Sample records for vector expressing human

  1. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

    PubMed

    Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

    2009-12-30

    Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

  2. Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

    PubMed Central

    2009-01-01

    Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

  3. Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

    PubMed

    Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

    2015-01-01

    We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

  4. [Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

    PubMed

    Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

    2015-07-01

    To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

  5. Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

    PubMed

    Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

    1999-04-01

    The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

  6. Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin.

    PubMed

    Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars

    2015-08-01

    Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.

  7. Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin

    PubMed Central

    Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G.; Corydon, Thomas J.; Mikkelsen, Jacob Giehm; Aagaard, Lars

    2015-01-01

    Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo. PMID:26204415

  8. Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

    PubMed Central

    Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

    2016-01-01

    Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

  9. Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

    PubMed

    Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

    2016-01-01

    Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

  10. Comparison of HIV- and EIAV-based vectors on their efficiency in transducing murine and human hematopoietic repopulating cells.

    PubMed

    Siapati, Elena K; Bigger, Brian W; Miskin, James; Chipchase, Daniel; Parsley, Kathryn L; Mitrophanous, Kyriacos; Themis, Mike; Thrasher, Adrian J; Bonnet, Dominique

    2005-09-01

    The use of lentiviral vectors for gene transfer into hematopoietic stem cells has raised considerable interest as these vectors can permanently integrate their genome into quiescent cells. Vectors based on alternative lentiviruses would theoretically be safer than HIV-1-based vectors and could also be used in HIV-positive patients, minimizing the risk of generating replication-competent virus. Here we report the use of third-generation equine infectious anemia virus (EIAV)- and HIV-1-based vectors with minimal viral sequences and absence of accessory proteins. We have compared their efficiency in transducing mouse and human hematopoietic stem cells both in vitro and in vivo to that of a previously documented second-generation HIV-1 vector. The third-generation EIAV- and HIV-based vectors gave comparable levels of transduction and transgene expression in both mouse and human NOD/SCID repopulating cells but were less efficient than the second-generation HIV-1 vector in human HSCs. For the EIAV vector this is possibly a reflection of the lower protein expression levels achieved in human cells, as vector copy number analysis revealed that this vector exhibited a trend to integrate equally efficiently compared to the third-generation HIV-1 vector in both mouse and human HSCs. Interestingly, the presence or absence of Tat in viral preparations did not influence the transduction efficiency of HIV-1 vectors in human HSCs.

  11. [Cloning of human CD45 gene and its expression in Hela cells].

    PubMed

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  12. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    PubMed

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  13. [Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

    PubMed

    Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

    2014-01-01

    To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

  14. The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

    NASA Astrophysics Data System (ADS)

    Roizman, Bernard

    1996-10-01

    Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

  15. Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, A.D.; Bender, M.A.; Harris, E.A.S.

    1988-11-01

    Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

  16. Development of nonhuman adenoviruses as vaccine vectors

    PubMed Central

    Bangari, Dinesh S.; Mittal, Suresh K.

    2006-01-01

    Human adenoviral (HAd) vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system. However, clinical use of adenoviral vectors for vaccine purposes is anticipated to be limited by vector immunity that is either preexisting or develops rapidly following the first inoculation with adenoviral vectors. Vector immunity inactivates the vector particles and rapidly removes the transduced cells, thereby limiting the duration of transgene expression. Due to strong vector immunity, subsequent use of the same vector is usually less efficient. In order to circumvent this limitation, nonhuman adenoviral vectors have been proposed as alternative vectors. In addition to eluding HAd immunity, these vectors possess most of the attractive features of HAd vectors. Several replication-competent or replication-defective nonhuman adenoviral vectors have been developed and investigated for their potential as vaccine delivery vectors. Here, we review recent advances in the design and characterization of various nonhuman adenoviral vectors, and discuss their potential applications for human and animal vaccination. PMID:16297508

  17. Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

    PubMed Central

    Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

    2015-01-01

    Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

  18. Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

    PubMed

    López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

    2015-01-01

    Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

  19. Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

    PubMed Central

    Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

    2015-01-01

    Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

  20. Helper-dependent adenovirus achieve more efficient and persistent liver transgene expression in non-human primates under immunosuppression.

    PubMed

    Unzu, C; Melero, I; Hervás-Stubbs, S; Sampedro, A; Mancheño, U; Morales-Kastresana, A; Serrano-Mendioroz, I; de Salamanca, R E; Benito, A; Fontanellas, A

    2015-11-01

    Helper-dependent adenoviral (HDA) vectors constitute excellent gene therapy tools for metabolic liver diseases. We have previously shown that an HDA vector encoding human porphobilinogen deaminase (PBGD) corrects acute intermittent porphyria mice. Now, six non-human primates were injected in the left hepatic lobe with the PBGD-encoding HDA vector to study levels and persistence of transgene expression. Intrahepatic administration of 5 × 10(12) viral particles kg(-1) (10(10) infective units kg(-1)) of HDA only resulted in transient (≈14 weeks) transgene expression in one out of three individuals. In contrast, a more prolonged 90-day immunosuppressive regimen (tacrolimus, mycophenolate, rituximab and steroids) extended meaningful transgene expression for over 76 weeks in two out of two cases. Transgene expression under immunosuppression (IS) reached maximum levels 6 weeks after HDA administration and gradually declined reaching a stable plateau within the therapeutic range for acute porphyria. The non-injected liver lobes also expressed the transgene because of vector circulation. IS controlled anticapsid T-cell responses and decreased the induction of neutralizing antibodies. Re-administration of HDA-hPBGD at week +78 achieved therapeutically meaningful transgene expression only in those animals receiving IS again at the time of this second vector exposure. Overall, immunity against adenoviral capsids poses serious hurdles for long-term HDA-mediated liver transduction, which can be partially circumvented by pharmacological IS.

  1. Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

    PubMed

    Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

    2013-12-01

    Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. A human parvovirus, adeno-associated virus, as a eucaryotic vector: Transient expression and encapsidation of the procaryotic gene for chloramphenicol acetyltransferase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tratschin, J.D.; West, M.H.P.; Sandbank, T.

    1984-10-01

    The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less

  3. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells.

    PubMed

    Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

    2017-01-20

    Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

  4. Engineering zucchini yellow mosaic potyvirus as a non-pathogenic vector for expression of heterologous proteins in cucurbits.

    PubMed

    Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A

    2001-04-27

    Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.

  5. In vitro evaluation of a mammary gland specific expression vector encoding recombinant human lysozyme for development of transgenic dairy goat embryos.

    PubMed

    Gui, Tao; Zhang, Meiling; Chen, Jianwen; Zhang, Yuanliang; Zhou, Naru; Zhang, Yu; Tao, Jia; Sui, Liucai; Li, Yunsheng; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

    2012-08-01

    A vector expressing human lysozyme (pBC1-hLYZ-GFP-Neo) was evaluated for gene and protein expression following liposome-mediated transformation of C-127 mouse mammary cancer cells. Cultures of G418-resistant clones were harvested 24-72 h after induction with prolactin, insulin and hydrocortisone. Target gene expression was analyzed by RT-PCR and Western blot and recombinant human lysozyme (rhLYZ) bacteriostatic activity was also evaluated. The hLYZ gene was correctly transcribed and translated in C-127 cells and hLYZ inhibited gram-positive bacterial growth, indicating the potential of this expression vector for development of a mammary gland bioreactor in goats. Guanzhong dairy goat skin fibroblasts transfected with pBC1-hLYZ-GFP-Neo were used to construct a goat embryo transgenically expressing rhLYZ by somatic nuclear transplantation with a blastocyst rate of 9.0 ± 2.8 %. These data establish the basis for cultivation of mastitis-resistant hLYZ transgenic goats.

  6. Telomerase-mediated life-span extension of human primary fibroblasts by human artificial chromosome (HAC) vector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko

    2008-05-09

    Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-{beta}-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 daysmore » after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells.« less

  7. Genetic modification of human trabecular meshwork with lentiviral vectors.

    PubMed

    Loewen, N; Fautsch, M P; Peretz, M; Bahler, C K; Cameron, J D; Johnson, D H; Poeschla, E M

    2001-11-20

    Glaucoma, a group of optic neuropathies, is the leading cause of irreversible blindness. Neuronal apoptosis in glaucoma is primarily associated with high intraocular pressure caused by chronically impaired outflow of aqueous humor through the trabecular meshwork, a reticulum of mitotically inactive endothelial-like cells located in the angle of the anterior chamber. Anatomic, genetic, and expression profiling data suggest the possibility of using gene transfer to treat glaucomatous intraocular pressure dysregulation, but this approach will require stable genetic modification of the differentiated aqueous outflow tract. We injected transducing unit-normalized preparations of either of two lentiviral vectors or an oncoretroviral vector as a single bolus into the aqueous circulation of cultured human donor eyes, under perfusion conditions that mimicked natural anterior chamber flow and maintained viability ex vivo. Reporter gene expression was assessed in trabecular meshwork from 3 to 16 days after infusion of 1.0 x 10(8) transducing units of each vector. The oncoretroviral vector failed to transduce the trabecular meshwork. In contrast, feline immunodeficiency virus and human immunodeficiency virus vectors produced efficient, localized transduction of the trabecular meshwork in situ. The results demonstrate that lentiviral vectors permit efficient genetic modification of the human trabecular meshwork when delivered via the afferent aqueous circulation, a clinically accessible route. In addition, controlled comparisons in this study establish that feline and human immunodeficiency virus vectors are equivalently efficacious in delivering genes to this terminally differentiated human tissue.

  8. A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

    PubMed

    Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

    2010-05-31

    Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

  9. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    PubMed Central

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and acquired human diseases affecting cells of erythroid lineage. PMID:9573295

  10. Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

    PubMed

    Crosby, Catherine M; Barry, Michael A

    2017-02-18

    Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

  11. Immunogenicity of Newcastle disease virus vectors expressing Norwalk virus capsid protein in the presence or absence of VP2 protein.

    PubMed

    Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y; Samal, Siba K

    2015-10-01

    Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirus-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    PubMed

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

  13. Cloning and characterization of an adenoviral vector for highly efficient and doxycycline – suppressible expression of bioactive human single – chain interleukin 12 in colon cancer

    PubMed Central

    Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

    2007-01-01

    Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. PMID:17594499

  14. Reflections on the early development of poxvirus vectors.

    PubMed

    Moss, Bernard

    2013-09-06

    Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.

  15. Evaluation of helper-dependent canine adenovirus vectors in a 3D human CNS model

    PubMed Central

    Simão, Daniel; Pinto, Catarina; Fernandes, Paulo; Peddie, Christopher J.; Piersanti, Stefania; Collinson, Lucy M.; Salinas, Sara; Saggio, Isabella; Schiavo, Giampietro; Kremer, Eric J.; Brito, Catarina; Alves, Paula M.

    2017-01-01

    Gene therapy is a promising approach with enormous potential for treatment of neurodegenerative disorders. Viral vectors derived from canine adenovirus type 2 (CAV-2) present attractive features for gene delivery strategies in the human brain, by preferentially transducing neurons, are capable of efficient axonal transport to afferent brain structures, have a 30-kb cloning capacity and have low innate and induced immunogenicity in pre-clinical tests. For clinical translation, in-depth pre-clinical evaluation of efficacy and safety in a human setting is primordial. Stem cell-derived human neural cells have a great potential as complementary tools by bridging the gap between animal models, which often diverge considerably from human phenotype, and clinical trials. Herein, we explore helper-dependent CAV-2 (hd-CAV-2) efficacy and safety for gene delivery in a human stem cell-derived 3D neural in vitro model. Assessment of hd-CAV-2 vector efficacy was performed at different multiplicities of infection, by evaluating transgene expression and impact on cell viability, ultrastructural cellular organization and neuronal gene expression. Under optimized conditions, hd-CAV-2 transduction led to stable long-term transgene expression with minimal toxicity. hd-CAV-2 preferentially transduced neurons, while human adenovirus type 5 (HAdV5) showed increased tropism towards glial cells. This work demonstrates, in a physiologically relevant 3D model, that hd-CAV-2 vectors are efficient tools for gene delivery to human neurons, with stable long-term transgene expression and minimal cytotoxicity. PMID:26181626

  16. Evaluation of helper-dependent canine adenovirus vectors in a 3D human CNS model.

    PubMed

    Simão, D; Pinto, C; Fernandes, P; Peddie, C J; Piersanti, S; Collinson, L M; Salinas, S; Saggio, I; Schiavo, G; Kremer, E J; Brito, C; Alves, P M

    2016-01-01

    Gene therapy is a promising approach with enormous potential for treatment of neurodegenerative disorders. Viral vectors derived from canine adenovirus type 2 (CAV-2) present attractive features for gene delivery strategies in the human brain, by preferentially transducing neurons, are capable of efficient axonal transport to afferent brain structures, have a 30-kb cloning capacity and have low innate and induced immunogenicity in preclinical tests. For clinical translation, in-depth preclinical evaluation of efficacy and safety in a human setting is primordial. Stem cell-derived human neural cells have a great potential as complementary tools by bridging the gap between animal models, which often diverge considerably from human phenotype, and clinical trials. Herein, we explore helper-dependent CAV-2 (hd-CAV-2) efficacy and safety for gene delivery in a human stem cell-derived 3D neural in vitro model. Assessment of hd-CAV-2 vector efficacy was performed at different multiplicities of infection, by evaluating transgene expression and impact on cell viability, ultrastructural cellular organization and neuronal gene expression. Under optimized conditions, hd-CAV-2 transduction led to stable long-term transgene expression with minimal toxicity. hd-CAV-2 preferentially transduced neurons, whereas human adenovirus type 5 (HAdV5) showed increased tropism toward glial cells. This work demonstrates, in a physiologically relevant 3D model, that hd-CAV-2 vectors are efficient tools for gene delivery to human neurons, with stable long-term transgene expression and minimal cytotoxicity.

