milk Banks should be pasteurized in order to inactivate the microbial agents that may be present. Currently, pasteurization, performed at 62.5 °C for 30 min (Holder Pasteurization, HoP), is recommended for this purpose in international guidelines. Several studies have been performed to investigate the effects of HoP on the properties of DM. The present paper has the aim of reviewing the published papers on this topic, and to provide a comparison of the reported variations of biologically-active DM components before and after HoP. This review was performed by searching the MEDLINE, EMBASE, CINHAL and Cochrane Library databases. Studies that clearly identified the HoP parameters and compared the same DM samples, before and after pasteurization, were focused on. A total of 44 articles satisfied the above criteria, and were therefore selected. The findings from the literature report variable results. A possible explanation for this may be the heterogeneity of the test protocols that were applied. Moreover, the present review spans more than five decades, and modern pasteurizers may be able to modify the degradation kinetics for heat-sensitive substances, compared to older ones. Overall, the data indicate that HoP affects several milk components, although it is difficult to quantify the degradation degree. However, clinical practices demonstrate that many beneficial properties of DM still persist after HoP. PMID:27490567

  19. A Comparison of Vertical Stiffness Values Calculated from Different Measures of Center of Mass Displacement in Single-Leg Hopping.

    PubMed

    Mudie, Kurt L; Gupta, Amitabh; Green, Simon; Hobara, Hiroaki; Clothier, Peter J

    2017-02-01

    This study assessed the agreement between K vert calculated from 4 different methods of estimating vertical displacement of the center of mass (COM) during single-leg hopping. Healthy participants (N = 38) completed a 10-s single-leg hopping effort on a force plate, with 3D motion of the lower limb, pelvis, and trunk captured. Derived variables were calculated for a total of 753 hop cycles using 4 methods, including: double integration of the vertical ground reaction force, law of falling bodies, a marker cluster on the sacrum, and a segmental analysis method. Bland-Altman plots demonstrated that K vert calculated using segmental analysis and double integration methods have a relatively small bias (0.93 kN⋅m -1 ) and 95% limits of agreement (-1.89 to 3.75 kN⋅m -1 ). In contrast, a greater bias was revealed between sacral marker cluster and segmental analysis (-2.32 kN⋅m -1 ), sacral marker cluster and double integration (-3.25 kN⋅m -1 ), and the law of falling bodies compared with all methods (17.26-20.52 kN⋅m -1 ). These findings suggest the segmental analysis and double integration methods can be used interchangeably for the calculation of K vert during single-leg hopping. The authors propose the segmental analysis method to be considered the gold standard for the calculation of K vert during single-leg, on-the-spot hopping.

  20. The Effect of Holder Pasteurization on Nutrients and Biologically-Active Components in Donor Human Milk: A Review.

    PubMed

    Peila, Chiara; Moro, Guido E; Bertino, Enrico; Cavallarin, Laura; Giribaldi, Marzia; Giuliani, Francesca; Cresi, Francesco; Coscia, Alessandra

    2016-08-02

    When a mother's milk is unavailable, the best alternative is donor milk (DM). Milk delivered to Human Milk Banks should be pasteurized in order to inactivate the microbial agents that may be present. Currently, pasteurization, performed at 62.5 °C for 30 min (Holder Pasteurization, HoP), is recommended for this purpose in international guidelines. Several studies have been performed to investigate the effects of HoP on the properties of DM. The present paper has the aim of reviewing the published papers on this topic, and to provide a comparison of the reported variations of biologically-active DM components before and after HoP. This review was performed by searching the MEDLINE, EMBASE, CINHAL and Cochrane Library databases. Studies that clearly identified the HoP parameters and compared the same DM samples, before and after pasteurization, were focused on. A total of 44 articles satisfied the above criteria, and were therefore selected. The findings from the literature report variable results. A possible explanation for this may be the heterogeneity of the test protocols that were applied. Moreover, the present review spans more than five decades, and modern pasteurizers may be able to modify the degradation kinetics for heat-sensitive substances, compared to older ones. Overall, the data indicate that HoP affects several milk components, although it is difficult to quantify the degradation degree. However, clinical practices demonstrate that many beneficial properties of DM still persist after HoP.

  1. Global Ill-Literacies: Hip Hop Cultures, Youth Identities, and the Politics of Literacy

    ERIC Educational Resources Information Center

    Alim, H. Samy

    2011-01-01

    This article focuses on the emergence of what the author refers to as "global ill-literacies," that is, the hybrid, transcultural linguistic and literacy practices of Hip Hop youth in local and global contexts, as well as the pedagogical possibilities that scholars open up as they engage these forms. By reviewing a broad but focused range of…

  2. What Is Hip-Hop-Based Education Doing in "Nice" Fields Such as Early Childhood and Elementary Education?

    ERIC Educational Resources Information Center

    Love, Bettina L.

    2015-01-01

    Hip-Hop-Based Education (HHBE) has resulted in many positive educational outcomes, ranging from teaching academic skills to teaching critical reflection at secondary levels. Given what HHBE initiatives have accomplished, it is troubling that there is an absence of attention to these methods in education programs for elementary and early childhood…

  3. Pistachio (Pistacia vera L.) is a new natural host of Hop stunt viroid.

    PubMed

    Elleuch, Amine; Hamdi, Imen; Ellouze, Olfa; Ghrab, Mohamed; Fkahfakh, Hatem; Drira, Noureddine

    2013-10-01

    Besides hop, Hop stunt viroid (HpSVd) infects many woody species including grapevine, citrus, peach, plum, apricot, almond, pomegranate, mulberry and jujube. Here, we report the first detection of HpSVd in pistachio (Pistacia vera L.). Samples corresponding to 16 pistachio cultivars were obtained from a nearby almond collection. From these samples, low molecular weight RNAs were extracted for double polyacrylamide gel electrophoresis, northern-blot analysis and reverse transcription polymerase chain reaction assays. HpSVd was detected in 4 of the 16 pistachio cultivars in the first year and in 6 in the second, being also detected in the almond collection. Examination of the nucleotide sequences of pistachio and almond isolates revealed 13 new sequence variants. Sequences from pistachio shared 92-96 % similarity with the first reported HpSVd sequence (GenBank X00009), and multiple alignment and phylogenetic analyses showed that one pistachio isolate (HpSVdPis67Jabari) clustered with the plum group, whereas all the others clustered with the hop, and the recombinants plum-citrus and plum-Hop/cit3 groups. By identifying pistachio as a new natural host, we confirm that HpSVd is an ubiquitous and genetically variable viroid that infects many different fruit trees cultivated worldwide.

  4. Molecular cloning and characterization of an Hsp90/70 organizing protein gene from Frankliniella occidentalis (Insecta: Thysanoptera, Thripidae).

    PubMed

    Li, Hong-Bo; Du, Yu-Zhou

    2013-05-15

    The heat shock 90/70 organizing protein (Hop), also known as Sti-1 (stress-induced protein-1), is a co-chaperone that usually mediates the interaction of Hsp90 and Hsp70 and has been extensively characterized in mammals and plants. However, its role in insects remains unknown. In the present study, we isolated and characterized a Hop homologue gene from Frankliniella occidentalis (Fohop). The Fohop contains a 1659bp ORF encoding a protein of 552 amino acids with a caculated molecular mass of approximately 62.25kDa, which displays a reasonable degree of identity with the known Hops and shares several canonical motifs, including three tetratricopeptide repeated motif domains (TPR1, TPR2A and TPR2B) and two aspartic acid-proline (DP) repeat motifs (DP1 and DP2). As in other hops, Fohop contains introns, but the number and the position are quite variable. The mRNA expression patterns indicated that Fohop was constitutively expressed throughout the developmental stages, but was obviously upregulated by heat stress both in larvae and adults. Our studies imply that Hop, as in other Hsps, may play an important role in heat shock response of F. occidentalis. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Steerable Hopping Six-Legged Robot

    NASA Technical Reports Server (NTRS)

    Younse, Paulo; Aghazarian, Hrand

    2010-01-01

    The figure depicts selected aspects of a six-legged robot that moves by hopping and that can be steered in the sense that it can be launched into a hop in a controllable direction. This is a prototype of hopping robots being developed for use in scientific exploration of rough terrain on remote planets that have surface gravitation less than that of Earth. Hopping robots could also be used on Earth, albeit at diminished hopping distances associated with the greater Earth gravitation. The upper end of each leg is connected through two universal joints to an upper and a lower hexagonal frame, such that the tilt of the leg depends on the relative position of the two frames. Two non-back-driveable worm-gear motor drives are used to control the relative position of the two frames along two axes 120 apart, thereby controlling the common tilt of all six legs and thereby, further, controlling the direction of hopping. Each leg includes an upper and a lower aluminum frame segment with a joint between them. A fiberglass spring, connected via hinges to both segments, is used to store hopping energy prior to launch into a hop and to cushion the landing at the end of the hop. A cable for loading the spring is run into each leg through the center of the universal joints and then down along the center lines of the segments to the lower end of the leg. A central spool actuated by a motor with a harmonic drive and an electromagnetic clutch winds in all six cables to compress all six springs (thereby also flexing all six legs) simultaneously. To ensure that all the legs push off and land in the same direction, timing- belt pulley drives are attached to the leg segments, restricting the flexing and extension of all six legs to a common linear motion. In preparation for a hop, the spool can be driven to load the spring legs by an amount corresponding to a desired hop distance within range. The amount of compression can be computed from the reading of a shaft-angle encoder that indicates the amount by which the spool has been turned. When the robot is ready to hop, the electromagnetic clutch disengages the motor from the spool, thus releasing the cable restraints on the springs and allowing the springs to extend all six legs simultaneously.

  6. Detrending with Empirical Mode Decomposition (DEMD): Theory, Evaluation, and Application

    NASA Astrophysics Data System (ADS)

    Bolch, Michael Adam

    Land-surface heterogeneity (LSH) at different scales has significant influence on atmospheric boundary layer (ABL) buoyant and shear turbulence generation and transfers of water, carbon and heat. The extent of proliferation of this influence into larger-scale circulations and atmospheric structures is a topic continually investigated in experimental and numerical studies, in many cases with the hopes of improving land-atmosphere parameterizations for modeling purposes. The blending height is a potential metric for the vertical propagation of LSH effects into the ABL, and has been the subject of study for several decades. Proper assessment of the efficacy of blending height theory invites the combination of observations throughout ABLs above different LSH scales with model simulations of the observed ABL and LSH conditions. The central goal of this project is to develop an apt and thoroughly scrutinized method for procuring ABL observations that are accurately detrended and justifiably relevant for such a study, referred to here as Detrending with Empirical Mode Decomposition (DEMD). The Duke University helicopter observation platform (HOP) provides ABL data [wind (u, v, and w), temperature ( T), moisture (q), and carbon dioxide (CO 2)] at a wide range of altitudes, especially in the lower ABL, where LSH effects are most prominent, and where other aircraft-based platforms cannot fly. Also, lower airspeeds translate to higher resolution of the scalars and fluxes needed to evaluate blending height theory. To confirm noninterference of the main rotor downwash with the HOP sensors, and also to identify optimal airspeeds, analytical, numerical, and observational studies are presented. Analytical analysis clears the main rotor downwash from the HOP nose at airspeeds above 10 m s-1. Numerical models find an acceptable range from 20-40 m s-1, due to a growing compressed air preceding the HOP nose. The first observational study finds no impact of different HOP airspeeds on measurements from ˜18 m s -1 to ˜55 m s-1 over a stable marine boundary layer (MBL). Another set of observations studies HOP and tower data, using the Duke University Mobile Micrometeorological Station (MMS) over an MBL, and concludes that HOP sensible heat (SH), latent heat (LE), and carbon dioxide (F CO2) fluxes align well with MMS findings. The HOP sensors provide ABL data at 40 Hz, as well as a real-time display of theta for in-flight ABL height estimation. Sensor calibration and alignment procedures indicate usable ABL measurements. HOP data are especially susceptible to the spurious influence of platform motion on ABL data, largely due to the low-altitude and low-airspeed capabilities of the HOP. For example, HOP altitude motion in the presence of a lapse rate can cause spurious T fluctuations. Empirical mode decomposition (EMD) can separate HOP data into a set of adaptive and unique intrinsic mode functions (IMFs), often with physical meaning. DEMD aims to correct for spurious contributions to HOP data, while merging EMD with a correlation analysis to adjust data without eliminating relevant ABL dynamics. To evaluate DEMD efficacy, two-dimensional synthetic T fields with simulated turbulence over a prescribed lapse rate are sampled with altitude fluctuations similar to HOP flights, and with a wide range of T perturbation and sampling path parameter variations. DEMD recovers the prescribed lapse rate within 1% on average for the 552 test cases passing the filtering criteria. The method is further evaluated via application to vertical cross sections taken from the Ocean-Land-Atmosphere Model (OLAM) large-eddy simulation (LES) results, where DEMD shows improved accuracy of SH recovery. DEMD is applied to three low-altitude HOP flight legs flown on 19 June 2007 during the Cloud and Land Surface Interaction Campaign (CLASIC), both as an example of practical application and to compare DEMD to the initially proposed method (Holder et al. 2011, hereafter H11). H11 dictates the elimination of correlated IMFs, along with other subtle differences from DEMD, which also eliminates any ABL motions embedded in those IMFs. As suspected, the H11 method produces marked reductions of variances and turbulence kinetic energy (TKE) and substantial deviations in SH, LE, and FCO2 compared to DEMD. DEMD detrends without unnecessary elimination. DEMD is vital for ensuring accurate scalars and fluxes from HOP data, and a strategy for future research is presented that integrates properly detrended observations from the CLASIC HOP dataset with OLAM simulations to explore LSH effects on ABL processes and evaluate blending height theory.

  7. Type III Effector Diversification via Both Pathoadaptation and Horizontal Transfer in Response to a Coevolutionary Arms Race

    PubMed Central

    Ma, Wenbo; Dong, Frederick F. T; Stavrinides, John; Guttman, David S

    2006-01-01

    The concept of the coevolutionary arms race holds a central position in our understanding of pathogen–host interactions. Here we identify the molecular mechanisms and follow the stepwise progression of an arms race in a natural system. We show how the evolution and function of the HopZ family of type III secreted effector proteins carried by the plant pathogen Pseudomonas syringae are influenced by a coevolutionary arms race between pathogen and host. We surveyed 96 isolates of P. syringae and identified three homologs (HopZ1, HopZ2, and HopZ3) distributed among ∼45% of the strains. All alleles were sequenced and their expression was confirmed. Evolutionary analyses determined that the diverse HopZ1 homologs are ancestral to P. syringae, and have diverged via pathoadaptive mutational changes into three functional and two degenerate forms, while HopZ2 and HopZ3 have been brought into P. syringae via horizontal transfer from other ecologically similar bacteria. A PAML selection analysis revealed that the C terminus of HopZ1 is under strong positive selection. Despite the extensive genetic variation observed in this family, all three homologs have cysteine–protease activity, although their substrate specificity may vary. The introduction of the ancestral hopZ1 allele into strains harboring alternate alleles results in a resistance protein-mediated defense response in their respective hosts, which is not observed with the endogenous allele. These data indicate that the P. syringae HopZ family has undergone allelic diversification via both pathoadaptive mutational changes and horizontal transfer in response to selection imposed by the host defense system. This genetic diversity permits the pathogen to avoid host defenses while still maintaining a virulence-associated protease, thereby allowing it to thrive on its current host, while simultaneously impacting its host range. PMID:17194219

  8. Honest, Open, Proud for adolescents with mental illness: pilot randomized controlled trial.

    PubMed

    Mulfinger, Nadine; Müller, Sabine; Böge, Isabel; Sakar, Vehbi; Corrigan, Patrick W; Evans-Lacko, Sara; Nehf, Luise; Djamali, Julia; Samarelli, Anna; Kempter, Michael; Ruckes, Christian; Libal, Gerhard; Oexle, Nathalie; Noterdaeme, Michele; Rüsch, Nicolas

    2018-06-01

    Due to public stigma or self-stigma and shame, many adolescents with mental illness (MI) struggle with the decision whether to disclose their MI to others. Both disclosure and nondisclosure are associated with risks and benefits. Honest, Open, Proud (HOP) is a peer-led group program that supports participants with disclosure decisions in order to reduce stigma's impact. Previously, HOP had only been evaluated among adults with MI. This two-arm pilot randomized controlled trial included 98 adolescents with MI. Participants were randomly assigned to HOP and treatment as usual (TAU) or to TAU alone. Outcomes were assessed pre (T0/baseline), post (T1/after the HOP program), and at 3-week follow-up (T2/6 weeks after T0). Primary endpoints were stigma stress at T1 and quality of life at T2. Secondary outcomes included self-stigma, disclosure-related distress, empowerment, help-seeking intentions, recovery, and depressive symptoms. The trial is registered on ClinicalTrials (NCT02751229; http://www.clinicaltrials.gov). Compared to TAU, adolescents in the HOP program showed significantly reduced stigma stress at T1 (d = .92, p < .001) and increased quality of life at T2 (d = .60, p = .004). In a longitudinal mediation model, the latter effect was fully mediated by stigma stress reduction at T1. HOP further showed significant positive effects on self-stigma, disclosure-related distress, secrecy, help-seeking intentions, attitudes to disclosure, recovery, and depressive symptoms. Effects at T1 remained stable or improved further at follow-up. In a limited economic evaluation HOP was cost-efficient in relation to gains in quality of life. As HOP is a compact three-session program and showed positive effects on stigma and disclosure variables as well as on symptoms and quality of life, it could help to reduce stigma's negative impact among adolescents with MI. © 2017 Association for Child and Adolescent Mental Health.

  9. Sensor-Motor Maps for Describing Linear Reflex Composition in Hopping.

    PubMed

    Schumacher, Christian; Seyfarth, André

    2017-01-01

    In human and animal motor control several sensory organs contribute to a network of sensory pathways modulating the motion depending on the task and the phase of execution to generate daily motor tasks such as locomotion. To better understand the individual and joint contribution of reflex pathways in locomotor tasks, we developed a neuromuscular model that describes hopping movements. In this model, we consider the influence of proprioceptive length (LFB), velocity (VFB) and force feedback (FFB) pathways of a leg extensor muscle on hopping stability, performance and efficiency (metabolic effort). Therefore, we explore the space describing the blending of the monosynaptic reflex pathway gains. We call this reflex parameter space a sensor-motor map . The sensor-motor maps are used to visualize the functional contribution of sensory pathways in multisensory integration. We further evaluate the robustness of these sensor-motor maps to changes in tendon elasticity, body mass, segment length and ground compliance. The model predicted that different reflex pathway compositions selectively optimize specific hopping characteristics (e.g., performance and efficiency). Both FFB and LFB were pathways that enable hopping. FFB resulted in the largest hopping heights, LFB enhanced hopping efficiency and VFB had the ability to disable hopping. For the tested case, the topology of the sensor-motor maps as well as the location of functionally optimal compositions were invariant to changes in system designs (tendon elasticity, body mass, segment length) or environmental parameters (ground compliance). Our results indicate that different feedback pathway compositions may serve different functional roles. The topology of the sensor-motor map was predicted to be robust against changes in the mechanical system design indicating that the reflex system can use different morphological designs, which does not apply for most robotic systems (for which the control often follows a specific design). Consequently, variations in body mechanics are permitted with consistent compositions of sensory feedback pathways. Given the variability in human body morphology, such variations are highly relevant for human motor control.

  10. Structural, magnetic and magnetocaloric properties of Co-doped nanocrystalline La0.7Te0.3Mn0.7Co0.3O3

    NASA Astrophysics Data System (ADS)

    Meenakshi; Kumar, Amit; Mahato, Rabindra Nath

    2018-02-01

    Structural, magnetic and magnetocaloric properties of the nanocrystalline La0.7Te0.3Mn0.7Co0.3O3 perovskite manganite were investigated. X-ray diffraction pattern indicated that the nanocrystalline sample crystallized in orthorhombic crystal structure with Pbnm space group. The average particle size was calculated using scanning electron microscope and it was found to be ∼150 nm. Temperature dependence magnetization measurements revealed ferromagnetic-paramagnetic phase transition and the Curie temperature (TC) was found to be ∼201 K. Field dependence magnetization showed the hysteresis at low temperature with a coercive field of ∼0.34 T and linear dependence at high temperature corresponds to paramagnetic region. Based on the magnetic field dependence magnetization data, the maximum entropy change and relative cooling power (RCP) were estimated and the values were 1.002 J kg-1 K-1 and 90 J kg-1 for a field change of 5 T respectively. Temperature dependent resistivity ρ(T) data exhibited semiconducting-like behavior at high temperature and the electrical transport was well explained by Mott's variable-range hopping (VRH) conduction mechanism in the temperature range of 250 K-300 K. Using the VRH fit, the calculated hoping distance (Rh) at 300 K was 54.4 Å and density of states N(EF) at room temperature was 7.04 × 1018 eV-1 cm-3. These values were comparable to other semiconducting oxides.

  11. Structural and electrical properties of conducting diamond nanowires.

    PubMed

    Sankaran, Kamatchi Jothiramalingam; Lin, Yen-Fu; Jian, Wen-Bin; Chen, Huang-Chin; Panda, Kalpataru; Sundaravel, Balakrishnan; Dong, Chung-Li; Tai, Nyan-Hwa; Lin, I-Nan

    2013-02-01

    Conducting diamond nanowires (DNWs) films have been synthesized by N₂-based microwave plasma enhanced chemical vapor deposition. The incorporation of nitrogen into DNWs films is examined by C 1s X-ray photoemission spectroscopy and morphology of DNWs is discerned using field-emission scanning electron microscopy and transmission electron microscopy (TEM). The electron diffraction pattern, the visible-Raman spectroscopy, and the near-edge X-ray absorption fine structure spectroscopy display the coexistence of sp³ diamond and sp² graphitic phases in DNWs films. In addition, the microstructure investigation, carried out by high-resolution TEM with Fourier transformed pattern, indicates diamond grains and graphitic grain boundaries on surface of DNWs. The same result is confirmed by scanning tunneling microscopy and scanning tunneling spectroscopy (STS). Furthermore, the STS spectra of current-voltage curves discover a high tunneling current at the position near the graphitic grain boundaries. These highly conducting regimes of grain boundaries form effective electron paths and its transport mechanism is explained by the three-dimensional (3D) Mott's variable range hopping in a wide temperature from 300 to 20 K. Interestingly, this specific feature of high conducting grain boundaries of DNWs demonstrates a high efficiency in field emission and pave a way to the next generation of high-definition flat panel displays or plasma devices.

  12. Anderson localization of electrons in single crystals: LixFe7Se8

    PubMed Central

    Ying, Tianping; Gu, Yueqiang; Chen, Xiao; Wang, Xinbo; Jin, Shifeng; Zhao, Linlin; Zhang, Wei; Chen, Xiaolong

    2016-01-01

    Anderson (disorder-induced) localization, proposed more than half a century ago, has inspired numerous efforts to explore the absence of wave diffusions in disordered media. However, the proposed disorder-induced metal-insulator transition (MIT), associated with the nonpropagative electron waves, has hardly been observed in three-dimensional (3D) crystalline materials, let alone single crystals. We report the observation of an MIT in centimeter-size single crystals of LixFe7Se8 induced by lattice disorder. Both specific heat and infrared reflectance measurements reveal the presence of considerable electronic states in the vicinity of the Fermi level when the MIT occurs, suggesting that the transition is not due to Coulomb repulsion mechanism. The 3D variable range hopping regime evidenced by electrical transport measurements at low temperatures indicates the localized nature of the electronic states on the Fermi level. Quantitative analyses of carrier concentration, carrier mobility, and simulated density of states (DOS) fully support that LixFe7Se8 is an Anderson insulator. On the basis of these results, we provide a unified DOS picture to explain all the experimental results, and a schematic diagram for finding other potential Anderson insulators. This material will thus serve as a rich playground for both theoretical and experimental investigations on MITs and disorder-induced phenomena. PMID:26989781

  13. Perceptions of the motivational climate, need satisfaction, and indices of well- and ill-being among hip hop dancers.

    PubMed

    Quested, Eleanor; Duda, Joan L

    2009-01-01

    Grounded in the self-determination theoretical framework (SDT) formulated by Deci and Ryan, and specifically the basic needs mini-theory (BNT), this study examined the relationship between perceptions of the motivational climate manifested in hip hop environments, satisfaction of the three basic needs, and indicators of well- and ill-being among hip hop dancers. Fifty-nine hip hop dancers (mean age: 20.29 years) completed a questionnaire assessing the variables of interest in the study. Perceptions of a task-involving climate were positively associated with satisfaction of the needs for autonomy, competence, and relatedness. Perceptions of an ego-involving climate negatively predicted relatedness. Satisfaction of the need for competence was positively associated with positive affect, and negatively linked to negative affect. Competence need satisfaction significantly mediated the relationship between a perceived task-involving climate and positive and negative affective states. In sum, the findings provided partial support for the facets of SDT and BNT. The results also indicated that promoting the task-involving features of dance learning environments may be beneficial to dancers' well-being.

  14. Comparison of tunnel variability between trans-portal and outside-in techniques in ACL reconstruction.

    PubMed

    Sim, Jae-Ang; Kim, Jong-Min; Lee, Sahnghoon; Bae, Ji-Yong; Seon, Jong-Keun

    2017-04-01

    Although trans-portal and outside-in techniques are commonly used for anatomical ACL reconstruction, there is very little information on variability in tunnel placement between two techniques. A total of 103 patients who received ACL reconstruction using trans-portal (50 patients) and outside-in techniques (53 patients) were included in the study. The ACL tunnel location, length and graft-femoral tunnel angle were analyzed using the 3D CT knee models, and we compared the location and length of the femoral and tibial tunnels, and graft bending angle between the two techniques. The variability in each technique regarding the tunnel location, length and graft tunnel angle using the range values was also compared. There were no differences in the average of femoral tunnel depth and height between the two groups. The ranges of femoral tunnel depth and height showed no difference between two groups (36 and 41 % in trans-portal technique vs. 32 and 41 % in outside-in technique). The average value and ranges of tibial tunnel location also showed similar results in two groups. The outside-in technique showed longer femoral tunnel than the trans-portal technique (34.0 vs. 36.8 mm, p = 0.001). The range of femoral tunnel was also wider in trans-portal technique than in outside-in technique. Although the outside-in technique showed significant acute graft bending angle than trans-portal technique in average values, the trans-portal technique showed wider ranges in graft bending angle than outside-in technique [ranges 73° (SD 13.6) vs. 53° (SD 10.7), respectively]. Although both trans-portal and outside-in techniques in ACL reconstruction can provide relatively consistent in femoral and tibial tunnel locations, trans-portal technique showed high variability in femoral tunnel length and graft bending angles than outside-in technique. Therefore, the outside-in technique in ACL reconstruction is considered as the effective method for surgeons to make more consistent femoral tunnel. III.

  15. Bipedal hopping timed to a metronome to detect impairments in anticipatory motor control in people with mild multiple sclerosis.

    PubMed

    Kirkland, Megan C; Chen, Alice; Downer, Matthew B; Holloway, Brett J; Wallack, Elizabeth M; Lockyer, Evan J; Buckle, Natasha C M; Abbott, Courtney L; Ploughman, Michelle

    2018-06-01

    People with mild multiple sclerosis (MS) often report subtle deficits in balance and cognition but display no measurable impairment on clinical assessments. We examined whether hopping to a metronome beat had the potential to detect anticipatory motor control deficits among people with mild MS (Expanded Disability Status Scale ≤ 3.5). Participants with MS (n = 13), matched controls (n = 9), and elderly subjects (n = 13) completed tests of cognition (Montreal Cognitive Assessment (MoCA)) and motor performance (Timed 25 Foot Walk Test (T25FWT)). Participants performed two bipedal hopping tasks: at 40 beats/min (bpm) and 60-bpm in random order. Hop characteristics (length, symmetry, variability) and delay from the metronome beat were extracted from an instrumented walkway and compared between groups. The MS group became more delayed from the metronome beat over time whereas elderly subjects tended to hop closer to the beat (F = 4.52, p = 0.02). Delay of the first hop during 60-bpm predicted cognition in people with MS (R = 0.55, β = 4.64 (SD 4.63), F = 4.85, p = 0.05) but not among control (R = 0.07, p = 0.86) or elderly subjects (R = 0.17, p = 0.57). In terms of hopping characteristics, at 60-bpm, people with MS and matched controls were significantly different from the elderly group. However, at 40-bpm, the MS group was no longer significantly different from the elderly group, even though matched controls and elderly still differed significantly. This new timed hopping test may be able to detect both physical ability, and feed-forward anticipatory control impairments in people with mild MS. Hopping at a frequency of 40-bpm seemed more challenging. Several aspects of anticipatory motor control can be measured: including reaction time to the first metronome cue and the ability to adapt and anticipate the beat over time. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

  16. Kinetic Analysis of Horizontal Plyometric Exercise Intensity.

    PubMed

    Kossow, Andrew J; Ebben, William P

    2018-05-01

    Kossow, AJ, DeChiara, TG, Neahous, SM, and Ebben, WP. Kinetic analysis of horizontal plyometric exercise intensity. J Strength Cond Res 32(5): 1222-1229, 2018-Plyometric exercises are frequently performed as part of a strength and conditioning program. Most studies assessed the kinetics of plyometric exercises primarily performed in the vertical plane. The purpose of this study was to evaluate the multiplanar kinetic characteristics of a variety of plyometric exercises, which have a significant horizontal component. This study also sought to assess sex differences in the intensity progression of these exercises. Ten men and 10 women served as subjects. The subjects performed a variety of plyometric exercises including the double-leg hop, standing long jump, single-leg standing long jump, bounding, skipping, power skipping, cone hops, and 45.72-cm hurdle hops. Subjects also performed the countermovement jump for comparison. All plyometric exercises were evaluated using a force platform. Dependent variables included the landing rate of force development and landing ground reaction forces for each exercise in the vertical, frontal, and sagittal planes. A 2-way mixed analysis of variance with repeated-measures for plyometric exercise type demonstrated main effects for exercise type for all dependent variables (p ≤ 0.001). There was no significant interaction between plyometric exercise type and sex for any of the variable assessed. Bonferroni-adjusted pairwise comparisons identified a number of differences between the plyometric exercises for the dependent variables assessed (p ≤ 0.05). These findings should be used to guide practitioners in the progression of plyometric exercise intensity, and thus program design, for those who require significant horizontal power in their sport.

  17. Low-frequency dielectric properties of intrinsic and Al-doped rutile TiO{sub 2} thin films grown by the atomic layer deposition technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kassmi, M.; LMOP, El Manar University, Tunis 2092; Pointet, J.

    2016-06-28

    Dielectric spectroscopy is carried out for intrinsic and aluminum-doped TiO{sub 2} rutile films which are deposited on RuO{sub 2} by the atomic layer deposition technique. Capacitance and conductance are measured in the 0.1 Hz–100 kHz range, for ac electric fields up to 1 MV{sub rms}/cm. Intrinsic films have a much lower dielectric constant than rutile crystals. This is ascribed to the presence of oxygen vacancies which depress polarizability. When Al is substituted for Ti, the dielectric constant further decreases. By considering Al-induced modification of polarizability, a theoretical relationship between the dielectric constant and the Al concentration is proposed. Al doping drastically decreasesmore » the loss in the very low frequency part of the spectrum. However, Al doping has almost no effect on the loss at high frequencies. The effect of Al doping on loss is discussed through models of hopping transport implying intrinsic oxygen vacancies and Al related centers. When increasing the ac electric field in the MV{sub rms}/cm range, strong voltage non-linearities are evidenced in undoped films. The conductance increases exponentially with the ac field and the capacitance displays negative values (inductive behavior). Hopping barrier lowering is proposed to explain high-field effects. Finally, it is shown that Al doping strongly improves the high-field dielectric behavior.« less

  18. Hops (Humulus lupulus L.) Bitter Acids: Modulation of Rumen Fermentation and Potential As an Alternative Growth Promoter

    PubMed Central

    Flythe, Michael D.; Kagan, Isabelle A.; Wang, Yuxi; Narvaez, Nelmy

    2017-01-01

    Antibiotics can improve ruminant growth and efficiency by altering rumen fermentation via selective inhibition of microorganisms. However, antibiotic use is increasingly restricted due to concerns about the spread of antibiotic-resistance. Plant-based antimicrobials are alternatives to antibiotics in animal production. The hops plant (Humulus lupulus L.) produces a range of bioactive secondary metabolites, including antimicrobial prenylated phloroglucinols, which are commonly called alpha- and beta-acids. These latter compounds can be considered phyto-ionophores, phytochemicals with a similar antimicrobial mechanism of action to ionophore antibiotics (e.g., monensin, lasalocid). Like ionophores, the hop beta-acids inhibit rumen bacteria possessing a classical Gram-positive cell envelope. This selective inhibition causes several effects on rumen fermentation that are beneficial to finishing cattle, such as decreased proteolysis, ammonia production, acetate: propionate ratio, and methane production. This article reviews the effects of hops and hop secondary metabolites on rumen fermentation, including the physiological mechanisms on specific rumen microorganisms, and consequences for the ruminant host and ruminant production. Further, we propose that hop beta-acids are useful model natural products for ruminants because of (1) the ionophore-like mechanism of action and spectrum of activity and (2) the literature available on the plant due to its use in brewing. PMID:28871284

  19. Diffusion in quasi-one-dimensional channels: A small system n, p, T, transition state theory for hopping times.

    PubMed

    Ahmadi, Sheida; Bowles, Richard K

    2017-04-21

    Particles confined to a single file, in a narrow quasi-one-dimensional channel, exhibit a dynamic crossover from single file diffusion to Fickian diffusion as the channel radius increases and the particles begin to pass each other. The long time diffusion coefficient for a system in the crossover regime can be described in terms of a hopping time, which measures the time it takes for a particle to escape the cage formed by its neighbours. In this paper, we develop a transition state theory approach to the calculation of the hopping time, using the small system isobaric-isothermal ensemble to rigorously account for the volume fluctuations associated with the size of the cage. We also describe a Monte Carlo simulation scheme that can be used to calculate the free energy barrier for particle hopping. The theory and simulation method correctly predict the hopping times for a two-dimensional confined ideal gas system and a system of confined hard discs over a range of channel radii, but the method breaks down for wide channels in the hard discs' case, underestimating the height of the hopping barrier due to the neglect of interactions between the small system and its surroundings.

  20. Biased random walks on Kleinberg's spatial networks

    NASA Astrophysics Data System (ADS)

    Pan, Gui-Jun; Niu, Rui-Wu

    2016-12-01

    We investigate the problem of the particle or message that travels as a biased random walk toward a target node in Kleinberg's spatial network which is built from a d-dimensional (d = 2) regular lattice improved by adding long-range shortcuts with probability P(rij) ∼rij-α, where rij is the lattice distance between sites i and j, and α is a variable exponent. Bias is represented as a probability p of the packet to travel at every hop toward the node which has the smallest Manhattan distance to the target node. We study the mean first passage time (MFPT) for different exponent α and the scaling of the MFPT with the size of the network L. We find that there exists a threshold probability pth ≈ 0.5, for p ≥pth the optimal transportation condition is obtained with an optimal transport exponent αop = d, while for 0 < p pth, and increases with L less than a power law and get close to logarithmical law for 0 < p

  1. Influence of Gas Adsorption and Gold Nanoparticles on the Electrical Properties of CVD-Grown MoS2 Thin Films.

    PubMed

    Cho, Yunae; Sohn, Ahrum; Kim, Sujung; Hahm, Myung Gwan; Kim, Dong-Ho; Cho, Byungjin; Kim, Dong-Wook

    2016-08-24

    Molybdenum disulfide (MoS2) has increasingly attracted attention from researchers and is now one of the most intensively explored atomic-layered two-dimensional semiconductors. Control of the carrier concentration and doping type of MoS2 is crucial for its application in electronic and optoelectronic devices. Because the MoS2 layers are atomically thin, their transport characteristics may be very sensitive to ambient gas adsorption and the resulting charge transfer. We investigated the influence of the ambient gas (N2, H2/N2, and O2) choice on the resistance (R) and surface work function (WF) of trilayer MoS2 thin films grown via chemical vapor deposition. We also studied the electrical properties of gold (Au)-nanoparticle (NP)-coated MoS2 thin films; their R value was found to be 2 orders of magnitude smaller than that for bare samples. While the WF largely varied for each gas, R was almost invariant for both the bare and Au-NP-coated samples regardless of which gas was used. Temperature-dependent transport suggests that variable range hopping is the dominant mechanism for electrical conduction for bare and Au-NP-coated MoS2 thin films. The charges transferred from the gas adsorbates might be insufficient to induce measurable R change and/or be trapped in the defect states. The smaller WF and larger localization length of the Au-NP-coated sample, compared with the bare sample, suggest that more carriers and less defects enhanced conduction in MoS2.

  2. Structure Controlled Long-Range Sequential Tunneling in Carbon-Based Molecular Junctions.

    PubMed

    Morteza Najarian, Amin; McCreery, Richard L

    2017-04-25

    Carbon-based molecular junctions consisting of aromatic oligomers between conducting sp 2 hybridized carbon electrodes exhibit structure-dependent current densities (J) when the molecular layer thickness (d) exceeds ∼5 nm. All four of the molecular structures examined exhibit an unusual, nonlinear ln J vs bias voltage (V) dependence which is not expected for conventional coherent tunneling or activated hopping mechanisms. All molecules exhibit a weak temperature dependence, with J increasing typically by a factor of 2 over the range of 200-440 K. Fluorene and anthraquinone show linear plots of ln J vs d with nearly identical J values for the range d = 3-10 nm, despite significant differences in their free-molecule orbital energy levels. The observed current densities for anthraquinone, fluorene, nitroazobenzene, and bis-thienyl benzene for d = 7-10 nm show no correlation with occupied (HOMO) or unoccupied (LUMO) molecular orbital energies, contrary to expectations for transport mechanisms based on the offset between orbital energies and the electrode Fermi level. UV-vis absorption spectroscopy of molecular layers bonded to carbon electrodes revealed internal energy levels of the chemisorbed films and also indicated limited delocalization in the film interior. The observed current densities correlate well with the observed UV-vis absorption maxima for the molecular layers, implying a transport mechanism determined by the HOMO-LUMO energy gap. We conclude that transport in carbon-based aromatic molecular junctions is consistent with multistep tunneling through a barrier defined by the HOMO-LUMO gap, and not by charge transport at the electrode interfaces. In effect, interfacial "injection" at the molecule/electrode interfaces is not rate limiting due to relatively strong electronic coupling, and transport is controlled by the "bulk" properties of the molecular layer interior.

  3. The effect of varying linker length on ion-transport properties in polymeric ionic liquids

    NASA Astrophysics Data System (ADS)

    Keith, Jordan; Mogurampelly, Santosh; Wheatle, Bill; Ganesan, Venkat

    We report results of atomistic molecular dynamics simulations on polymerized 1-butyl-3-(n-alkyl)imidazolium ionic liquids with PF6- counterions. Consistent with experimental observations, we observe that the mobility of the PF6- ions increases with increasing n-alkyl linker length. Analysis of our results suggests that the motion of PF6- ions is driven by intermolecular ion hopping between chains, which in turn is influenced by ion-pair coordination numbers and intermolecular ionic separation distances. With increasing linker length, we observe 1) the anions coordinating less closely with cations and 2) intermolecular hopping distances decreasing.

  4. Performance analysis of decode-and-forward dual-hop optical spatial modulation with diversity combiner over atmospheric turbulence

    NASA Astrophysics Data System (ADS)

    Odeyemi, Kehinde O.; Owolawi, Pius A.; Srivastava, Viranjay M.

    2017-11-01

    Dual-hops transmission is a growing interest technique that can be used to mitigate against atmospheric turbulence along the Free Space Optical (FSO) communication links. This paper analyzes the performance of Decode-and-Forward (DF) dual-hops FSO systems in-conjunction with spatial modulation and diversity combiners over a Gamma-Gamma atmospheric turbulence channel using heterodyne detection. Maximum Ratio Combiner (MRC), Equal Gain Combiner (EGC) and Selection Combiner (SC) are considered at the relay and destination as mitigation tools to improve the system error performance. Power series expansion of modified Bessel function is used to derive the closed form expression for the end-to-end Average Pairwise Error Probability (APEP) expressions for each of the combiners under study and a tight upper bound on the Average Bit Error Rate (ABER) per hop is given. Thus, the overall end-to-end ABER for the dual-hops FSO system is then evaluated. The numerical results depicted that dual-hops transmission systems outperformed the direct link systems. Moreover, the impact of having the same and different combiners at the relay and destination are also presented. The results also confirm that the combination of dual hops transmission with spatial modulation and diversity combiner significantly improves the systems error rate with the MRC combiner offering an optimal performance with respect to variation in atmospheric turbulence, change in links average received SNR and link range of the system.

  5. Trouble with diffusion: Reassessing hillslope erosion laws with a particle-based model

    NASA Astrophysics Data System (ADS)

    Tucker, Gregory E.; Bradley, D. Nathan

    2010-03-01

    Many geomorphic systems involve a broad distribution of grain motion length scales, ranging from a few particle diameters to the length of an entire hillslope or stream. Studies of analogous physical systems have revealed that such broad motion distributions can have a significant impact on macroscale dynamics and can violate the assumptions behind standard, local gradient flux laws. Here, a simple particle-based model of sediment transport on a hillslope is used to study the relationship between grain motion statistics and macroscopic landform evolution. Surface grains are dislodged by random disturbance events with probabilities and distances that depend on local microtopography. Despite its simplicity, the particle model reproduces a surprisingly broad range of slope forms, including asymmetric degrading scarps and cinder cone profiles. At low slope angles the dynamics are diffusion like, with a short-range, thin-tailed hop length distribution, a parabolic, convex upward equilibrium slope form, and a linear relationship between transport rate and gradient. As slope angle steepens, the characteristic grain motion length scale begins to approach the length of the slope, leading to planar equilibrium forms that show a strongly nonlinear correlation between transport rate and gradient. These high-probability, long-distance motions violate the locality assumption embedded in many common gradient-based geomorphic transport laws. The example of a degrading scarp illustrates the potential for grain motion dynamics to vary in space and time as topography evolves. This characteristic renders models based on independent, stationary statistics inapplicable. An accompanying analytical framework based on treating grain motion as a survival process is briefly outlined.

  6. Bluetooth and security

    NASA Astrophysics Data System (ADS)

    Ivo, Penn

    2004-04-01

    Bluetooth is the new emerging technology for wireless communication. It can be used to connect almost any device to another device. The traditional example is to link a Personal Digital Assistant (PDA) or a laptop to a mobile phone. That way you can easily take remote connections with your PDA or laptop without getting your mobile phone from your pocket or messing around with cables. A Class 3 Bluetooth device has range of 0,1 - 10 meters. The architecture of Bluetooth is formed by the radio, the base frequency part and the Link Manager. Bluetooth uses the radio range of 2.45 GHz. The theoretical maximum bandwidth is 1 Mb/s, which is slowed down a bit by Forward Error Correction (FEC). Bluetooth specification designates the frequency hopping to be implemented with Gaussian Frequency Shift Keying (GFSK). The base frequency part of the Bluetooth architecture uses a combination of circuit and packet switching technologies. Bluetooth can support either one asynchronous data channel and up to three simultaneous synchronous speech channels, or one channel that transfers asynchronous data and synchronous speech simultaneously. The Link Manager is an essential part of the Bluetooth architecture. It uses Link Manager Protocol (LMP) to configure, authenticate and handle the connections between Bluetooth devices. Several Bluetooth devices can form an ad hoc network. In these piconets, one of the Bluetooth devices will act as a master and the others are slaves. The master sets the frequency-hopping behavior of the piconet. It is also possible to connect up to 10 piconets to each other to form so-called scatternets. Bluetooth has been designed to operate in noisy radio frequency environments, and uses a fast acknowledgement and frequency-hopping scheme to make the link robust, communication-wise. Bluetooth radio modules avoid interference from other signals by hopping to a new frequency after transmitting or receiving a packet. Compared with other systems operating in the same frequency band, the Bluetooth radio typically hops faster and uses shorter packets. This is because short packages and fast hopping limit the impact of microwave ovens and other sources of disturbances. Use of Forward Error Correction (FEC) limits the impact of random noise on long-distance links. Bluetooth transmissions are secure in a business and home environment. Bluetooth has built in sufficient encryption and authentication and is thus very secure in any environment. In addition to this, a frequency-hopping scheme with 1600 hops/sec. is employed. This is far quicker than any other competing system. This, together with an automatic output power adaption to reduce the range exactly to requirement, makes the system extremely difficult to eavesdrop. Information Integrity in Bluetooth has these components: Random Number Generation, Encryption, Encryption Key Management and Authentication.

  7. Ab initio modeling of steady-state and time-dependent charge transport in hole-only α-NPD devices

    NASA Astrophysics Data System (ADS)

    Liu, Feilong; Massé, Andrea; Friederich, Pascal; Symalla, Franz; Nitsche, Robert; Wenzel, Wolfgang; Coehoorn, Reinder; Bobbert, Peter A.

    2016-12-01

    We present an ab initio modeling study of steady-state and time-dependent charge transport in hole-only devices of the amorphous molecular semiconductor α-NPD [N ,N'-Di(1 -naphthyl)-N ,N'-diphenyl-(1 ,1'-biphenyl)-4 ,4'-diamine] . The study is based on the microscopic information obtained from atomistic simulations of the morphology and density functional theory calculations of the molecular hole energies, reorganization energies, and transfer integrals. Using stochastic approaches, the microscopic information obtained in simulation boxes at a length scale of ˜10 nm is expanded and employed in one-dimensional (1D) and three-dimensional (3D) master-equation modeling of the charge transport at the device scale of ˜100 nm. Without any fit parameter, predicted current density-voltage and impedance spectroscopy data obtained with the 3D modeling are in very good agreement with measured data on devices with different α-NPD layer thicknesses in a wide range of temperatures, bias voltages, and frequencies. Similarly good results are obtained with the computationally much more efficient 1D modeling after optimizing a hopping prefactor.

  8. Spin relaxation in graphene nanoribbons in the presence of substrate surface roughness

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaghazardi, Zahra; Faez, Rahim; Touski, Shoeib Babaee

    2016-08-07

    In this work, spin transport in corrugated armchair graphene nanoribbons (AGNRs) is studied. We survey combined effects of spin-orbit interaction and surface roughness, employing the non-equilibrium Green's function formalism and multi-orbitals tight-binding model. Rough substrate surfaces have been statistically generated and the hopping parameters are modulated based on the bending and distance of corrugated carbon atoms. The effects of surface roughness parameters, such as roughness amplitude and correlation length, on spin transport in AGNRs are studied. The increase of surface roughness amplitude results in the coupling of σ and π bands in neighboring atoms, leading to larger spin flipping ratemore » and therefore reduction of the spin-polarization, whereas a longer correlation length makes AGNR surface smoother and increases spin-polarization. Moreover, spin diffusion length of carriers is extracted and its dependency on the roughness parameters is investigated. In agreement with experimental data, the spin diffusion length for various substrate ranges between 2 and 340 μm. Our results indicate the importance of surface roughness on spin-transport in graphene.« less

  9. First principles study of the structural, electronic, and transport properties of triarylamine-based nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akande, Akinlolu, E-mail: akandea@tcd.ie; Bhattacharya, Sandip; Cathcart, Thomas

    2014-02-21

    We investigate with state of the art density functional theory the structural, electronic, and transport properties of a class of recently synthesized nanostructures based on triarylamine derivatives. First, we consider the single molecule precursors in the gas phase and calculate their static properties, namely (i) the geometrical structure of the neutral and cationic ions, (ii) the electronic structure of the frontier molecular orbitals, and (iii) the ionization potential, hole extraction potential, and internal reorganization energy. This initial study does not evidence any direct correlation between the properties of the individual molecules and their tendency to self-assembly. Subsequently, we investigate themore » charge transport characteristics of the triarylamine derivatives nanowires, by using Marcus theory. For one derivative we further construct an effective Hamiltonian including intermolecular vibrations and evaluate the mobility from the Kubo formula implemented with Monte Carlo sampling. These two methods, valid respectively in the sequential hopping and polaronic band limit, give us values for the room-temperature mobility in the range 0.1–12 cm{sup 2}/Vs. Such estimate confirms the superior transport properties of triarylamine-based nanowires, and make them an attracting materials platform for organic electronics.« less

  10. Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

    DOE PAGES

    Velásquez, André C.; Nomura, Kinya; Cooper, Max D.; ...

    2017-04-19

    The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

  11. Leucine-rich-repeat-containing variable lymphocyte receptors as modules to target plant-expressed proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Velásquez, André C.; Nomura, Kinya; Cooper, Max D.

    The ability to target and manipulate protein-based cellular processes would accelerate plant research; yet, the technology to specifically and selectively target plant-expressed proteins is still in its infancy. Leucine-rich repeats (LRRs) are ubiquitously present protein domains involved in mediating protein–protein interactions. LRRs confer the binding specificity to the highly diverse variable lymphocyte receptor (VLR) antibodies (including VLRA, VLRB and VLRC types) that jawless vertebrates make as the functional equivalents of jawed vertebrate immunoglobulin-based antibodies. Here, VLRBs targeting an effector protein from a plant pathogen, HopM1, were developed by immunizing lampreys and using yeast surface display to select for high-affinity VLRBs.more » HopM1-specific VLRBs (VLRM1) were expressed in planta in the cytosol, the trans-Golgi network, and the apoplast. Expression of VLRM1 was higher when the protein localized to an oxidizing environment that would favor disulfide bridge formation (when VLRM1 was not localized to the cytoplasm), as disulfide bonds are necessary for proper VLR folding. VLRM1 specifically interacted in planta with HopM1 but not with an unrelated bacterial effector protein while HopM1 failed to interact with a non-specific VLRB. Later, VLRs may be used as flexible modules to bind proteins or carbohydrates of interest in planta, with broad possibilities for their use by binding directly to their targets and inhibiting their action, or by creating chimeric proteins with new specificities in which endogenous LRR domains are replaced by those present in VLRs.« less

  12. Electrophysical Properties of Onion-Like Carbon

    NASA Astrophysics Data System (ADS)

    Tkachev, E. N.; Romanenko, A. I.; Zhdanov, K. R.; Anikeeva, O. B.; Buryakov, T. I.; Kuznetsov, V. L.; Moseenkov, S. I.

    2016-06-01

    The paper examines electrophysical properties of onion-like carbon (OLC) samples, where particles have the average size of 4-8 nm and are formed by 5-10 nested fullerene-like spheres connected by 1-3 common curved graphene shells into aggregates with a size of 50-300 nm. We measured the temperature dependence of electrical resistance from 4.2 to 300 K and dependence of magnetoresistance in magnetic fields up to 6 T at the temperature of 4.2 K. Temperature dependences of electrical resistance of samples can be described within the framework of the Mott law with variable hop length for the one-dimensional case or within the framework of the Efros-Shklovskii Coulomb gap. We observed the quadratically increasing positive magnetoresistance up to 6 T associated with compression of wave functions of conduction electrons. Negative magnetoresistance was observed in the range of magnetic fields up to 1-2 T in the case of some samples. This is due to the fact that magnetic field suppresses the contributions to magnetoresistance made by interference effects in the area of hopping conductivity. The measurements were used to estimate the localization radius that is comparable to the diameter of OLC particles (nano-onions).

  13. Kinematic and Kinetic Analysis of the Single-Leg Triple Hop Test in Women With and Without Patellofemoral Pain.

    PubMed

    dos Reis, Amir Curcio; Correa, João Carlos Ferrari; Bley, André Serra; Rabelo, Nayra Deise dos Anjos; Fukuda, Thiago Yukio; Lucareli, Paulo Roberto Garcia

    2015-10-01

    Cross-sectional study. To compare the biomechanical strategies of the trunk and lower extremity during the transition period between the first and second hop of a single-leg triple hop test in women with and without patellofemoral pain (PFP). Recent literature has shown that PFP is associated with biomechanical impairments of the lower extremities. A number of studies have analyzed the position of the trunk and lower extremities for functional activities such as walking, squatting, jumping, and the step-down test. However, studies on more challenging activities, such as the single-leg triple hop test, may be more representative of sports requiring jumping movements. Women between 18 and 35 years of age (control group, n = 20; PFP group, n = 20) participated in the study. Three-dimensional kinematic and kinetic data were collected during the transition period between the first and second hops while participants performed the single-leg triple hop test. Compared to the control group, women with PFP exhibited greater (P<.05) anterior and ipsilateral trunk lean, contralateral pelvic drop, hip internal rotation and adduction, and ankle eversion, while exhibiting less hip and knee flexion. A significant difference (P<.05) in time to peak joint angle was also found between groups for all the variables analyzed, except anterior pelvic tilt and hip flexion. In addition, women with PFP exhibited greater (P<.05) hip and knee abductor internal moments. Compared to the control group, women with PFP exhibited altered trunk, pelvis, hip, knee, and ankle kinematics and kinetics.

  14. Correlated matrix-fluctuation-mediated activated transport of dilute penetrants in glass-forming liquids and suspensions

    NASA Astrophysics Data System (ADS)

    Zhang, Rui; Schweizer, Kenneth S.

    2017-05-01

    We formulate a microscopic, force-level statistical mechanical theory for the activated diffusion of dilute penetrants in dense liquids, colloidal suspensions, and glasses. The approach explicitly and self-consistently accounts for coupling between penetrant hopping and matrix dynamic displacements that actively facilitate the hopping event. The key new ideas involve two mechanistically (at a stochastic trajectory level) coupled dynamic free energy functions for the matrix and spherical penetrant particles. A single dynamic coupling parameter quantifies how much the matrix displaces relative to the penetrant when the latter reaches its transition state which is determined via the enforcement of a temporal causality or coincidence condition. The theory is implemented for dilute penetrants smaller than the matrix particles, with or without penetrant-matrix attractive forces. Model calculations reveal a rich dependence of the penetrant diffusion constant and degree of dynamic coupling on size ratio, volume fraction, and attraction strength. In the absence of attractions, a near exponential decrease of penetrant diffusivity with size ratio over an intermediate range is predicted, in contrast to the much steeper, non-exponential variation if one assumes local matrix dynamical fluctuations are not correlated with penetrant motion. For sticky penetrants, the relative and absolute influence of caging versus physical bond formation is studied. The conditions for a dynamic crossover from the case where a time scale separation between penetrant and matrix activated hopping exists to a "slaved" or "constraint release" fully coupled regime are determined. The particle mixture model is mapped to treat experimental thermal systems and applied to make predictions for the diffusivity of water, toluene, methanol, and oxygen in polyvinylacetate liquids and glasses. The theory agrees well with experiment with values of the penetrant-matrix size ratio close to their chemically intuitive values.

  15. Correlated matrix-fluctuation-mediated activated transport of dilute penetrants in glass-forming liquids and suspensions

    PubMed Central

    Schweizer, Kenneth S.

    2017-01-01

    We formulate a microscopic, force-level statistical mechanical theory for the activated diffusion of dilute penetrants in dense liquids, colloidal suspensions, and glasses. The approach explicitly and self-consistently accounts for coupling between penetrant hopping and matrix dynamic displacements that actively facilitate the hopping event. The key new ideas involve two mechanistically (at a stochastic trajectory level) coupled dynamic free energy functions for the matrix and spherical penetrant particles. A single dynamic coupling parameter quantifies how much the matrix displaces relative to the penetrant when the latter reaches its transition state which is determined via the enforcement of a temporal causality or coincidence condition. The theory is implemented for dilute penetrants smaller than the matrix particles, with or without penetrant-matrix attractive forces. Model calculations reveal a rich dependence of the penetrant diffusion constant and degree of dynamic coupling on size ratio, volume fraction, and attraction strength. In the absence of attractions, a near exponential decrease of penetrant diffusivity with size ratio over an intermediate range is predicted, in contrast to the much steeper, non-exponential variation if one assumes local matrix dynamical fluctuations are not correlated with penetrant motion. For sticky penetrants, the relative and absolute influence of caging versus physical bond formation is studied. The conditions for a dynamic crossover from the case where a time scale separation between penetrant and matrix activated hopping exists to a “slaved” or “constraint release” fully coupled regime are determined. The particle mixture model is mapped to treat experimental thermal systems and applied to make predictions for the diffusivity of water, toluene, methanol, and oxygen in polyvinylacetate liquids and glasses. The theory agrees well with experiment with values of the penetrant-matrix size ratio close to their chemically intuitive values. PMID:28527449

  16. Charge transport in molecular junctions: From tunneling to hopping with the probe technique

    NASA Astrophysics Data System (ADS)

    Kilgour, Michael; Segal, Dvira

    2015-07-01

    We demonstrate that a simple phenomenological approach can be used to simulate electronic conduction in molecular wires under thermal effects induced by the surrounding environment. This "Landauer-Büttiker's probe technique" can properly replicate different transport mechanisms, phase coherent nonresonant tunneling, ballistic behavior, and hopping conduction. Specifically, our simulations with the probe method recover the following central characteristics of charge transfer in molecular wires: (i) the electrical conductance of short wires falls off exponentially with molecular length, a manifestation of the tunneling (superexchange) mechanism. Hopping dynamics overtakes superexchange in long wires demonstrating an ohmic-like behavior. (ii) In off-resonance situations, weak dephasing effects facilitate charge transfer, but under large dephasing, the electrical conductance is suppressed. (iii) At high enough temperatures, kBT/ɛB > 1/25, with ɛB as the molecular-barrier height, the current is enhanced by a thermal activation (Arrhenius) factor. However, this enhancement takes place for both coherent and incoherent electrons and it does not readily indicate on the underlying mechanism. (iv) At finite-bias, dephasing effects may impede conduction in resonant situations. We further show that memory (non-Markovian) effects can be implemented within the Landauer-Büttiker's probe technique to model the interaction of electrons with a structured environment. Finally, we examine experimental results of electron transfer in conjugated molecular wires and show that our computational approach can reasonably reproduce reported values to provide mechanistic information.

  17. Precision improvement of frequency-modulated continuous-wave laser ranging system with two auxiliary interferometers

    NASA Astrophysics Data System (ADS)

    Shi, Guang; Wang, Wen; Zhang, Fumin

    2018-03-01

    The measurement precision of frequency-modulated continuous-wave (FMCW) laser distance measurement should be proportional to the scanning range of the tunable laser. However, the commercial external cavity diode laser (ECDL) is not an ideal tunable laser source in practical applications. Due to the unavoidable mode hopping and scanning nonlinearity of the ECDL, the measurement precision of FMCW laser distance measurements can be substantially affected. Therefore, an FMCW laser ranging system with two auxiliary interferometers is proposed in this paper. Moreover, to eliminate the effects of ECDL, the frequency-sampling method and mode hopping influence suppression method are employed. Compared with a fringe counting interferometer, this FMCW laser ranging system has a measuring error of ± 20 μm at the distance of 5.8 m.

  18. Dopant driven tunability of dielectric relaxation in MxCo(1-x)Fe2O4 (M: Zn2+, Mn2+, Ni2+) nano-ferrites

    NASA Astrophysics Data System (ADS)

    Datt, Gopal; Abhyankar, A. C.