  17. Intramammary expression and therapeutic effect of a human lysozyme-expressing vector for treating bovine mastitis*

    PubMed Central

    Sun, Huai-Chang; Xue, Fang-Ming; Qian, Ke; Fang, Hao-Xia; Qiu, Hua-Lei; Zhang, Xin-Yu; Yin, Zhao-Hua

    2006-01-01

    To develop a gene therapy strategy for treating bovine mastitis, a new mammary-specific vector containing human lysozyme (hLYZ) cDNA and kanamycin resistance gene was constructed for intramammary expression and clinical studies. After one time acupuncture or intracisternal infusion of healthy cows with 400 μg of the p215C3LYZ vector, over 2.0 μg/ml of rhLYZ could be detected by enzymatic assay for about 3 weeks in the milk samples. Western blotting showed that rhLYZ secreted into milk samples from the vector-injected cows had molecular weight similar to that of the natural hLYZ in human colostrums. Twenty days after the primary injection, the quarters were re-injected with the same vector by quarter acupuncture and even higher concentrations of rhLYZ could be detected. Indirect competitive ELISA of milk samples showed that the vector injection did not induce detectable humoral immune response against hLYZ. Clinical studies showed that twice acupuncture of quarters with the p215C3LYZ vector had overt therapeutic effect on clinical and subclinical mastitis previously treated with antibiotics, including disappearance of clinical symptoms and relatively high microbiological cure rates. These data provide a solid rationale for using the vector to develop gene therapy for treating bovine mastitis. PMID:16532537

  18. [Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

    PubMed

    Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

    2013-04-01

    This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

  19. Recombinant adeno-associated virus mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.

    PubMed Central

    Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B

    1997-01-01

    We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population. PMID:9032306

  20. Recombinant adeno-associated virus mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.

    PubMed

    Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B

    1997-03-01

    We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population.

  1. Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells.

    PubMed

    Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G; Martin, Francisco

    2016-11-17

    Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny.

  2. Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells

    PubMed Central

    Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G.; Martin, Francisco

    2016-01-01

    Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny. PMID:27853296

  3. Genetic modification of adeno-associated viral vector type 2 capsid enhances gene transfer efficiency in polarized human airway epithelial cells.

    PubMed

    White, April F; Mazur, Marina; Sorscher, Eric J; Zinn, Kurt R; Ponnazhagan, Selvarangan

    2008-12-01

    Cystic fibrosis (CF) is a common genetic disease characterized by defects in the expression of the CF transmembrane conductance regulator (CFTR) gene. Gene therapy offers better hope for the treatment of CF. Adeno-associated viral (AAV) vectors are capable of stable expression with low immunogenicity. Despite their potential in CF gene therapy, gene transfer efficiency by AAV is limited because of pathophysiological barriers in these patients. Although a few AAV serotypes have shown better transduction compared with the AAV2-based vectors, gene transfer efficiency in human airway epithelium has still not reached therapeutic levels. To engineer better AAV vectors for enhanced gene delivery in human airway epithelium, we developed and characterized mutant AAV vectors by genetic capsid modification, modeling the well-characterized AAV2 serotype. We genetically incorporated putative high-affinity peptide ligands to human airway epithelium on the GH loop region of AAV2 capsid protein. Six independent mutant AAV were constructed, containing peptide ligands previously reported to bind with high affinity for known and unknown receptors on human airway epithelial cells. The vectors were tested on nonairway cells and nonpolarized and polarized human airway epithelial cells for enhanced infectivity. One of the mutant vectors, with the peptide sequence THALWHT, not only showed the highest transduction in undifferentiated human airway epithelial cells but also indicated significant transduction in polarized cells. Interestingly, this modified vector was also able to infect cells independently of the heparan sulfate proteoglycan receptor. Incorporation of this ligand on other AAV serotypes, which have shown improved gene transfer efficiency in the human airway epithelium, may enhance the application of AAV vectors in CF gene therapy.

  4. The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

    2012-12-01

    The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

  5. Insertion of targeting domains into the envelope glycoprotein of Moloney murine leukemia virus (MoMLV)-based vectors modulates the route of mCAT-1-mediated viral entry.

    PubMed

    Viejo-Borbolla, A; Pizzato, M; Blair, E D; Schulz, T F

    2005-03-01

    Several groups have inserted targeting domains into the envelope glycoprotein (Env) of Moloney murine leukemia virus (MoMLV) in an attempt to produce targeted retroviral vectors for human gene therapy. While binding of these modified Envs to the target molecule expressed on the surface of human cells was observed, specific high-titer infection of human cells expressing the target molecule was not achieved. Here we investigate the initial steps in the entry process of targeted MoMLV vectors both in murine and human cells expressing the MoMLV receptor, the mouse cationic amino acid transporter-1 (mCAT-1). We show that insertion of a small ligand targeted to E-selectin and of a single chain antibody (scFv) targeted to folate-binding protein (FBP) into the N-terminus of MoMLV Env results in the reduction of the infectivity and the kinetics of entry of the MoMLV vectors. The use of soluble receptor-binding domain (sRBD), bafilomycin A1 (BafA1) and methyl-beta-cyclodextrin (MbetaC) increase the infectivity of the MoMLV vectors targeted to FBP (MoMLV-FBP) suggesting that the scFv targeted to FBP increases the threshold for fusion and might re-route entry of the targeted MoMLV-FBP vector towards an endocytic, non-productive pathway.

  6. Vectors for co-expression of an unrestricted number of proteins

    PubMed Central

    Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

    2007-01-01

    A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

  7. Improved muscle-derived expression of human coagulation factor IX from a skeletal actin/CMV hybrid enhancer/promoter.

    PubMed

    Hagstrom, J N; Couto, L B; Scallan, C; Burton, M; McCleland, M L; Fields, P A; Arruda, V R; Herzog, R W; High, K A

    2000-04-15

    Hemophilia B is caused by the absence of functional coagulation factor IX (F.IX) and represents an important model for treatment of genetic diseases by gene therapy. Recent studies have shown that intramuscular injection of an adeno-associated viral (AAV) vector into mice and hemophilia B dogs results in vector dose-dependent, long-term expression of biologically active F.IX at therapeutic levels. In this study, we demonstrate that levels of expression of approximately 300 ng/mL (6% of normal human F.IX levels) can be reached by intramuscular injection of mice using a 2- to 4-fold lower vector dose (1 x 10(11) vector genomes/mouse, injected into 4 intramuscular sites) than previously described. This was accomplished through the use of an improved expression cassette that uses the cytomegalovirus (CMV) immediate early enhancer/promoter in combination with a 1.2-kilobase portion of human skeletal actin promoter. These results correlated with enhanced levels of F.IX transcript and secreted F.IX protein in transduced murine C2C12 myotubes. Systemic F.IX expression from constructs containing the CMV enhancer/promoter alone was 120 to 200 ng/mL in mice injected with 1 x 10(11) vector genomes. Muscle-specific promoters performed poorly for F.IX transgene expression in vitro and in vivo. However, the incorporation of a sequence from the alpha-skeletal actin promoter containing at least 1 muscle-specific enhancer and 1 enhancer-like element further improved muscle-derived expression of F.IX from a CMV enhancer/promoter-driven expression cassette over previously published results. These findings will allow the design of a clinical protocol for therapeutic levels of F.IX expression with lower vector doses, thus enhancing efficacy and safety of the protocol. (Blood. 2000;95:2536-2542)

  8. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response.

    PubMed

    Manno, Catherine S; Pierce, Glenn F; Arruda, Valder R; Glader, Bertil; Ragni, Margaret; Rasko, John J; Rasko, John; Ozelo, Margareth C; Hoots, Keith; Blatt, Philip; Konkle, Barbara; Dake, Michael; Kaye, Robin; Razavi, Mahmood; Zajko, Albert; Zehnder, James; Rustagi, Pradip K; Nakai, Hiroyuki; Chew, Amy; Leonard, Debra; Wright, J Fraser; Lessard, Ruth R; Sommer, Jürg M; Tigges, Michael; Sabatino, Denise; Luk, Alvin; Jiang, Haiyan; Mingozzi, Federico; Couto, Linda; Ertl, Hildegund C; High, Katherine A; Kay, Mark A

    2006-03-01

    We have previously shown that a single portal vein infusion of a recombinant adeno-associated viral vector (rAAV) expressing canine Factor IX (F.IX) resulted in long-term expression of therapeutic levels of F.IX in dogs with severe hemophilia B. We carried out a phase 1/2 dose-escalation clinical study to extend this approach to humans with severe hemophilia B. rAAV-2 vector expressing human F.IX was infused through the hepatic artery into seven subjects. The data show that: (i) vector infusion at doses up to 2 x 10(12) vg/kg was not associated with acute or long-lasting toxicity; (ii) therapeutic levels of F.IX were achieved at the highest dose tested; (iii) duration of expression at therapeutic levels was limited to a period of approximately 8 weeks; (iv) a gradual decline in F.IX was accompanied by a transient asymptomatic elevation of liver transaminases that resolved without treatment. Further studies suggested that destruction of transduced hepatocytes by cell-mediated immunity targeting antigens of the AAV capsid caused both the decline in F.IX and the transient transaminitis. We conclude that rAAV-2 vectors can transduce human hepatocytes in vivo to result in therapeutically relevant levels of F.IX, but that future studies in humans may require immunomodulation to achieve long-term expression.

  9. Induction of Human Blood Group A Antigen Expression on Mouse Cells, Using Lentiviral Gene Transduction

    PubMed Central

    Fan, Xiaohu; Lang, Haili; Zhou, Xianpei; Zhang, Li; Yin, Rong; Maciejko, Jessica; Giannitsos, Vasiliki; Motyka, Bruce; Medin, Jeffrey A.; Platt, Jeffrey L.

    2010-01-01

    Abstract The ABO histo-blood group system is the most important antigen system in transplantation medicine, yet no small animal model of the ABO system exists. To determine the feasibility of developing a murine model, we previously subcloned the human α-1,2-fucosyltransferase (H-transferase, EC 2.4.1.69) cDNA and the human α-1,3-N-acetylgalactosaminyltransferase (A-transferase, EC 2.4.1.40) cDNA into lentiviral vectors to study their ability to induce human histo-blood group A antigen expression on mouse cells. Herein we investigated the optimal conditions for human A and H antigen expression in murine cells. We determined that transduction of a bicistronic lentiviral vector (LvEF1-AH-trs) resulted in the expression of A antigen in a mouse endothelial cell line. We also studied the in vivo utility of this vector to induce human A antigen expression in mouse liver. After intrahepatic injection of LvEF1-AH-trs, A antigen expression was observed on hepatocytes as detected by immunohistochemistry and real-time RT-PCR. In human group A erythrocyte-sensitized mice, A antigen expression in the liver was associated with tissue damage, and deposition of antibody and complement. These results suggest that this gene transfer strategy can be used to simulate the human ABO blood group system in a murine model. This model will facilitate progress in the development of interventions for ABO-incompatible transplantation and transfusion scenarios, which are difficult to develop in clinical or large animal settings. PMID:20163247

  10. Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

    PubMed

    Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

    2011-12-01

    The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

  11. Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein.

    PubMed Central

    Stevenson, S C; Rollence, M; Marshall-Neff, J; McClelland, A

    1997-01-01

    The adenovirus fiber protein is responsible for attachment of the virion to unidentified cell surface receptors. There are at least two distinct adenovirus fiber receptors which interact with the group B (Ad3) and group C (Ad5) adenoviruses. We have previously shown by using expressed adenovirus fiber proteins that it is possible to change the specificity of the fiber protein by exchanging the head domain with another serotype which recognizes a different receptor (S. C. Stevenson et al., J. Virol. 69:2850-2857, 1995). A chimeric fiber cDNA containing the Ad3 fiber head domain fused to the Ad5 fiber tail and shaft was incorporated into the genome of an adenovirus vector with E1 and E3 deleted encoding beta-galactosidase to generate Av9LacZ4, an adenovirus particle which contains a chimeric fiber protein. Western blot analysis of the chimeric fiber vector confirmed expression of the chimeric fiber protein and its association with the adenovirus capsid. Transduction experiments with fiber protein competitors demonstrated the altered receptor tropism of the chimeric fiber vector compared to that of the parental Av1LacZ4 vector. Transduction of a panel of human cell lines with the chimeric and parental vectors provided evidence for a different cellular distribution of the Ad5 and Ad3 receptors. Three cell lines (THP-1, MRC-5, and FaDu) were more efficiently transduced by the vector containing the Ad3 fiber head than by the Ad5 fiber vector. In contrast, human coronary artery endothelial cells were transduced more readily with the vector containing the Ad5 fiber than with the chimeric fiber vector. HeLa and human umbilical vein endothelial cells were transduced at equivalent levels compared with human diploid fibroblasts, which were refractory to transduction with both vectors. These results provide evidence for the differential expression of the Ad5 and Ad3 receptors on human cell lines derived from clinically relevant target tissues. Furthermore, we show that exchange of the fiber head domain is a viable approach to the production of adenovirus vectors with cell-type-selective transduction properties. It may be possible to extend this approach to the use of ligands for a range of different cellular receptors in order to target gene transfer to specific cell types at the level of transduction. PMID:9151872

  12. Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

    PubMed Central

    Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.