    2017-07-01

    Nano-ferrites with tunable dielectric and magnetic properties are highly desirable in modern electronics industries. This work reports the effect of ferromagnetic (Ni), anti-ferromagnetic (Mn), and non-magnetic (Zn) substitution on cobalt-ferrites' dielectric and magnetic properties. The Rietveld analysis of XRD data and the Raman spectroscopic study reveals that all the samples are crystallized in the Fd-3m space group. The T2g Raman mode was observed to split into branches, which is due to the presence of different cations (with different vibrational frequencies) at crystallographic A and B-sites. The magnetization study shows that the MnCoFe2O4 sample has the highest saturation magnetization of 87 emu/g, which is attributed to the presence of Mn2+ cations at the B-site with a magnetic moment of 5 μB. The dielectric permittivity of these nanoparticles (NPs) obeys the modified Debye model, which is further supported by Cole-Cole plots. The dielectric constant of MnCoFe2O4 ferrite is found to be one order higher than that of the other two ferrites. The increased bond length of the Mn2+-O2- bond along with the enhanced d-d electron transition between Mn 2 +/Co 2 +⇋Fe 3 + cations at the B-site are found to be the main contributing factors for the enhanced dielectric constant of MnCoFe2O4 ferrite. We find evidence of variable-range hopping of localized polarons in these ferrite NPs. The activation energy, hopping range, and density of states N (" separators="|EF ), of these polarons were calculated using Motts' 1/4th law. The estimated activation energies of these polarons at 300 K were found to be 288 meV, 426 meV, and 410 meV, respectively, for the MnCoFe2O4, NiCoFe2O4, and ZnCoFe2O4 ferrite NPs, while the hopping range of these polarons were found to be 27.14 Å, 11.66 Å, and 8.17 Å, respectively. Observation of a low dielectric loss of ˜0.04, in the frequency range of 0.1-1 MHz, in these NPs makes them potential candidates for energy harvesting devices in the modern electronics industry.

  19. Hip abduction-adduction strength and one-leg hop tests: test-retest reliability and relationship to function in elite ice hockey players.

    PubMed

    Kea, J; Kramer, J; Forwell, L; Birmingham, T

    2001-08-01

    Single group, test-retest. To determine: (1) hip abduction and adduction torques during concentric and eccentric muscle actions, (2) medial and lateral one-leg hop distances, (3) the test-retest reliability of these measurements, and (4) the relationship between isokinetic measures of hip muscle strength and hop distances in elite ice hockey players. The skating motion used in ice hockey requires strong contractions of the hip and knee musculature. However, baseline scores for hip strength and hop distances, their test-retest reliability, and measures of the extent to which these tests are related for this population are not available. The dominant leg of 27 men (mean age 20 +/- 3 yrs) was tested on 2 occasions. Hip abduction and adduction movements were completed at 60 degrees.s(-1) angular velocity, with the subject lying on the non-test side and the test leg moving vertically in the subject's coronal plane. One-leg hops requiring jumping from and landing on the same leg without losing balance were completed in the medial and lateral directions. Hip adduction torques were significantly greater than abduction torques during both concentric and eccentric muscle actions, while no significant difference was observed between medial and lateral hop distances. Although hop test scores produced excellent ICCs (> 0.75) when determined using scores on 1 occasion, torques needed to be averaged over 2 test occasions to reach this level. Correlations between the strength and hop tests ranged from slight to low (r = -0.26 to 0.27) and were characterized by wide 95% confidence intervals (-0.54 to 0.61). Isokinetic tests of hip abduction and adduction did not provide a strong indication of performance during sideways hop tests. Although isokinetic tests can provide a measure of muscular strength under specific test conditions, they should not be relied upon as a primary indicator of functional abilities or readiness to return to activity.

  20. Microscopic origins of charge transport in triphenylene systems

    NASA Astrophysics Data System (ADS)

    Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio

    2018-06-01

    We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.

  1. Thermopower of molecular junctions: Tunneling to hopping crossover in DNA

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2016-12-01

    We study the electrical conductance G and the thermopower S of single-molecule junctions and reveal signatures of different transport mechanisms: off-resonant tunneling, on-resonant coherent (ballistic) motion, and multi-step hopping. These mechanisms are identified by studying the behavior of G and S while varying molecular length and temperature. Based on a simple one-dimensional model for molecular junctions, we derive approximate expressions for the thermopower in these different regimes. Analytical results are compared to numerical simulations, performed using a variant of Büttiker's probe technique, the so-called voltage-temperature probe, which allows us to phenomenologically introduce environmentally induced elastic and inelastic electron scattering effects, while applying both voltage and temperature biases across the junction. We further simulate the thermopower of GC-rich DNA sequences with mediating A:T blocks and manifest the tunneling-to-hopping crossover in both the electrical conductance and the thermopower, in accord with measurements by Li et al. [Nat. Commun. 7, 11294 (2016)].

  2. A Crystal-Physical Model of Electrotransfer in the Superionic Conductor Pb1 - x Sc x F2 + x ( x = 0.1)

    NASA Astrophysics Data System (ADS)

    Sorokin, N. I.

    2018-04-01

    The frequency (ν = 10-1-107 Hz) dependences of electrical conductivity σ(ν) of single crystals of superionic conductor Pb0.9Sc0.1F2.1 (10 mol % ScF3) with fluorite type structure (CaF2) in the temperature range 153-410 K have been investigated. The static bulk conductivity σ dc =1.5 × 10-4 S/cm and average hopping frequency ν h = 1.5 × 107 Hz of charge carriers (mobile ions F-) at room temperature (293 K) have been defined from the σ dc (ν) experimental curves. Enthalpies of thermoactivated processes of ionic conductivity σ dc ( T) (Δ H σ = 0.393 ± 0.005 eV) and dielectric relaxation ν h ( T) (Δ H h = 0.37 ± 0.03 eV) coincide within their errors. A crystal-physical model of fluorine-ion transport in a Pb0.9Sc0.1F2.1 crystal lattice has been proposed. The characteristic parameters of charge carriers have been calculated: concentration n mob = 2.0 × 1021 cm-3, the distance of the hopping d ≈ 0.5 nm and mobility μmob = 4.5 × 10-7 cm2/s V (293 K).

  3. D.C. electrical conductivity and conduction mechanism of some azo sulfonyl quinoline ligands and uranyl complexes.

    PubMed

    El-Ghamaz, N A; Diab, M A; El-Sonbati, A Z; Salem, O L

    2011-12-01

    Supramolecular coordination of dioxouranium(VI) heterochelates 5-sulphono-7-(4'-X phenylazo)-8-hydroxyquinoline HL(n) (n=1, X=CH(3); n=2, X=H; n=3, X=Cl; n=4, X=NO(2)) have been prepared and characterized with various physico-chemical techniques. The infrared spectral studies showed a monobasic bidentate behavior with the oxygen and azonitrogen donor system. The temperature dependence of the D.C. electrical conductivity of HL(n) ligands and their uranyl complexes has been studied in the temperature range 305-415 K. The thermal activation energies E(a) for HL(n) compounds were found to be in the range 0.44-0.9 eV depending on the nature of the substituent X. The complexation process decreased E(a) values to the range 0.043-045 eV. The electrical conduction mechanism has been investigated for all samples under investigation. It was found to obey the variable range hopping mechanism (VRH). Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Temperature gating and competing temperature-dependent effects in DNA molecular wires

    NASA Astrophysics Data System (ADS)

    Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

    2017-02-01

    While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

  5. The Influence of Relative Submergence on the Near-bed Flow Field: Implications for Bed-load Transport

    NASA Astrophysics Data System (ADS)

    Cooper, J.; Tait, S.; Marion, A.

    2005-12-01

    Bed-load is governed by interdependent mechanisms, the most significant being the interaction between bed roughness, surface layer composition and near-bed flow. Despite this, practically all transport rate equations are described as a function of average bed shear stress. Some workers have examined the role of turbulence in sediment transport (Nelson et al. 1995) but have not explored the potential significance of spatial variations in the near-bed flow field. This is unfortunate considering evidence showing that transport is spatially heterogeneous and could be linked to the spatial nature of the near-bed flow (Drake et al., 1988). An understanding is needed of both the temporal and spatial variability in the near-bed flow field. This paper presents detailed spatial velocity measurements of the near-bed flow field over a gravel-bed, obtained using Particle Image Velocimetry. These data have been collected in a laboratory flume under two regimes: (i) tests with one bed slope and different flow depths; and (ii) tests with a combination of flow depths and slopes at the same average bed shear stress. Results indicate spatial variation in the streamwise velocities of up to 45 per cent from the double-averaged velocity (averaged in both time and space). Under both regimes, as the depth increased, spatial variability in the flow field increased. The probability distributions of near-bed streamwise velocities became progressively more skewed towards the higher velocities. This change was more noticeable under regime (i). This has been combined with data from earlier tests in which the near-bed velocity close to an entraining grain was measured using a PIV/image analysis system (Chegini et al, 2002). This along with data on the shape of the probability density function of velocities capable of entraining individual grains derived from a discrete-particle model (Heald et al., 2004) has been used to estimate the distribution of local velocities required for grain motion in the above tests. The overlap between this distribution and the measured velocities are used to estimate entrainment rates. Predicted entrainment rates increase with relative submergence, even for similar bed shear stress. Assuming bed-load rate is the product of entrainment rate and hop length, and that hop lengths are sensibly stable, suggests that transport rate has a dependence on relative submergence. This demonstrates that transport rate is not a direct function of average bed shear stress. The results describe a mechanism that will cause river channels with contrasting morphologies (and different relative submergence) but similar levels of average bed stress to experience different levels of sediment mobility. Chegini A. Tait S. Heald J. McEwan I. 2002 The development of an automated system for the measurement of near bed turbulence and grain motion. Proc. ASCE Conf. on Hydraulic Measurements and Experimental Methods, ISBN 0-7844-0655-3. Drake T.G. Shreve R.L. Dietrich W.E. Whiting P.J. Leopold L.B. 1988 Bedload transport of fine gravel observed by motion-picture photography, J. Fluid Mech., 192, 193-217. Heald J. McEwan I. Tait, S. 2004 Sediment transport over a flat bed in a unidirectional flow: simulations and validation, Phil. Trans. Roy. Soc. of London A, 362, 1973-1986. Nelson J.M. Shreve R.L. McLean S.R. Drake T.G. 1995 Role of near-bed turbulence structure in bed-load transport and bed form mechanics, Water. Res. Res., 31, 8, 2071-2086.

  6. A review of carrier thermoelectric-transport theory in organic semiconductors.

    PubMed

    Lu, Nianduan; Li, Ling; Liu, Ming

    2016-07-20

    Carrier thermoelectric-transport theory has recently become of growing interest and numerous thermoelectric-transport models have been proposed for organic semiconductors, due to pressing current issues involving energy production and the environment. The purpose of this review is to provide a theoretical description of the thermoelectric Seebeck effect in organic semiconductors. Special attention is devoted to the carrier concentration, temperature, polaron effect and dipole effect dependence of the Seebeck effect and its relationship to hopping transport theory. Furthermore, various theoretical methods are used to discuss carrier thermoelectric transport. Finally, an outlook of the remaining challenges ahead for future theoretical research is provided.

  7. Optimisation of active suspension control inputs for improved vehicle ride performance

    NASA Astrophysics Data System (ADS)

    Čorić, Mirko; Deur, Joško; Xu, Li; Tseng, H. Eric; Hrovat, Davor

    2016-07-01

    A collocation-type control variable optimisation method is used in the paper to analyse to which extent the fully active suspension (FAS) can improve the vehicle ride comfort while preserving the wheel holding ability. The method is first applied for a cosine-shaped bump road disturbance of different heights, and for both quarter-car and full 10 degree-of-freedom vehicle models. A nonlinear anti-wheel hop constraint is considered, and the influence of bump preview time period is analysed. The analysis is then extended to the case of square- or cosine-shaped pothole with different lengths, and the quarter-car model. In this case, the cost function is extended with FAS energy consumption and wheel damage resilience costs. The FAS action is found to be such to provide a wheel hop over the pothole, in order to avoid or minimise the damage at the pothole trailing edge. In the case of long pothole, when the FAS cannot provide the wheel hop, the wheel is travelling over the pothole bottom and then hops over the pothole trailing edge. The numerical optimisation results are accompanied by a simplified algebraic analysis.

  8. CW and pulsed electrically detected magnetic resonance spectroscopy at 263 GHz/12 T on operating amorphous silicon solar cells

    NASA Astrophysics Data System (ADS)

    Akhtar, W.; Schnegg, A.; Veber, S.; Meier, C.; Fehr, M.; Lips, K.

    2015-08-01

    Here we describe a new high frequency/high field continuous wave and pulsed electrically detected magnetic resonance (CW EDMR and pEDMR) setup, operating at 263 GHz and resonance fields between 0 and 12 T. Spin dependent transport in illuminated hydrogenated amorphous silicon p-i-n solar cells at 5 K and 90 K was studied by in operando 263 GHz CW and pEDMR alongside complementary X-band CW EDMR. Benefiting from the superior resolution at 263 GHz, we were able to better resolve EDMR signals originating from spin dependent hopping and recombination processes. 5 K EDMR spectra were found to be dominated by conduction and valence band tail states involved in spin dependent hopping, with additional contributions from triplet exciton states. 90 K EDMR spectra could be assigned to spin pair recombination involving conduction band tail states and dangling bonds as the dominating spin dependent transport process, with additional contributions from valence band tail and triplet exciton states.

  9. Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

    NASA Astrophysics Data System (ADS)

    Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

    2018-01-01

    The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

  10. Millimeter Wave Alternate Route Study.

    DTIC Science & Technology

    1981-04-01

    processing gains are based upon the assumption that the jammer equally distributes his available power over all the hopping frequencies. If this is true...Examples Assumptions 0 25 GHz hopping range (e.g., 20 GHz to 45 GHz) 0 10 ms settling time * 0.1 second dwell time - implies 11% increase in channel data...of the architectures presented previously. The assumption that each link has equal probability p of being disrupted (i.e., successfully jammed) seems

  11. Nanoscale Electron Transport Measurements of Immobilized Cytochrome P450 Proteins

    PubMed Central

    Bostick, Christopher D.; Flora, Darcy R.; Gannett, Peter M.; Tracy, Timothy S.; Lederman, David

    2015-01-01

    Gold nanopillars, functionalized with an organic self-assembled monolayer, can be used to measure the electrical conductance properties of immobilized proteins without aggregation. Measurements of the conductance of nanopillars with cytochrome P450 2C9 (CYP2C9) proteins using conducting probe atomic force microscopy demonstrate that a correlation exists between the energy barrier height between hopping sites and CYP2C9 metabolic activity. Measurements performed as a function of tip force indicate that, when subjected to a large force, the protein is more stable in the presence of a substrate. This agrees with the hypothesis that substrate entry into the active site helps to stabilize the enzyme. The relative distance between hopping sites also increases with increasing force, possibly because protein functional groups responsible for electron transport depend on the structure of the protein. The inhibitor sulfaphenazole, in addition to the previously studied aniline, increased the barrier height for electron transfer and thereby makes CYP2C9 reduction more difficult and inhibits metabolism. This suggests that P450 Type II binders may decrease the ease of electron transport processes in the enzyme, in addition to occupying the active site. PMID:25804257

  12. Intrinsic mobility limit for anisotropic electron transport in Alq3.

    PubMed

    Drew, A J; Pratt, F L; Hoppler, J; Schulz, L; Malik-Kumar, V; Morley, N A; Desai, P; Shakya, P; Kreouzis, T; Gillin, W P; Kim, K W; Dubroka, A; Scheuermann, R

    2008-03-21

    Muon spin relaxation has been used to probe the charge carrier motion in the molecular conductor Alq3 (tris[8-hydroxy-quinoline] aluminum). At 290 K, the magnetic field dependence of the muon spin relaxation corresponds to that expected for highly anisotropic intermolecular electron hopping. Intermolecular mobility in the fast hopping direction has been found to be 0.23+/-0.03 cm2 V-1 s(-1) in the absence of an electric- field gradient, increasing to 0.32+/-0.06 cm2 V-1 s(-1) in an electric field gradient of 1 MV m(-1). These intrinsic mobility values provide an estimate of the upper limit for mobility achievable in bulk material.

  13. Efficient kinetic Monte Carlo method for reaction-diffusion problems with spatially varying annihilation rates

    NASA Astrophysics Data System (ADS)

    Schwarz, Karsten; Rieger, Heiko

    2013-03-01

    We present an efficient Monte Carlo method to simulate reaction-diffusion processes with spatially varying particle annihilation or transformation rates as it occurs for instance in the context of motor-driven intracellular transport. Like Green's function reaction dynamics and first-passage time methods, our algorithm avoids small diffusive hops by propagating sufficiently distant particles in large hops to the boundaries of protective domains. Since for spatially varying annihilation or transformation rates the single particle diffusion propagator is not known analytically, we present an algorithm that generates efficiently either particle displacements or annihilations with the correct statistics, as we prove rigorously. The numerical efficiency of the algorithm is demonstrated with an illustrative example.

  14. Magnetoresistance in organic semiconductors: Including pair correlations in the kinetic equations for hopping transport

    NASA Astrophysics Data System (ADS)

    Shumilin, A. V.; Kabanov, V. V.; Dediu, V. I.

    2018-03-01

    We derive kinetic equations for polaron hopping in organic materials that explicitly take into account the double occupation possibility and pair intersite correlations. The equations include simplified phenomenological spin dynamics and provide a self-consistent framework for the description of the bipolaron mechanism of the organic magnetoresistance. At low applied voltages, the equations can be reduced to those for an effective resistor network that generalizes the Miller-Abrahams network and includes the effect of spin relaxation on the system resistivity. Our theory discloses the close relationship between the organic magnetoresistance and the intersite correlations. Moreover, in the absence of correlations, as in an ordered system with zero Hubbard energy, the magnetoresistance vanishes.

  15. Charge Transport in Trehalose-Derived Sugar Glasses

    NASA Astrophysics Data System (ADS)

    Nemzer, Louis; Navati, Mahantesh; Friedman, Joel; Epstein, Arthur

    2013-03-01

    Trehalose is a naturally occurring disaccharide with a well-known ability to preserve the biological function of proteins and cell membranes during periods of stress, including dehydration, by stabilizing the conformations of the macromolecules within a glassy matrix. This phenomenon makes use of the propensity of trehalose to interact strongly with protein functional groups and solvating water molecules via hydrogen bonding. Recently, it has been shown that trehalose sugar glasses also support long range charge transport in the form of oxidation-reduction reactions occurring between spatially separated donors and acceptors. Based on an Arrhenius conductivity analysis, along with IR-absorption and dielectric spectroscopy data, we propose that a Grotthuss-like proton hopping mechanism is responsible for the high charge carrier mobility and observed bias-dependent apparent activation energy. The possibility is raised for novel redox reactions to be performed on proteins constrained to specific 3D conformations. This could lead to a deeper understanding of biological processes, such as anhydrobiosis, as well as the development of new biomimetic photovoltaic devices.

  16. Sodium deficiency effect on the transport properties of La0.8Na0.2-x□xMnO3 manganites

    NASA Astrophysics Data System (ADS)

    Elghoul, N.; Wali, M.; Kraiem, S.; Rahmouni, H.; Dhahri, E.; Khirouni, K.

    2015-12-01

    Effect of sodium deficiency on the transport properties of La0.8Na0.2-x□xMnO3 manganites is investigated using impedance spectroscopy technique. In the whole explored temperature range (77-700 K), conductivity measurements show the appearance of a metal-semiconductor transition for all investigated samples. Also, a saturation region is observed in σ (T) curves. It is found that conduction mechanism is governed by hopping process. The conductivity of the material decreases with increasing sodium deficiency. The transition temperature and the activation energy values inferred from grain boundary resistance and conductivity analysis are closed to each other. Such result confirms the contribution of grain boundary on the electrical conductivity. The variation of the Average Normalized Change (ANC) and its derivative with temperature gives important information about the available density of trapped charge states. The obtained results explain the observed saturation region in conductivity at high temperature region.

  17. Unraveling the Semiconducting/Metallic Discrepancy in Ni 3(HITP) 2

    DOE PAGES

    Foster, Michael E.; Sohlberg, Karl; Allendorf, Mark D.; ...

    2018-01-10

    Here, Ni 3(2,3,6,7,10,11-hexaiminotriphenylene) 2 is a π-stacked layered metal–organic framework material with extended π-conjugation that is analogous to graphene. Published experimental results indicate that the material is semiconducting, but all theoretical studies to date predict the bulk material to be metallic. Given that previous experimental work was carried out on specimens containing complex nanocrystalline microstructures and the tendency for internal interfaces to introduce transport barriers, we apply DFT to investigate the influence of internal interface defects on the electronic structure of Ni 3(HITP) 2. The results show that interface defects can introduce a transport barrier by breaking the π-conjugation and/ormore » decreasing the dispersion of the electronic bands near the Fermi level. We demonstrate that the presence of defects can open a small gap, in the range of 15–200 meV, which is consistent with the experimentally inferred hopping barrier.« less

  18. Study of hopping type conduction from AC conductivity in multiferroic composite

    NASA Astrophysics Data System (ADS)

    Pandey, Rabichandra; Guha, Shampa; Pradhan, Lagen Kumar; Kumar, Sunil; Supriya, Sweety; Kar, Manoranjan

    2018-05-01

    0.5BiFe0.80Ti0.20O3-0.5Co0.5Ni0.5Fe2O4(BFTO-CNFO) multiferroic composite was prepared by planetary ball mill method. X-ray diffraction analysis confirms the formation of the compound with the simultaneous presence of spinel Co0.5Ni0.5Fe2O4 (CNFO) and perovskite BiFe0.80Ti0.20O3 (BFTO) phase. Temperature dependent dielectric permittivity and loss tangent were studied with a frequency range of 100Hz to 1MHz. AC conductivity study was performed to analyze the electrical conduction behaviour in the composite. Johnscher's power law was employed to the AC conductivity data to understand the hopping of localized charge carrier in the compound. The binding energy, minimum hopping distance and density of states of the charge carriers in the composite were evaluated from the AC conductivity data. Minimum hopping distance is found to be in order of Angstrom (Å).

  19. Mobile bound states of Rydberg excitations in a lattice

    NASA Astrophysics Data System (ADS)

    Letscher, Fabian; Petrosyan, David

    2018-04-01

    Spin-lattice models play a central role in the studies of quantum magnetism and nonequilibrium dynamics of spin excitations—-magnons. We show that a spin lattice with strong nearest-neighbor interactions and tunable long-range hopping of excitations can be realized by a regular array of laser-driven atoms, with an excited Rydberg state representing the spin-up state and a Rydberg-dressed ground state corresponding to the spin-down state. We find exotic interaction-bound states of magnons that propagate in the lattice via the combination of resonant two-site hopping and nonresonant second-order hopping processes. Arrays of trapped Rydberg-dressed atoms can thus serve as a flexible platform to simulate and study fundamental few-body dynamics in spin lattices.

  20. Origin of strong dispersion in Hubbard insulators

    DOE PAGES

    Wang, Y.; Wohlfeld, K.; Moritz, B.; ...

    2015-08-10

    Using cluster perturbation theory, we explain the origin of the strongly dispersive feature found at high binding energy in the spectral function of the Hubbard model. By comparing the Hubbard and $t₋J₋3s$ model spectra, we show that this dispersion does not originate from either coupling to spin fluctuations ($∝ J$ ) or the free hopping ($∝ t$ ). Instead, it should be attributed to a long-range, correlated hopping $∝ t²/U$ which allows an effectively free motion of the hole within the same antiferromagnetic sublattice. This origin explains both the formation of the high-energy anomaly in the single-particle spectrum and themore » sensitivity of the high-binding-energy dispersion to the next-nearest-neighbor hopping $t'$ .« less

  1. Transport characteristics in Au/pentacene/Au diodes

    NASA Astrophysics Data System (ADS)

    Hayashi, Toshiaki; Naka, Akiyoshi; Hiroki, Masanobu; Yokota, Tomoyuki; Someya, Takao; Fujiwara, Akira

    2018-03-01

    We have used scanning and transmission electron microscopes (SEM and TEM) to study the structure of a pentacene thin film grown on a Au layer with and shown that it consists of randomly oriented amorphous pentacene clusters. We have also investigated the transport properties of amorphous pentacene in a metal-semiconductor-metal (MSM) diode structure and shown that the current is logarithmically proportional to the square root of the applied voltage, which indicates that transport occurs as the result of hopping between localized sites randomly distributed in space and energy.

  2. Charge transport calculations by a wave-packet dynamical approach using maximally localized Wannier functions based on density functional theory: Application to high-mobility organic semiconductors

    NASA Astrophysics Data System (ADS)

    Ishii, Hiroyuki; Kobayashi, Nobuhiko; Hirose, Kenji

    2017-01-01

    We present a wave-packet dynamical approach to charge transport using maximally localized Wannier functions based on density functional theory including van der Waals interactions. We apply it to the transport properties of pentacene and rubrene single crystals and show the temperature-dependent natures from bandlike to thermally activated behaviors as a function of the magnitude of external static disorder. We compare the results with those obtained by the conventional band and hopping models and experiments.

  3. Thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics in different oxygen-reduction conditions

    NASA Astrophysics Data System (ADS)

    Li, Yi; Liu, Jian; Wang, Chun-Lei; Su, Wen-Bin; Zhu, Yuan-Hu; Li, Ji-Chao; Mei, Liang-Mo

    2015-04-01

    The thermoelectric properties of Sr0.61Ba0.39Nb2O6-δ ceramics, reduced in different conditions, are investigated in the temperature range from 323 K to 1073 K. The electrical transport behaviors of the samples are dominated by the thermal-activated polaron hopping in the low temperature range, the Fermi glass behavior in the middle temperature range, and the Anderson localized behavior in the high temperature range. The thermal conductivity presents a plateau at high-temperatures, indicating a glass-like thermal conduction behavior. Both the thermoelectric power factor and the thermal conductivity increase with the increase of the degree of oxygen-reduction. Taking these two factors into account, the oxygen-reduction can still contribute to promoting the thermoelectric figure of merit. The highest ZT value is obtained to be ˜0.19 at 1073 K in the heaviest oxygen reduced sample. Project supported by the National Basic Research Program of China (Grant No. 2013CB632506) and the National Natural Science Foundation of China (Grant Nos. 51202132 and 51002087).

  4. Electrical transport in transverse direction through silicon carbon alloy multilayers containing regular size silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Mandal, Aparajita; Kole, Arindam; Dasgupta, Arup; Chaudhuri, Partha

    2016-11-01

    Electrical transport in the transverse direction has been studied through a series of hydrogenated silicon carbon alloy multilayers (SiC-MLs) deposited by plasma enhanced chemical vapor deposition method. Each SiC-ML consists of 30 cycles of the alternating layers of a nearly amorphous silicon carbide (a-SiC:H) and a microcrystalline silicon carbide (μc-SiC:H) that contains high density of silicon quantum dots (Si-QDs). A detailed investigation by cross sectional TEM reveals preferential growth of densely packed Si-QDs of regular sizes ∼4.8 nm in diameter in a vertically aligned columnar structure within the SiC-ML. More than six orders of magnitude increase in transverse current through the SiC-ML structure were observed for decrease in the a-SiC:H layer thickness from 13 nm to 2 nm. The electrical transport mechanism was established to be a combination of grain boundary or band tail hopping and Frenkel-Poole (F-P) type conduction depending on the temperature and externally applied voltage ranges. Evaluation of trap concentration within the multilayer structures from the fitted room temperature current voltage characteristics by F-P function shows reduction up-to two orders of magnitude indicating an improvement in the short range order in the a-SiC:H matrix for decrease in the thickness of a-SiC:H layer.

  5. Electronic transport in smectic liquid crystals

    NASA Astrophysics Data System (ADS)

    Shiyanovskaya, I.; Singer, K. D.; Twieg, R. J.; Sukhomlinova, L.; Gettwert, V.

    2002-04-01

    Time-of-flight measurements of transient photoconductivity have revealed bipolar electronic transport in phenylnaphthalene and biphenyl liquid crystals (LC), which exhibit several smectic mesophases. In the phenylnaphthalene LC, the hole mobility is significantly higher than the electron mobility and exhibits different temperature and phase behavior. Electron mobility in the range ~10-5 cm2/V s is temperature activated and remains continuous at the phase transitions. However, hole mobility is nearly temperature independent within the smectic phases, but is very sensitive to smectic order, 10-3 cm2/V s in the smectic-B (Sm-B) and 10-4 cm2/V s in the smectic-A (Sm-A) mesophases. The different behavior for holes and electron transport is due to differing transport mechanisms. The electron mobility is apparently controlled by rate-limiting multiple shallow trapping by impurities, but hole mobility is not. To explain the lack of temperature dependence for hole mobility within the smectic phases we consider two possible polaron transport mechanisms. The first mechanism is based on the hopping of Holstein small polarons in the nonadiabatic limit. The polaron binding energy and transfer integral values, obtained from the model fit, turned out to be sensitive to the molecular order in smectic mesophases. A second possible scenario for temperature-independent hole mobility involves the competion between two different polaron mechanisms involving so-called nearly small molecular polarons and small lattice polarons. Although the extracted transfer integrals and binding energies are reasonable and consistent with the model assumptions, the limited temperature range of the various phases makes it difficult to distinguish between any of the models. In the biphenyl LCs both electron and hole mobilities exhibit temperature activated behavior in the range of 10-5 cm2/V s without sensitivity to the molecular order. The dominating transport mechanism is considered as multiple trapping in the impurity sites. Temperature-activated mobility was treated within the disorder formalism, and activation energy and width of density of states have been calculated.

  6. A statistically compiled test battery for feasible evaluation of knee function after rupture of the Anterior Cruciate Ligament - derived from long-term follow-up data.

    PubMed

    Schelin, Lina; Tengman, Eva; Ryden, Patrik; Häger, Charlotte

    2017-01-01

    Clinical test batteries for evaluation of knee function after injury to the Anterior Cruciate Ligament (ACL) should be valid and feasible, while reliably capturing the outcome of rehabilitation. There is currently a lack of consensus as to which of the many available assessment tools for knee function that should be included. The present aim was to use a statistical approach to investigate the contribution of frequently used tests to avoid redundancy, and filter them down to a proposed comprehensive and yet feasible test battery for long-term evaluation after ACL injury. In total 48 outcome variables related to knee function, all potentially relevant for a long-term follow-up, were included from a cross-sectional study where 70 ACL-injured (17-28 years post injury) individuals were compared to 33 controls. Cluster analysis and logistic regression were used to group variables and identify an optimal test battery, from which a summarized estimator of knee function representing various functional aspects was derived. As expected, several variables were strongly correlated, and the variables also fell into logical clusters with higher within-correlation (max ρ = 0.61) than between clusters (max ρ = 0.19). An extracted test battery with just four variables assessing one-leg balance, isokinetic knee extension strength and hop performance (one-leg hop, side hop) were mathematically combined to an estimator of knee function, which acceptably classified ACL-injured individuals and controls. This estimator, derived from objective measures, correlated significantly with self-reported function, e.g. Lysholm score (ρ = 0.66; p<0.001). The proposed test battery, based on a solid statistical approach, includes assessments which are all clinically feasible, while also covering complementary aspects of knee function. Similar test batteries could be determined for earlier phases of ACL rehabilitation or to enable longitudinal monitoring. Such developments, established on a well-grounded consensus of measurements, would facilitate comparisons of studies and enable evidence-based rehabilitation.

  7. Adsorption and dynamics of Si atoms at the monolayer Pb/Si(111) surface

    NASA Astrophysics Data System (ADS)

    Kumar, Rakesh; Fang, Chuang-Kai; Lee, Chih-Hao; Hwang, Ing-Shouh

    2017-06-01

    In this work, we studied the adsorption behavior of deposited Si atoms along with their diffusion and other dynamic processes on a Pb monolayer-covered Si(111) surface from 125 to 230 K using a variable-temperature scanning tunneling microscope. The Pb-covered Si(111) surface forms a low-symmetry rowlike (√{7 }×√{3 } ) structure in this temperature range and the Si atoms bind favorably to two specific on-top sites (T1 A and T1 B) on the trimer row after deposition at the sample temperature of ˜125 K . The Si atoms were immobile at low temperatures and started to switch between the two neighboring T1 A and T1 B sites within the same trimer when the temperature was raised to ˜150 K . When the temperature was raised above ˜160 K , the adsorbed Si atoms could hop to other trimers along the same trimer row. Below ˜170 K , short hops to adjacent trimers dominated, but long hops dominated at temperatures above ˜170 K . The activation energy and prefactor for the Si atoms diffusion were derived through analysis of continuous-time imaging at temperatures from 160 to 174 K. In addition, irreversible aggregation of single Si atoms into Si clusters started to occur at the phase boundaries or defective sites at temperatures above ˜170 K . At temperature above ˜180 K , nearly all Si atoms aggregated into clusters, which may have important implications for the atomic mechanism of epitaxial growth of Si on the Pb-covered Si(111) surface. In addition, our study provides strong evidence for breaking in the mirror symmetry in the (√{7 }×√{3 } )-Pb structure, which has implications for the atomic model of this controversial structure.

  8. A physical model for the reverse leakage current in (In,Ga)N/GaN light-emitting diodes based on nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Musolino, M.; Treeck, D. van, E-mail: treeck@pdi-berlin.de; Tahraoui, A.

    2016-01-28

    We investigated the origin of the high reverse leakage current in light emitting diodes (LEDs) based on (In,Ga)N/GaN nanowire (NW) ensembles grown by molecular beam epitaxy on Si substrates. To this end, capacitance deep level transient spectroscopy (DLTS) and temperature-dependent current-voltage (I-V) measurements were performed on a fully processed NW-LED. The DLTS measurements reveal the presence of two distinct electron traps with high concentrations in the depletion region of the p-i-n junction. These band gap states are located at energies of 570 ± 20 and 840 ± 30 meV below the conduction band minimum. The physical origin of these deep level states is discussed. Themore » temperature-dependent I-V characteristics, acquired between 83 and 403 K, show that different conduction mechanisms cause the observed leakage current. On the basis of all these results, we developed a quantitative physical model for charge transport in the reverse bias regime. By taking into account the mutual interaction of variable range hopping and electron emission from Coulombic trap states, with the latter being described by phonon-assisted tunnelling and the Poole-Frenkel effect, we can model the experimental I-V curves in the entire range of temperatures with a consistent set of parameters. Our model should be applicable to planar GaN-based LEDs as well. Furthermore, possible approaches to decrease the leakage current in NW-LEDs are proposed.« less

  9. Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

    NASA Astrophysics Data System (ADS)

    Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

    2018-04-01

    We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1-x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase (T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase (T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac(T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant (ɛ' = 1273), dielectric loss (tanδ = 0.047) at 1 kHz, electromechanical coupling coefficients (k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants (d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

  10. Dielectric, Piezoelectric and Variable Range Hopping Conductivity Studies of Bi0.5(Na, K)0.5TiO3 Ceramics

    NASA Astrophysics Data System (ADS)

    Pattipaka, Srinivas; James, A. R.; Dobbidi, Pamu

    2018-07-01

    We report a detailed study on the structural, microstructural, piezoelectric, dielectric and AC conductivity of Bi0.5(Na1- x K x )0.5TiO3 (BNKT; x = 0, 0.1, 0.2 and 0.3) ceramics fabricated by a conventional solid-state reaction method. XRD and Raman analysis revealed that Bi0.5(Na0.8K0.2)0.5TiO3 and Bi0.5(Na0.7K0.3)0.5TiO3 ceramics exhibit a mixture of rhombohedral and tetragonal structures. The segregation of K at the grain boundary was confirmed by transmission electron microscopy and is related to typical microstructural local compositional mapping analysis. Two transitions, at ˜ 330°C and 150°C, observed from the ɛ' versus T curve in pure BNT are associated with the ferroelectric tetragonal to paraelectric cubic phase ( T C) and ferroelectric rhombohedral to ferroelectric tetragonal phase ( T d), respectively. Further, the T C and T d shifted towards the lower temperature with a rise in K concentration. Frequency dispersion of T d and T C suggest that BNKT ceramics exhibit a weak relaxor behavior with diffuse phase transition, which is confirmed by Uchino-Nomura criteria and the Vogel-Fulcher law. The AC resistivity ρ ac( T) follows the Mott variable range hopping conduction mechanism. A significant enhancement of dielectric and piezoelectric properties were observed for x = 0.2 system: dielectric constant ( ɛ' = 1273), dielectric loss (tan δ = 0.047) at 1 kHz, electromechanical coupling coefficients ( k ij : k 33, k t ˜ 60%, k 31 ˜ 62% and k p ˜ 46%), elastic coupling coefficients ( S_{33}D = 6.40 × 10-13 m2/N and S_{33}E = 10.06 × 10-13 m2/N) and piezoelectric constants ( d 33 = 64.23 pC/N and g 33 = 5.69 × 10-3 Vm/N).

  11. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    NASA Astrophysics Data System (ADS)

    Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

    2014-11-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB2 has a very high bulk glass transition temperature Tg, and we observe no three-state hopping or sequential two-state hopping previously seen on lower Tg glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Duc; Girolami, Gregory S.; Beckman Institute, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB{sub 2} glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunnelingmore » spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB{sub 2} has a very high bulk glass transition temperature T{sub g}, and we observe no three-state hopping or sequential two-state hopping previously seen on lower T{sub g} glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses.« less

  13. Environmental effects are stronger than human effects on mammalian predator-prey relationships in arid Australian ecosystems.

    PubMed

    Allen, Benjamin L; Fawcett, Alana; Anker, Alison; Engeman, Richard M; Lisle, Allan; Leung, Luke K-P

    2018-01-01

    Climate (drought, rainfall), geology (habitat availability), land use change (provision of artificial waterpoints, introduction of livestock), invasive species (competition, predation), and direct human intervention (lethal control of top-predators) have each been identified as processes driving the sustainability of threatened fauna populations. We used a systematic combination of empirical observational studies and experimental manipulations to comprehensively evaluate the effects of these process on a model endangered rodent, dusky hopping-mice (Notomys fuscus). We established a large manipulative experiment in arid Australia, and collected information from relative abundance indices, camera traps, GPS-collared dingoes (Canis familiaris) and dingo scats, along with a range of related environmental data (e.g. rainfall, habitat type, distance to artificial water etc.). We show that hopping-mice populations were most strongly influenced by geological and climatic effects of resource availability and rainfall, and not land use, invasive species, or human effects of livestock grazing, waterpoint provision, or the lethal control of dingoes. Hopping-mice distribution declined along a geological gradient of more to less available hopping-mice habitat (sand dunes), and their abundance was driven by rainfall. Hopping-mice populations fluctuated independent of livestock presence, artificial waterpoint availability or repeated lethal dingo control. Hopping-mice populations appear to be limited first by habitat availability, then by food availability, then by predation. Contemporary top-predator control practices (for protection of livestock) have little influence on hopping-mice behaviour or population dynamics. Given our inability to constrain the effects of predation across broad scales, management actions focusing on increasing available food and habitat (e.g. alteration of fire and herbivory) may have a greater chance of improving the conservation status of hopping-mice and other small mammals in arid areas. Our study also reaffirms the importance of using systematic and experimental approaches to detect true drivers of population distribution and dynamics where multiple potential drivers operate simultaneously. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Metabolite profiling of flavonols and in vitro antioxidant activity of young shoots of wild Humulus lupulus L. (hop).

    PubMed

    Maietti, Annalisa; Brighenti, Virginia; Bonetti, Gianpiero; Tedeschi, Paola; Prencipe, Francesco Pio; Benvenuti, Stefania; Brandolini, Vincenzo; Pellati, Federica

    2017-08-05

    Humulus lupulus L., commonly named hop, is well-known for its sedative and estrogenic activity. While hop cones are widely characterized, only few works have been carried out on the young shoots of this plant. In the light of this, the aim of this study was to identify for the first time the flavonoids present in young hop shoots and to compare the composition of samples harvested from different locations in Northern Italy with their antioxidant activity. The samples were extracted by means of dynamic maceration with methanol. The HPLC-UV/DAD, HPLC-ESI-MS and MS 2 analysis were carried out by using an Ascentis C 18 column (250×4.6mm I.D., 5μm), with a mobile phase composed of 0.1M formic acid in both water and acetonitrile, under gradient elution. Quercetin and kaempferol glycosides were the main compounds identified and quantified in hop shoot extracts. Total flavonols ranged from 2698±185 to 517±48μg/g (fresh weight). The antioxidant activity was determined by means of the radical scavenging activity assay against diphenylpicrylhydrazyl (DPPH) and by using a photochemiluscence assay with a Photochem ® apparatus. The results showed that hop shoots represent a new source of flavonols; therefore, they can be useful for a possible incorporation in the diet as a functional food or applied in the nutraceutical ambit. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Dynamics of interacting Dicke model in a coupled-cavity array

    NASA Astrophysics Data System (ADS)

    Badshah, Fazal; Qamar, Shahid; Paternostro, Mauro

    2014-09-01

    We consider the dynamics of an array of mutually interacting cavities, each containing an ensemble of N two-level atoms. By exploring the possibilities offered by ensembles of various dimensions and a range of atom-light and photon-hopping values, we investigate the generation of multisite entanglement, as well as the performance of excitation transfer across the array, resulting from the competition between on-site nonlinearities of the matter-light interaction and intersite photon hopping. In particular, for a three-cavity interacting system it is observed that the initial excitation in the first cavity completely transfers to the ensemble in the third cavity through the hopping of photons between the adjacent cavities. Probabilities of the transfer of excitation of the cavity modes and ensembles exhibit characteristics of fast and slow oscillations governed by coupling and hopping parameters, respectively. In the large-hopping case, by seeding an initial excitation in the cavity at the center of the array, a tripartite W state, as well as a bipartite maximally entangled state, is obtained, depending on the interaction time. Population of the ensemble in a cavity has a positive impact on the rate of excitation transfer between the ensembles and their local cavity modes. In particular, for ensembles of five to seven atoms, tripartite W states can be produced even when the hopping rate is comparable to the cavity-atom coupling rate. A similar behavior of the transfer of excitation is observed for a four-coupled-cavity system with two initial excitations.

  16. Electrical conductivity of oxidized-graphenic nanoplatelets obtained from bamboo: effect of the oxygen content

    NASA Astrophysics Data System (ADS)

    Gross, K.; Prías Barragán, J. J.; Sangiao, S.; De Teresa, J. M.; Lajaunie, L.; Arenal, R.; Ariza Calderón, H.; Prieto, P.

    2016-09-01

    The large-scale production of graphene and reduced-graphene oxide (rGO) requires low-cost and eco-friendly synthesis methods. We employed a new, simple, cost-effective pyrolytic method to synthetize oxidized-graphenic nanoplatelets (OGNP) using bamboo pyroligneous acid (BPA) as a source. Thorough analyses via high-resolution transmission electron microscopy and electron energy-loss spectroscopy provides a complete structural and chemical description at the local scale of these samples. In particular, we found that at the highest carbonization temperature the OGNP-BPA are mainly in a sp2 bonding configuration (sp2 fraction of 87%). To determine the electrical properties of single nanoplatelets, these were contacted by Pt nanowires deposited through focused-ion-beam-induced deposition techniques. Increased conductivity by two orders of magnitude is observed as oxygen content decreases from 17% to 5%, reaching a value of 2.3 × 103 S m-1 at the lowest oxygen content. Temperature-dependent conductivity reveals a semiconductor transport behavior, described by the Mott three-dimensional variable range hopping mechanism. From the localization length, we estimate a band-gap value of 0.22(2) eV for an oxygen content of 5%. This investigation demonstrates the great potential of the OGNP-BPA for technological applications, given that their structural and electrical behavior is similar to the highly reduced rGO sheets obtained by more sophisticated conventional synthesis methods.

  17. Electronic transition and electrical transport properties of delafossite CuCr1-xMgxO2 (0 ≤ x ≤ 12%) films prepared by the sol-gel method: A composition dependence study

    NASA Astrophysics Data System (ADS)

    Han, M. J.; Duan, Z. H.; Zhang, J. Z.; Zhang, S.; Li, Y. W.; Hu, Z. G.; Chu, J. H.

    2013-10-01

    Highly transparent CuCr1-xMgxO2 (0 ≤ x ≤ 12%) films were prepared on (001) sapphire substrates by sol-gel method. The microstructure, phonon modes, optical band gap, and electrical transport properties have been systematically discussed. It was found that Mg-doping improved the crystal quality and enhanced the (00l) preferred orientation. The spectral transmittance of films approaches about 70%-75% in the visible-near-infrared wavelength region. With increasing Mg-composition, the optical band gap first declines and climbs up due to the band gap renormalization and Burstein-Moss effect. The direct and indirect band gaps of CuCr0.94Mg0.06O2 film are 3.00 and 2.56 eV, respectively. In addition, it shows a crossover from the thermal activation behavior to that of three-dimensional variable range hopping from temperature-dependent electrical conductivity. The crossover temperature decreases with increasing Mg-doping composition, which can be ascribed to the change of spin-charge coupling between the hole and the local spin at Cr site. It should be noted that the electrical conductivity of CuCr1-xMgxO2 films becomes larger with increasing x value. The highest electrical conductivity of 3.85 S cm-1 at room temperature for x = 12% is four-order magnitude larger than that (8.81 × 10-4 S cm-1) for pure CuCrO2 film. The high spectral transmittance and larger conductivity indicate that Mg-doped CuCrO2 films are promising for optoelectronic device applications.

  18. Transparent lattices and their solitary waves.

    PubMed

    Sadurní, E

    2014-09-01

    We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.

  19. An Overview of Radiation-Induced Interface Traps in MOS (Metal-Oxide Semiconductor) Structures

    DTIC Science & Technology

    1989-11-01

    to be Controlled by hole transport to the Si/S1 02 interface and by neutral hydrogen diffusion, respectively. ’We also discuss several models which...trivalent Si which is undergo a dispersive hopping transport which not mobile and a mobile nonbridging oxygen. controls the rate of interface state... control the buildup of ping event itself seems to be a phonon-assisted radiation-induced interface states are subjects tunneling transition between

  20. Direct determination of energy level alignment and charge transport at metal-Alq3 interfaces via ballistic-electron-emission spectroscopy.

    PubMed

    Jiang, J S; Pearson, J E; Bader, S D

    2011-04-15

    Using ballistic-electron-emission spectroscopy (BEES), we directly determined the energy barrier for electron injection at clean interfaces of Alq(3) with Al and Fe to be 2.1 and 2.2 eV, respectively. We quantitatively modeled the sub-barrier BEES spectra with an accumulated space charge layer, and found that the transport of nonballistic electrons is consistent with random hopping over the injection barrier.

  1. Formation and electrical transport properties of pentacene nanorod crystal.

    PubMed

    Akai-Kasaya, M; Ohmori, C; Kawanishi, T; Nashiki, M; Saito, A; Aono, M; Kuwahara, Y

    2010-09-10

    The monophasic formation of an uncharted pentacene crystal, the pentacene nanorod, has been investigated. The restricted formation of the pentacene nanorod on a bare mica surface reveals a peculiar surface catalytic crystal growth mode of the pentacene. We demonstrated the charge transport measurements through a single pentacene nanorod and analyzed the data using a periodic hopping conduction model. The results revealed that the pentacene nanorod has a periodic conductive node within their one-dimensional crystal.

  2. Direct determination of energy level alignment and charge transport at metal/Alq{sub 3} interfaces via ballistic-electron-emission spectroscopy.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, J. S.; Pearson, J. E.; Bader, S. D.

    2011-04-15

    Using ballistic-electron-emission spectroscopy (BEES), we directly determined the energy barrier for electron injection at clean interfaces of Alq{sub 3} with Al and Fe to be 2.1 and 2.2 eV, respectively. We quantitatively modeled the sub-barrier BEES spectra with an accumulated space charge layer, and found that the transport of nonballistic electrons is consistent with random hopping over the injection barrier.

  3. Single molecule translocation in smectics illustrates the challenge for time-mapping in simulations on multiple scales

    NASA Astrophysics Data System (ADS)

    Mukherjee, Biswaroop; Peter, Christine; Kremer, Kurt

    2017-09-01

    Understanding the connections between the characteristic dynamical time scales associated with a coarse-grained (CG) and a detailed representation is central to the applicability of the coarse-graining methods to understand molecular processes. The process of coarse graining leads to an accelerated dynamics, owing to the smoothening of the underlying free-energy landscapes. Often a single time-mapping factor is used to relate the time scales associated with the two representations. We critically examine this idea using a model system ideally suited for this purpose. Single molecular transport properties are studied via molecular dynamics simulations of the CG and atomistic representations of a liquid crystalline, azobenzene containing mesogen, simulated in the smectic and the isotropic phases. The out-of-plane dynamics in the smectic phase occurs via molecular hops from one smectic layer to the next. Hopping can occur via two mechanisms, with and without significant reorientation. The out-of-plane transport can be understood as a superposition of two (one associated with each mode of transport) independent continuous time random walks for which a single time-mapping factor would be rather inadequate. A comparison of the free-energy surfaces, relevant to the out-of-plane transport, qualitatively supports the above observations. Thus, this work underlines the need for building CG models that exhibit both structural and dynamical consistency to the underlying atomistic model.

  4. Intrachain versus interchain electron transport in poly(fluorene-alt-benzothiadiazole): a quantum-chemical insight.

    PubMed

    Van Vooren, Antoine; Kim, Ji-Seon; Cornil, Jérôme

    2008-05-16

    Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole) [F8BT], displays very different charge-transport properties for holes versus electrons when comparing annealed and pristine thin films and transport parallel (intrachain) and perpendicular (interchain) to the polymer axes. The present theoretical contribution focuses on the electron-transport properties of F8BT chains and compares the efficiency of intrachain versus interchain transport in the hopping regime. The theoretical results rationalize significantly lowered electron mobility in annealed F8BT thin films and the smaller mobility anisotropy (mu( parallel)/mu( perpendicular)) measured for electrons in aligned films (i.e. 5-7 compared to 10-15 for holes).

  5. Wave-packet approach to transport properties of carrier coupled with intermolecular and intramolecular vibrations of organic semiconductors

    NASA Astrophysics Data System (ADS)

    Ishii, Hiroyuki; Honma, Keisuke; Kobayashi, Nobuhiko; Hirose, Kenji

    2012-06-01

    We present a methodology to study the charge-transport properties of organic semiconductors by the time-dependent wave-packet diffusion method, taking the polaron effects into account. As an example, we investigate the transport properties of single-crystal pentacene organic semiconductors coupled with inter- and intramolecular vibrations within the mixed Holstein and Peierls model, which describes both hopping and bandlike transport behaviors due to small and large polaron formations. Taking into account static disorders, which inevitably exist in the molecular crystals, we present the temperature dependence of charge-transport properties in competition among the thermal fluctuation of molecular motions, the polaron formation, and the static disorders.

  6. Hopping locomotion at different gravity: metabolism and mechanics in humans.

    PubMed

    Pavei, Gaspare; Minetti, Alberto E

    2016-05-15

    Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

  7. VOC source identification from personal and residential indoor, outdoor and workplace microenvironment samples in EXPOLIS-Helsinki, Finland

    NASA Astrophysics Data System (ADS)

    Edwards, Rufus D.; Jurvelin, J.; Koistinen, K.; Saarela, K.; Jantunen, M.

    Principal component analyses (varimax rotation) were used to identify common sources of 30 target volatile organic compounds (VOCs) in residential outdoor, residential indoor and workplace microenvironment and personal 48-h exposure samples, as a component of the EXPOLIS-Helsinki study. Variability in VOC concentrations in residential outdoor microenvironments was dominated by compounds associated with long-range transport of pollutants, followed by traffic emissions, emissions from trees and product emissions. Variability in VOC concentrations in environmental tobacco smoke (ETS) free residential indoor environments was dominated by compounds associated with indoor cleaning products, followed by compounds associated with traffic emissions, long-range transport of pollutants and product emissions. Median indoor/outdoor ratios for compounds typically associated with traffic emissions and long-range transport of pollutants exceeded 1, in some cases quite considerably, indicating substantial indoor source contributions. Changes in the median indoor/outdoor ratios during different seasons reflected different seasonal ventilation patterns as increased ventilation led to dilution of those VOC compounds in the indoor environment that had indoor sources. Variability in workplace VOC concentrations was dominated by compounds associated with traffic emissions followed by product emissions, long-range transport and air fresheners. Variability in VOC concentrations in ETS free personal exposure samples was dominated by compounds associated with traffic emissions, followed by long-range transport, cleaning products and product emissions. VOC sources in personal exposure samples reflected the times spent in different microenvironments, and personal exposure samples were not adequately represented by any one microenvironment, demonstrating the need for personal exposure sampling.

  8. Nonintrinsic origin of the colossal dielectric constants in Ca Cu3 Ti4 O12

    NASA Astrophysics Data System (ADS)

    Lunkenheimer, P.; Fichtl, R.; Ebbinghaus, S. G.; Loidl, A.

    2004-11-01

    The dielectric properties of CaCu3Ti4O12 , a material showing colossal values of the dielectric constant, were investigated over a broad temperature and frequency range extending up to 1.3GHz . A detailed equivalent-circuit analysis of the results and two crucial experiments, employing different types of contacts and varying the sample thickness were performed. The results provide clear evidence that the apparently high values of the dielectric constant in CaCu3Ti4O12 are nonintrinsic and due to electrode polarization effects. The intrinsic properties of CaCu3Ti4O12 are characterized by charge transport via hopping of localized charge carriers and a relatively high dielectric constant of the order of 100.

  9. Unsaturated magnetoconductance of epitaxial La0.7Sr0.3MnO3 thin films in pulsed magnetic fields up to 60 T

    NASA Astrophysics Data System (ADS)

    Niu, Wei; Wang, Xuefeng; Gao, Ming; Xia, Zhengcai; Du, Jun; Nie, Yuefeng; Song, Fengqi; Xu, Yongbing; Zhang, Rong

    2017-05-01

    We report on the temperature and field dependence of resistance of La0.7Sr0.3MnO3 thin films over a wide temperature range and in pulsed magnetic fields up to 60 T. The epitaxial La0.7Sr0.3MnO3 thin films were deposited by laser molecular beam epitaxy. High magnetic field magnetoresistance curves were fitted by the Brillouin function, which indicated the existence of magnetically polarized regions and the underlying hopping mechanism. The unsaturated magnetoconductance was the most striking finding observed in pulsed magnetic fields up to 60 T. These observations can deepen the fundamental understanding of the colossal magnetoresistance in manganites with strong correlation of transport properties and magnetic ordering.

  10. Superconducting and magnetic properties of Bi 2Sr 2Ca 1- xY xCu 2O y (0≦ x≦1)

    NASA Astrophysics Data System (ADS)

    Yoshizaki, R.; Saito, Y.; Abe, Y.; Ikeda, H.

    1988-07-01

    The effect of substitution of Y atoms for Ca atoms has been studied in the Bi 2Sr 2Ca 1- xY xCu 2O y compound system. For x<0.5, superconductivity is observed and its fractional volume is reduced with increasing x, though the transition temperature of about 85 K is maintained. For x≧0.5 samples, the electrical resistivity behavior can be well described by the three-dimensional variable range hopping conduction, indicating that the system is essentially insulating. In this range of x, magnetic susceptibility shows spin-glass-type cusp at 13 K in the heating process after zero-field cooling and an enhanced cusp at 11 K in the field-cooling process. In the temperature range above about 150 K the Curie-Weiss dependence holds well with a positive paramagnetic Curie temperature, which increases to 40 K with increasing x in the insulating region.

  11. Theoretical and experimental study of AC electrical conduction mechanism in the low temperature range of p-CuIn3Se5

    NASA Astrophysics Data System (ADS)

    Essaleh, L.; Amhil, S.; Wasim, S. M.; Marín, G.; Choukri, E.; Hajji, L.

    2018-05-01

    In the present work, an attempt has been made to study theoretically and experimentally the AC electrical conduction mechanism in disordered semiconducting materials. The key parameter considered in this analysis is the frequency exponent s(ω , T) =( ∂ln(σAC(ω , T))/∂ ln(ω)T , where σAC is the AC electrical conductivity that depends on angular frequency ω and temperature T. In the theoretical part of this work, the effect of the barrier hopping energy, the polaron radius and the characteristic relaxation time is considered. The theoretical models of Quantum Mechanical Tunneling (QMT), Non overlapping Small Polaron Tunneling (NSPT), Overlapping Large Polaron Tunneling (OLPT) and Correlated Barrier Hopping (CBH) are considered to fit experimental data of σAC in p-CuIn3Se5 (p-CIS135) in the low temperature range up to 96 K. Some important parameters, as the polaron radius, the localization length and the barrier hopping energies, are estimated and their temperature and frequency dependence discussed.

  12. Analysis of muscle activity and ankle joint movement during the side-hop test.

    PubMed

    Yoshida, Masahiro; Taniguchi, Keigo; Katayose, Masaki

    2011-08-01

    Functional performance tests (FPTs) that consist of movements, such as hopping, landing, and cutting, provide useful measurements. Although some tests have been established for kinematic studies of the knee joint, very few tests have been established for the ankle joint. To use the FPT as a test battery for patients with an ankle sprain, it is necessary to document typical patterns of muscle activation and range of motion (ROM) of the ankle joint during FPTs. Therefore, the purpose of this study was to investigate the pattern of the ROM of the ankle inversion/eversion and the muscle activity of the peroneus longus muscle (PL) and the tibial anterior muscle (TA) in normal subjects during the side-hop test. To emphasize the characteristics of ROM and electromyography (EMG) at each phase, the side-hop tests were divided into 4 phases: lateral-hop contact phase (LC), lateral-hop flight phase (LF), medial hop contact phase (MC), and medial hop flight phase (MF), and the ROM of ankle inversion/eversion, a peak angle of ankle inversion, and Integral EMG (IEMG) of PL and TA compared among 4 phases. Fifteen male subjects with no symptoms of ankle joint problems participated in this research. The ROM of ankle inversion/eversion during the side-hop test was 27 ± 3.8° (mean ± SD), and there was a significant difference in the ROM of ankle inversion/eversion among 4 phases (p < 0.05). The phase in which the widest ROM was presented was the MF. A peak angle of the ankle inversion at MC was significantly greater than at LC and MF (p <0.05). A peak angle of the ankle inversion at LF was significantly greater than at LC and MF. The PL remained contracting with 50-160% of maximal voluntary contraction (MVC). The IEMGs of PL in both the contact phases were significantly greater than in both the flight phases (p < 0.05). In addition, the PL activity at LC was significantly greater than at MC. The TA remained contracting at 50-80% of MVC through the side-hop test. The IEMG of TA at both the contact phases was significantly greater than at 2 flight phases. However, there was no significant difference between LC and MF. Results of this study could be useful as basic data when evaluating the validity of the side-hop test for patients with ankle sprain.

  13. Reliability and validity of functional performance tests in dancers with hip dysfunction.

    PubMed

    Kivlan, Benjamin R; Carcia, Christopher R; Clemente, F Richard; Phelps, Amy L; Martin, Robroy L

    2013-08-01

    Quasi-experimental, repeated measures. Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. NINETEEN FEMALE DANCERS (AGE: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = -4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = -0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = -0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = -1.84, p=0.08) were not statistically different between sides. The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. 3b. Non-consecutive cohort study.

  14. RELIABILITY AND VALIDITY OF FUNCTIONAL PERFORMANCE TESTS IN DANCERS WITH HIP DYSFUNCTION

    PubMed Central

    Carcia, Christopher R.; Clemente, F. Richard; Phelps, Amy L.; Martin, RobRoy L.