    1999-01-01

    The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005

  13. MicroRNA-Regulated Non-Viral Vectors with Improved Tumor Specificity in an Orthotopic Rat Model of Hepatocellular Carcinoma

    PubMed Central

    Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.

    2013-01-01

    In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066

  14. An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geller, A.I.; Keyomarsi, K.; Bryan, J.

    1990-11-01

    The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less

  15. Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

    PubMed Central

    Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

    2008-01-01

    In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

  16. The myeloid-binding peptide adenoviral vector enables multi-organ vascular endothelial gene targeting.

    PubMed

    Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M

    2014-08-01

    Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.

  17. UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

    PubMed Central

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

  18. Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro

    P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNAmore » expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.« less

  19. A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

    PubMed

    Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

    2009-03-01

    Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

  20. Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats.

    PubMed

    Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

    2014-09-01

    Human immunodeficiency virus (HIV)-associated sensory neuropathy is a common neurological complication of HIV infection affecting up to 30% of HIV-positive individuals. However, the exact neuropathological mechanisms remain unknown, which hinders our ability to develop effective treatments for HIV-related neuropathic pain (NP). In this study, we tested the hypothesis that inhibition of proinflammatory factors with overexpression of interleukin (IL)-10 reduces HIV-related NP in a rat model. NP was induced by the application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve. The hindpaws of rats were inoculated with nonreplicating herpes simplex virus (HSV) vectors expressing anti-inflammatory cytokine IL-10 or control vector. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The mechanical threshold response was assessed over time using the area under curves. The expression of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 in both the lumbar spinal cord and the L4/5 dorsal root ganglia (DRG), was examined at 14 and 28 days after vector inoculation using Western blots. We found that in the gp120-induced NP model, IL-10 overexpression mediated by the HSV vector resulted in a significant elevation of the mechanical threshold that was apparent on day 3 after vector inoculation compared with the control vector (P < 0.001). The antiallodynic effect of the single HSV vector inoculation expressing IL-10 lasted >28 days. The area under curve in the HSV vector expressing IL-10 was increased compared with that in the control vector (P < 0.0001). HSV vectors expressing IL-10 reversed the upregulation of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 expression at 14 and/or 28 days in the DRG and/or the spinal dorsal horn. Our studies demonstrate that blocking the signaling of these proinflammatory molecules in the DRG and/or the spinal cord using the HSV vector expressing IL-10 is able to reduce HIV-related NP. These results provide new insights on the potential mechanisms of HIV-associated NP and a proof of concept for treating painful HIV sensory neuropathy with this type of gene therapy.

  1. Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

    PubMed Central

    Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

    2004-01-01

    Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

  2. [Use of a novel baculovirus vector to express nucleoprotein gene of Crimean-Congo hemorrhagic fever virus in both insect and mammalian cells].

    PubMed

    Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang

    2002-09-01

    To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.

  3. Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

    PubMed Central

    Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

    2018-01-01

    To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

  4. Modified Newcastle disease virus vectors expressing the H5 hemagglutinin induce enhanced protection against highly pathogenic H5N1 avian influenza virus in chickens

    PubMed Central

    Kim, Shin-Hee; Paldurai, Anandan; Xiao, Sa; Collins, Peter L.; Samal, Siba K.

    2016-01-01

    Naturally-occurring attenuated strains of Newcastle disease virus (NDV) are being developed as vaccine vectors for use in poultry and humans. However, some NDV strains, such as Beaudette C (BC), may retain too much virulence in poultry for safe use, and more highly attenuated strains may be suboptimally immunogenic. We therefore modified the BC strain by changing the multibasic cleavage site sequence of the F protein to the dibasic sequence of avirulent strain LaSota. Additionally, the BC, F, and HN proteins were modified in several ways to enhance virus replication. These modified BC-derived vectors and the LaSota strain were engineered to express the hemagglutin (HA) protein of H5N1 highly pathogenic influenza virus (HPAIV). In general, the modified BC-based vectors expressing HA replicated better than LaSota/HA, and expressed higher levels of HA protein. Pathogenicity tests indicated that all the modified viruses were highly attenuated in chickens. Based on in vitro characterization, two of the modified BC vectors were chosen for evaluation in chickens as vaccine vectors against H5N1 HPAIV A/Vietnam/1203/04. Immunization of chickens with rNDV vector vaccines followed by challenge with HPAIV demonstrated high levels of protection against clinical disease and mortality. However, only those chickens immunized with modified BC/HA in which residues 271–330 from the F protein had been replaced with the corresponding sequence from the NDV AKO strain conferred complete protection against challenge virus shedding. Our findings suggest that this modified rNDV can be used safely as a vaccine vector with enhanced replication, expression, and protective efficacy in avian species, and potentially in humans. PMID:24968158

  5. Acetylcholinesterase of Phlebotomus papatasi (Scopoli): expression and biochemical properties of orthologous organophosphate resistance mutations from mosquitoes

    USDA-ARS?s Scientific Manuscript database

    Phlebotomine sand flies are small hematophagous vectors of human and zoonotic leishmaniases present throughout tropical and subtropical areas of the world. Phlebotomus papatasi is a principal vector of human cutaneous leishmaniasis that has presented serious problems for military operations and resi...

  6. Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

    2011-07-01

    Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

  7. Alpharetroviral Vector-mediated Gene Therapy for X-CGD: Functional Correction and Lack of Aberrant Splicing

    PubMed Central

    Kaufmann, Kerstin B.; Brendel, Christian; Suerth, Julia D.; Mueller-Kuller, Uta; Chen-Wichmann, Linping; Schwäble, Joachim; Pahujani, Shweta; Kunkel, Hana; Schambach, Axel; Baum, Christopher; Grez, Manuel

    2013-01-01

    Comparative integrome analysis has revealed that the most neutral integration pattern among retroviruses is attributed to alpharetroviruses. We chose X-linked chronic granulomatous disease (X-CGD) as model to evaluate the potential of self-inactivating (SIN) alpharetroviral vectors for gene therapy of monogenic diseases. Therefore, we combined the alpharetroviral vector backbone with the elongation factor-1α short promoter, both considered to possess a low genotoxic profile, to drive transgene (gp91phox) expression. Following efficient transduction transgene expression was sustained and provided functional correction of the CGD phenotype in a cell line model at low vector copy number. Further analysis in a murine X-CGD transplantation model revealed gene-marking of bone marrow cells and oxidase positive granulocytes in peripheral blood. Transduction of human X-CGD CD34+ cells provided functional correction up to wild-type levels and long-term expression upon transplantation into a humanized mouse model. In contrast to lentiviral vectors, no aberrantly spliced transcripts containing cellular exons fused to alpharetroviral sequences were found in transduced cells, implying that the safety profile of alpharetroviral vectors may extend beyond their neutral integration profile. Taken together, this highlights the potential of this SIN alpharetroviral system as a platform for new candidate vectors for future gene therapy of hematopoietic disorders. PMID:23207695

  8. Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

    PubMed Central

    Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

    2015-01-01

    Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

  9. Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

    PubMed

    Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

    2015-01-01

    Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

  10. Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

    PubMed Central

    Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

    2010-01-01

    Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

  11. Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

    PubMed

    Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

    2008-12-01

    With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

  12. HCV core protein represses the apoptosis and improves the autophagy of human hepatocytes

    PubMed Central

    Liu, Changhong; Qu, Aihua; Han, Xiaochun; Wang, Yiguo

    2015-01-01

    Objectives: This study aims to investigate the influence on human hepatocytes apoptosis and autophagy by the hepatitis C virus (HCV) core protein. Methods: QSG-7701, a human-derived non-neoplastic liver cell line, was transfected with PIRES-core vector that was a eukaryotic vector to express HCV core protein. Fluorescence microscope was used to observe the changes of nuclei in apoptosis cells by Annex in V-FITC/PI double staining. Flow cytometry was applied to detect the rate of cell apoptosis. Western blotting was used to detect the expression of HCV core protein, transcription factor nuclear factor-kappa B (NF-κB), autophagic biomarker microtubule associated protein 1 light chain 3 (LC3), and Beclin-1. Results: The apoptosis rate was significantly lower (P < 0.05) in QSG7701/core group (transfected with PIRES-core vector, (1.34±0.07)%) than in QSG7701 group (no transfection, (2.35±0.11)%) and in QSG7701 QSG7701/pcDNA3.1 group (transfected with pcDNA3.1 vector, (2.58±0.1)%). NF-κB expression was up-expressed in QSG7701/core group than in QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). LC3-II expression and Beclin-1 expression was significant higher in QSG7701/core group than in the QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). Conclusion: HCV core protein can repress the apoptosis and improve the autophagy of QSG7701 through up-regulating NF-κB and Beclin-1 expression. PMID:26629077

  13. A Tupaia paramyxovirus vector system for targeting and transgene expression.

    PubMed

    Engeland, Christine E; Bossow, Sascha; Hudacek, Andrew W; Hoyler, Birgit; Förster, Judith; Veinalde, Rūta; Jäger, Dirk; Cattaneo, Roberto; Ungerechts, Guy; Springfeld, Christoph

    2017-09-01

    Viruses from the diverse family of Paramyxoviridae include important pathogens and are applied in gene therapy and for cancer treatment. The Tupaia paramyxovirus (TPMV), isolated from the kidney of a tree shrew, does not infect human cells and neutralizing antibodies against other Paramyxoviridae do not cross-react with TPMV. Here, we present a vector system for de novo generation of infectious TPMV that allows for insertion of additional genes as well as targeting using antibody single-chain variable fragments. We show that the recombinant TPMV specifically infect cells expressing the targeted receptor and replicate in human cells. This vector system provides a valuable tool for both basic research and therapeutic applications.

  14. High-efficiency Transduction of Rhesus Hematopoietic Repopulating Cells by a Modified HIV1-based Lentiviral Vector

    PubMed Central

    Uchida, Naoya; Hargrove, Phillip W.; Lap, Coen J.; Evans, Molly E.; Phang, Oswald; Bonifacino, Aylin C.; Krouse, Allen E.; Metzger, Mark E.; Nguyen, Anh-Dao; Hsieh, Matthew M.; Wolfsberg, Tyra G.; Donahue, Robert E.; Persons, Derek A.; Tisdale, John F.

    2012-01-01

    Human immunodeficiency virus type 1 (HIV1) vectors poorly transduce rhesus hematopoietic cells due to species-specific restriction factors, including the tripartite motif-containing 5 isoformα (TRIM5α) which targets the HIV1 capsid. We previously developed a chimeric HIV1 (χHIV) vector system wherein the vector genome is packaged with the simian immunodeficiency virus (SIV) capsid for efficient transduction of both rhesus and human CD34+ cells. To evaluate whether χHIV vectors could efficiently transduce rhesus hematopoietic repopulating cells, we performed a competitive repopulation assay in rhesus macaques, in which half of the CD34+ cells were transduced with standard SIV vectors and the other half with χHIV vectors. As compared with SIV vectors, χHIV vectors achieved higher vector integration, and the transgene expression rates were two- to threefold higher in granulocytes and red blood cells and equivalent in lymphocytes and platelets for 2 years. A recipient of χHIV vector-only transduced cells reached up to 40% of transgene expression rates in granulocytes and lymphocytes and 20% in red blood cells. Similar to HIV1 and SIV vectors, χHIV vector frequently integrated into gene regions, especially into introns. In summary, our χHIV vector demonstrated efficient transduction for rhesus long-term repopulating cells, comparable with SIV vectors. This χHIV vector should allow preclinical testing of HIV1-based therapeutic vectors in large animal models. PMID:22871664

  15. The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

    PubMed

    Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

    2013-11-01

    Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

  16. NYVAC vector modified by C7L viral gene insertion improves T cell immune responses and effectiveness against leishmaniasis.

    PubMed

    Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M

    2016-07-15

    The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Density-dependent host choice by disease vectors: epidemiological implications of the ideal free distribution.

    PubMed

    Basáñez, María-Gloria; Razali, Karina; Renz, Alfons; Kelly, David

    2007-03-01

    The proportion of vector blood meals taken on humans (the human blood index, h) appears as a squared term in classical expressions of the basic reproduction ratio (R(0)) for vector-borne infections. Consequently, R(0) varies non-linearly with h. Estimates of h, however, constitute mere snapshots of a parameter that is predicted, from evolutionary theory, to vary with vector and host abundance. We test this prediction using a population dynamics model of river blindness assuming that, before initiation of vector control or chemotherapy, recorded measures of vector density and human infection accurately represent endemic equilibrium. We obtain values of h that satisfy the condition that the effective reproduction ratio (R(e)) must equal 1 at equilibrium. Values of h thus obtained decrease with vector density, decrease with the vector:human ratio and make R(0) respond non-linearly rather than increase linearly with vector density. We conclude that if vectors are less able to obtain human blood meals as their density increases, antivectorial measures may not lead to proportional reductions in R(0) until very low vector levels are achieved. Density dependence in the contact rate of infectious diseases transmitted by insects may be an important non-linear process with implications for their epidemiology and control.

  18. Promoter-Based Theranostics for Prostate Cancer

    DTIC Science & Technology

    2016-06-01

    diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human

  19. Evaluation of the immunogenicity of a recombinant HSV-1 vector expressing human group C rotavirus VP6 protein.

    PubMed

    Rota, Rosana P; Palacios, Carlos A; Temprana, C Facundo; Argüelles, Marcelo H; Mandile, Marcelo G; Mattion, Nora; Laimbacher, Andrea S; Fraefel, Cornell; Castello, Alejandro A; Glikmann, Graciela

    2018-06-01

    Group C Rotavirus (RVC) has been associated globally with sporadic outbreaks of gastroenteritis in children and adults. RVC also infects animals, and interspecies transmission has been reported as well as its zoonotic potential. Considering its genetic diversity and the absence of effective vaccines, it is important and necessary to develop new generation vaccines against RVC for both humans and animals. The aim of the present study was to develop and characterize an HSV-1-based amplicon vector expressing a human RVC-VP6 protein and evaluate the humoral immune response induced after immunizing BALB/c mice. Local fecal samples positive for RVC were used for isolation and sequencing of the vp6 gene, which phylogenetically belongs to the I2 genotype. We show here that cells infected with the HSV[VP6C] amplicon vector efficiently express the VP6 protein, and induced specific anti-RVC antibodies in mice immunized with HSV[VP6C], in a prime-boost schedule. This work highlights that amplicon vectors are an attractive platform for the generation of safe genetic immunogens against RVC, without the addition of external adjuvants. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F

    PubMed Central

    Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

    2017-01-01

    ABSTRACT Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo. In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo, resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. PMID:28835504

  1. Genic insights from integrated human proteomics in GeneCards.

    PubMed

    Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron

    2016-01-01

    GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite's next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein-RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several GeneCards sections and help promote and organize the genome-wide structural and functional knowledge of the human proteome. Database URL:http://www.genecards.org/. © The Author(s) 2016. Published by Oxford University Press.

  2. Construction of siRNA/miRNA expression vectors based on a one-step PCR process

    PubMed Central

    Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

    2009-01-01

    Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

  3. Gene Transfer of Glutamic Acid Decarboxylase 67 by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats.

    PubMed

    Kanao, Megumi; Kanda, Hirotsugu; Huang, Wan; Liu, Shue; Yi, Hyun; Candiotti, Keith A; Lubarsky, David A; Levitt, Roy C; Hao, Shuanglin

    2015-06-01

    Human immunodeficiency virus (HIV)-related painful sensory neuropathies primarily consist of the HIV infection-related distal sensory polyneuropathy and antiretroviral toxic neuropathies. Pharmacotherapy provides only partial relief of pain in patients with HIV/acquired immune deficiency syndrome because little is known about the exact neuropathological mechanisms for HIV-associated neuropathic pain (NP). Hypofunction of γ-aminobutyric acid (GABA) GABAergic inhibitory mechanisms has been reported after peripheral nerve injury. In this study, we tested the hypothesis that HIV gp120 combined with antiretroviral therapy reduces spinal GABAergic inhibitory tone and that restoration of GABAergic inhibitory tone will reduce HIV-related NP in a rat model. The application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve plus systemic ddC (one antiretroviral drug) induced mechanical allodynia. The hind paws of rats were inoculated with replication-defective herpes simplex virus (HSV) vectors genetically encoding gad1 gene to express glutamic acid decarboxylase 67 (GAD67), an enzyme that catalyzes the decarboxylation of glutamate to GABA. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The expression of GAD67 in both the lumbar spinal cord and the L4-5 dorsal root ganglia was examined using western blots. The expression of mitochondrial superoxide in the spinal dorsal horn was examined using MitoSox imaging. The immunoreactivity of spinal GABA, pCREB, and pC/EBPβ was tested using immunohistochemistry. In the gp120 with ddC-induced neuropathic pain model, GAD67 expression mediated by the HSV vector caused an elevation of mechanical threshold that was apparent on day 3 after vector inoculation. The antiallodynic effect of the single HSV vector inoculation expressing GAD67 lasted >28 days. The area under the time-effect curves in the HSV vector expressing GAD67 was increased compared with that in the control vectors (P = 0.0005). Intrathecal GABA-A/B agonists elevated mechanical threshold in the pain model. The HSV vectors expressing GAD67 reversed the lowered GABA immunoreactivity in the spinal dorsal horn in the neuropathic rats. HSV vectors expressing GAD67 in the neuropathic rats reversed the increased signals of mitochondrial superoxide in the spinal dorsal horn. The vectors expressing GAD67 reversed the upregulated immunoreactivity expression of pCREB and pC/EBPβ in the spinal dorsal horn in rats exhibiting NP. Based on our results, we suggest that GAD67 mediated by HSV vectors acting through the suppression of mitochondrial reactive oxygen species and transcriptional factors in the spinal cord decreases pain in the HIV-related neuropathic pain model, providing preclinical evidence for gene therapy applications in patients with HIV-related pain states.

  4. Knock-in fibroblasts and transgenic blastocysts for expression of human FGF2 in the bovine β-casein gene locus using CRISPR/Cas9 nuclease-mediated homologous recombination.

    PubMed

    Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong

    2016-06-01

    Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.

  5. HSV as a vector in vaccine development and gene therapy.

    PubMed

    Marconi, Peggy; Argnani, Rafaela; Epstein, Alberto L; Manservigi, Roberto

    2009-01-01

    The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), major human pathogen whose lifestyle is based on a long-term dual interaction with the infected host characterized by the existence of lytic and latent infections, has allowed the development of potential vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous system, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases and targeted infection of specific tissues or organs. Three different classes of vectors can be derived from HSV-1: replication-competent attenuated vectors, replication-incompetent recombinant vectors and defective helper-dependent vectors known as amplicons. This chapter highlights the current knowledge concerning design, construction and recent applications, as well as the potential and current limitations of the three different classes of HSV-1-based vectors.

  6. Dissecting the mechanism of histone deacetylase inhibitors to enhance the activity of zinc finger nucleases delivered by integrase-defective lentiviral vectors.

    PubMed

    Joglekar, Alok V; Stein, Libby; Ho, Michelle; Hoban, Megan D; Hollis, Roger P; Kohn, Donald B

    2014-07-01

    Integrase-defective lentiviral vectors (IDLVs) have been of limited success in the delivery of zinc finger nucleases (ZFNs) to human cells, due to low expression. A reason for reduced gene expression has been proposed to involve the epigenetic silencing of vector genomes, carried out primarily by histone deacetylases (HDACs). In this study, we tested valproic acid (VPA), a known HDAC inhibitor (HDACi), for its ability to increase transgene expression from IDLVs, especially in the context of ZFN delivery. Using ZFNs targeting the human adenosine deaminase (ADA) gene in K562 cells, we demonstrated that treatment with VPA enhanced ZFN expression by up to 3-fold, resulting in improved allelic disruption at the ADA locus. Furthermore, three other U.S. Food and Drug Administration-approved HDACis (vorinostat, givinostat, and trichostatin-A) exhibited a similar effect on the activity of ZFN-IDLVs in K562 cells. In primary human CD34(+) cells, VPA- and vorinostat-treated cells showed higher levels of expression of both green fluorescent protein (GFP) as well as ZFNs from IDLVs. A major mechanism for the effects of HDAC inhibitors on improving expression was from their modulation of the cell cycle, and the influence of heterochromatinization was determined to be a lesser contributing factor.

  7. Transgene expression of green fluorescent protein and germ line transmission in cloned pigs derived from in vitro transfected adult fibroblasts.

    PubMed

    Brunetti, Dario; Perota, Andrea; Lagutina, Irina; Colleoni, Silvia; Duchi, Roberto; Calabrese, Fiorella; Seveso, Michela; Cozzi, Emanuele; Lazzari, Giovanna; Lucchini, Franco; Galli, Cesare

    2008-12-01

    The pig represents the xenogeneic donor of choice for future organ transplantation in humans for anatomical and physiological reasons. However, to bypass several immunological barriers, strong and stable human genes expression must occur in the pig's organs. In this study we created transgenic pigs using in vitro transfection of cultured cells combined with somatic cell nuclear transfer (SCNT) to evaluate the ubiquitous transgene expression driven by pCAGGS vector in presence of different selectors. pCAGGS confirmed to be a very effective vector for ubiquitous transgene expression, irrespective of the selector that was used. Green fluorescent protein (GFP) expression observed in transfected fibroblasts was also maintained after nuclear transfer, through pre- and postimplantation development, at birth and during adulthood. Germ line transmission without silencing of the transgene was demonstrated. The ubiquitous expression of GFP was clearly confirmed in several tissues including endothelial cells, thus making it a suitable vector for the expression of multiple genes relevant to xenotransplantation where tissue specificity is not required. Finally cotransfection of green and red fluorescence protein transgenes was performed in fibroblasts and after nuclear transfer blastocysts expressing both fluorescent proteins were obtained.

  8. Repeat Transduction in the Mouse Lung by Using Adeno-Associated Virus Vectors with Different Serotypes

    PubMed Central

    Halbert, Christine L.; Rutledge, Elizabeth A.; Allen, James M.; Russell, David W.; Miller, A. Dusty

    2000-01-01

    Vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in the lung; however, we have found that while gene expression can persist for at least 8 months in mice, it was reduced dramatically in rabbits over a period of 2 months. The efficiency and persistence of AAV2-mediated gene expression in the human lung have yet to be determined, but it seems likely that readministration will be necessary over the lifetime of an individual. Unfortunately, we have found that transduction by a second administration of an AAV2 vector is blocked, presumably due to neutralizing antibodies generated in response to the primary vector exposure. Here, we have explored the use of AAV2 vectors pseudotyped with capsid proteins from AAV serotypes 2, 3, and 6 for readministration in the mouse lung. We found that an AAV6 vector transduced airway epithelial and alveolar cells in the lung at rates that were at least as high as those of AAV2 pseudotype vectors, while transduction rates mediated by AAV3 were much lower. AAV6 pseudotype vector transduction was unaffected by prior administration of an AAV2 or AAV3 vector, and transduction by an AAV2 pseudotype vector was unaffected by prior AAV6 vector administration, showing that cross-reactive neutralizing antibodies against AAV2 and AAV6 are not generated in mice. Interestingly, while prior administration of an AAV2 vector completely blocked transduction by a second AAV2 pseudotype vector, prior administration of an AAV6 vector only partially inhibited transduction by a second administration of an AAV6 pseudotype vector. Analysis of sera obtained from mice and humans showed that AAV6 is less immunogenic than AAV2, which helps explain this finding. These results support the development of AAV6 vectors for lung gene therapy both alone and in combination with AAV2 vectors. PMID:10627564

  9. An Update on Canine Adenovirus Type 2 and Its Vectors

    PubMed Central

    Bru, Thierry; Salinas, Sara; Kremer, Eric J.

    2010-01-01

    Adenovirus vectors have significant potential for long- or short-term gene transfer. Preclinical and clinical studies using human derived adenoviruses (HAd) have demonstrated the feasibility of flexible hybrid vector designs, robust expression and induction of protective immunity. However, clinical use of HAd vectors can, under some conditions, be limited by pre-existing vector immunity. Pre-existing humoral and cellular anti-capsid immunity limits the efficacy and duration of transgene expression and is poorly circumvented by injections of larger doses and immuno-suppressing drugs. This review updates canine adenovirus serotype 2 (CAV-2, also known as CAdV-2) biology and gives an overview of the generation of early region 1 (E1)-deleted to helper-dependent (HD) CAV-2 vectors. We also summarize the essential characteristics concerning their interaction with the anti-HAd memory immune responses in humans, the preferential transduction of neurons, and its high level of retrograde axonal transport in the central and peripheral nervous system. CAV-2 vectors are particularly interesting tools to study the pathophysiology and potential treatment of neurodegenerative diseases, as anti-tumoral and anti-viral vaccines, tracer of synaptic junctions, oncolytic virus and as a platform to generate chimeric vectors. PMID:21994722

  10. Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

    PubMed Central

    Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

    2012-01-01

    Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

  11. Long-Term Behavioral Recovery in Parkinsonian Rats by an HSV Vector Expressing Tyrosine Hydroxylase

    PubMed Central

    Naegele, Janice R.; O’Malley, Karen L.; Geller, Alfred I.