    2013-01-01

    Study Design: Quasi-experimental, repeated measures. Purpose/Background: Functional performance tests that identify hip joint impairments and assess the effect of intervention have not been adequately described for dancers. The purpose of this study was to examine the reliability and validity of hop and balance tests among a group of dancers with musculoskeletal pain in the hip region. Methods: Nineteen female dancers (age: 18.90±1.11 years; height: 164.85±6.95 cm; weight: 60.37±8.29 kg) with unilateral hip pain were assessed utilizing the cross-over reach, medial triple hop, lateral triple hop, and cross-over hop tests on two occasions, 2 days apart. Test-retest reliability and comparisons between the involved and uninvolved side for each respective test were determined. Results: Intra-class correlation coefficients for the functional performance tests ranged from 0.89-0.96. The cross-over reach test had a SEM of 2.79 cm and a MDC of 7.73 cm. The medial and lateral triple hop tests had SEM values of 7.51 cm and 8.17 cm, and MDC values of 20.81 cm and 22.62 cm, respectively. The SEM was 0.15 seconds and the MDC was 0.42 seconds for the cross-over hop test. Performance on the medial triple hop test was significantly less on the involved side (370.21±38.26 cm) compared to the uninvolved side (388.05±41.49 cm); t(18) = −4.33, p<0.01. The side-to-side comparisons of the cross-over reach test (involved mean=61.68±10.9 cm; uninvolved mean=61.69±8.63 cm); t(18) = −0.004, p=0.99, lateral triple hop test (involved mean=306.92±35.79 cm; uninvolved mean=310.68±24.49 cm); t(18) = −0.55, p=0.59, and cross-over hop test (involved mean=2.49±0.34 seconds; uninvolved mean= 2.61±0.42 seconds; t(18) = −1.84, p=0.08) were not statistically different between sides. Conclusion: The functional performance tests used in this study can be reliably performed on dancers with unilateral hip pain. The medial triple hop test was the only functional performance test with evidence of validity in side-to-side comparisons. These results suggest that the medial triple hop test may be a reliable and valid functional performance test to assess impairments related to hip pain among dancers. Level of Evidence: 3b. Non-consecutive cohort study PMID:24175123

  15. COMMUNICATION: Stochastic resonance and the evolution of Daphnia foraging strategy

    NASA Astrophysics Data System (ADS)

    Dees, Nathan D.; Bahar, Sonya; Moss, Frank

    2008-12-01

    Search strategies are currently of great interest, with reports on foraging ranging from albatrosses and spider monkeys to microzooplankton. Here, we investigate the role of noise in optimizing search strategies. We focus on the zooplankton Daphnia, which move in successive sequences consisting of a hop, a pause and a turn through an angle. Recent experiments have shown that their turning angle distributions (TADs) and underlying noise intensities are similar across species and age groups, suggesting an evolutionary origin of this internal noise. We explore this hypothesis further with a digital simulation (EVO) based solely on the three central Darwinian themes: inheritability, variability and survivability. Separate simulations utilizing stochastic resonance (SR) indicate that foraging success, and hence fitness, is maximized at an optimum TAD noise intensity, which is represented by the distribution's characteristic width, σ. In both the EVO and SR simulations, foraging success is the criterion, and the results are the predicted characteristic widths of the TADs that maximize success. Our results are twofold: (1) the evolving characteristic widths achieve stasis after many generations; (2) as a hop length parameter is changed, variations in the evolved widths generated by EVO parallel those predicted by SR. These findings provide support for the hypotheses that (1) σ is an evolved quantity and that (2) SR plays a role in evolution.

  16. Sequential vortex hopping in an array of artificial pinning centers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keay, J. C.

    2010-02-24

    We use low-temperature magnetic force microscopy (MFM) to study the hopping motion of vortices in an array of artificial pinning centers (APCs). The array consists of nanoscale holes etched in a niobium thin film by Ar-ion sputtering through an anodic aluminum-oxide template. Variable-temperature magnetometry shows a transition temperature of 7.1 K and an enhancement of the magnetization up to the third matching field at 5 K. Using MFM with attractive and repulsive tip-vortex interaction, we measure the vortex-pinning strength and investigate the motion of individual vortices in the APC array. The depinning force for individual vortices at low field rangedmore » from 0.7 to 1.2 pN. The motion of individual vortices was found to be reproducible and consistent with movement between adjacent holes in the film. The movements are repeatable but the sequence of hops depends on the scan direction. This asymmetry in the motion indicates nonuniform local pinning, a consequence of array disorder and hole-size variation.« less

  17. Loss of Drosophila Vps16A enhances autophagosome formation through reduced Tor activity.

    PubMed

    Takáts, Szabolcs; Varga, Ágnes; Pircs, Karolina; Juhász, Gábor

    2015-01-01

    The HOPS tethering complex facilitates autophagosome-lysosome fusion by binding to Syx17 (Syntaxin 17), the autophagosomal SNARE. Here we show that loss of the core HOPS complex subunit Vps16A enhances autophagosome formation and slows down Drosophila development. Mechanistically, Tor kinase is less active in Vps16A mutants likely due to impaired endocytic and biosynthetic transport to the lysosome, a site of its activation. Tor reactivation by overexpression of Rheb suppresses autophagosome formation and restores growth and developmental timing in these animals. Thus, Vps16A reduces autophagosome numbers both by indirectly restricting their formation rate and by directly promoting their clearance. In contrast, the loss of Syx17 blocks autophagic flux without affecting the induction step in Drosophila.

  18. Carbon nanotube vacuum gauges utilizing long, dissipative tubes

    NASA Astrophysics Data System (ADS)

    Kaul, Anupama B.; Manohara, Harish M.

    2008-04-01

    A carbon nanotube-based thermal conductivity vacuum gauge is described which utilizes 5-10 μm long diffusively contacted SWNTs for vacuum sensing. By etching the thermal SiO II beneath the tubes and minimizing heat conduction through the substrate, pressure sensitivity was extended toward higher vacuums. The pressure response of unannealed and annealed devices was compared to that of released devices. The released devices showed sensitivity to pressure as low as 1 x 10 -6 Torr. The sensitivity increased more dramatically with power for the released device compared to that of the unreleased device. Low temperature electronic transport measurements of the tubes were suggestive of a thermally activated hopping mechanism where the activation energy for hopping was calculated to be ~ 39 meV.

  19. Ion transport in the microporous titanosilicate ETS-10.

    PubMed

    Wei, Ta-Chen; Hillhouse, Hugh W

    2006-07-20

    Impedance spectroscopy was used to investigate ion transport in the microporous crystalline framework titanosilicate ETS-10 in the frequency range from 1 Hz to 10 MHz. These data were compared to measured data from the microporous aluminosilicate zeolite X. Na-ETS-10 was found to have a lower activation energy for ion conduction than that of NaX, 58.5 kJ/mol compared to 66.8 kJ/mol. However, the dc conductivity and ion hopping rate for Na-ETS-10 were also lower than NaX. This was found to be due to the smaller entropy contribution in Na-ETS-10 because of its high cation site occupancy. This was verified by ion exchanging Na(+) with Cu(2+) in both microporous frameworks. This exchange decreases the cation site occupancy and reduces correlation effects. The exchanged Cu-ETS-10 was found to have both lower activation energy and higher ionic conductivity than CuX. Zeolite X has the highest ion conductivity among the zeolites, and thus the data shown here indicate that ETS-10 has more facile transport of higher valence cations which may be important for ion-exchange, environmental remediation of radionucleotides, and nanofabrication.

  20. Augmented Ehrenfest dynamics yields a rate for surface hopping

    NASA Astrophysics Data System (ADS)

    Subotnik, Joseph E.

    2010-04-01

    We present a new algorithm for mixed quantum-classical dynamics that helps bridge the gap between mean-field (Ehrenfest) and surface-hopping dynamics by defining a natural rate of decoherence. In order to derive this decoherence result, we have expanded the number of independent variables in the usual Ehrenfest routine so that mixed quantum-classical derivatives are now propagated in time alongside the usual Ehrenfest variables. Having done so, we compute a unique rate of decoherence using two independent approaches: (i) by comparing the equations of motion for the joint nuclear-electronic probability density in phase space according to Ehrenfest dynamics versus partial Wigner transform dynamics and (ii) by introducing a frozen Gaussian interpretation of Ehrenfest dynamics which allows nuclear wave packets to separate. The first consequence of this work is a means to rigorously check the accuracy of standard Ehrenfest dynamics. Second, this paper suggests a nonadiabatic dynamics algorithm, whereby the nuclei are propagated on the mean-field (Ehrenfest) potential energy surface and undergo stochastic decoherence events. Our work resembles the surface-hopping algorithm of Schwartz and co-workers [J. Chem. Phys. 123, 234106 (2005)]—only now without any adjustable parameters. For the case of two electronic states, we present numerical results on the so-called "Tully problems" and emphasize that future numerical benchmarking is still needed. Future work will also treat the problem of three or more electronic states.

  1. Outage analysis of relay-assisted underwater wireless optical communication systems

    NASA Astrophysics Data System (ADS)

    Tabeshnezhad, Azadeh; Pourmina, Mohammad Ali

    2017-12-01

    In this paper, we theoretically evaluate the outage probabilities of underwater wireless optical communication (UWOC) systems. Our derivations are general as the channel model under consideration takes into account all of the channel degrading effects, namely absorption, scattering, and turbulence-induced fading. We numerically show that the UWOC systems, due to the severe channel impairments, cannot typically support longer link ranges than 100 m. Therefore, in this paper, in order to increase the transmission reliability and hence extend the viable communication range of UWOC systems, we apply decode-and-forward (DF) relay-assisted communications either in the form of multi-hop transmission, where multiple intermediate relays are serially employed between the source and destination, or parallel relaying in which multiple DF relays are distributed among the source-to-destination path to cooperate in the end-to-end transmission. Our numerical results reveal that multi-hop transmission, owing to the distance-dependency of all of the channel degrading effects, can tremendously improve the end-to-end outage probability and increase the accessible link ranges to hundreds of meter. For example, a dual-hop transmission in a 45 m coastal water link can provide up to 41 dB performance improvement at the outage probability of 10-9.

  2. Quantitative analysis of the guest-concentration dependence of the mobility in a disordered fluorene-arylamine host-guest system in the guest-to-guest regime

    NASA Astrophysics Data System (ADS)

    Nicolai, H. T.; Hof, A. J.; Lu, M.; Blom, P. W. M.; de Vries, R. J.; Coehoorn, R.

    2011-11-01

    The charge transport in a polyspirobifluorene derivative with copolymerized N,N,N',N'-tetraaryldiamino biphenyl (TAD) hole transport units is investigated as a function of the TAD content. For TAD concentrations larger than 5%, guest-to-guest transport is observed. It is demonstrated that in this regime the charge carrier density dependent mobility can be described consistently with the extended Gaussian disorder model, with a density of hopping sites which is proportional to the TAD concentration and comparable to the molecular density.

  3. The magnetic ordering in high magnetoresistance Mn-doped ZnO thin films

    DOE PAGES

    Venkatesh, S.; Baras, A.; Lee, J. -S.; ...

    2016-03-24

    Here, we studied the nature of magnetic ordering in Mn-doped ZnO thin films that exhibited ferromagnetism at 300 K and superparamagnetism at 5 K. We directly inter-related the magnetisation and magnetoresistance by invoking the polaronpercolation theory and variable range of hopping conduction below the metal-to-insulator transition. By obtaining a qualitative agreement between these two models, we attribute the ferromagnetism to the s-d exchange-induced spin splitting that was indicated by large positive magnetoresistance (~40 %). Low temperature superparamagnetism was attributed to the localization of carriers and non-interacting polaron clusters. This analysis can assist in understanding the presence or absence of ferromagnetismmore » in doped/un-doped ZnO.« less

  4. Thermoelectric Properties of Selenospinel Cu6Fe4Sn12Se32

    NASA Astrophysics Data System (ADS)

    Suekuni, Koichiro; Kunii, Masaru; Nishiate, Hirotaka; Ohta, Michihiro; Yamamoto, Atsushi; Koyano, Mikio

    2012-06-01

    This report describes thermoelectric properties up to 500 K for polycrystalline selenospinel Cu6Fe4Sn12Se32 samples. Thermal conductivity shows a low value of 1 W/Km because of their structural complexity such as Fe/Sn site disorder. Electrical resistivity ρ varies as exp( T 0/ T 1/4) and thermopower S varies as T 1/2 at low temperatures, which indicates that Mott variable-range hopping is the dominant conduction mechanism. However, at high temperatures (above 350 K), ρ and S decrease simultaneously. The temperature dependences are attributed to the thermal excitation of electrons. The possible band structure for Cu6Fe4Sn12Se32 is examined to clarify the behavior of ρ and S.

  5. A new surface-potential-based compact model for the MoS2 field effect transistors in active matrix display applications

    NASA Astrophysics Data System (ADS)

    Cao, Jingchen; Peng, Songang; Liu, Wei; Wu, Quantan; Li, Ling; Geng, Di; Yang, Guanhua; Ji, Zhouyu; Lu, Nianduan; Liu, Ming

    2018-02-01

    We present a continuous surface-potential-based compact model for molybdenum disulfide (MoS2) field effect transistors based on the multiple trapping release theory and the variable-range hopping theory. We also built contact resistance and velocity saturation models based on the analytical surface potential. This model is verified with experimental data and is able to accurately predict the temperature dependent behavior of the MoS2 field effect transistor. Our compact model is coded in Verilog-A, which can be implemented in a computer-aided design environment. Finally, we carried out an active matrix display simulation, which suggested that the proposed model can be successfully applied to circuit design.

  6. Efficient DV-HOP Localization for Wireless Cyber-Physical Social Sensing System: A Correntropy-Based Neural Network Learning Scheme

    PubMed Central

    Xu, Yang; Luo, Xiong; Wang, Weiping; Zhao, Wenbing

    2017-01-01

    Integrating wireless sensor network (WSN) into the emerging computing paradigm, e.g., cyber-physical social sensing (CPSS), has witnessed a growing interest, and WSN can serve as a social network while receiving more attention from the social computing research field. Then, the localization of sensor nodes has become an essential requirement for many applications over WSN. Meanwhile, the localization information of unknown nodes has strongly affected the performance of WSN. The received signal strength indication (RSSI) as a typical range-based algorithm for positioning sensor nodes in WSN could achieve accurate location with hardware saving, but is sensitive to environmental noises. Moreover, the original distance vector hop (DV-HOP) as an important range-free localization algorithm is simple, inexpensive and not related to the environment factors, but performs poorly when lacking anchor nodes. Motivated by these, various improved DV-HOP schemes with RSSI have been introduced, and we present a new neural network (NN)-based node localization scheme, named RHOP-ELM-RCC, through the use of DV-HOP, RSSI and a regularized correntropy criterion (RCC)-based extreme learning machine (ELM) algorithm (ELM-RCC). Firstly, the proposed scheme employs both RSSI and DV-HOP to evaluate the distances between nodes to enhance the accuracy of distance estimation at a reasonable cost. Then, with the help of ELM featured with a fast learning speed with a good generalization performance and minimal human intervention, a single hidden layer feedforward network (SLFN) on the basis of ELM-RCC is used to implement the optimization task for obtaining the location of unknown nodes. Since the RSSI may be influenced by the environmental noises and may bring estimation error, the RCC instead of the mean square error (MSE) estimation, which is sensitive to noises, is exploited in ELM. Hence, it may make the estimation more robust against outliers. Additionally, the least square estimation (LSE) in ELM is replaced by the half-quadratic optimization technique. Simulation results show that our proposed scheme outperforms other traditional localization schemes. PMID:28085084

  7. Plausible carrier transport model in organic-inorganic hybrid perovskite resistive memory devices

    NASA Astrophysics Data System (ADS)

    Park, Nayoung; Kwon, Yongwoo; Choi, Jaeho; Jang, Ho Won; Cha, Pil-Ryung

    2018-04-01

    We demonstrate thermally assisted hopping (TAH) as an appropriate carrier transport model for CH3NH3PbI3 resistive memories. Organic semiconductors, including organic-inorganic hybrid perovskites, have been previously speculated to follow the space-charge-limited conduction (SCLC) model. However, the SCLC model cannot reproduce the temperature dependence of experimental current-voltage curves. Instead, the TAH model with temperature-dependent trap densities and a constant trap level are demonstrated to well reproduce the experimental results.

  8. Human Exploration of Mars

    NASA Astrophysics Data System (ADS)

    Gwynne, Owen; McKay, Chris; Zubrin, Robert

    1991-06-01

    Novel approaches to the human exploration of Mars are considered with emphasis on a space suit design, extraterrestrial surface mobility, and water supply. A possible way of transporting personnel on the surface of Mars uses a suborbital rocket that will hop from one site to the next, refuelling each time it lands and giving the Martian explorers effective global mobility. Telepresence could be used to avoid limiting the people on Mars to a small exploration area as a result of a lack of transportation infrastructure. Drawings and photographs are included.

  9. Condensation and transport in the totally asymmetric inclusion process (TASIP)

    NASA Astrophysics Data System (ADS)

    Knebel, Johannes; Weber, Markus F.; Krueger, Torben; Frey, Erwin

    Transport phenomena are often modeled by the hopping of particles on regular lattices or networks. Such models describe, e.g., the exclusive movement of molecular motors along microtubules: no two motors may occupy the same site. In our work, we study inclusion processes that are the bosonic analogues of the fermionic exclusion processes. In inclusion processes, many particles may occupy a single site and hopping rates depend linearly on the occupation of departure and arrival sites. Particles thus attract other particles to their own site. Condensation occurs when particles collectively cluster in one or multiple sites, whereas other sites become depleted.We showed that inclusion processes describe both the selection of strategies in evolutionary zero-sum games and the condensation of non-interacting bosons into multiple quantum states in driven-dissipative systems. The condensation is captured by the antisymmetric Lotka-Volterra equation (ALVE), which constitutes a nonlinearly coupled dynamical system. We derived an algebraic method to analyze the ALVE and to determine the condensates. Our approach allows for the design of networks that result in condensates with oscillating occupations, and yields insight into the interplay between network topology and transport properties. Deutsche Forschungsgemeinschaft (SFB-TR12), German Excellence Initiative (Nanosystems Initiative Munich), Center for NanoScience Munich.

  10. CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Characteristics of alternating current hopping conductivity in DNA sequences

    NASA Astrophysics Data System (ADS)

    Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui

    2009-08-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.

  11. Teaching Inequalities: Using Public Transportation and Visual Sociology to Make It Real

    ERIC Educational Resources Information Center

    Grauerholz, Liz; Settembrino, Marc

    2016-01-01

    In this article, we describe an adaptation of Nichols, Berry, and Kalogrides's "Hop on the Bus" exercise. In addition to riding the bus, we incorporated a visual component similar to that developed by Whitley by having students conduct a sociological, photographic exercise after they disembarked. Qualitative and quantitative assessment…

  12. Study of dielectric relaxation and AC conductivity of InP:S single crystal

    NASA Astrophysics Data System (ADS)

    El-Nahass, M. M.; Ali, H. A. M.; El-Shazly, E. A.

    2012-07-01

    The dielectric relaxation and AC conductivity of InP:S single crystal were studied in the frequency range from 100 to 5.25 × 105 Hz and in the temperature range from 296 to 455 K. The dependence of the dielectric constant (ɛ1) and the dielectric loss (ɛ2) on both frequency and temperature was investigated. Since no peak was observed on the dielectric loss, we used a method based on the electric modulus to evaluate the activation energy of the dielectric relaxation. Scaling of the electric modulus spectra showed that the charge transport dynamics is independent of temperature. The AC conductivity (σAC) was found to obey the power law: Aωs. Analysis of the AC conductivity data and the frequency exponent showed that the correlated barrier hopping (CBH) model is the dominant mechanism for the AC conduction. The variation of AC conductivity with temperature at different frequencies showed that σAC is a thermally activated process.

  13. Alternating current transport and dielectric relaxation of nanocrystalline graphene oxide

    NASA Astrophysics Data System (ADS)

    Zedan, I. T.; El-Menyawy, E. M.

    2018-07-01

    Graphene oxide (GO) has been synthesized from natural graphite using modified Hummer's method and is subjected to sonication for 1 h. X-ray diffraction (XRD) showed that the prepared GO has nanocrystalline structure with particle size of about 5 nm and high-resolution transmission electron microscope showed that it had a layered structure. The nanocrystalline GO powder was pressed as a disk and the alternating current (AC) electrical conductivity, σAC, and dielectric properties have been investigated in the frequency range 50Hz-5 MHz and temperature range 298-523K using parallel plate spectroscopic technique. Analysis of σ AC as a function of frequency shows that the relation follows Jonscher's universal law with frequency exponent decreases with increasing temperature in which the correlated barrier hopping model is applicable to describe the behavior. The dielectric constant and dielectric loss are studied as functions of frequency and temperature. The dielectric modulus formalism is used for describing the relaxation process in which the relaxation time and its activation energy were evaluated.

  14. Dielectric relaxation and ac conductivity behavior of carboxyl functionalized multiwalled carbon nanotubes/poly (vinyl alcohol) composites

    NASA Astrophysics Data System (ADS)

    Amrin, Sayed; Deshpande, V. D.

    2017-03-01

    We study the dielectric relaxation and ac conductivity behavior of MWCNT-COOH/Polyvinyl alcohol nanocomposite films in the temperature (T) range 303-423 K and in the frequency (f) range 0.1 Hz-1 MHz. The dielectric constant increases with an increase in temperature and also with an increase in MWCNT-COOH loading into the polymer matrix, as a result of interfacial polarization. The permittivity data were found to fit well with the modified Cole-Cole equation. Temperature dependent values of the relaxation times, free charge carrier conductivity and space charge carrier conductivity were extracted from the equation. An observed increment in the ac conductivity for the nanocomposites was analysed by a Jonscher power law which suggests that the correlated barrier hopping is the dominant charge transport mechanism for the nanocomposite films. The electric modulus study revealed deviations from ideal Debye-type behavior which are explained by considering a generalized susceptibility function. XRD and DSC results show an increase in the degree of crystallinity.

  15. Electrical conductivity and dielectric relaxation of 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile

    NASA Astrophysics Data System (ADS)

    El-Menyawy, E. M.; Zedan, I. T.; Nawar, H. H.

    2014-03-01

    The electrical and dielectric properties of the synthesized 2-(antipyrin-4-ylhydrazono)-2-(4-nitrophenyl)acetonitrile (AHNA) have been studied. The direct and alternating current (DC and AC) conductivities and complex dielectric constant were investigated in temperature range 303-403 K. The AC conductivity and dielectric properties of AHNA were investigated over frequency range 100 Hz-5 MHz. From DC and AC measurements, electrical conduction is found to be a thermally activated process. The frequency-dependent AC conductivity obeys Jonscher's universal power law in which the frequency exponent decreases with increasing temperature. The correlated barrier hopping (CBH) is the predominant model for describing the charge carrier transport in which the electrical parameters are evaluated. The activation energy is found to decrease with increasing frequency. The behaviors of dielectric and dielectric loss are discussed in terms of a polarization mechanism. The dielectric loss shows frequency power law from which the maximum barrier height is determined as 0.19 eV in terms of the Guintini model.

  16. Locality and nonlocality in geomorphic transport laws: Implications of a particle-based model of hillslope evolution

    NASA Astrophysics Data System (ADS)

    Tucker, G. E.; Bradley, D. N.

    2008-12-01

    Many geomorphic transport laws assume that the transport process is local, meaning that the space and time scales of particle displacement are short relative to those of the system as a whole. This assumption allows one to express sediment flux in terms of at-a-point properties such as the local surface gradient. However, while this assumption is quite reasonable for some processes (for example, grain displacement by raindrop impact), it is questionable for others (such as landsliding). Moreover, particle displacement distance may also depend on slope angle, becoming longer as gradient increases. For example, the average motion distance during sediment ravel events on very steep slopes may approach the length of the entire hillslope. In such cases, the mass flux through a given point may depend not only on the local topography but also on topography some distance upslope, thus violating the locality assumption. Here we use a stochastic, particle- based model of hillslope evolution to gain insight into the potential for, and consequences of, nonlocality in sediment transport. The model is designed as a simple analogy for a host of different processes that displace sediment grains on hillslopes. The hillslope is represented as a two-dimensional pile of particles. These particles undergo quasi-random motion according to the following rules: (1) during each iteration, a particle and a direction are selected at random; (2) the particle hops in the direction of motion with a probability that depends on the its height relative to that of its immediate neighbor; (3) the particle continues making hops in the same direction and with the same probability dependence, until coming to rest or exiting the base of the slope. The topography and motion statistics that emerge from these rules show a range of behavior that depends on a dimensionless relief parameter. At low relief, hillslope shape is parabolic, mean displacement length is on the order of two particle widths, and the probability distribution of displacement length is thin- tailed (approximately exponential). At high relief, hillslopes become planar, average displacement length increases by an order of magnitude, and the displacement-length distribution becomes heavy-tailed (albeit truncated at the slope length). Across the spectrum of relief values, the relationship between mean flux and gradient resembles the family of nonlinear flux-gradient curves that has been used to model hillslope evolution. We compare the emergent morphology and transport statistics with linear, nonlinear, and fractional diffusion models of hillslope transport.

  17. Slow Relaxation in Anderson Critical Systems

    NASA Astrophysics Data System (ADS)

    Choi, Soonwon; Yao, Norman; Choi, Joonhee; Kucsko, Georg; Lukin, Mikhail

    2016-05-01

    We study the single particle dynamics in disordered systems with long range hopping, focusing on the critical cases, i.e., the hopping amplitude decays as 1 /rd in d-dimension. We show that with strong on-site potential disorder, the return probability of the particle decays as power-law in time. As on-site potential disorder decreases, the temporal profile smoothly changes from a simple power-law to the sum of multiple power-laws with exponents ranged from 0 to νmax. We analytically compute the decay exponents using a simple resonance counting argument, which quantitatively agrees with exact numerical results. Our result implies that the dynamics in Anderson Critical systems are dominated by resonances. Harvard-MIT CUA, Kwanjeong Educational Fellowship, AFOSR MURI, Samsung Scholarship.

  18. Opening-assisted coherent transport in the semiclassical regime

    NASA Astrophysics Data System (ADS)

    Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

    2017-02-01

    We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.

  19. Characterization of the Migration of Hop Volatiles into Different Crown Cork Liner Polymers and Can Coatings.

    PubMed

    Wietstock, Philip C; Glattfelder, Richard; Garbe, Leif-Alexander; Methner, Frank-Jürgen

    2016-04-06

    Absorption of hop volatiles by crown cork liner polymers and can coatings was investigated in beer during storage. All hop volatiles measured were prone to migrate into the closures, and the absorption kinetics was demonstrated to fit Fick's second law of diffusion well for a plane sheet. The extent and rate of diffusion were significantly dissimilar and were greatly dependent upon the nature of the volatile. Diffusion coefficients ranged from 1.32 × 10(-5) cm(2)/day (limonene) to 0.26 × 10(-5) cm(2)/day (α-humulene). The maximum amounts absorbed into the material at equilibrium were in the following order: limonene > α-humulene > trans-caryophyllene > myrcene ≫ linalool > α-terpineol > geraniol. With the application of low-density polyethylene (LDPE) liners with oxygen-scavenging functionality, oxygen-barrier liners made up from high-density polyethylene (HDPE) or liner polymers from a different manufacturer had no significant effect on the composition of hop volatiles in beers after prolonged storage of 55 days; however, significantly higher amounts of myrcene and limonene were found in the oxygen-barrier-type crown cork, while all other closures behaved similarly. Can coatings were demonstrated to absorb hop volatiles in a similar pattern as crown corks but to a lesser extent. Consequently, significantly higher percentages of myrcene were found in the beers.

  20. Variation of sperm head shape and tail length in a species of Australian hydromyine rodent: the spinifex hopping mouse, Notomys alexis.

    PubMed

    Bauer, M; Breed, W G

    2006-01-01

    In Australia, there are around 60 species of murid rodents that occur in the subfamily Hydromyinae, most of which produce highly complex, monomorphic, spermatozoa in which the head has an apical hook together with two ventral processes containing filamentous actin and a long tail of species-specific length. One of the few exceptions to this is the spinifex hopping mouse, Notomys alexis, whose spermatozoa have previously been shown to have pleiomorphic heads. In this study, the structural organisation of the sperm head has been investigated in more detail and the variability in length of the midpiece and total length of the sperm tail has been determined for this species. The findings confirm that pleiomorphic sperm heads are invariably present in these animals and that this variability is associated with that of the nucleus, although nuclear vacuoles were not evident. The total length of the sperm tail, as well as that of the midpiece, was also highly variable both within, as well as between, individual animals. The reason(s) for this high degree of variability in sperm morphology is not known but it may relate to a relaxation of the genetic control of sperm form owing to depressed levels of inter-male sperm competition.

  1. Benefits of advanced propulsion technology for the advanced supersonic transport

    NASA Technical Reports Server (NTRS)

    Hines, R. W.; Sabatella, J. A.

    1973-01-01

    Future supersonic transports will have to provide improvement in the areas of economics, range, and emissions relative to the present generation of supersonic transports, as well as meeting or improving upon FAR 36 noise goals. This paper covers the promising propulsion systems including variable-cycle engine concepts for long-range supersonic commercial transport application. The benefits of applying advanced propulsion technology to solve the economic and environmental problems are reviewed. The advanced propulsion technologies covered are in the areas of structures, materials, cooling techniques, aerodynamics, variable engine geometry, jet noise suppressors, acoustic treatment, and low-emission burners. The results of applying the advanced propulsion technology are presented in terms of improvement in overall system takeoff gross weight and return on investment.

  2. Dynamic conductivity from audio to optical frequencies of semiconducting manganites approaching the metal-insulator transition

    NASA Astrophysics Data System (ADS)

    Lunkenheimer, P.; Mayr, F.; Loidl, A.

    2006-07-01

    We report the frequency-dependent conductivity of the manganite system La1-xSrxMnO3 (x0.2) when approaching the metal-insulator transition from the insulating side. Results from low-frequency dielectric measurements are combined with spectra in the infrared region. For low doping levels the behavior is dominated by hopping transport of localized charge carriers at low frequencies and by phononic and electronic excitations in the infrared region. For the higher Sr contents the approach of the metallic state is accompanied by the successive suppression of the hopping contribution at low frequencies and by the development of polaronic excitations in the infrared region, which finally become superimposed by a strong Drude contribution in the fully metallic state.

  3. Generalized Kondo lattice model and its spin-polaron realization by the projection method for cuprates

    NASA Astrophysics Data System (ADS)

    Valkov, V. V.; Dzebisashvili, D. M.; Barabanov, A. F.

    2017-05-01

    The spin-fermion model, which is an effective low-energy realization of the three-band Emery model after passing to the Wannier representation for the px and py orbitals of the subsystem of oxygen ions, reduces to the generalized Kondo lattice model. A specific feature of this model is the existence of spin-correlated hoppings of the current carriers between distant cells. Numerical calculations of the spectrum of spin-electron excitations highlight the important role of the long-range spin-correlated hoppings.