    2006-01-01

    One therapeutic approach to treating Parkinson’s disease is to convert endogenous striatal cells into levo-3,4-dihydroxyphenylalanine (l-dopa)–producing cells. A defective herpes simplex virus type 1 vector expressing human tyrosine hydroxylase was delivered into the partially denervated striatum of 6-hydroxydopamine–lesioned rats, used as a model of Parkinson’s disease. Efficient behavioral and biochemical recovery was maintained for 1 year after gene transfer. Biochemical recovery included increases in both striatal tyrosine hydroxylase enzyme activity and in extracellular dopamine concentrations. Persistence of human tyrosine hydroxylase was revealed by expression of RNA and immunoreactivity. PMID:7669103

  12. Preclinical Demonstration of Lentiviral Vector-mediated Correction of Immunological and Metabolic Abnormalities in Models of Adenosine Deaminase Deficiency

    PubMed Central

    Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby

    2014-01-01

    Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635

  13. Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy.

    PubMed Central

    Gorziglia, M I; Kadan, M J; Yei, S; Lim, J; Lee, G M; Luthra, R; Trapnell, B C

    1996-01-01

    A novel recombinant adenovirus vector, Av3nBg, was constructed with deletions in adenovirus E1, E2a, and E3 regions and expressing a beta-galactosidase reporter gene. Av3nBg can be propagated at a high titer in a corresponding A549-derived cell line, AE1-2a, which contains the adenovirus E1 and E2a region genes inducibly expressed from separate glucocorticoid-responsive promoters. Av3nBg demonstrated gene transfer and expression comparable to that of Av1nBg, a first-generation adenovirus vector with deletions in E1 and E3. Several lines of evidence suggest that this vector is significantly more attenuated than E1 and E3 deletion vectors. Metabolic DNA labeling studies showed no detectable de novo vector DNA synthesis or accumulation, and metabolic protein labeling demonstrated no detectable de novo hexon protein synthesis for Av3nBg in naive A549 cells even at a multiplicity of infection of up to 3,000 PFU per cell. Additionally, naive A549 cells infected by Av3nBg did not accumulate infectious virions. In contrast, both Av1nBg and Av2Lu vectors showed DNA replication and hexon protein synthesis at multiplicities of infection of 500 PFU per cell. Av2Lu has a deletion in E1 and also carries a temperature-sensitive mutation in E2a. Thus, molecular characterization has demonstrated that the Av3nBg vector is improved with respect to the potential for vector DNA replication and hexon protein expression compared with both first-generation (Av1nBg) and second-generation (Av2Lu) adenoviral vectors. These observations may have important implications for potential use of adenovirus vectors in human gene therapy. PMID:8648763

  14. Drop-out phagemid vector for switching from phage displayed affinity reagents to expression formats.

    PubMed

    Pershad, Kritika; Sullivan, Mark A; Kay, Brian K

    2011-05-15

    Affinity reagents that are generated by phage display are typically subcloned into an expression vector for further biochemical characterization. This insert transfer process is time consuming and laborious especially if many inserts are to be subcloned. To simplify the transfer process, we have constructed a "drop-out" phagemid vector that can be rapidly converted to an expression vector by a simple restriction enzyme digestion with MfeI (to "drop-out" the gene III coding sequence), which generates alkaline phosphatase (AP) fusions of the affinity reagents on religation. Subsequently, restriction digestion with AscI drops out the AP coding region and religation generates affinity reagents with a C-terminal six-histidine tag. To validate the usefulness of this vector, four different human single chain Fragments of variable regions (scFv) were tested, three of which show specific binding to three zebrafish (Danio rerio) proteins, namely suppression of tumorigenicity 13, recoverin, and Ppib and the fourth binds to human Lactoferrin protein. For each of the constructs tested, the gene III and AP drop-out efficiency was between 90% and 100%. This vector is especially useful in speeding up the downstream screening of affinity reagents and bypassing the time-consuming subcloning experiments. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Assaying the Stability and Inactivation of AAV Serotype 1 Vectors

    PubMed Central

    Howard, Douglas B.; Harvey, Brandon K.

    2017-01-01

    Adeno-associated virus (AAV) vectors are a commonplace tool for gene delivery ranging from cell culture to human gene therapy. One feature that makes AAV a desirable vector is its stability, in regard to both the duration of transgene expression and retention of infectivity as a viral particle. This study examined the stability of AAV serotype 1 (AAV1) vectors under different conditions. First, transducibility after storage at 4°C decreased 20% over 7 weeks. Over 10 freeze–thaw cycles, the resulting transduction efficiency became variable at 60–120% of a single thaw. Using small stainless steel slugs to mimic a biosafety cabinet or metal lab bench surface, it was found that an AAV1 vector can be reconstituted after 6 days of storage at room temperature. The stability of AAV is a desired feature, but effective decontamination procedures must be available for safety and experimental integrity. Multiple disinfectants commonly used in the laboratory for ability to inactivate an AAV1 vector were tested, and it was found that autoclaving, 0.25% peracetic acid, iodine, or 10% Clorox bleach completely prevented AAV-mediated transgene expression. These data suggest that peracetic acid should be used for inactivating AAV1 vectors on metal-based surfaces or instruments in order to avoid inadvertent transgene expression in human cells or cross-contamination of instruments. PMID:28192678

  16. Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

    PubMed

    Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

    2018-06-21

    Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

  17. [Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

    PubMed

    Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

    2013-08-01

    To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

  18. Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein.

    PubMed

    Kessler, P D; Podsakoff, G M; Chen, X; McQuiston, S A; Colosi, P C; Matelis, L A; Kurtzman, G J; Byrne, B J

    1996-11-26

    Somatic gene therapy has been proposed as a means to achieve systemic delivery of therapeutic proteins. However, there is limited evidence that current methods of gene delivery can practically achieve this goal. In this study, we demonstrate that, following a single intramuscular administration of a recombinant adeno-associated virus (rAAV) vector containing the beta-galactosidase (AAV-lacZ) gene into adult BALB/c mice, protein expression was detected in myofibers for at least 32 weeks. A single intramuscular administration of an AAV vector containing a gene for human erythropoietin (AAV-Epo) into mice resulted in dose-dependent secretion of erythropoietin and corresponding increases in red blood cell production that persisted for up to 40 weeks. Primary human myotubes transduced in vitro with the AAV-Epo vector also showed dose-dependent production of Epo. These results demonstrate that rAAV vectors are able to transduce skeletal muscle and are capable of achieving sustained expression and systemic delivery of a therapeutic protein following a single intramuscular administration. Gene therapy using AAV vectors may provide a practical strategy for the treatment of inherited and acquired protein deficiencies.

  19. Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein

    PubMed Central

    Kessler, Paul D.; Podsakoff, Gregory M.; Chen, Xiaojuan; McQuiston, Susan A.; Colosi, Peter C.; Matelis, Laura A.; Kurtzman, Gary J.; Byrne, Barry J.

    1996-01-01

    Somatic gene therapy has been proposed as a means to achieve systemic delivery of therapeutic proteins. However, there is limited evidence that current methods of gene delivery can practically achieve this goal. In this study, we demonstrate that, following a single intramuscular administration of a recombinant adeno-associated virus (rAAV) vector containing the β-galactosidase (AAV-lacZ) gene into adult BALB/c mice, protein expression was detected in myofibers for at least 32 weeks. A single intramuscular administration of an AAV vector containing a gene for human erythropoietin (AAV-Epo) into mice resulted in dose-dependent secretion of erythropoietin and corresponding increases in red blood cell production that persisted for up to 40 weeks. Primary human myotubes transduced in vitro with the AAV-Epo vector also showed dose-dependent production of Epo. These results demonstrate that rAAV vectors are able to transduce skeletal muscle and are capable of achieving sustained expression and systemic delivery of a therapeutic protein following a single intramuscular administration. Gene therapy using AAV vectors may provide a practical strategy for the treatment of inherited and acquired protein deficiencies. PMID:8943064

  20. The Tol2 transposon system mediates the genetic engineering of T-cells with CD19-specific chimeric antigen receptors for B-cell malignancies.

    PubMed

    Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K

    2015-02-01

    Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.

  1. A lentiviral vector with a short troponin-I promoter for tracking cardiomyocyte differentiation of human embryonic stem cells.

    PubMed

    Gallo, P; Grimaldi, S; Latronico, M V G; Bonci, D; Pagliuca, A; Gallo, P; Ausoni, S; Peschle, C; Condorelli, G

    2008-02-01

    Human embryonic stem cells (hESCs) may become important for cardiac repair due to their potentially unlimited ability to generate cardiomyocytes (CMCs). Moreover, genetic manipulation of hESC-derived CMCs would be a very promising technique for curing myocardial disorders. At the present time, however, inducing the differentiation of hESCs into CMCs is extremely difficult and, therefore, an easy and standardizable technique is needed to evaluate differentiation strategies. Vectors driving cardiac-specific expression may represent an important tool not only for monitoring new cardiac-differentiation strategies, but also for the manipulation of cardiac differentiation of ESCs. To this aim, we generated cardiac-specific lentiviral vectors (LVVs) in which expression is driven by a short fragment of the cardiac troponin-I proximal promoter (TNNI3) with a human cardiac alpha-actin enhancer, and tested its suitability in inducing tissue-specific gene expression and ability to track the CMC lineage during differentiation of ESCs. We determined that (1) TNNI3-LVVs efficiently drive cardiac-specific gene expression and mark the cardiomyogenic lineage in human and mouse ESC differentiation systems (2) the cardiac alpha-actin enhancer confers a further increase in gene-expression specificity of TNNI3-LVVs in hESCs. Although this technique may not be useful in tracking small numbers of cells, data suggested that TNNI3-based LVVs are a powerful tool for manipulating human ESCs and modifying hESC-derived CMCs.

  2. Sustainability of keratinocyte gene transfer and cell survival in vivo.

    PubMed

    Choate, K A; Khavari, P A

    1997-05-20

    The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

  3. A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

    PubMed Central

    Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

    2011-01-01

    Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

  4. Selection of transduced CD34+ progenitors and enzymatic correction of cells from Gaucher patients, with bicistronic vectors.

    PubMed Central

    Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S

    1995-01-01

    The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847

  5. Tissue-Specific Expression of Herpes Simplex Virus Thymidine Kinase Gene Delivered by Adeno-Associated Virus Inhibits the Growth of Human Hepatocellular Carcinoma in Athymic Mice

    NASA Astrophysics Data System (ADS)

    Su, Hua; Lu, Ronghua; Chang, Judy C.; Kan, Yuet Wai

    1997-12-01

    About 70% of hepatocellular carcinomas are known to express α -fetoprotein, which is normally expressed in fetal but not in adult livers. To induce herpes simplex virus-thymidine kinase expression in these cancer cells, we constructed an adeno-associated viral vector containing the HSV-TK gene under the control of the α -fetoprotein enhancer and albumin promoter. We previously demonstrated in vitro that although this vector can transduce a variety of human cells, only transduced AFP and albumin-expressing hepatocellular carcinoma cell lines were sensitive to killing by ganciclovir (GCV). In the present study, we explored the effect of this vector on hepatocellular carcinoma cells in vivo. Subcutaneous tumors generated in nude mice by implanting hepatocellular carcinoma cells previously transduced with this vector shrank dramatically after treatment with GCV. Bystander effect was also observed on the tumors generated by mixing transduced and untransduced cells. To test whether the tumor cells can be transduced by the virus in vivo, we injected the recombinant adeno-associated virus into tumors generated by untransduced hepatocarcinoma cell line. Tumor growth were retarded after treatment with GCV. These experiments demonstrate the feasibility of in vivo transduction of tumor cell with rAAV.

  6. Transducing Airway Basal Cells with a Helper-Dependent Adenoviral Vector for Lung Gene Therapy.

    PubMed

    Cao, Huibi; Ouyang, Hong; Grasemann, Hartmut; Bartlett, Claire; Du, Kai; Duan, Rongqi; Shi, Fushan; Estrada, Marvin; Seigel, Kyle E; Coates, Allan L; Yeger, Herman; Bear, Christine E; Gonska, Tanja; Moraes, Theo J; Hu, Jim

    2018-06-01

    A major challenge in developing gene-based therapies for airway diseases such as cystic fibrosis (CF) is sustaining therapeutic levels of transgene expression over time. This is largely due to airway epithelial cell turnover and the host immunogenicity to gene delivery vectors. Modern gene editing tools and delivery vehicles hold great potential for overcoming this challenge. There is currently not much known about how to deliver genes into airway stem cells, of which basal cells are the major type in human airways. In this study, helper-dependent adenoviral (HD-Ad) vectors were delivered to mouse and pig airways via intranasal delivery, and direct bronchoscopic instillation, respectively. Vector transduction was assessed by immunostaining of lung tissue sections, which revealed that airway basal cells of mice and pigs can be targeted in vivo. In addition, efficient transduction of primary human airway basal cells was verified with an HD-Ad vector expressing green fluorescent protein. Furthermore, we successfully delivered the human CFTR gene to airway basal cells from CF patients, and demonstrated restoration of CFTR channel activity following cell differentiation in air-liquid interface culture. Our results provide a strong rationale for utilizing HD-Ad vectors to target airway basal cells for permanent gene correction of genetic airway diseases.

  7. Gene transfer to the cerebellum.

    PubMed

    Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

    2010-12-01

    There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

  8. Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines

    PubMed Central

    2017-01-01

    Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. PMID:28775971

  9. Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein.