  4. Dead mouse hopping: Tyzzer's disease in spinifex hopping-mice (Notomys alexis).

    PubMed

    Stannard, Hayley J; Tulk, Melissa L; Old, Julie M

    2017-03-01

    Tyzzer's disease is caused by Clostridium piliformes and affects a wide range of domestic and wildlife species. Non-descript signs, if any, and a short incubation period make Tyzzer's disease difficult to diagnose and treat before death occurs. Here we describe an unexpected outbreak of Tyzzer's disease in a colony of native Australian spinifex hopping-mice (Notomys alexis). In this study captive hopping-mice were used in a nutrition trial (n=11), and others were housed in close proximity (n=4). During the nutrition trial, two hopping-mice exhibited signs of lethargy and diarrhoea, and were removed from the trial but died soon after. Other hopping-mice exhibited limited clinical signs of ill-health, prior to their death. In total four animals were found dead, and another seven were euthanised, to prevent a potential disease outbreak. Tyzzer's disease was confirmed post-mortem using histopathology silver stain to detect the bacilli-shaped bacteria (C. piliformes) in liver tissue of two hopping-mice. After Tyzzer's disease was confirmed enhanced infection control measures were implemented. Enhanced control measures included the use of metal containers for food and water, sick animals were fed and cleaned last, 5% sodium hypochlorite was used as the cleaning agent, stricter hand washing protocols and a change of gloves between feeding animals, and strict limits on persons entering the facility. Control measures for this disease should include euthanasia of any animals suspected to be infected, complete disinfection of all enclosures and associated equipment using sodium hypochlorite. Molecular methods could be employed to ensure complete removal of bacterial spores prior to new animals being moved into enclosures where affected animals were housed. Tyzzer's disease is a fast spreading disease which can cause detrimental effects to captive colonies and their environment. Captive colonies subjected to stress are at risk of Tyzzer's disease. Appropriate quarantine procedures, close montoring and quick action in response to signs of illness will ensure Tyzzer's disease outbreaks do not occur. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Photoluminescence and charge-transport characteristics of nano-columnar titanium dioxide films prepared by rf-sputtering on alumina templates

    NASA Astrophysics Data System (ADS)

    Kheirandish, E.; Hosseini, T.; Yavarishad, N.; King, S.; Kouklin, N.

    2018-02-01

    The current study presents the synthesis and characterization of poly-crystalline TiO2 thin-film prepared by rf-sputtering on top of a highly regimented nanoporous Au-coated Al2O3 substrate. The film’s physical and electronic properties were characterized via SEM, EDS, x-ray diffraction and RAMAN spectroscopy as well as temperature dependent photoluminescence (PL) and I-V measurements. The films feature a 1D, columnar-like structure and exhibit a medium strength, spectrally-broad light emission in the UV-visible range. PL emission shows a weak T-dependence and is attributed to interband electronic transitions and defect-assisted radiative recombinations. The charge transport is confirmed to be polaronic in nature with both thermally-assisted hopping and quantum mechanical tunneling regulating a charge flow within the columns in the intermediate temperature regime of ˜200-320 K. These results open a door to utilizing nano-textured substrates/scaffolds to produce electronic-grade anatase TiO2 by sputtering for advanced opto-electronic device applications.

  6. Visualizing long-term single-molecule dynamics in vivo by stochastic protein labeling.

    PubMed

    Liu, Hui; Dong, Peng; Ioannou, Maria S; Li, Li; Shea, Jamien; Pasolli, H Amalia; Grimm, Jonathan B; Rivlin, Patricia K; Lavis, Luke D; Koyama, Minoru; Liu, Zhe

    2018-01-09

    Our ability to unambiguously image and track individual molecules in live cells is limited by packing of multiple copies of labeled molecules within the resolution limit. Here we devise a universal genetic strategy to precisely control copy number of fluorescently labeled molecules in a cell. This system has a dynamic range of ∼10,000-fold, enabling sparse labeling of proteins expressed at different abundance levels. Combined with photostable labels, this system extends the duration of automated single-molecule tracking by two orders of magnitude. We demonstrate long-term imaging of synaptic vesicle dynamics in cultured neurons as well as in intact zebrafish. We found axon initial segment utilizes a "waterfall" mechanism gating synaptic vesicle transport polarity by promoting anterograde transport processivity. Long-time observation also reveals that transcription factor hops between clustered binding sites in spatially restricted subnuclear regions, suggesting that topological structures in the nucleus shape local gene activities by a sequestering mechanism. This strategy thus greatly expands the spatiotemporal length scales of live-cell single-molecule measurements, enabling new experiments to quantitatively understand complex control of molecular dynamics in vivo.

  7. Transport of oxygen ions in Er doped La2Mo2O9 oxide ion conductors: Correlation with microscopic length scales

    NASA Astrophysics Data System (ADS)

    Paul, T.; Ghosh, A.

    2018-01-01

    We report oxygen ion transport in La2-xErxMo2O9 (0.05 ≤ x ≤ 0.25) oxide ion conductors. We have measured conductivity and dielectric spectra at different temperatures in a wide frequency range. The mean square displacement and spatial extent of non-random sub-diffusive regions are estimated from the conductivity spectra and dielectric spectra, respectively, using linear response theory. The composition dependence of the conductivity is observed to be similar to that of the spatial extent of non-random sub-diffusive regions. The behavior of the composition dependence of the mean square displacement of oxygen ions is opposite to that of the conductivity. The attempt frequency estimated from the analysis of the electric modulus agrees well with that obtained from the Raman spectra analysis. The full Rietveld refinement of X-ray diffraction data of the samples is performed to estimate the distance between different oxygen lattice sites. The results obtained from such analysis confirm the ion hopping within the spatial extent of non-random sub-diffusive regions.

  8. Ba doped Fe3O4 nanocrystals: Magnetic field and temperature tuning dielectric and electrical transport

    NASA Astrophysics Data System (ADS)

    Dutta, Papia; Mandal, S. K.; Nath, A.

    2018-05-01

    Nanocrystalline BaFe2O4 has been prepared through low temperature pyrophoric reaction method. The structural, dielectric and electrical transport properties of BaFe2O4 are investigated in detail. AC electrical properties have been studied over the wide range of frequencies with applied dc magnetic fields and temperatures. The value of impedance is found to increase with increase in magnetic field attributing the magnetostriction property of the sample. The observed value of magneto-impedance and magnetodielectric is found to ∼32% and ∼33% at room temperature. Nyquist plots have been fitted using resistance-capacitor circuits at different magnetic fields and temperatures showing the dominant role of grain and grain boundaries of the sample. Metal-semiconductor transition ∼403 K has been discussed in terms of delocalized and localized charge carrier.We have estimated activation energy using Arrhenius relation indicating temperature dependent electrical relaxation process in the system. Ac conductivity follow a Jonscher’s single power law indicating the large and small polaronic hopping conduction mechanism in the system.

  9. Temperature dependence of the triplet diffusion and quenching rates in films of an Ir(ppy)3 -cored dendrimer

    NASA Astrophysics Data System (ADS)

    Ribierre, J. C.; Ruseckas, A.; Samuel, I. D. W.; Staton, S. V.; Burn, P. L.

    2008-02-01

    We study photoluminescence and triplet-triplet exciton annihilation in a neat film of a fac-tris(2-phenylpyridyl)iridium(III) [Ir(ppy)3] -cored dendrimer and in its blend with a 4,4' -bis( N -carbazolyl)biphenyl host for the temperature range of 77-300K . The nearest neighbor hopping rate of triplet excitons is found to increase by a factor of 2 with temperature between 150 and 300K and is temperature independent at lower temperature. The intermolecular quenching rate follows the Arrhenius law with an activation energy of 7meV , which can be explained by stronger dipole-dipole interactions with the donor molecule in the higher triplet substate. The results indicate that energy disorder has no significant effect on triplet transport and quenching in these materials.

  10. A statistically compiled test battery for feasible evaluation of knee function after rupture of the Anterior Cruciate Ligament – derived from long-term follow-up data

    PubMed Central

    2017-01-01

    Purpose Clinical test batteries for evaluation of knee function after injury to the Anterior Cruciate Ligament (ACL) should be valid and feasible, while reliably capturing the outcome of rehabilitation. There is currently a lack of consensus as to which of the many available assessment tools for knee function that should be included. The present aim was to use a statistical approach to investigate the contribution of frequently used tests to avoid redundancy, and filter them down to a proposed comprehensive and yet feasible test battery for long-term evaluation after ACL injury. Methods In total 48 outcome variables related to knee function, all potentially relevant for a long-term follow-up, were included from a cross-sectional study where 70 ACL-injured (17–28 years post injury) individuals were compared to 33 controls. Cluster analysis and logistic regression were used to group variables and identify an optimal test battery, from which a summarized estimator of knee function representing various functional aspects was derived. Results As expected, several variables were strongly correlated, and the variables also fell into logical clusters with higher within-correlation (max ρ = 0.61) than between clusters (max ρ = 0.19). An extracted test battery with just four variables assessing one-leg balance, isokinetic knee extension strength and hop performance (one-leg hop, side hop) were mathematically combined to an estimator of knee function, which acceptably classified ACL-injured individuals and controls. This estimator, derived from objective measures, correlated significantly with self-reported function, e.g. Lysholm score (ρ = 0.66; p<0.001). Conclusions The proposed test battery, based on a solid statistical approach, includes assessments which are all clinically feasible, while also covering complementary aspects of knee function. Similar test batteries could be determined for earlier phases of ACL rehabilitation or to enable longitudinal monitoring. Such developments, established on a well-grounded consensus of measurements, would facilitate comparisons of studies and enable evidence-based rehabilitation. PMID:28459885

  11. Theoretical studies of optics and charge transport in organic conducting oligomers and polymers: Rational design of improved transparent and conducting polymers

    NASA Astrophysics Data System (ADS)

    Hutchison, Geoffrey Rogers

    Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths, and show that well-known tilted and herringbone motifs in oligothiophenes are driven by electrostatic repulsion. Tilted stacks exhibit intrinsic charge-transfer rates smaller than cofacial stacks, but with lower packing energy. Given similar electron and hole bandwidths, a charge injection model explains substitution-modulated majority carrier changes in n- and p-type oligothiophene field-effect transistors.

  12. Temperature-driven evolution of critical points, interlayer coupling, and layer polarization in bilayer Mo S2

    NASA Astrophysics Data System (ADS)

    Du, Luojun; Zhang, Tingting; Liao, Mengzhou; Liu, Guibin; Wang, Shuopei; He, Rui; Ye, Zhipeng; Yu, Hua; Yang, Rong; Shi, Dongxia; Yao, Yugui; Zhang, Guangyu

    2018-04-01

    The recently emerging two-dimensional (2D) transition-metal dichalcogenides (TMDCs) have been a fertile ground for exploring abundant exotic physical properties. Critical points, the extrema or saddle points of electronic bands, are the cornerstone of condensed-matter physics and fundamentally determine the optical and transport phenomena of the TMDCs. However, for bilayer Mo S2 , a typical TMDC and the unprecedented electrically tunable venue for valleytronics, there has been a considerable controversy on its intrinsic electronic structure, especially for the conduction band-edge locations. Moreover, interlayer hopping and layer polarization in bilayer Mo S2 which play vital roles in valley-spintronic applications have remained experimentally elusive. Here, we report the experimental observation of intrinsic critical points locations, interlayer hopping, layer-spin polarization, and their evolution with temperature in bilayer Mo S2 by performing temperature-dependent photoluminescence. Our measurements confirm that the conduction-band minimum locates at the Kc instead of Qc, and the energy splitting between Qc and Kc redshifts with a descent of temperature. Furthermore, the interlayer hopping energy for holes and temperature-dependent layer polarization are quantitatively determined. Our observations are in good harmony with density-functional theory calculations.

  13. HOP family plays a major role in long-term acquired thermotolerance in Arabidopsis.

    PubMed

    Fernández-Bautista, Nuria; Fernández-Calvino, Lourdes; Muñoz, Alfonso; Toribio, René; Mock, Hans P; Castellano, M Mar

    2018-05-08

    HSP70-HSP90 organizing protein (HOP) is a family of cytosolic cochaperones whose molecular role in thermotolerance is quite unknown in eukaryotes and unexplored in plants. In this article, we describe that the three members of the AtHOP family display a different induction pattern under heat, being HOP3 highly regulated during the challenge and the attenuation period. Despite HOP3 is the most heat-regulated member, the analysis of the hop1 hop2 hop3 triple mutant demonstrates that the three HOP proteins act redundantly to promote long-term acquired thermotolerance in Arabidopsis. HOPs interact strongly with HSP90 and part of the bulk of HOPs shuttles from the cytoplasm to the nuclei and to cytoplasmic foci during the challenge. RNAseq analyses demonstrate that, although the expression of the Hsf targets is not generally affected, the transcriptional response to heat is drastically altered during the acclimation period in the hop1 hop2 hop3 triple mutant. This mutant also displays an unusual high accumulation of insoluble and ubiquitinated proteins under heat, which highlights the additional role of HOP in protein quality control. These data reveal that HOP family is involved in different aspects of the response to heat, affecting the plant capacity to acclimate to high temperatures for long periods. © 2018 John Wiley & Sons Ltd.

  14. Prediction of sand transport over immobile gravel from supply limited to capacity conditions

    USDA-ARS?s Scientific Manuscript database

    The prediction of the transport of sand in armored gravel reaches downstream of dams is complicated by variable bed conditions ranging from sand transported through gravel to sand in transport over buried gravel. Knowledge of the rate of sand transport in these conditions, however, is necessary for...

  15. Search behavior of arboreal insectivorous migrants at gulf coast stopover sites in spring

    USGS Publications Warehouse

    Chen, Chao-Chieh; Barrow, W.C.; Ouchley, K.; Hamilton, R.B.

    2011-01-01

    Search behavior of arboreal insectivorous migrants was studied at three stopover sites along the northern coast of the Gulf of Mexico during spring migrations, 1993–1995. We examined if search behavior was affected by phylogeny, or by environmental factors. A sequence of search movements (hop, flutter, or flight) in a foraging bout was recorded for each migrant encountered. Search rate, frequency, and distance of movements were calculated for each species. Search rate was positively correlated with proportion of hop, but negatively correlated to flight distance. Hop distance was positively correlated to tarsus length, as was flight distance to wing length for the 31 species of migrants. Cluster analysis indicated closely related species generally have similar foraging modes, which range from “sit-and-wait” of flycatchers to “widely foraging” of warblers. Migrants tended to use more hops in dense vegetation, but more flights in areas with sparse vegetation. Migrants also used more flights when foraging in mixed-species flocks and during periods of high migrant density. Logistic models indicated warblers were more influenced by environmental factors than vireos, possibly because warblers are near-perch searchers and more affected by these factors.

  16. Surface hopping with a manifold of electronic states. II. Application to the many-body Anderson-Holstein model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dou, Wenjie; Subotnik, Joseph E.; Nitzan, Abraham

    We investigate a simple surface hopping (SH) approach for modeling a single impurity level coupled to a single phonon and an electronic (metal) bath (i.e., the Anderson-Holstein model). The phonon degree of freedom is treated classically with motion along–and hops between–diabatic potential energy surfaces. The hopping rate is determined by the dynamics of the electronic bath (which are treated implicitly). For the case of one electronic bath, in the limit of small coupling to the bath, SH recovers phonon relaxation to thermal equilibrium and yields the correct impurity electron population (as compared with numerical renormalization group). For the case ofmore » out of equilibrium dynamics, SH current-voltage (I-V) curve is compared with the quantum master equation (QME) over a range of parameters, spanning the quantum region to the classical region. In the limit of large temperature, SH and QME agree. Furthermore, we can show that, in the limit of low temperature, the QME agrees with real-time path integral calculations. As such, the simple procedure described here should be useful in many other contexts.« less

  17. Modeling hole transport in wet and dry DNA.

    PubMed

    Pavanello, Michele; Adamowicz, Ludwik; Volobuyev, Maksym; Mennucci, Benedetta

    2010-04-08

    We present a DFT/classical molecular dynamics model of DNA charge conductivity. The model involves a temperature-driven, hole-hopping charge transfer and includes the time-dependent nonequilibrium interaction of DNA with its molecular environment. We validate our method against a variety of hole transport experiments. The method predicts a significant hole-transfer slowdown of approximately 35% from dry to wet DNA with and without electric field bias. In addition, in agreement with experiments, it also predicts an insulating behavior of (GC)(N) oligomers for 40 < N < 1000, depending on the experimental setup.

  18. Multi-Hop Teleportation of an Unknown Qubit State Based on W States

    NASA Astrophysics Data System (ADS)

    Zhou, Xiang-Zhen; Yu, Xu-Tao; Zhang, Zai-Chen

    2018-04-01

    Quantum teleportation is important in quantum communication networks. Considering that quantum state information is also transmitted between two distant nodes, intermediated nodes are employed and two multi-hop teleportation protocols based on W state are proposed. One is hop-by-hop teleportation protocol and the other is the improved multi-hop teleportation protocol with centralized unitary transformation. In hop-by-hop protocol, the transmitted quantum state needs to be recovered at every node on the route. In improved multi-hop teleportation protocol with centralized unitary transformation, intermediate nodes need not to recover the transmitted quantum state. Compared to the hop-by-hop protocol, the improved protocol can reduce the transmission delay and improve the transmission efficiency.

  19. Perceived bitterness character of beer in relation to hop variety and the impact of hop aroma.

    PubMed

    Oladokun, Olayide; James, Sue; Cowley, Trevor; Dehrmann, Frieda; Smart, Katherine; Hort, Joanne; Cook, David

    2017-09-01

    The impact of hop variety and hop aroma on perceived beer bitterness intensity and character was investigated using analytical and sensory methods. Beers made from malt extract were hopped with 3 distinctive hop varieties (Hersbrucker, East Kent Goldings, Zeus) to achieve equi-bitter levels. A trained sensory panel determined the bitterness character profile of each singly-hopped beer using a novel lexicon. Results showed different bitterness character profiles for each beer, with hop aroma also found to change the hop variety-derived bitterness character profiles of the beer. Rank-rating evaluations further showed the significant effect of hop aroma on selected key bitterness character attributes, by increasing perceived harsh and lingering bitterness, astringency, and bitterness intensity via cross-modal flavour interactions. This study advances understanding of the complexity of beer bitterness perception by demonstrating that hop variety selection and hop aroma both impact significantly on the perceived intensity and character of this key sensory attribute. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Origin of the Strain Sensitivity for an Organic Heptazole Thin-Film and Its Strain Gauge Application

    NASA Astrophysics Data System (ADS)

    Bae, Heesun; Jeon, Pyo Jin; Park, Ji Hoon; Lee, Kimoon

    2018-04-01

    The authors report on the origin of the strain sensitivity for an organic C26H16N2 (heptazole) thinfilm and its application for the detection of tensile strain. From the electrical characterization on the thin-film transistor adopting a heptazole channel, heptazole film exhibits p-channel conduction with a relatively low value of field-effect mobility (0.05 cm2/Vs), suggesting a hopping conduction behavior via hole carriers. By analyzing the strain and temperature dependences of the electrical conductivity, we reveal that the electrical conduction for a heptazole thin-film is dominated by the variable range hopping process with quite a large energy separation (224.9 meV) between the localized states under a relatively long attenuation length (10.46 Å). This indicates that a change in the inter-grain spacing that is much larger than the attenuation length is responsible for the reversible modification of electrical conductivity depending on strain for the heptazole film. By utilizing our heptazole thin-film both as a strain sensitive passive resistor and an active semiconducting channel layer, we can achieve a strain gauge device exhibiting reversible endurance for tensile strains up to 2.12%. Consequently, this study advances the understanding of the fundamental strain sensing mechanism in a heptazole thin-film toward finding a promise material with a strain gauge for applications as potential flexible devices and/or wearable electronics.

  1. Metal-Insulator Transition in Nanoparticle Solids: Insights from Kinetic Monte Carlo Simulations

    DOE PAGES

    Qu, Luman; Vörös, Márton; Zimanyi, Gergely T.

    2017-08-01

    Progress has been rapid in increasing the efficiency of energy conversion in nanoparticles. However, extraction of the photo-generated charge carriers remains challenging. Encouragingly, the charge mobility has been improved recently by driving nanoparticle (NP) films across the metal-insulator transition (MIT). To simulate MIT in NP films, we developed a hierarchical Kinetic Monte Carlo transport model. Electrons transfer between neighboring NPs via activated hopping when the NP energies differ by more than an overlap energy, but transfer by a non-activated quantum delocalization, if the NP energies are closer than the overlap energy. As the overlap energy increases, emerging percolating clusters supportmore » a metallic transport across the entire film. We simulated the evolution of the temperature-dependent electron mobility. We analyzed our data in terms of two candidate models of the MIT: (a) as a Quantum Critical Transition, signaled by an effective gap going to zero; and (b) as a Quantum Percolation Transition, where a sample-spanning metallic percolation path is formed as the fraction of the hopping bonds in the transport paths is going to zero. We found that the Quantum Percolation Transition theory provides a better description of the MIT. We also observed an anomalously low gap region next to the MIT. We discuss the relevance of our results in the light of recent experimental measurements.« less

  2. Metal-Insulator Transition in Nanoparticle Solids: Insights from Kinetic Monte Carlo Simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qu, Luman; Vörös, Márton; Zimanyi, Gergely T.

    Progress has been rapid in increasing the efficiency of energy conversion in nanoparticles. However, extraction of the photo-generated charge carriers remains challenging. Encouragingly, the charge mobility has been improved recently by driving nanoparticle (NP) films across the metal-insulator transition (MIT). To simulate MIT in NP films, we developed a hierarchical Kinetic Monte Carlo transport model. Electrons transfer between neighboring NPs via activated hopping when the NP energies differ by more than an overlap energy, but transfer by a non-activated quantum delocalization, if the NP energies are closer than the overlap energy. As the overlap energy increases, emerging percolating clusters supportmore » a metallic transport across the entire film. We simulated the evolution of the temperature-dependent electron mobility. We analyzed our data in terms of two candidate models of the MIT: (a) as a Quantum Critical Transition, signaled by an effective gap going to zero; and (b) as a Quantum Percolation Transition, where a sample-spanning metallic percolation path is formed as the fraction of the hopping bonds in the transport paths is going to zero. We found that the Quantum Percolation Transition theory provides a better description of the MIT. We also observed an anomalously low gap region next to the MIT. We discuss the relevance of our results in the light of recent experimental measurements.« less

  3. Trap densities and transport properties of pentacene metal-oxide-semiconductor transistors: II—Numerical modeling of dc characteristics

    NASA Astrophysics Data System (ADS)

    Basile, A. F.; Kyndiah, A.; Biscarini, F.; Fraboni, B.

    2014-06-01

    A numerical procedure to calculate the drain-current (ID) vs. gate-voltage (VG) characteristics from numerical solutions of the Poisson equation for organic Thin-Film Transistors (TFTs) is presented. Polaron transport is modeled as two-dimensional charge transport in a semiconductor having free-carrier density of states proportional to the density of molecules and traps with energy equal to the polaron-hopping barrier. The simulated ID-VG curves are proportional to the product of the density of free carriers, calculated as a function of VG, and the intrinsic mobility, assumed to be a constant independent of temperature. The presence of traps in the oxide was also taken into account in the model, which was applied to a TFT made with six monolayers of pentacene grown on an oxide substrate. The polaron-hopping barrier determines the temperature dependence of the simulated ID-VG curves, trapping in the oxide is responsible for current reduction at high bias and the slope of the characteristics near threshold is related to the metal-semiconductor work-function difference. The values of the model parameters yielding the best match between calculations and experiments are consistent with previous experimental results and theoretical predictions. Therefore, this model enables to extract both physical and technological properties of thin-film devices from the temperature-dependent dc characteristics.

  4. Theoretical proposal for a magnetic resonance study of charge transport in organic semiconductors

    NASA Astrophysics Data System (ADS)

    Mkhitaryan, Vagharsh

    Charge transport in disordered organic semiconductors occurs via carrier incoherent hops in a band of localized states. In the framework of continuous-time random walk the carrier on-site waiting time distribution (WTD) is one of the basic characteristics of diffusion. Besides, WTD is fundamentally related to the density of states (DOS) of localized states, which is a key feature of a material determining the optoelectric properties. However, reliable first-principle calculations of DOS in organic materials are not yet available and experimental characterization of DOS and WTD is desirable. We theoretically study the spin dynamics of hopping carriers and propose measurement schemes directly probing WTD, based on the zero-field spin relaxation and the primary (Hahn) spin echo. The proposed schemes are possible because, as we demonstrate, the long-time behavior of the zero-field relaxation and the primary echo is determined by WTD, both for the hyperfine coupling dominated and the spin-orbit coupling dominated spin dynamics. We also examine the dispersive charge transport, which is a non-Markovian sub-diffusive process characterized by non-stationarity. We show that the proposed schemes unambiguously capture the effects of non-stationarity, e.g., the aging behavior of random walks. This work was supported by the Department of Energy-Basic Energy Sciences under Contract No. DE-AC02-07CH11358.

  5. From "They" Science to "Our" Science: Hip Hop Epistemology in STEAM Education

    NASA Astrophysics Data System (ADS)

    Dolberry, Maurice E.

    Hip hop has moved from being considered a type of music into being understood as a culture in which a prominent type of music originates. Hip hop culture has a philosophy and epistemological constructs as well. This study analyzed those constructs to determine how conceptions of science factor in hip hop worldviews. Pedagogical models in culturally responsive teaching and Science, Technology, Engineering, Arts, and Mathematics (STEAM) education were also examined to discern their philosophical connections with hip hop culture. These connections were used to create two theoretical models. The first one, Hip Hop Science, described how scientific thought functions in hip hop culture. The second model, Hip Hop STEAM Pedagogy, proposes how hip hop culture can inform STEAM teaching practices. The study began by using Critical Race Theory to create a theoretical framework proposing how the two theoretical models could be derived from the philosophical and pedagogical concepts. Content analysis and narrative inquiry were used to analyze data collected from scholarly texts, hip hop songs, and interviews with hip hop-responsive educators. The data from these sources were used initially to assess the adequacy of the proposed theoretical framework, and subsequently to improve its viability. Four overlapping themes emerged from the data analyses, including hip hop-resistance to formal education; how hip hop culture informs pedagogical practice in hip hop-responsive classrooms; conceptions of knowledge and reality that shape how hip hoppers conduct scientific inquiry; and hip hop-based philosophies of effective teaching for hip hoppers as a marginalized cultural group. The findings indicate that there are unique connections between hip hop epistemology, sciencemindedness, and pedagogical practices in STEAM education. The revised theoretical framework clarified the nature of these connections, and supported claims from prior research that hip hop culture provides viable sites of engagement for STEAM educators. It concluded with suggestions for future research that further explicates hip hop epistemology and Hip Hop STEAM Pedagogy.

  6. Sensomics analysis of key bitter compounds in the hard resin of hops (Humulus lupulus L.) and their contribution to the bitter profile of Pilsner-type beer.

    PubMed

    Dresel, Michael; Dunkel, Andreas; Hofmann, Thomas

    2015-04-08

    Recent brewing trials indicated the occurrence of valuable bitter compounds in the hard resin fraction of hop. Aiming at the discovery of these compounds, hop's ε-resin was separated by means of a sensory guided fractionation approach and the key taste molecules were identified by means of UV/vis, LC-TOF-MS, and 1D/2D-NMR studies as well as synthetic experiments. Besides a series of literature known xanthohumol derivatives, multifidol glucosides, flavon-3-on glycosides, and p-coumaric acid esters, a total of 11 bitter tastants are reported for the first time, namely, 1",2"-dihydroxanthohumol F, 4'-hydroxytunicatachalcone, isoxantholupon, 1-methoxy-4-prenylphloroglucinol, dihydrocyclohumulohydrochinone, xanthohumols M, N, and P, and isoxanthohumols M, N, and P, respectively. Human sensory analysis revealed low bitter recognition threshold concentrations ranging from 5 (co-multifidol glucopyranoside) to 198 μmol/L (trans-p-coumaric acid ethyl ester) depending on their chemical structure. For the first time, LC-MS/MS quantitation of these taste compounds in Pilsner-type beer, followed by taste re-engineering experiments, revealed the additive contribution of iso-α-acids and the identified hard resin components to be truly necessary and sufficient for constructing the authentic bitter percept of beer. Finally, brewing trails using the ε-resin as the only hop source impressively demonstrated the possibility to produce beverages strongly enriched with prenylated hop flavonoids.

  7. Adaptations in single-leg hop biomechanics following anterior cruciate ligament reconstruction.

    PubMed

    Orishimo, Karl F; Kremenic, Ian J; Mullaney, Michael J; McHugh, Malachy P; Nicholas, Stephen J

    2010-11-01

    When a patient performs a clinically normal hop test based on distance, it cannot be assumed that the biomechanics are similar between limbs. The objective was to compare takeoff and landing biomechanics between legs in patients who have undergone anterior cruciate ligament reconstruction. Kinematics and ground reaction forces were recorded as 13 patients performed the single-leg hop on each leg. Distance hopped, joint range of motion, peak joint kinetics and the peak total extensor moment were compared between legs during both takeoff and landing. Average hop distance ratio (involved/noninvolved) was 93 ± 4%. Compared to the noninvolved side, knee motion during takeoff on the involved side was significantly reduced (P = 0.008). Peak moments and powers on the involved side were lower at the knee and higher at the ankle and hip compared with the noninvolved side (Side by Joint P = 0.011; P = 0.003, respectively). The peak total extensor moment was not different between legs (P = 0.305) despite a decrease in knee moment and increases in ankle and hip moments (Side by Joint P = 0.015). During landing, knee motion was reduced (P = 0.043), and peak power absorbed was decreased at the knee and hip and increased at the ankle on the involved side compared to the noninvolved side (P = 0.003). The compensations by other joints may indicate protective adaptations to avoid overloading the reconstructed knee.