    PubMed

    Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

    2016-08-05

    P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

    PubMed Central

    Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

    2003-01-01

    In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

  11. The Bartonella quintana Extracytoplasmic Function Sigma Factor RpoE Has a Role in Bacterial Adaptation to the Arthropod Vector Environment

    PubMed Central

    Abromaitis, Stephanie

    2013-01-01

    Bartonella quintana is a vector-borne bacterial pathogen that causes fatal disease in humans. During the infectious cycle, B. quintana transitions from the hemin-restricted human bloodstream to the hemin-rich body louse vector. Because extracytoplasmic function (ECF) sigma factors often regulate adaptation to environmental changes, we hypothesized that a previously unstudied B. quintana ECF sigma factor, RpoE, is involved in the transition from the human host to the body louse vector. The genomic context of B. quintana rpoE identified it as a member of the ECF15 family of sigma factors found only in alphaproteobacteria. ECF15 sigma factors are believed to be the master regulators of the general stress response in alphaproteobacteria. In this study, we examined the B. quintana RpoE response to two stressors that are encountered in the body louse vector environment, a decreased temperature and an increased hemin concentration. We determined that the expression of rpoE is significantly upregulated at the body louse (28°C) versus the human host (37°C) temperature. rpoE expression also was upregulated when B. quintana was exposed to high hemin concentrations. In vitro and in vivo analyses demonstrated that RpoE function is regulated by a mechanism involving the anti-sigma factor NepR and the response regulator PhyR. The ΔrpoE ΔnepR mutant strain of B. quintana established that RpoE-mediated transcription is important in mediating the tolerance of B. quintana to high hemin concentrations. We present the first analysis of an ECF15 sigma factor in a vector-borne human pathogen and conclude that RpoE has a role in the adaptation of B. quintana to the hemin-rich arthropod vector environment. PMID:23564167

  12. Modified Newcastle Disease virus as an improved vaccine vector against Simian Immunodeficiency virus.

    PubMed

    Manoharan, Vinoth K; Khattar, Sunil K; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

    2018-06-12

    SIV infection in macaques is a relevant animal model for HIV pathogenesis and vaccine study in humans. To design a safe and effective vaccine against HIV, we evaluated the suitability of naturally-occurring avirulent Newcastle disease virus (NDV) strains and several modified versions of NDV as vectors for the expression and immunogenicity of SIV envelope protein gp160. All the NDV vectors expressed gp160 protein in infected cells. The gp160 expressed by these vectors formed oligomers and was incorporated into the NDV envelope. All the NDV vectors expressing gp160 were attenuated in chickens. Intranasal immunization of guinea pigs with modified NDV vectors such as rNDV-APMV-2CS/gp160 and rNDV-APMV-8CS/gp160 (NDV strain LaSota containing the cleavage site sequences of F protein of avian paramyxovirus (APMV) serotype 2 and 8, respectively), and rNDV-BC-F-HN/gp160 (NDV strain BC containing LaSota F cleavage site and LaSota F and HN genes) elicited improved SIV-specific humoral and mucosal immune responses compared to other NDV vectors. These modified vectors were also efficient in inducing neutralizing antibody responses to tier 1 A SIVmac251.6 and tier 1B SIVmac251/M766 strains. This study suggests that our novel modified NDV vectors are safe and immunogenic and can be used as vaccine vector to control HIV.

  13. A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

    2006-10-06

    We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

  14. Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

    PubMed

    Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

    1998-01-01

    The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

  15. Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F.

    PubMed

    Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D; Graham, Barney S; Collins, Peter L; Munir, Shirin

    2017-11-15

    Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo , resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. Copyright © 2017 American Society for Microbiology.

  16. Efficient generation of transgene-free human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors

    PubMed Central

    Ban, Hiroshi; Nishishita, Naoki; Fusaki, Noemi; Tabata, Toshiaki; Saeki, Koichi; Shikamura, Masayuki; Takada, Nozomi; Inoue, Makoto; Hasegawa, Mamoru; Kawamata, Shin; Nishikawa, Shin-Ichi

    2011-01-01

    After the first report of induced pluripotent stem cells (iPSCs), considerable efforts have been made to develop more efficient methods for generating iPSCs without foreign gene insertions. Here we show that Sendai virus vector, an RNA virus vector that carries no risk of integrating into the host genome, is a practical solution for the efficient generation of safer iPSCs. We improved the Sendai virus vectors by introducing temperature-sensitive mutations so that the vectors could be easily removed at nonpermissive temperatures. Using these vectors enabled the efficient production of viral/factor-free iPSCs from both human fibroblasts and CD34+ cord blood cells. Temperature-shift treatment was more effective in eliminating remaining viral vector-related genes. The resulting iPSCs expressed human embryonic stem cell markers and exhibited pluripotency. We suggest that generation of transgene-free iPSCs from cord blood cells should be an important step in providing allogeneic iPSC-derived therapy in the future. PMID:21821793

  17. Expression of the human blood coagulation protein factor XIIIa in Saccharomyces cerevisiae: dependence of the expression levels from host-vector systems and medium conditions.

    PubMed

    Bröker, M; Bäuml, O; Göttig, A; Ochs, J; Bodenbenner, M; Amann, E

    1991-03-01

    The human blood coagulation protein Factor XIIIa (FXIIIa) was expressed in Saccharomyces cerevisiae employing Escherichia coli-yeast shuttle vectors based on a 2-mu plasmid. Several factors affecting high production yield of recombinant FXIIIa were analysed. The use of the regulatable GAL-CYC1 hybrid promoter resulted in higher FXIIIa expression when compared with the constitutive ADCI promoter. Screening for suitable yeast strains for expression of FXIIIa under the transcriptional control of the GAL-CYC1 hybrid promoter revealed a broad spectrum of productivity. No obvious correlation between the expression rate and the genetic markers of the strains could be identified. The medium composition markedly influenced the FXIIIa expression rates. The expression of FXIIIa was strictly regulated by the carbon source. Glucose as the only sugar and energy source repressed the synthesis of FXIIIa, whereas addition of galactose induced FXIIIa expression. Special feeding schemes resulted in a productivity of up to 100 mg FXIIIa/l in shake flasks.

  18. Targeting both viral and host determinants of human immunodeficiency virus entry, using a new lentiviral vector coexpressing the T20 fusion inhibitor and a selective CCL5 intrakine.

    PubMed

    Petit, Nicolas; Dorgham, Karim; Levacher, Béatrice; Burlion, Aude; Gorochov, Guy; Marodon, Gilles

    2014-08-01

    Numerous strategies targeting early and late steps of the HIV life cycle have been proposed for gene therapy. However, targeting viral and host determinants of HIV entry is the only strategy that would prevent viral DNA-mediated CD4(+) cell death while diminishing the possibility for the virus to escape. To this end, we devised a bicistronic lentiviral vector expressing the membrane-bound form of the T20 fusion inhibitor, referred to as the C46 peptide, and a CCR5 superagonist, modified to sequester CCR5 away from the cell surface, referred to as the P2-CCL5 intrakine. We tested the effects of the vector on HIV infection and replication, using the human CEMR5 cell line expressing CD4 and CCR5, and primary human T cells. Transduced cells expressed the C46 peptide, detected with the 2F5 monoclonal antibody by flow cytometry. Expression of the P2-CCL5 intrakine correlates with lower levels of cell surface CCR5. Complete protection against HIV infection could be observed in cells expressing the protective transgenes. Importantly, we show that the combination of the transgenes was more potent than either transgene alone, showing the interest of expressing two entry inhibitors to inhibit HIV infection. Last, genetically modified cells possessed a selective advantage over nonmodified cells on HIV challenge in vitro, showing that modified cells were protected from HIV-induced cell death. Our results demonstrate that lentiviral vectors coexpressing the T20 fusion inhibitor and the P2-CCL5 intrakine represent promising tools for HIV gene therapy.

  19. Vero/BC-F: an efficient packaging cell line stably expressing F protein to generate single round-infectious human parainfluenza virus type 2 vector.

    PubMed

    Ohtsuka, J; Fukumura, M; Tsurudome, M; Hara, K; Nishio, M; Kawano, M; Nosaka, T

    2014-08-01

    A stable packaging cell line (Vero/BC-F) constitutively expressing fusion (F) protein of the human parainfluenza virus type 2 (hPIV2) was established for production of the F-defective and single round-infectious hPIV2 vector in a strategy for recombinant vaccine development. The F gene expression has not evoked cytostatic or cytotoxic effects on the Vero/BC-F cells and the F protein was physiologically active to induce syncytial formation with giant polykaryocytes when transfected with a plasmid expressing hPIV2 hemagglutinin-neuraminidase (HN). Transduction of the F-defective replicon RNA into the Vero/BC-F cells led to the release of the infectious particles that packaged the replicon RNA (named as hPIV2ΔF) without detectable mutations, limiting the infectivity to a single round. The maximal titer of the hPIV2ΔF was 6.0 × 10(8) median tissue culture infections dose per ml. The influenza A virus M2 gene was inserted into hPIV2ΔF, and the M2 protein was found to be highly expressed in a human lung cancer cell line after transduction. Furthermore, in vivo airway infection experiments revealed that the hPIV2ΔF was capable of delivering transgenes to hamster tracheal cells. Thus, non-transmissible or single round-infectious hPIV2 vector will be potentially applicable to human gene therapy or recombinant vaccine development.

  20. Highly stable maintenance of a mouse artificial chromosome in human cells and mice.

    PubMed

    Kazuki, Kanako; Takehara, Shoko; Uno, Narumi; Imaoka, Natsuko; Abe, Satoshi; Takiguchi, Masato; Hiramatsu, Kei; Oshimura, Mitsuo; Kazuki, Yasuhiro

    2013-12-06

    Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements. Previously, we showed that a MAC vector developed from a natural mouse chromosome by chromosome engineering was more stably maintained in adult tissues and hematopoietic cells in mice than HAC vectors. In this study, to expand the utility for a gene delivery vector in human cells and mice, we investigated the long-term stability of the MACs in cultured human cells and transchromosomic mice. We also investigated the chromosomal copy number-dependent expression of genes on the MACs in mice. The MAC was stably maintained in human HT1080 cells in vitro during long-term culture. The MAC was stably maintained at least to the F8 and F4 generations in ICR and C57BL/6 backgrounds, respectively. The MAC was also stably maintained in hematopoietic cells and tissues derived from old mice. Transchromosomic mice containing two or four copies of the MAC were generated by breeding. The DNA contents were comparable to the copy number of the MACs in each tissue examined, and the expression of the EGFP gene on the MAC was dependent on the chromosomal copy number. Therefore, the MAC vector may be useful not only for gene delivery in mammalian cells but also for animal transgenesis. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

    PubMed Central

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

  2. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    PubMed

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  3. The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector.

    PubMed

    Akbari, Omar S; Antoshechkin, Igor; Amrhein, Henry; Williams, Brian; Diloreto, Race; Sandler, Jeremy; Hay, Bruce A

    2013-09-04

    Mosquitoes are vectors of a number of important human and animal diseases. The development of novel vector control strategies requires a thorough understanding of mosquito biology. To facilitate this, we used RNA-seq to identify novel genes and provide the first high-resolution view of the transcriptome throughout development and in response to blood feeding in a mosquito vector of human disease, Aedes aegypti, the primary vector for Dengue and yellow fever. We characterized mRNA expression at 34 distinct time points throughout Aedes development, including adult somatic and germline tissues, by using polyA+ RNA-seq. We identify a total of 14,238 novel new transcribed regions corresponding to 12,597 new loci, as well as many novel transcript isoforms of previously annotated genes. Altogether these results increase the annotated fraction of the transcribed genome into long polyA+ RNAs by more than twofold. We also identified a number of patterns of shared gene expression, as well as genes and/or exons expressed sex-specifically or sex-differentially. Expression profiles of small RNAs in ovaries, early embryos, testes, and adult male and female somatic tissues also were determined, resulting in the identification of 38 new Aedes-specific miRNAs, and ~291,000 small RNA new transcribed regions, many of which are likely to be endogenous small-interfering RNAs and Piwi-interacting RNAs. Genes of potential interest for transgene-based vector control strategies also are highlighted. Our data have been incorporated into a user-friendly genome browser located at www.Aedes.caltech.edu, with relevant links to Vectorbase (www.vectorbase.org).

  4. Chimeric Bovine/Human Parainfluenza Virus Type 3 Expressing Respiratory Syncytial Virus (RSV) F Glycoprotein: Effect of Insert Position on Expression, Replication, Immunogenicity, Stability, and Protection against RSV Infection

    PubMed Central

    Munir, Shirin; Amaro-Carambot, Emerito; Surman, Sonja; Mackow, Natalie; Yang, Lijuan; Buchholz, Ursula J.; Collins, Peter L.; Schaap-Nutt, Anne

    2014-01-01

    ABSTRACT A recombinant chimeric bovine/human parainfluenza type 3 virus (rB/HPIV3) vector expressing the respiratory syncytial virus (RSV) fusion F glycoprotein previously exhibited disappointing levels of RSV F immunogenicity and genetic stability in children (D. Bernstein et al., Pediatr. Infect. Dis. J. 31:109–114, 2012; C.-F. Yang et al., Vaccine 31:2822–2827, 2013). To investigate parameters that might affect vaccine performance and stability, we constructed and characterized rB/HPIV3 viruses expressing RSV F from the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) genome positions. There was a 30- to 69-fold gradient in RSV F expression from the first to the sixth position. The inserts moderately attenuated vector replication in vitro and in the upper and lower respiratory tracts of hamsters: this was not influenced by the level of RSV F expression and syncytium formation. Surprisingly, inserts in the second, third, and sixth positions conferred increased temperature sensitivity: this was greatest for the third position and was the most attenuating in vivo. Each rB/HPIV3 vector induced a high titer of neutralizing antibodies in hamsters against RSV and HPIV3. Protection against RSV challenge was greater for position 2 than for position 6. Evaluation of insert stability suggested that RSV F is under selective pressure to be silenced during vector replication in vivo, but this was not exacerbated by a high level of RSV F expression and generally involved a small percentage of recovered vector. Vector passaged in vitro accumulated mutations in the HN open reading frame, causing a dramatic increase in plaque size that may have implications for vaccine production and immunogenicity. IMPORTANCE The research findings presented here will be instrumental for improving the design of a bivalent pediatric vaccine for respiratory syncytial virus and parainfluenza virus type 3, two major causes of severe respiratory tract infection in infants and young children. Moreover, this knowledge has general application to the development and clinical evaluation of other mononegavirus vectors and vaccines. PMID:24478424

  5. Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

    PubMed

    Tao, Zhi-Wei; Zou, Ping-An

    2018-06-13

    Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

  6. Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

    PubMed

    Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

    2009-06-04

    Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

  7. Single residue AAV capsid mutation improves transduction of photoreceptors in the Abca4-/- mouse and bipolar cells in the rd1 mouse and human retina ex vivo.

    PubMed

    De Silva, Samantha R; Charbel Issa, Peter; Singh, Mandeep S; Lipinski, Daniel M; Barnea-Cramer, Alona O; Walker, Nathan J; Barnard, Alun R; Hankins, Mark W; MacLaren, Robert E

    2016-11-01

    Gene therapy using adeno-associated viral (AAV) vectors for the treatment of retinal degenerations has shown safety and efficacy in clinical trials. However, very high levels of vector expression may be necessary for the treatment of conditions such as Stargardt disease where a dual vector approach is potentially needed, or in optogenetic strategies for end-stage degeneration in order to achieve maximal light sensitivity. In this study, we assessed two vectors with single capsid mutations, rAAV2/2(Y444F) and rAAV2/8(Y733F) in their ability to transduce retina in the Abca4 -/- and rd1 mouse models of retinal degeneration. We noted significantly increased photoreceptor transduction using rAAV2/8(Y733F) in the Abca4 -/- mouse, in contrast to previous work where vectors tested in this model have shown low levels of photoreceptor transduction. Bipolar cell transduction was achieved following subretinal delivery of both vectors in the rd1 mouse, and via intravitreal delivery of rAAV2/2(Y444F). The successful use of rAAV2/8(Y733F) to target bipolar cells was further validated on human tissue using an ex vivo culture system of retinal explants. Capsid mutant AAV vectors transduce human retinal cells and may be particularly suited to treat retinal degenerations in which high levels of transgene expression are required.

  8. Expression of human electron transfer flavoprotein-ubiquinone oxidoreductase from a baculovirus vector: kinetic and spectral characterization of the human protein.

    PubMed

    Simkovic, Martin; Degala, Gregory D; Eaton, Sandra S; Frerman, Frank E

    2002-06-15

    Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is an iron-sulphur flavoprotein and a component of an electron-transfer system that links 10 different mitochondrial flavoprotein dehydrogenases to the mitochondrial bc1 complex via electron transfer flavoprotein (ETF) and ubiquinone. ETF-QO is an integral membrane protein, and the primary sequences of human and porcine ETF-QO were deduced from the sequences of the cloned cDNAs. We have expressed human ETF-QO in Sf9 insect cells using a baculovirus vector. The cDNA encoding the entire protein, including the mitochondrial targeting sequence, was present in the vector. We isolated a membrane-bound form of the enzyme that has a molecular mass identical with that of the mature porcine protein as determined by SDS/PAGE and has an N-terminal sequence that is identical with that predicted for the mature holoenzyme. These data suggest that the heterologously expressed ETF-QO is targeted to mitochondria and processed to the mature, catalytically active form. The detergent-solubilized protein was purified by ion-exchange and hydroxyapatite chromatography. Absorption and EPR spectroscopy and redox titrations are consistent with the presence of flavin and iron-sulphur centres that are very similar to those in the equivalent porcine and bovine proteins. Additionally, the redox potentials of the two prosthetic groups appear similar to those of the other eukaryotic ETF-QO proteins. The steady-state kinetic constants of human ETF-QO were determined with ubiquinone homologues, a ubiquinone analogue, and with human wild-type ETF and a Paracoccus-human chimaeric ETF as varied substrates. The results demonstrate that this expression system provides sufficient amounts of human ETF-QO to enable crystallization and mechanistic investigations of the iron-sulphur flavoprotein.

  9. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    PubMed

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  10. Overexpression of SASH1 related to the decreased invasion ability of human glioma U251 cells.

    PubMed

    Yang, Liu; Liu, Mei; Gu, Zhikai; Chen, Jianguo; Yan, Yaohua; Li, Jian

    2012-12-01

    The purpose of this study was to investigate the impact of SAM- and SH3-domain containing 1 (SASH1) on the biological behavior of glioma cells, including its effects on cellular growth, proliferation, apoptosis, invasion, and metastasis, and thereby to provide an experimental basis for future therapeutic treatments. A pcDNA3.1-SASH1 eukaryotic expression vector was constructed and transfected into the U251 human glioma cell line. Using the tetrazolium-based colorimetric (MTT) assay, flow cytometry analyses, transwell invasion chamber experiments, and other methods, we examined the impact of SASH1 on the biological behaviors of U251 cells, including effects on viability, cell cycle, apoptosis, and invasion. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-2, MMP-9, and other proteins was observed. Compared to the empty vector and blank control groups, the pcDNA3.1-SASH1 group of U251 cells exhibited significantly reduced cell viability, proliferation, and invasion (p < 0.05), although there was no difference between the empty vector and blank control groups. The pcDNA3.1-SASH1 group demonstrated a significantly higher apoptotic index than did the empty vector and blank control groups (p < 0.05), and the percentage of apoptotic cells was similar between the empty vector and blank control groups. In addition, the pcDNA3.1-SASH1 group expressed significantly lower protein levels of cyclin D1 and MMP-2/9 compared to the control and empty vector groups (p < 0.05) and significantly higher protein levels of caspase-3 than the other two groups (p < 0.05). Cyclin D1, caspase-3, and MMP-2/9 expression was unchanged between the empty vector and blank control groups. SASH1 gene expression might be related to the inhibition of the growth, proliferation, and invasion of U251 cells and the promotion of U251 cells apoptosis.

  11. Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

    PubMed

    Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

    2017-08-01

    Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Modification and identification of a vector for making a large phage antibody library.

    PubMed

    Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing

    2007-11-20

    The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.

  13. RNA interference mediated in human primary cells via recombinant baculoviral vectors.

    PubMed

    Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

    2005-04-01

    The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

  14. A high-level prokaryotic expression system: synthesis of human interleukin 1 alpha and its receptor antagonist.

    PubMed

    Birikh, K R; Lebedenko, E N; Boni, I V; Berlin, Y A

    1995-10-27

    Synthetic intronless genes, coding for human interleukin 1 alpha (IL 1 alpha) and interleukin 1 receptor antagonist (IL1ra), have been expressed efficiently in a specially designed prokaryotic vector, pGMCE (a pGEM1 derivative), where the target gene forms the second part of a two-cistron system. The first part of the system is a translation enhancer-containing mini-cistron, whose termination codon overlaps the start codon of the target gene. In the case of the IL1 alpha gene, the high expression level is largely due to the direct efficient translation initiation at the second cistron, whereas with the IL1ra gene in the same system, the proximal translation initiation region (TIR) provides a high level of coupled expression of the target gene. Thus, pGMCE is a potentially versatile vector for direct prokaryotic expression.

  15. A New Genetic Vaccine Platform Based on an Adeno-Associated Virus Isolated from a Rhesus Macaque ▿

    PubMed Central

    Lin, Jianping; Calcedo, Roberto; Vandenberghe, Luk H.; Bell, Peter; Somanathan, Suryanarayan; Wilson, James M.

    2009-01-01

    We created a hybrid adeno-associated virus (AAV) from two related rhesus macaque isolates, called AAVrh32.33, and evaluated it as a vaccine carrier for human immunodeficiency virus type 1 (HIV-1) and type A influenza virus antigens. The goal was to overcome the limitations of vaccines based on other AAVs, which generate dysfunctional T-cell responses and are inhibited by antibodies found in human sera. Injection of a Gag-expressing AAVrh32.33 vector into mice resulted in a high-quality CD8+ T-cell response. The resulting Gag-specific T cells express multiple cytokines at high levels, including interleukin-2, with many having memory phenotypes; a subsequent boost with an adenovirus vector yielded a brisk expansion of Gag-specific T cells. A priming dose of AAVrh32.33 led to high levels of Gag antibodies, which exceed levels found after injection of adenovirus vectors. Importantly, passive transfer of pooled human immunoglobulin into mice does not interfere with the efficacy of AAVrh32.33 expressing nucleoproteins from influenza virus, as measured by protection to a lethal dose of influenza virus, which is consistent with the very low seroprevalence to this virus in humans. Studies of macaques with vectors expressing gp140 from HIV-1 (i.e., with AAVrh32.33 as the prime and simian adenovirus type 24 as the boost) demonstrated results similar to those for mice with high-level and high-quality CD8+ T-cell responses to gp140 and high-titered neutralizing antibodies to homologous HIV-1. The biology of this novel AAV hybrid suggests that it should be a preferred genetic vaccine carrier, capable of generating robust T- and B-cell responses. PMID:19812149

  16. In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

    PubMed

    Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

    2008-01-01

    Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

  17. Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

    NASA Astrophysics Data System (ADS)

    Lau, Yun-Fai; Kan, Yuet Wai

    1983-09-01

    We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

  18. A genetically adjuvanted influenza B virus vector increases immunogenicity and protective efficacy in mice.

    PubMed

    Kittel, Christian; Wressnigg, Nina; Shurygina, Anna Polina; Wolschek, Markus; Stukova, Marina; Romanovskaya-Romanko, Ekatherina; Romanova, Julia; Kiselev, Oleg; Muster, Thomas; Egorov, Andrej

    2015-10-01

    The existence of multiple antigenically distinct types and subtypes of influenza viruses allows the construction of a multivalent vector system for the mucosal delivery of foreign sequences. Influenza A viruses have been exploited successfully for the expression of extraneous antigens as well as immunostimulatory molecules. In this study, we describe the development of an influenza B virus vector whose functional part of the interferon antagonist NS1 was replaced by human interleukin 2 (IL2) as a genetic adjuvant. We demonstrate that IL2 expressed by this viral vector displays immune adjuvant activity in immunized mice. Animals vaccinated with the IL2 viral vector showed an increased hemagglutination inhibition antibody response and higher protective efficacy after challenge with a wild-type influenza B virus when compared to mice vaccinated with a control virus. Our results demonstrate that it is feasible to construct influenza B vaccine strains expressing immune-potentiating foreign sequences from the NS genomic segment. Based on these data, it is now hypothetically possible to create a trivalent (or quadrivalent) live attenuated influenza vaccine in which each component expresses a selected genetic adjuvant with tailored expression levels.

  19. In situ reprogramming to transdifferentiate fibroblasts into cardiomyocytes using adenoviral vectors: Implications for clinical myocardial regeneration.

    PubMed

    Mathison, Megumi; Singh, Vivek P; Chiuchiolo, Maria J; Sanagasetti, Deepthi; Mao, Yun; Patel, Vivekkumar B; Yang, Jianchang; Kaminsky, Stephen M; Crystal, Ronald G; Rosengart, Todd K

    2017-02-01

    The reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells improves ventricular function in myocardial infarction models. Only integrating persistent expression vectors have thus far been used to induce reprogramming, potentially limiting its clinical applicability. We therefore tested the reprogramming potential of nonintegrating, acute expression adenoviral (Ad) vectors. Ad or lentivirus vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) were validated in vitro. Sprague-Dawley rats then underwent coronary ligation and Ad-mediated administration of vascular endothelial growth factor to generate infarct prevascularization. Three weeks later, animals received Ad or lentivirus encoding G, M, or T (AdGMT or LentiGMT) or an equivalent dose of a null vector (n = 11, 10, and 10, respectively). Outcomes were analyzed by echocardiography, magnetic resonance imaging, and histology. Ad and lentivirus vectors provided equivalent G, M, and T expression in vitro. AdGMT and LentiGMT both likewise induced expression of the cardiomyocyte marker cardiac troponin T in approximately 6% of cardiac fibroblasts versus <1% cardiac troponin T expression in AdNull (adenoviral vector that does not encode a transgene)-treated cells. Infarcted myocardium that had been treated with AdGMT likewise demonstrated greater density of cells expressing the cardiomyocyte marker beta myosin heavy chain 7 compared with AdNull-treated animals. Echocardiography demonstrated that AdGMT and LentiGMT both increased ejection fraction compared with AdNull (AdGMT: 21% ± 3%, LentiGMT: 14% ± 5%, AdNull: -0.4% ± 2%; P < .05). Ad vectors are at least as effective as lentiviral vectors in inducing cardiac fibroblast transdifferentiation into induced cardiomyocyte-like cells and improving cardiac function in postinfarct rat hearts. Short-term expression Ad vectors may represent an important means to induce cardiac cellular reprogramming in humans. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

  20. VectorBase: a data resource for invertebrate vector genomics

    PubMed Central

    Lawson, Daniel; Arensburger, Peter; Atkinson, Peter; Besansky, Nora J.; Bruggner, Robert V.; Butler, Ryan; Campbell, Kathryn S.; Christophides, George K.; Christley, Scott; Dialynas, Emmanuel; Hammond, Martin; Hill, Catherine A.; Konopinski, Nathan; Lobo, Neil F.; MacCallum, Robert M.; Madey, Greg; Megy, Karine; Meyer, Jason; Redmond, Seth; Severson, David W.; Stinson, Eric O.; Topalis, Pantelis; Birney, Ewan; Gelbart, William M.; Kafatos, Fotis C.; Louis, Christos; Collins, Frank H.