  8. Mortality in American Hip-Hop and Rap Recording Artists, 1987-2014.

    PubMed

    Lawson, Carl J

    2015-12-01

    The deaths of American hip-hop and rap recording artists often receive considerable media attention. However, these artists' deaths have not been examined as a distinct group like the deaths of rock, classical, jazz, and pop music artists. This is a seminal epidemiological analysis on the deaths of an understudied group, American hip-hop and rap music recording artists. Media reports were analyzed of the deaths of American hip-hop and rap music recording artists that occurred from January 1, 1987 to December 31, 2014. The decedents' age, sex, race, cause of death, stage names, and city and state of death were recorded for analysis. The most commonly reported cause of death was homicide. The 280 deaths were categorized as homicide (55%), unintentional injury (13%), cardiovascular (7%), undetermined/undisclosed (7%), cancer (6%), other (5%), suicide (4%), and infectious disease (3%). The mean reported age at death was 30 yrs (range 15-75) and the median was 29 yrs; 97% were male and 92% were black. All but one of the homicides were committed with firearms. Homicide was the most commonly reported cause of death. Public health focus and guidance for hip-hop and rap recording artists should mirror that for African-American men and adolescent males ages 15-54 yrs, for whom the leading causes of death are homicide, unintentional injury, and heart disease. Given the preponderance of homicide deaths in this analysis, premature mortality reduction efforts should focus on violence prevention and conflict mitigation.

  9. The nature of excess electrons in anatase and rutile from hybrid DFT and RPA.

    PubMed

    Spreafico, Clelia; VandeVondele, Joost

    2014-12-21

    The behavior of excess electrons in undoped and defect free bulk anatase and rutile TiO2 has been investigated by state-of-the-art electronic structure methods including hybrid density functional theory (DFT) and the random phase approximation (RPA). Consistent with experiment, charge trapping and polaron formation is observed in both anatase and rutile. The difference in the anisotropic shape of the polarons is characterized, confirming for anatase the large polaron picture. For anatase, where polaron formation energies are small, charge trapping is observed also with standard hybrid functionals, provided the simulation cell is sufficiently large (864 atoms) to accommodate the lattice relaxation. Even though hybrid orbitals are required as a starting point for RPA in this system, the obtained polaron formation energies are relatively insensitive to the amount of Hartree-Fock exchange employed. The difference in trapping energy between rutile and anatase can be obtained accurately with both hybrid functionals and RPA. Computed activation energies for polaron hopping and delocalization clearly show that anatase and rutile might have different charge transport mechanisms. In rutile, only hopping is likely, whereas in anatase hopping and delocalization are competing. Delocalization will result in conduction-band-like and thus enhanced transport. Anisotropic conduction, in agreement with experimental data, is observed, and results from the tendency to delocalize in the [001] direction in rutile and the (001) plane in anatase. For future work, our calculations serve as a benchmark and suggest RPA on top on hybrid orbitals (PBE0 with 30% Hartree-Fock exchange), as a suitable method to study the rich chemistry and physics of TiO2.

  10. Cu1–xFexO: hopping transport and ferromagnetism

    PubMed Central

    Nasir, Mohd.; Islam, Rakibul; Ahmed, Md. A; Ayaz, Saniya; Kumar, Gautham; Kumar, Sunil; Prajapat, C. L.; Roussel, Frederick; Biring, Sajal

    2017-01-01

    Single phase, sol–gel prepared Cu1–xFexO (0 ≤ x ≤ 0.125) powders are characterized in terms of structural, electronic and magnetic properties. Using dielectric and magnetic studies we investigate the coupling of electron and spin. The electrical conductivities and activation energies are studied with increasing Fe content. Modelling of experimental conductivity data emphasizes a single hopping mechanism for all samples except x = 0.125, which have two activation energies. Hole doping is confirmed by confirming a majority Fe3+ substitution of Cu2+ in CuO from X-ray photoelectron spectroscopy studies (XPS). Such a substitution results in stabilized ferromagnetism. Fe substitution introduces variation in coercivity as an intrinsic magnetic property in Fe-doped CuO, and not as a secondary impurity phase. PMID:28989741

  11. Disorder-assisted quantum transport in suboptimal decoherence regimes

    PubMed Central

    Novo, Leonardo; Mohseni, Masoud; Omar, Yasser

    2016-01-01

    We investigate quantum transport in binary tree structures and in hypercubes for the disordered Frenkel-exciton Hamiltonian under pure dephasing noise. We compute the energy transport efficiency as a function of disorder and dephasing rates. We demonstrate that dephasing improves transport efficiency not only in the disordered case, but also in the ordered one. The maximal transport efficiency is obtained when the dephasing timescale matches the hopping timescale, which represent new examples of the Goldilocks principle at the quantum scale. Remarkably, we find that in weak dephasing regimes, away from optimal levels of environmental fluctuations, the average effect of increasing disorder is to improve the transport efficiency until an optimal value for disorder is reached. Our results suggest that rational design of the site energies statistical distributions could lead to better performances in transport systems at nanoscale when their natural environments are far from the optimal dephasing regime. PMID:26726133

  12. Unified computational model of transport in metal-insulating oxide-metal systems

    NASA Astrophysics Data System (ADS)

    Tierney, B. D.; Hjalmarson, H. P.; Jacobs-Gedrim, R. B.; Agarwal, Sapan; James, C. D.; Marinella, M. J.

    2018-04-01

    A unified physics-based model of electron transport in metal-insulator-metal (MIM) systems is presented. In this model, transport through metal-oxide interfaces occurs by electron tunneling between the metal electrodes and oxide defect states. Transport in the oxide bulk is dominated by hopping, modeled as a series of tunneling events that alter the electron occupancy of defect states. Electron transport in the oxide conduction band is treated by the drift-diffusion formalism and defect chemistry reactions link all the various transport mechanisms. It is shown that the current-limiting effect of the interface band offsets is a function of the defect vacancy concentration. These results provide insight into the underlying physical mechanisms of leakage currents in oxide-based capacitors and steady-state electron transport in resistive random access memory (ReRAM) MIM devices. Finally, an explanation of ReRAM bipolar switching behavior based on these results is proposed.

  13. Lifting the geometric frustration through a monoclinic distortion in “114” YBaFe{sub 4}O{sub 7.0}: Magnetism and transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duffort, V.; Sarkar, T.; Caignaert, V., E-mail: vincent.caignaert@ensicaen.fr

    2013-09-15

    The possibility to lift the geometric frustration in the “114” stoichiomeric tetragonal oxide YBaFe{sub 4}O{sub 7.0} by decreasing the temperature has been investigated using neutron and synchrotron powder diffraction techniques. Besides the structural transition from tetragonal to monoclinic symmetry that appears at T{sub S}=180 K, a magnetic transition is observed below T{sub N}=95 K. The latter corresponds to a lifting of the 3D geometric frustration toward an antiferromagnetic long range ordering, never observed to date in a cubic based “114’” oxide. The magnetic structure, characterized by the propagation vector k{sub 1}=(0,0,½), shows that one iron Fe2 exhibits a larger magneticmore » moment than the three others, suggesting a possible charge ordering according to the formula YBaFe{sup 3+}Fe{sub 3}{sup 2+}O{sub 7.0}. The magnetic M(T) and χ′(T) curves, in agreement with neutron data, confirm the structural and magnetic transitions and evidence the coexistence of residual magnetic frustration. Moreover, the transport measurements show a resistive transition from a thermally activated conduction mechanism to a variable range hopping mechanism at T{sub S}=180 K, with a significant increase of the dependence of the resistivity vs. temperature. Mössbauer spectroscopy clearly evidences a change in the electronic configuration of the iron framework at the structural transition as well as coexistence of several oxidation states. The role of barium underbonding in these transitions is discussed. - Graphical abstract: Atomic displacements at the tetragonal-monoclinic transition in YBaFe{sub 4}O{sub 7}. Display Omitted - Highlights: • The structural and magnetic phase transitions of YBaFe{sub 4}O{sub 7} were studied below room temperature. • The tetragonal to monoclinic transition, characterized by NPD and SXRD, was studied using mode crystallography approach. • Monoclinic distortion allows the lifting of the geometrical frustration on the iron sublattice, leading to AF order at T=95 K.« less

  14. Correlation between structural and transport properties of electron beam irradiated PrMnO3 compounds

    NASA Astrophysics Data System (ADS)

    Christopher, Benedict; Rao, Ashok; Nagaraja, B. S.; Shyam Prasad, K.; Okram, G. S.; Sanjeev, Ganesh; Petwal, Vikash Chandra; Verma, Vijay Pal; Dwivedi, Jishnu; Poornesh, P.

    2018-02-01

    The structural, electrical, magnetic, and thermal properties of electron beam (EB) irradiated PrMnO3 manganites were investigated in the present communication. X-ray diffraction data reveals that all samples are single phased with orthorhombic distorted structure (Pbnm). Furthermore, the diffracted data are analyzed in detail using Rietveld refinement technique. It is observed that the EB dosage feebly disturbs the MnO6 octahedra. The electrical resistivity of all the samples exhibits semiconducting behavior. Small polaron hopping model is conveniently employed to investigate the semiconducting nature of the pristine as well as EB irradiated samples. The Seebeck coefficient (S) of the pristine as well as the irradiated samples exhibit large positive values at lower temperatures, signifying holes as the dominant charge carriers. The analysis of Seebeck coefficient data confirms that the small polaron hopping mechanism assists the thermoelectric transport property in the high temperature region. The magnetic measurements confirm the existence of paramagnetic (PM) to ferromagnetic (FM) behavior for the pristine and irradiated samples. In the lower temperature regime, coexistence of FM clusters and AFM matrix is dominating. Thus, the complex magnetic behavior of the compound has been explained in terms of rearrangement of antiferromagnetically coupled ionic moments.

  15. Hopping transport in the space-charge region of p-n structures with InGaN/GaN QWs as a source of excess 1/f noise and efficiency droop in LEDs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bochkareva, N. I.; Ivanov, A. M.; Klochkov, A. V.

    2015-06-15

    It is shown that the emission efficiency and the 1/f noise level in light-emitting diodes with InGaN/GaN quantum wells correlate with how the differential resistance of a diode varies with increasing current. Analysis of the results shows that hopping transport via defect states across the n-type part of the space-charge region results in limitation of the current by the tunneling resistance at intermediate currents and shunting of the n-type barrier at high currents. The increase in the average number of tunneling electrons suppresses the 1/f current noise at intermediate currents. The strong growth in the density of current noise atmore » high currents, S{sub J} ∝ J{sup 3}, is attributed to a decrease in the average number of tunneling electrons as the n-type barrier decreases in height and width with increasing forward bias. The tunneling-recombination leakage current along extended defects grows faster than the tunneling injection current, which leads to emission efficiency droop.« less

  16. Effects of dopant induced defects on structural, multiferroic and optical properties of Bi1-x Pb x FeO3 (0 ≤ x ≤ 0.3) ceramics

    NASA Astrophysics Data System (ADS)

    Hassnain Jaffari, G.; Aftab, M.; Samad, Abdus; Mumtaz, Fiza; Awan, M. S.; Shah, S. Ismat

    2018-01-01

    Bi1-x Pb x FeO3 (0 ≤ x ≤ 0.3) has been characterized in detail with an aim to identify role of defect such as dopant, various vacancies, grain boundaries etc, and their effect on structural, optical and multiferroic properties. Structural analysis revealed that Pb substitution transforms the rhombohedral phase of BiFeO3 to the pseudocubic phase for x ≥ 0.15, consistently all vibrational Raman modes associated with the rhombohedral phase are found disappeared. Optical response revealed weakening of the d-d transitions with Pb addition indicating change in the Fe atoms environment consistent with the transition from non-centrosymmetric to the centrosymmetric structure. Transport and dielectric responses are explained in terms of hopping due to the presence of defects like oxygen vacancies and grain boundary conduction. In the high temperature regime, grain boundary conduction led to decrease in resistivity with the presence of a hump that is associated with hopping conduction. Extrinsic contributions in the transport properties correlate well with dielectric response. Magnetic and ferroelectric responses are also presented where role of oxygen vacancies defects has been clearly identified.

  17. Effects of adding a weekly eccentric-overload training session on strength and athletic performance in team-handball players.

    PubMed

    Sabido, Rafael; Hernández-Davó, Jose Luis; Botella, Javier; Navarro, Angel; Tous-Fajardo, Julio

    2017-06-01

    To investigate the influence of adding a weekly eccentric-overload training (EOT) session in several athletic performance's tests, 18 team-handball players were assigned either to an EOT (n = 11) or a Control (n = 7) group. Both groups continued to perform the same habitual strength training, but the EOT group added one session/week during a 7-week training programme consisting of four sets of eight repetitions for the bilateral half-squat and unilateral lunge exercises. The test battery included handball throwing velocity, maximum dynamic strength (1RM), countermovement jump (CMJ), 20 m sprint, triple hop for distance, and eccentric/concentric power in both the half-squat and lunge exercises. Data were analysed using magnitude-based inferences. Both groups improved their 1RM in the half squat, 20 m sprint time, and CMJ performance to a similar extent, but the EOT group showed a beneficial effect for both right [(42/58/0), possibly positive] and left [(99/1/0), very likely positive] triple hop for distance performance. In addition, the EOT group showed greater power output improvements in both eccentric and concentric phases of the half-squat (difference in percent of change ranging from 6.5% to 22.0%) and lunge exercises (difference in per cent of change ranging from 13.1% to 24.9%). Nevertheless, no group showed changes in handball throwing velocity. Selected variables related to team-handball performance (i.e. functional jumping performance, power output) can be improved by adding a single EOT session per week, highlighting the usefulness of this low-volume/high-intensity training when aiming at optimizing dynamic athletic performance.

  18. Large effects of A-site average cation size on the properties of the double perovskites Ba2-xSrxMnReO6:  A d5-d1 system

    NASA Astrophysics Data System (ADS)

    Popov, Guerman; Greenblatt, Martha; Croft, Mark

    2003-01-01

    Ba2-xSrxMnReO6 (x=0, 0.5, 1, 2) phases with a double-perovskite structure were prepared by solid-state techniques in evacuated sealed silica tubes. Mn2+ and Re6+ are virtually completely ordered on the B sites. The compounds are ferrimagnetic below 120 K. The maximum saturation moment was obtained for a compound with x=0.5 whose tolerance factor is closest to 1. The whole series of compounds, 0.0⩽x⩽2.0, exhibits semiconducting behavior with variable-range hopping type of conduction. Sr2MnReO6 has an unusually high coercive field (2.6 T at 5 K) and two transitions in the M-H loop. Ba2MnReO6 shows large positive magnetoresistance (14% at 80 K, 5 T) below 140 K, while the other compositions studied exhibit negative magnetoresistance in the temperature range measured.

  19. Electron localization mechanism in the normal state of high- T c superconductors

    NASA Astrophysics Data System (ADS)

    Yamani, Z.; Akhavan, M.

    The ceramic compounds Gd 1- xPr xCu 3O 7- y (GdPr-123) with 0.0 ≤ x≤1.0, were synthesized by standard solid state reaction technique. XRD analysis shows a predominantly single phase perovskite structure with the orthorhombic Pmmm symmetry. The samples have been examined for superconductivity by measuring electrical resistivity within the temperature range 10-300 K. These measurements show a suppression of superconductivity with increasing x. It is observed that the critical Pr concentration ( x cr) required to suppress superconductivity is about 0.45, the samples with x < 0.45 become superconducting and are metallic in their normal state, the samples with x ≥ 0.45 do not become superconducting and show a semiconducting behavior above 10 K. To interpret the normal state properties of the samples, the quantum percolation theory based on localized states is applied. A cross-over between variable-range hopping (VRH) and Coulomb gap (CG) mechanisms is observed as a result of decreasing the Pr content.

  20. Zinc chloride modified electronic transport and relaxation studies in barium-tellurite glasses

    NASA Astrophysics Data System (ADS)

    Dhankhar, Sunil; Kundu, R. S.; Rani, Sunita; Sharma, Preeti; Murugavel, S.; Punia, Rajesh; Kishore, N.

    2017-09-01

    The ac conductivity of halide based tellurium glasses having composition 70 TeO2-(30-x) BaO-x ZnCl2; x = 5, 10, 15, 20 and 25 has been investigated in the frequency range 10-1 Hz to 105Hz and in the temperature range 453 K to 553 K. The frequency and temperature dependent ac conductivity show mixed behaviour with increase in halide content and found to obey Jonscher's universal power law. The values of dc conductivity, crossover frequency and frequency exponent have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. For determining the conduction mechanism in studied glass system, frequency exponent has been analyzed by various theoretical models. In presently studied glasses, the ac conduction takes place via overlapping large polaron tunneling (OLPT). The values of activation energy for dc conduction (W) and the one associated with relaxation process ( E R) are found to increase with increase in x up to glass sample with x = 15 and thereafter it decrease with increase in zinc chloride content. DC conduction takes place via variable range hopping (VRH) as proposed by Mott with some modification suggested by Punia et al. The value of real part of modulus ( M') is observed to decrease with increase in temperature. The value of stretched exponent (β) obtained from fitting of M'' reveals the presence of non-Debye type of relaxation in presently studied glass samples. Scaling spectra of ac conductivity and values of electric modulus ( M' and M'') collapse into a single master curve for all the compositions and temperatures. The values of relaxation energy ( E R) for all the studied glass compositions are almost equal to W, suggesting that polarons have to overcome same barrier while relaxing and conducting. The conduction and relaxation processes in the studied glass samples are composition and temperature independent. [Figure not available: see fulltext.

  1. Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

    PubMed Central

    Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

    2010-01-01

    AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

  2. Energy management that generates terrain following versus apex-preserving hopping in man and machine.

    PubMed

    Kalveram, Karl Theodor; Haeufle, Daniel F B; Seyfarth, André; Grimmer, Sten

    2012-01-01

    While hopping, 12 subjects experienced a sudden step down of 5 or 10 cm. Results revealed that the hopping style was "terrain following". It means that the subjects pursued to keep the distance between maximum hopping height (apex) and ground profile constant. The spring-loaded inverse pendulum (SLIP) model, however, which is currently considered as template for stable legged locomotion would predict apex-preserving hopping, by which the absolute maximal hopping height is kept constant regardless of changes of the ground level. To get more insight into the physics of hopping, we outlined two concepts of energy management: "constant energy supply", by which in each bounce--regardless of perturbations--the same amount of mechanical energy is injected, and "lost energy supply", by which the mechanical energy that is going to be dissipated in the current cycle is assessed and replenished. When tested by simulations and on a robot testbed capable of hopping, constant energy supply generated stable and robust terrain following hopping, whereas lost energy supply led to something like apex-preserving hopping, which, however, lacks stability as well as robustness. Comparing simulated and machine hopping with human hopping suggests that constant energy supply has a good chance to be used by humans to generate hopping.

  3. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  4. Effect of a lateral step-up exercise protocol on quadriceps and lower extremity performance.

    PubMed

    Worrell, T W; Borchert, B; Erner, K; Fritz, J; Leerar, P

    1993-12-01

    Closed kinetic chain exercises have been promoted as more functional and more appropriate than open kinetic chain exercises. Limited research exists demonstrating the effect of closed kinetic chain exercise on quadriceps and lower extremity performance. The purpose of this study was to determine the effect of a lateral step-up exercise protocol on isokinetic quadriceps peak torque and the following lower extremity activities: 1) leg press, 2) maximal step-up repetitions with body weight plus 25%, 3) hop for distance, and 4) 6-m timed hop. Twenty subjects participated in a 4-week training period, and 18 subjects served as controls. For the experimental group, a repeated measure ANOVA comparing pretest and posttest values revealed significant improvements in the leg press (p < or = .05), step-ups (p < or = .05), hop for distance (p < or = .05), and hop for time (p < or = .05) and no significant increase in isokinetic quadriceps peak torque (p > or = .05). Over the course of the training period, weight used for the step-up exercise increased (p < or = .05), repetitions decreased (p < or = .05), and step-up work did not change (p > or = .05). For the control group, no significant change (p > or = .05) occurred in any variable. The inability of the isokinetic dynamometer to detect increases in quadriceps performance is important because the isokinetic values are frequently used as criteria for return to functional activities. We conclude that closed kinetic chain testing and exercise provide additional means to assess and rehabilitate the lower extremity.

  5. Vibronic dephasing model for coherent-to-incoherent crossover in DNA

    NASA Astrophysics Data System (ADS)

    Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

    2018-05-01

    In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

  6. Rethinking Pedagogy in Urban Spaces: Implementing Hip-Hop Pedagogy in the Urban Science Classroom

    ERIC Educational Resources Information Center

    Adjapong, Edmund S.; Emdin, Christopher

    2015-01-01

    A significant amount of research regarding Hip-Hop Based Education (HHBE) fails to provide insight on how to incorporate elements of Hip-Hop into daily teaching practices; rather Hip-Hop based educators focus mainly on incorporating Hip-Hop culture into curricula. This study explores the benefits of using two specific Hip-Hop pedagogical practices…

  7. Performance of highly connected photonic switching lossless metro-access optical networks

    NASA Astrophysics Data System (ADS)

    Martins, Indayara Bertoldi; Martins, Yara; Barbosa, Felipe Rudge

    2018-03-01

    The present work analyzes the performance of photonic switching networks, optical packet switching (OPS) and optical burst switching (OBS), in mesh topology of different sizes and configurations. The "lossless" photonic switching node is based on a semiconductor optical amplifier, demonstrated and validated with experimental results on optical power gain, noise figure, and spectral range. The network performance was evaluated through computer simulations based on parameters such as average number of hops, optical packet loss fraction, and optical transport delay (Am). The combination of these elements leads to a consistent account of performance, in terms of network traffic and packet delivery for OPS and OBS metropolitan networks. Results show that a combination of highly connected mesh topologies having an ingress e-buffer present high efficiency and throughput, with very low packet loss and low latency, ensuring fast data delivery to the final receiver.

  8. Surprises from the field: Novel aspects of aeolian saltation observed under natural turbulence

    NASA Astrophysics Data System (ADS)

    Martin, R. L.; Kok, J. F.; Chamecki, M.

    2015-12-01

    The mass flux of aeolian (wind-blown) sediment transport - critical for understanding earth and planetary geomorphology, dust generation, and soil stability - is difficult to predict. Recent work suggests that competing models for saltation (the characteristic hopping of aeolian sediment) fail because they do not adequately account for wind turbulence. To address this issue, we performed field deployments measuring high-frequency co-variations of aeolian saltation and near-surface winds at multiple sites under a range of conditions. Our observations yield several novel findings not currently captured by saltation models: (1) Saltation flux displays no significant lag relative to horizontal wind velocity; (2) Characteristic height of the saltation layer remains constant with changes in shear velocity; and (3) During saltation, the vertical profile of mean horizontal wind velocity is steeper than expected from the Reynolds stress. We examine how the interactions between saltation and turbulence in field settings could explain some of these surprising observations.

  9. Refractory materials for high-temperature thermoelectric energy conversion

    NASA Technical Reports Server (NTRS)

    Wood, C.; Emin, D.

    1983-01-01

    Theoretical work of two decades ago adequately explained the transport behavior and effectively guided the development of thermoelectric materials of high conversion efficiencies of conventional semiconductors (e.g., SiGe alloys). The more significant contributions involved the estimation of optimum doping concentrations, the reduction of thermal conductivity by solid solution doping and the development of a variety of materials with ZT approx. 1 in the temperature range 300 K to 1200 K. ZT approx. 1 is not a theoretical limitation although, experimentally, values in excess of one were not achieved. Work has continued with emphasis on higher temperature energy conversion. A number of promising materials have been discovered in which it appears that ZT 1 is realizable. These materials are divided into two classes: (1) the rare-earth chalcogenides which behave as itinerant highly-degenerate n-type semiconductors at room-temperature, and (2) the boron-rich borides, which exhibit p-type small-polaronic hopping conductivity.

  10. Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

    NASA Astrophysics Data System (ADS)

    Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

    2017-06-01

    The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

  11. Study of temperature dependent electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses

    NASA Astrophysics Data System (ADS)

    Deepika, Singh, Hukum

    2018-05-01

    This paper reports the variation in electrical properties of Se80-xTe20Bix (x = 0, 3, 6) glasses studied at different temperatures. The amorphous samples were prepared using the melt quenching method and the electrical measurements were performed on Keithley Electrometer in the temperature ranging from 298-373 K. The I-V characteristics were noted at different temperatures and the data obtained was analysed to get dc electrical conductivity and activation energy of electrical conduction. Further, Mott's 3D VRH model has been applied to obtain density of states, hopping range and hopping energy at different temperatures. The obtained results show that dc electrical conductivity increases with increase in Bi composition in Se-Te system. These compositions also show close agreement to Mott's VRH model.

  12. Intrinsic SiO{sub x}-based unipolar resistive switching memory. II. Thermal effects on charge transport and characterization of multilevel programing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Yao-Feng, E-mail: yfchang@utexas.edu; Chen, Ying-Chen; Chen, Yen-Ting

    2014-07-28

    Multilevel programing and charge transport characteristics of intrinsic SiO{sub x}-based resistive switching memory are investigated using TaN/SiO{sub x}/n{sup ++}Si (MIS) and TiW/SiO{sub x}/TiW (MIM) device structures. Current transport characteristics of high- and low-resistance states (HRS and LRS) are studied in both device structures during multilevel operation. Analysis of device thermal response demonstrates that the effective electron energy barrier is strongly dependent on the resistance of the programed state, with estimates of 0.1 eV in the LRS and 0.6 eV in the HRS. Linear data fitting and conductance analyses indicate Poole-Frenkel emission or hopping conductance in the low-voltage region, whereas Fowler-Nordheim (F-N) ormore » trap-assisted tunneling (TAT) is indicated at moderate voltage. Characterizations using hopping transport lead to hopping distance estimates of ∼1 nm in the LRS for both device structures. Relative permittivity values (ε{sub r}) were extracted using the Poole-Frenkel formulism and estimates of local filament temperature, where ε{sub r} values were ∼80 in the LRS and ∼4 in the HRS, suggesting a strongly polarized medium in the LRS. The onset of F-N tunneling or TAT corresponds to an observed “overshoot” in the I-V response with an estimated threshold of 1.6 ± 0.2 V, in good agreement with reported electro-luminescence results for LRS devices. Resistive switching is discussed in terms of electrochemical reactions between common SiO{sub 2} defects, and specific defect energy levels are assigned to the dominant transitions in the I-V response. The overshoot response in the LRS is consistent with TAT through either the Eγ' oxygen vacancy or the hydrogen bridge defect, both of which are reported to have an effective bandgap of 1.7 eV. The SET threshold at ∼2.5 V is modeled as hydrogen release from the (Si-H){sub 2} defect to generate the hydrogen bridge, and the RESET transition is modeled as an electrochemical reaction that re-forms (SiH){sub 2}. The results provide further insights into charge transport and help identify potential switching mechanisms in SiO{sub x}-based unipolar resistive switching memory.« less

  13. Organogenic nodule formation in hop: a tool to study morphogenesis in plants with biotechnological and medicinal applications.

    PubMed

    Fortes, Ana M; Santos, Filipa; Pais, Maria S

    2010-01-01

    The usage of Humulus lupulus for brewing increased the demand for high-quality plant material. Simultaneously, hop has been used in traditional medicine and recently recognized with anticancer and anti-infective properties. Tissue culture techniques have been reported for a wide range of species, and open the prospect for propagation of disease-free, genetically uniform and massive amounts of plants in vitro. Moreover, the development of large-scale culture methods using bioreactors enables the industrial production of secondary metabolites. Reliable and efficient tissue culture protocol for shoot regeneration through organogenic nodule formation was established for hop. The present review describes the histological, and biochemical changes occurring during this morphogenic process, together with an analysis of transcriptional and metabolic profiles. We also discuss the existence of common molecular factors among three different morphogenic processes: organogenic nodules and somatic embryogenesis, which strictly speaking depend exclusively on intrinsic developmental reprogramming, and legume nitrogen-fixing root nodules, which arises in response to symbiosis. The review of the key factors that participate in hop nodule organogenesis and the comparison with other morphogenic processes may have merit as a study presenting recent advances in complex molecular networks occurring during morphogenesis and together, these provide a rich framework for biotechnology applications.

  14. AC conduction of Ba1-xCaxTiO3 and BZT-BCTx

    NASA Astrophysics Data System (ADS)

    Khien, Nguyen Van; Huy, Than Trong; Hong, Le Van

    2018-03-01

    Ba1-xCaxTiO3 (BCTx), (x =0.0-0.3) and Ba0.8Zr0.2TiO3-Ba1-xCaxTiO3 (BZT-BCTx), (x=0.15-0.35) were fabricated by the solid state reaction method. Phase structure of the material samples was identified by X-ray diffraction. The impedance versus frequency in a range of 100 Hz to 2.5 MHz was measured for all the samples at room temperature. AC conductivity versus frequency of the BCTx and BZT-BCTx was evaluated and fitted by using the extended Universal Dielectric Response (UDR) equations. The fitting results were discussed in detail and shown that the localized reorientation polarization-based mechanism is most contributed in BCTx matrial samples. Basically both two the hopping polaron and polarization mechanisms play roles in BZT-BCTx material samples. In contrary the short-range polaron hopping is dominated in ac conductivity of BZT-BCTx material samples in low frequency range.

  15. Suppression of Plant Immune Responses by the Pseudomonas savastanoi pv. savastanoi NCPPB 3335 Type III Effector Tyrosine Phosphatases HopAO1 and HopAO2

    PubMed Central

    Castañeda-Ojeda, María Pilar; Moreno-Pérez, Alba; Ramos, Cayo; López-Solanilla, Emilia

    2017-01-01

    The effector repertoire of the olive pathogen P. savastanoi pv. savastanoi NCPPB 3335 includes two members of the HopAO effector family, one of the most diverse T3E families of the P. syringae complex. The study described here explores the phylogeny of these dissimilar members, HopAO1 and HopAO2, among the complex and reveals their activities as immune defense suppressors. Although HopAO1 is predominantly encoded by phylogroup 3 strains isolated from woody organs of woody hosts, both HopAO1 and HopAO2 are phylogenetically clustered according to the woody/herbaceous nature of their host of isolation, suggesting host specialization of the HopAO family across the P. syringae complex. HopAO1 and HopAO2 translocate into plant cells and show hrpL-dependent expression, which allows their classification as actively deployed type III effectors. Our data also show that HopAO1 and HopAO2 possess phosphatase activity, a hallmark of the members of this family. Both of them exert an inhibitory effect on early plant defense responses, such as ROS production and callose deposition, and are able to suppress ETI responses induced by the effectorless polymutant of P. syringae pv. tomato DC3000 (DC3000D28E) in Nicotiana. Moreover, we demonstrate that a ΔhopAO1 mutant of P. savastanoi NCPBB 3335 exhibits a reduced fitness and virulence in olive plants, which supports the relevance of this effector during the interaction of this strain with its host plants. This work contributes to the field with the first report regarding functional analysis of HopAO homologs encoded by P. syringae or P. savastanoi strains isolated from woody hosts. PMID:28529516

  16. Respiratory disease associated with occupational inhalation to hop (Humulus lupulus) during harvest and processing.

    PubMed

    Reeb-Whitaker, Carolyn K; Bonauto, David K

    2014-11-01

    There is little published evidence for occupational respiratory disease caused by hop dust inhalation. In the United States, hops are commercially produced in the Pacific Northwest region. To describe occupational respiratory disease in hop workers. Washington State workers' compensation claims filed by hop workers for respiratory disease were systematically identified and reviewed. Incidence rates of respiratory disease in hop workers were compared with rates in field vegetable crop farm workers. Fifty-seven cases of respiratory disease associated with hop dust inhalation were reported from 1995 to 2011. Most cases (61%) were diagnosed by the attending health care practitioner as having work-related asthma. Seven percent of cases were diagnosed as chronic obstructive pulmonary disease, and the remaining cases were diagnosed as allergic respiratory disorders (eg, allergic rhinitis) or asthma-associated symptoms (eg, dyspnea). Cases were associated with hop harvesting, secondary hop processing, and indirect exposure. The incidence rate of respiratory disease in hop workers was 15 cases per 10,000 full-time workers, which was 30 times greater than the incidence rate for field vegetable crop workers. A strong temporal association between hop dust exposure and respiratory symptoms and a clear association between an increase in hop dust concentrations and the clinical onset of symptoms were apparent in 3 cases. Occupational exposure to hop dust is associated with respiratory disease. Respiratory disease rates were higher in hop workers than in a comparison group of agricultural workers. Additional research is needed before hop dust can be confirmed as a causative agent for occupational asthma. Copyright © 2014 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  17. Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film

    NASA Astrophysics Data System (ADS)

    Das, Amit Kumar; Meikap, Ajit Kumar

    2017-12-01

    In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.

  18. Current-voltage hysteresis and dielectric properties of PVA coated MWCNT film

    NASA Astrophysics Data System (ADS)

    Das, Amit Kumar; Meikap, Ajit Kumar

    2018-06-01

    In this work, we have prepared polyvinyl alcohol (PVA) coated multiwall carbon nanotube (MWCNT) film by an in situ chemical oxidative preparation technique. The thermogravimetric analysis clearly explains the thermal degradation of pure polymer and polymer nanocomposite film. We have studied the AC electrical transport properties and current-voltage (I-V) characteristic of PVA-MWCNT composites within the temperature range 300 ≤ T ≤ 423 K and frequency range 150 Hz ≤ f ≤ 2 MHz. It is observed that the dielectric constant of the composite film increases significantly. The frequency variation of AC conductivity follows the power law ( ωS ) and a sharp transition from small polaron tunneling to correlated barrier hopping model is found. The imaginary part of electric modulus shows non-Debye type asymmetric behaviour. The impedance spectroscopy shows the negative temperature coefficient of resistance of the composite film. Nyquist plot of the composite film at different temperatures is established from impedance measurement. The current-voltage characteristic (under ± 20 V) shows hysteresis behaviour and field dependent resistance. We simulate the experimentally observed current density-electric field data with the established theory.

  19. Clinical Effects of Dry Needling Among Asymptomatic Individuals With Hamstring Tightness: A Randomized Controlled Trial.

    PubMed

    Geist, Kathleen; Bradley, Claire; Hofman, Alan; Koester, Rob; Roche, Fenella; Shields, Annalise; Frierson, Elizabeth; Rossi, Ainsley; Johanson, Marie

    2017-11-01

    Randomized controlled trial. The aim of this study was to determine the effects of dry needling on hamstring extensibility and functional performance tests among asymptomatic individuals with hamstring muscle tightness. Dry needling has been shown to increase range of motion in the upper quarter and may have similar effects in the lower quarter. 27 subjects with hamstring extensibility deficits were randomly assigned to side of treatment (dominant or nondominant) and group (blunt needling or dry needling). The first session included measurement of hamstring extensibility and performance on 4 unilateral hop tests, instruction in home hamstring stretching exercises and needling distal to the ischial tuberosity and midbellies of the medial and lateral hamstrings. A second session, 3-5 days following the first session, included outcome measures and a second needling intervention, and a third session, 4-6 weeks following the first session, included outcome measures only. A 2 × 3 × 2 ANOVA was used to statistically analyze the data. Hamstring extensibility showed a significant side × time interaction (P < .05). The single hop for distance, timed 6-meter hop, and the crossover hop test had a significant main effect of time (P < .05). The triple hop for distance showed a significant side × time × group interaction (P < .05). It does not appear dry needling results in increased extensibility beyond that of stretching alone in asymptomatic individuals. Our study findings suggest that dry needling may improve certain dimensions of functional performance, although no clear conclusion can be made. Intervention, level 2b.

  20. Charge transport in nanostructured materials: Implementation and verification of constrained density functional theory

    DOE PAGES

    Goldey, Matthew B.; Brawand, Nicholas P.; Voros, Marton; ...

    2017-04-20

    The in silico design of novel complex materials for energy conversion requires accurate, ab initio simulation of charge transport. In this work, we present an implementation of constrained density functional theory (CDFT) for the calculation of parameters for charge transport in the hopping regime. We verify our implementation against literature results for molecular systems, and we discuss the dependence of results on numerical parameters and the choice of localization potentials. In addition, we compare CDFT results with those of other commonly used methods for simulating charge transport between nanoscale building blocks. As a result, we show that some of thesemore » methods give unphysical results for thermally disordered configurations, while CDFT proves to be a viable and robust approach.« less

  1. Organogenic nodule development in hop (Humulus lupulus L.): Transcript and metabolic responses

    PubMed Central

    Fortes, Ana M; Santos, Filipa; Choi, Young H; Silva, Marta S; Figueiredo, Andreia; Sousa, Lisete; Pessoa, Fernando; Santos, Bartolomeu A; Sebastiana, Mónica; Palme, Klaus; Malhó, Rui; Verpoorte, Rob; Pais, Maria S

    2008-01-01

    Background Hop (Humulus lupulus L.) is an economically important plant forming organogenic nodules which can be used for genetic transformation and micropropagation. We are interested in the mechanisms underlying reprogramming of cells through stress and hormone treatments. Results An integrated molecular and metabolomic approach was used to investigate global gene expression and metabolic responses during development of hop's organogenic nodules. Transcript profiling using a 3,324-cDNA clone array revealed differential regulation of 133 unigenes, classified into 11 functional categories. Several pathways seem to be determinant in organogenic nodule formation, namely defense and stress response, sugar and lipid metabolism, synthesis of secondary metabolites and hormone signaling. Metabolic profiling using 1H NMR spectroscopy associated to two-dimensional techniques showed the importance of metabolites related to oxidative stress response, lipid and sugar metabolism and secondary metabolism in organogenic nodule formation. Conclusion The expression profile of genes pivotal for energy metabolism, together with metabolites profile, suggested that these morphogenic structures gain energy through a heterotrophic, transport-dependent and sugar-degrading anaerobic metabolism. Polyamines and auxins are likely to be involved in the regulation of expression of many genes related to organogenic nodule formation. These results represent substantial progress toward a better understanding of this complex developmental program and reveal novel information regarding morphogenesis in plants. PMID:18823540

  2. A Geographical Heuristic Routing Protocol for VANETs

    PubMed Central

    Urquiza-Aguiar, Luis; Tripp-Barba, Carolina; Aguilar Igartua, Mónica

    2016-01-01

    Vehicular ad hoc networks (VANETs) leverage the communication system of Intelligent Transportation Systems (ITS). Recently, Delay-Tolerant Network (DTN) routing protocols have increased their popularity among the research community for being used in non-safety VANET applications and services like traffic reporting. Vehicular DTN protocols use geographical and local information to make forwarding decisions. However, current proposals only consider the selection of the best candidate based on a local-search. In this paper, we propose a generic Geographical Heuristic Routing (GHR) protocol that can be applied to any DTN geographical routing protocol that makes forwarding decisions hop by hop. GHR includes in its operation adaptations simulated annealing and Tabu-search meta-heuristics, which have largely been used to improve local-search results in discrete optimization. We include a complete performance evaluation of GHR in a multi-hop VANET simulation scenario for a reporting service. Our study analyzes all of the meaningful configurations of GHR and offers a statistical analysis of our findings by means of MANOVA tests. Our results indicate that the use of a Tabu list contributes to improving the packet delivery ratio by around 5% to 10%. Moreover, if Tabu is used, then the simulated annealing routing strategy gets a better performance than the selection of the best node used with carry and forwarding (default operation). PMID:27669254

  3. Correlation between cation conduction and ionic morphology in a PEO-based single ion conductor

    NASA Astrophysics Data System (ADS)

    Lin, Kan-Ju; Maranas, Janna

    2011-03-01

    We use molecular dynamics simulation to study ion transport and backbone mobility of a PEO-based single ion conductor. Ion mobility depends on the chemical structure and the local environment of the ions, which consequently impact ionic conductivity. We characterize the aggregation state of the ions, and assess the role of ion complexes in ionomer dynamics. In addition to solvated cations and pairs, higher order ion clusters are found. Most of the ion clusters are in string-like structure and cross-link two or more different ionomer chains through ionic binding. Ionic crosslinks decrease mobility at the ionic co-monomer; hence the mobility of the adjacent PEO segment is influenced. Na ions show slow mobility when they are inside large clusters. The hopping timescale for Na varies from 20 ns to 200. A correlation is found between Na mobility and the number of hops from one coordination site to another. Besides ether oxygens, Na ions in the ionomer also use the anion and the edge of the cluster as hopping sites. The string-like structure of clusters provide less stable sites at the two ends thus ions are more mobile in those regions. We observed Grotthus like mechanism in our ionomer, in which the positive charge migrates within the string-like cluster without the cations actually moving.

  4. A Geographical Heuristic Routing Protocol for VANETs.

    PubMed

    Urquiza-Aguiar, Luis; Tripp-Barba, Carolina; Aguilar Igartua, Mónica

    2016-09-23

    Vehicular ad hoc networks (VANETs) leverage the communication system of Intelligent Transportation Systems (ITS). Recently, Delay-Tolerant Network (DTN) routing protocols have increased their popularity among the research community for being used in non-safety VANET applications and services like traffic reporting. Vehicular DTN protocols use geographical and local information to make forwarding decisions. However, current proposals only consider the selection of the best candidate based on a local-search. In this paper, we propose a generic Geographical Heuristic Routing (GHR) protocol that can be applied to any DTN geographical routing protocol that makes forwarding decisions hop by hop. GHR includes in its operation adaptations simulated annealing and Tabu-search meta-heuristics, which have largely been used to improve local-search results in discrete optimization. We include a complete performance evaluation of GHR in a multi-hop VANET simulation scenario for a reporting service. Our study analyzes all of the meaningful configurations of GHR and offers a statistical analysis of our findings by means of MANOVA tests. Our results indicate that the use of a Tabu list contributes to improving the packet delivery ratio by around 5% to 10%. Moreover, if Tabu is used, then the simulated annealing routing strategy gets a better performance than the selection of the best node used with carry and forwarding (default operation).

  5. Dielectric Characterization of a Nonlinear Optical Material

    PubMed Central

    Lunkenheimer, P.; Krohns, S.; Gemander, F.; Schmahl, W. W.; Loidl, A.

    2014-01-01

    Batisite was reported to be a nonlinear optical material showing second harmonic generation. Using dielectric spectroscopy and polarization measurements, we provide a thorough investigation of the dielectric and charge-transport properties of this material. Batisite shows the typical characteristics of a linear lossy dielectric. No evidence for ferro- or antiferroelectric polarization is found. As the second-harmonic generation observed in batisite points to a non-centrosymmetric structure, this material is piezoelectric, but most likely not ferroelectric. In addition, we found evidence for hopping charge transport of localized charge carriers and a relaxational process at low temperatures. PMID:25109553

  6. Perpendicular transport in superlattice bipolar transistors (SBT)

    NASA Astrophysics Data System (ADS)

    Sibille, A.; Palmier, J. F.; Minot, C.; Harmand, J. C.; Dubon-Chevallier, C.

    Diffusion-limited electron transport in superlattices is studied by gain measurements on heterojunction bipolar transistors with a {GaAs}/{GaAlAs} superlattice base. In the case of thin barriers, Bloch conduction is observed, while hopping between localized levels prevails for large barriers. A transition occurs between these two regimes, localization being achieved when the energy broadening induced by the electron-phonon coupling added to the disorder due to imperfect growth is of the order of the miniband width. This interpretation is supported by temperature dependence measurements of the perpendicular mobilities in relation with theoretical calculations of these mobilities.

  7. Electrical transport properties of nanoplates shaped tungsten oxide embedded poly(vinyl-alcohol) film

    NASA Astrophysics Data System (ADS)

    Das, Amit Kumar; Chatterjee, Piyali; Meikap, Ajit Kumar

    2018-04-01

    Tungsten oxide (WO3) nanoplates have been synthesized via hydrothermal method. The average crystallite size of the nanoplates is 28.9 ± 0.5 nm. The direct and indirect band gap of WO3 is observed. The AC conductivity of PVA-WO3 composite film has been observed and carrier transport mechanism follows correlated barrier hopping model. The maximum barrier height of the composite film is 0.1 eV. The electric modulus reflects the non-Debye type behaviour of relaxation time which is simulated by Kohlrausch-Willims-Watts (KWW) function.

  8. Trade-off Analysis of Underwater Acoustic Sensor Networks

    NASA Astrophysics Data System (ADS)

    Tuna, G.; Das, R.

    2017-09-01

    In the last couple of decades, Underwater Acoustic Sensor Networks (UASNs) were started to be used for various commercial and non-commercial purposes. However, in underwater environments, there are some specific inherent constraints, such as high bit error rate, variable and large propagation delay, limited bandwidth capacity, and short-range communications, which severely degrade the performance of UASNs and limit the lifetime of underwater sensor nodes as well. Therefore, proving reliability of UASN applications poses a challenge. In this study, we try to balance energy consumption of underwater acoustic sensor networks and minimize end-to-end delay using an efficient node placement strategy. Our simulation results reveal that if the number of hops is reduced, energy consumption can be reduced. However, this increases end-to-end delay. Hence, application-specific requirements must be taken into consideration when determining a strategy for node deployment.

  9. Piezo activated mode tracking system for widely tunable mode-hop-free external cavity mid-IR semiconductor lasers

    NASA Technical Reports Server (NTRS)

    Tittel, Frank K. (Inventor); Curl, Robert F. (Inventor); Wysocki, Gerard (Inventor)

    2010-01-01

    A widely tunable, mode-hop-free semiconductor laser operating in the mid-IR comprises a QCL laser chip having an effective QCL cavity length, a diffraction grating defining a grating angle and an external cavity length with respect to said chip, and means for controlling the QCL cavity length, the external cavity length, and the grating angle. The laser of claim 1 wherein said chip may be tuned over a range of frequencies even in the absence of an anti-reflective coating. The diffraction grating is controllably pivotable and translatable relative to said chip and the effective QCL cavity length can be adjusted by varying the injection current to the chip. The laser can be used for high resolution spectroscopic applications and multi species trace-gas detection. Mode-hopping is avoided by controlling the effective QCL cavity length, the external cavity length, and the grating angle so as to replicate a virtual pivot point.

  10. Key features of hip hop dance motions affect evaluation by judges.

    PubMed

    Sato, Nahoko; Nunome, Hiroyuki; Ikegami, Yasuo

    2014-06-01

    The evaluation of hip hop dancers presently lacks clearly defined criteria and is often dependent on the subjective impressions of judges. Our study objective was to extract hidden motion characteristics that could potentially distinguish the skill levels of hip hop dancers and to examine the relationship between performance kinematics and judging scores. Eleven expert, six nonexpert, and nine novice dancers participated in the study, where each performed the "wave" motion as an experimental task. The movements of their upper extremities were captured by a motion capture system, and several kinematic parameters including the propagation velocity of the wave were calculated. Twelve judges evaluated the performances of the dancers, and we compared the kinematic parameters of the three groups and examined the relationship between the judging scores and the kinematic parameters. We found the coefficient of variation of the propagation velocity to be significantly different among the groups (P < .01) and highly correlated with the judging scores (r = -0.800, P < .01). This revealed that the variation of propagation velocity was the most dominant variable representing the skill level of the dancers and that the smooth propagation of the wave was most closely related to the evaluation by judges.

  11. Charge carrier coherence and Hall effect in organic semiconductors.

    PubMed

    Yi, H T; Gartstein, Y N; Podzorov, V

    2016-03-30

    Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force acting on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor.

  12. Propulsion of the Water Flea, Daphnia magna: Experiments, Scaling, and Modelling

    NASA Astrophysics Data System (ADS)

    Skipper, A. N.; Murphy, D.; Webster, D. R.; Yen, J.

    2016-02-01

    The freshwater crustacean Daphnia magna is a widely studied zooplankton in relation to food webs, predator-prey interactions, and other biological/ecological considerations; however, their locomotion is poorly quantified and understood. These water fleas utilize a hop-and-sink mechanism that consists of making quick, impulsive jumps by beating their antennae to propel themselves forward ( 1 body length). The animals then sink for a period, during which they stretch out their antennae to increase drag and thereby reduce their sinking velocity. Time-resolved three-dimensional flow fields surrounding the animals were quantified with a unique infrared tomographic particle image velocity (tomo-PIV) system. Three-dimensional kinematics data were also extracted from the image sequences. In the current work, we compared body kinematics and flow disturbance among organisms of size in the range of 1.3 to 2.8 mm. The stroke cycle averaged 150 ms in duration, ranging from 100 to 180 ms; this period is generally evenly split between the power and recovery strokes. The range of peak hop velocity was 27.2 to 32.5 mm/s, and peak acceleration was in the range of 0.68 to 1.8 m/s2. The results showed a distinct relationship between peak hop speed (Vmax 14 BL/s) and body size; these data collapsed onto a single time-record curve during the power stroke when properly non-dimensionalized. The fluid flow induced by each antennae consisted of a viscous vortex ring that demonstrated a slow decay in the wake. The strength, size, and decay of the induced viscous vortex rings were compared as a function of organism size. Finally, the viscous vortex rings were analyzed in the context of a double Stokeslet model that consisted of two impulsively applied point forces separated by the animal width.

  13. NMR and transport measurements of copper chalcogenide and clathrate compounds

    NASA Astrophysics Data System (ADS)

    Sirusi Arvij, Ali

    Due to limited sources of fossil fuels worldwide and a large percentage wasted as heat energy, searching for efficient thermoelectric materials to convert heat to electricity has gained a great deal of attention. Most of the attempts are focused on materials with substantially lower lattice thermal conductivity and narrow band gaps. Among them, inorganic clathrates and copper-based chalcogenides possess intrinsic low thermal conductivity which makes them promising thermoelectrics. In this work, nuclear magnetic resonance (NMR), transport, and magnetic measurements were performed on clathrates and copper-based chalcogenides to investigate their vibrational and electronic charge carrier properties, as well as the unknown structures of Cu2Se and Cu 2Te at low temperatures, and the effect of rattling of guest atoms in the clathrates. The NMR results in Ba8Ga16Ge30 indicate a pseudogap in the Ga electronic density of states, superposed upon a surprisingly large Ba contribution to the conduction band. Meanwhile, the phonon contributions to the Ga relaxation rates are large and increase more rapidly with temperature than typical semiconductors due to enhanced anharmonicity of the propagative phonon modes over a wide range. Moreover, the observed NMR shifts in the Ba8Cu5Si xGe41-x clathrates change in a nonlinear way with increasing Si substitution: from x = 0 to about 20 the shifts are essentially constant, while approaching x = 41 they increase rapidly, demonstrating a significant change in hybridizations vs Si substitution. NMR studies of Cu2Se show an initial appearance of ionic hopping in a narrow temperature range above 100 K, coinciding with the recently observed low-temperature phase transition. At room temperature and above, this goes over to rapid Cu-ion hopping and a single motionally narrowed line both above and below the alpha-beta structural transition. Furthermore, the NMR results on Cu2Te and Cu 1.98Ag0.2Te demonstrate unusually large negative chemical shifts, as well as large Cu and Te s-state contributions in the valence band. The large diamagnetic chemical shifts coincide with behavior previously identified for materials with topologically nontrivial band inversion, and in addition, the large metallic shifts point to analogous features in the valence band density of states, suggesting that Cu2Te may have similar inverted features.

  14. Ebola virus entry requires the cholesterol transporter Niemann-Pick C1.

    PubMed

    Carette, Jan E; Raaben, Matthijs; Wong, Anthony C; Herbert, Andrew S; Obernosterer, Gregor; Mulherkar, Nirupama; Kuehne, Ana I; Kranzusch, Philip J; Griffin, April M; Ruthel, Gordon; Dal Cin, Paola; Dye, John M; Whelan, Sean P; Chandran, Kartik; Brummelkamp, Thijn R

    2011-08-24

    Infections by the Ebola and Marburg filoviruses cause a rapidly fatal haemorrhagic fever in humans for which no approved antivirals are available. Filovirus entry is mediated by the viral spike glycoprotein (GP), which attaches viral particles to the cell surface, delivers them to endosomes and catalyses fusion between viral and endosomal membranes. Additional host factors in the endosomal compartment are probably required for viral membrane fusion; however, despite considerable efforts, these critical host factors have defied molecular identification. Here we describe a genome-wide haploid genetic screen in human cells to identify host factors required for Ebola virus entry. Our screen uncovered 67 mutations disrupting all six members of the homotypic fusion and vacuole protein-sorting (HOPS) multisubunit tethering complex, which is involved in the fusion of endosomes to lysosomes, and 39 independent mutations that disrupt the endo/lysosomal cholesterol transporter protein Niemann-Pick C1 (NPC1). Cells defective for the HOPS complex or NPC1 function, including primary fibroblasts derived from human Niemann-Pick type C1 disease patients, are resistant to infection by Ebola virus and Marburg virus, but remain fully susceptible to a suite of unrelated viruses. We show that membrane fusion mediated by filovirus glycoproteins and viral escape from the vesicular compartment require the NPC1 protein, independent of its known function in cholesterol transport. Our findings uncover unique features of the entry pathway used by filoviruses and indicate potential antiviral strategies to combat these deadly agents.

  15. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program.

    PubMed

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-09-12

    In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Both legs will show improvement in hop test-measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Retrospective cohort study. Level 3. Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre- and post-hop test scores were recorded as the primary outcome measure. Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. © 2016 The Author(s).

  16. Quantitative Improvements in Hop Test Scores After a 6-Week Neuromuscular Training Program

    PubMed Central

    Meierbachtol, Adam; Rohman, Eric; Paur, Eric; Bottoms, John; Tompkins, Marc

    2016-01-01

    Background: In patients who have undergone anterior cruciate ligament reconstruction (ACLR), the effect of neuromuscular re-education (NMR) programs on standard hop tests outcomes, including limb symmetry indices (LSIs), is unknown. Hypothesis: Both legs will show improvement in hop test–measured units after neuromuscular training, but the involved leg will show relatively greater improvement leading to improved limb symmetry. Patients younger than 18 years will show more improvement than patients who are older. Study Design: Retrospective cohort study. Level of Evidence: Level 3. Methods: Patients self-selected their participation in this NMR program, which was completed after traditional outpatient physical therapy. Pre– and post–hop test scores were recorded as the primary outcome measure. Results: Seventy-one patients met the inclusion criteria and completed hop testing. Overall, the involved leg showed significant improvements (pretest/posttest) for single-leg hop (138.30 cm/156.89 cm), triple crossover hop (370.05 cm/423.11 cm), and timed hop (2.21 s/1.99 s). Similarly, on the uninvolved leg, improvements were seen for the single-leg hop (159.30 cm/171.87 cm) and triple crossover hop (427.50 cm/471.27 cm). Overall mean limb symmetry improved across all 4 hop tests, but there was significant improvement only on the single-leg hop (87% pretest to 92% posttest). Patients younger than 18 years showed mean significant LSI improvement on the triple crossover hop. Conclusion: Utilizing an intensive 6-week NMR program after ACLR prior to return to sport can improve quantitative hop test measurements. Patients younger than 18 years had greater improvement than those 18 years and older. Clinical Relevance: Advanced NMR programs can be successfully utilized in the postoperative ACLR setting to improve quantitative limb symmetry. PMID:27620968

  17. Maintenance of order in a moving strong condensate

    NASA Astrophysics Data System (ADS)

    Whitehouse, Justin; Costa, André; Blythe, Richard A.; Evans, Martin R.

    2014-11-01

    We investigate the conditions under which a moving condensate may exist in a driven mass transport system. Our paradigm is a minimal mass transport model in which n - 1 particles move simultaneously from a site containing n > 1 particles to the neighbouring site in a preferred direction. In the spirit of a zero-range process the rate u(n) of this move depends only on the occupation of the departure site. We study a hopping rate u(n) = 1 + b/nα numerically and find a moving strong condensate phase for b > bc(α) for all α > 0. This phase is characterised by a condensate that moves through the system and comprises a fraction of the system's mass that tends to unity. The mass lost by the condensate as it moves is constantly replenished from the trailing tail of low occupancy sites that collectively comprise a vanishing fraction of the mass. We formulate an approximate analytical treatment of the model that allows a reasonable estimate of bc(α) to be obtained. We show numerically (for α = 1) that the transition is of mixed order, exhibiting a discontinuity in the order parameter as well as a diverging length scale as b\\searrow bc .

  18. The impact of adsorption on the localization of spins in graphene oxide and reduced graphene oxide, observed with electron paramagnetic resonance

    NASA Astrophysics Data System (ADS)

    Kempiński, Mateusz; Florczak, Patryk; Jurga, Stefan; Śliwińska-Bartkowiak, Małgorzata; Kempiński, Wojciech

    2017-08-01

    We report the observations of electronic properties of graphene oxide and reduced graphene oxide, performed with electron paramagnetic resonance technique in a broad temperature range. Both materials were examined in pure form and saturated with air, helium, and heavy water molecules. We show that spin localization strongly depends on the type and amount of molecules adsorbed at the graphene layer edges (and possible in-plane defects). Physical and chemical states of edges play crucial role in electrical transport within graphene-based materials, with hopping as the leading mechanism of charge carrier transport. Presented results are a good basis to understand the electronic properties of other carbon structures made of graphene-like building blocks. Most active carbons show some degree of functionalization and are known of having good adsorptive properties; thus, controlling both phenomena is important for many applications. Sample treatment with temperature, vacuum, and various adsorbents allowed for the observation of a possible metal-insulator transition and sorption pumping effects. The influence of adsorption on the localization phenomena in graphene would be very important if to consider the graphene-based material as possible candidates for the future spintronics that works in ambient conditions.

  19. Electronic transport in two-dimensional high dielectric constant nanosystems

    DOE PAGES

    Ortuño, M.; Somoza, A. M.; Vinokur, V. M.; ...

    2015-04-10

    There has been remarkable recent progress in engineering high-dielectric constant two dimensional (2D) materials, which are being actively pursued for applications in nanoelectronics in capacitor and memory devices, energy storage, and high-frequency modulation in communication devices. Yet many of the unique properties of these systems are poorly understood and remain unexplored. Here we report a numerical study of hopping conductivity of the lateral network of capacitors, which models two-dimensional insulators, and demonstrate that 2D long-range Coulomb interactions lead to peculiar size effects. We find that the characteristic energy governing electronic transport scales logarithmically with either system size or electrostatic screeningmore » length depending on which one is shorter. Our results are relevant well beyond their immediate context, explaining, for example, recent experimental observations of logarithmic size dependence of electric conductivity of thin superconducting films in the critical vicinity of superconductor-insulator transition where a giant dielectric constant develops. Our findings mark a radical departure from the orthodox view of conductivity in 2D systems as a local characteristic of materials and establish its macroscopic global character as a generic property of high-dielectric constant 2D nanomaterials.« less

  20. Electronic transport in two-dimensional high dielectric constant nanosystems.

    PubMed

    Ortuño, M; Somoza, A M; Vinokur, V M; Baturina, T I

    2015-04-10

    There has been remarkable recent progress in engineering high-dielectric constant two dimensional (2D) materials, which are being actively pursued for applications in nanoelectronics in capacitor and memory devices, energy storage, and high-frequency modulation in communication devices. Yet many of the unique properties of these systems are poorly understood and remain unexplored. Here we report a numerical study of hopping conductivity of the lateral network of capacitors, which models two-dimensional insulators, and demonstrate that 2D long-range Coulomb interactions lead to peculiar size effects. We find that the characteristic energy governing electronic transport scales logarithmically with either system size or electrostatic screening length depending on which one is shorter. Our results are relevant well beyond their immediate context, explaining, for example, recent experimental observations of logarithmic size dependence of electric conductivity of thin superconducting films in the critical vicinity of superconductor-insulator transition where a giant dielectric constant develops. Our findings mark a radical departure from the orthodox view of conductivity in 2D systems as a local characteristic of materials and establish its macroscopic global character as a generic property of high-dielectric constant 2D nanomaterials.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.
Top