    2009-01-01

    VectorBase (http://www.vectorbase.org) is an NIAID-funded Bioinformatic Resource Center focused on invertebrate vectors of human pathogens. VectorBase annotates and curates vector genomes providing a web accessible integrated resource for the research community. Currently, VectorBase contains genome information for three mosquito species: Aedes aegypti, Anopheles gambiae and Culex quinquefasciatus, a body louse Pediculus humanus and a tick species Ixodes scapularis. Since our last report VectorBase has initiated a community annotation system, a microarray and gene expression repository and controlled vocabularies for anatomy and insecticide resistance. We have continued to develop both the software infrastructure and tools for interrogating the stored data. PMID:19028744

  1. Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

    PubMed

    Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

    2015-04-01

    Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

  2. VectorBase: an updated bioinformatics resource for invertebrate vectors and other organisms related with human diseases

    PubMed Central

    Giraldo-Calderón, Gloria I.; Emrich, Scott J.; MacCallum, Robert M.; Maslen, Gareth; Dialynas, Emmanuel; Topalis, Pantelis; Ho, Nicholas; Gesing, Sandra; Madey, Gregory; Collins, Frank H.; Lawson, Daniel

    2015-01-01

    VectorBase is a National Institute of Allergy and Infectious Diseases supported Bioinformatics Resource Center (BRC) for invertebrate vectors of human pathogens. Now in its 11th year, VectorBase currently hosts the genomes of 35 organisms including a number of non-vectors for comparative analysis. Hosted data range from genome assemblies with annotated gene features, transcript and protein expression data to population genetics including variation and insecticide-resistance phenotypes. Here we describe improvements to our resource and the set of tools available for interrogating and accessing BRC data including the integration of Web Apollo to facilitate community annotation and providing Galaxy to support user-based workflows. VectorBase also actively supports our community through hands-on workshops and online tutorials. All information and data are freely available from our website at https://www.vectorbase.org/. PMID:25510499

  3. [Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

    PubMed

    Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

    2006-06-01

    To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was tested by indirect ELISA in mother mouse, the infectious virus was separated with the method of virus separation, and pp65 antigen was checked up by indirect immunofluorescence staining in fetal mouse. Results showed differential antibody of anti-HCMV pp65 was produced in mouse model. Tilter of the antibody was from 1:2.51 to 1:50.79. Results of virus separation and pp65 checkup of fetal mouse brain tissue were negative. So the conclusion can be reached that pEGFP-C1-UL83 as DNA vaccine in vivo has sheltered effect which can prevent HCMV vertical transmission from mother mouse to her fetus.

  4. Evolution of mosquito preference for humans linked to an odorant receptor

    PubMed Central

    McBride, Carolyn S.; Baier, Felix; Omondi, Aman B.; Spitzer, Sarabeth A.; Lutomiah, Joel; Sang, Rosemary; Ignell, Rickard; Vosshall, Leslie B.

    2014-01-01

    Female mosquitoes are major vectors of human disease and the most dangerous are those that preferentially bite humans. A ‘domestic’ form of the mosquito Aedes aegypti has evolved to specialize in biting humans and is the major worldwide vector of dengue, yellow fever, and Chikungunya viruses. The domestic form coexists with an ancestral, animal-biting ‘forest’ form along the coast of Kenya. We collected the two forms, established laboratory colonies, and document striking divergence in preference for human versus animal odour. We further show that the evolution of preference for human odour in domestic mosquitoes is tightly linked to increases in the expression and ligand-sensitivity of the odorant receptor AaegOr4, which we found recognises a compound present at high levels in human odour. Our results provide a rare example of a gene contributing to behavioural evolution and provide insight into how disease-vectoring mosquitoes came to specialise on humans. PMID:25391959

  5. HSV Recombinant Vectors for Gene Therapy

    PubMed Central

    Manservigi, Roberto; Argnani, Rafaela; Marconi, Peggy

    2010-01-01

    The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), has allowed the development of potential replication-competent and replication-defective vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous systems, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases, and targeted infection to specific tissues or organs. Replication-defective recombinant vectors are non-toxic gene transfer tools that preserve most of the neurotropic features of wild type HSV-1, particularly the ability to express genes after having established latent infections, and are thus proficient candidates for therapeutic gene transfer settings in neurons. A replication-defective HSV vector for the treatment of pain has recently entered in phase 1 clinical trial. Replication-competent (oncolytic) vectors are becoming a suitable and powerful tool to eradicate brain tumours due to their ability to replicate and spread only within the tumour mass, and have reached phase II/III clinical trials in some cases. The progress in understanding the host immune response induced by the vector is also improving the use of HSV as a vaccine vector against both HSV infection and other pathogens. This review briefly summarizes the obstacle encountered in the delivery of HSV vectors and examines the various strategies developed or proposed to overcome such challenges. PMID:20835362

  6. Human XPA and XRCC1 DNA repair proteins expressed in yeast, Saccharomyces cerevisiae.

    PubMed

    Pushnova, E A; Ostanin, K; Thelen, M P

    2001-11-01

    Human XPA and XRCC1 DNA repair proteins have been expressed in a series of novel yeast episomal vectors. Expression of XPA cDNA resulted in synthesis of anti-XPA crossreacting polypeptides of 40 and 42 kDa, the status of the native protein found in human cells. Likewise, the majority of the recombinant XRCC1 found in the yeast intracellular fraction corresponded to the molecular mass of the full-length human protein. Recombinant XPA protein expressed as an NH(2)-terminal polyhistidine fusion could be affinity purified using Ni(2+) agarose. Copyright 2001 Academic Press.

  7. Effects of the deletion of early region 4 (E4) open reading frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on virus-host cell interaction, transgene expression, and immunogenicity of replicating adenovirus HIV vaccine vectors.

    PubMed

    Thomas, Michael A; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A; Venzon, David; Robert-Guroff, Marjorie

    2013-01-01

    The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector.

  8. Effects of the Deletion of Early Region 4 (E4) Open Reading Frame 1 (orf1), orf1-2, orf1-3 and orf1-4 on Virus-Host Cell Interaction, Transgene Expression, and Immunogenicity of Replicating Adenovirus HIV Vaccine Vectors

    PubMed Central

    Thomas, Michael A.; Song, Rui; Demberg, Thorsten; Vargas-Inchaustegui, Diego A.; Venzon, David; Robert-Guroff, Marjorie

    2013-01-01

    The global health burden engendered by human immunodeficiency virus (HIV)-induced acquired immunodeficiency syndrome (AIDS) is a sobering reminder of the pressing need for a preventative vaccine. In non-human primate models replicating adenovirus (Ad)-HIV/SIV recombinant vaccine vectors have been shown to stimulate potent immune responses culminating in protection against challenge exposures. Nonetheless, an increase in the transgene carrying capacity of these Ad vectors, currently limited to approximately 3000 base pairs, would greatly enhance their utility. Using a replicating, E3-deleted Ad type 5 host range mutant (Ad5 hr) encoding full-length single-chain HIVBaLgp120 linked to the D1 and D2 domains of rhesus macaque CD4 (rhFLSC) we systematically deleted the genes encoding early region 4 open reading frame 1 (E4orf1) through E4orf4. All the Ad-rhFLSC vectors produced similar levels of viral progeny. Cell cycle analysis of infected human and monkey cells revealed no differences in virus-host interaction. The parental and E4-deleted viruses expressed comparable levels of the transgene with kinetics similar to Ad late proteins. Similar levels of cellular immune responses and transgene-specific antibodies were elicited in vaccinated mice. However, differences in recognition of Ad proteins and induced antibody subtypes were observed, suggesting that the E4 gene products might modulate antibody responses by as yet unknown mechanisms. In short, we have improved the transgene carrying capacity by one thousand base pairs while preserving the replicability, levels of transgene expression, and immunogenicity critical to these vaccine vectors. This additional space allows for flexibility in vaccine design that could not be obtained with the current vector and as such should facilitate the goal of improving vaccine efficacy. To the best of our knowledge, this is the first report describing the effects of these E4 deletions on transgene expression and immunogenicity in a replicating Ad vector. PMID:24143187

  9. Facial Expression Recognition using Multiclass Ensemble Least-Square Support Vector Machine

    NASA Astrophysics Data System (ADS)

    Lawi, Armin; Sya'Rani Machrizzandi, M.

    2018-03-01

    Facial expression is one of behavior characteristics of human-being. The use of biometrics technology system with facial expression characteristics makes it possible to recognize a person’s mood or emotion. The basic components of facial expression analysis system are face detection, face image extraction, facial classification and facial expressions recognition. This paper uses Principal Component Analysis (PCA) algorithm to extract facial features with expression parameters, i.e., happy, sad, neutral, angry, fear, and disgusted. Then Multiclass Ensemble Least-Squares Support Vector Machine (MELS-SVM) is used for the classification process of facial expression. The result of MELS-SVM model obtained from our 185 different expression images of 10 persons showed high accuracy level of 99.998% using RBF kernel.

  10. Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

    PubMed

    Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M

    2007-05-01

    Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

  11. A novel intranuclear RNA vector system for long-term stem cell modification

    PubMed Central

    Ikeda, Yasuhiro; Makino, Akiko; Matchett, William E.; Holditch, Sara J.; Lu, Brian; Dietz, Allan B.; Tomonaga, Keizo

    2015-01-01

    Genetically modified stem and progenitor cells have emerged as a promising regenerative platform in the treatment of genetic and degenerative disorders, highlighted by their successful therapeutic use in inherent immunodeficiencies. However, biosafety concerns over insertional mutagenesis resulting from integrating recombinant viral vectors have overshadowed the widespread clinical applications of genetically modified stem cells. Here, we report an RNA-based episomal vector system, amenable for long-term transgene expression in stem cells. Specifically, we used a unique intranuclear RNA virus, Borna disease virus (BDV), as the gene transfer vehicle, capable of persistent infections in various cell types. BDV-based vectors allowed for long-term transgene expression in mesenchymal stem cells (MSCs) without affecting cellular morphology, cell surface CD105 expression, or the adipogenicity of MSCs. Similarly, replication-defective BDV vectors achieved long-term transduction of human induced pluripotent stem cells (iPSCs), while maintaining the ability to differentiate into three embryonic germ layers. Thus, the BDV-based vectors offer a genomic modification-free, episomal RNA delivery system for sustained stem cell transduction. PMID:26632671

  12. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer.

    PubMed

    Buchlis, George; Podsakoff, Gregory M; Radu, Antonetta; Hawk, Sarah M; Flake, Alan W; Mingozzi, Federico; High, Katherine A

    2012-03-29

    In previous work we transferred a human factor IX-encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer.

  13. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer

    PubMed Central

    Buchlis, George; Podsakoff, Gregory M.; Radu, Antonetta; Hawk, Sarah M.; Flake, Alan W.; Mingozzi, Federico

    2012-01-01

    In previous work we transferred a human factor IX–encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer. PMID:22271447

  14. A host-restricted viral vector for antigen-specific immunization against Lyme disease pathogen.

    PubMed

    Xiao, Sa; Kumar, Manish; Yang, Xiuli; Akkoyunlu, Mustafa; Collins, Peter L; Samal, Siba K; Pal, Utpal

    2011-07-18

    Newcastle disease virus (NDV) is an avian virus that is attenuated in primates and is a potential vaccine vector for human use. We evaluated NDV as a vector for expressing selected antigens of the Lyme disease pathogen Borrelia burgdorferi. A series of recombinant NDVs were generated that expressed intracellular or extracellular forms of two B. burgdorferi antigens: namely, the basic membrane protein A (BmpA) and the outer surface protein C (OspC). Expression of the intracellular and extracellular forms of these antigens was confirmed in cultured chicken cells. C3H or Balb/C mice that were immunized intranasally with the NDV vectors mounted vigorous serum antibody responses against the NDV vector, but failed to mount a robust response against either the intracellular or extracellular forms of BmpA or OspC. By contrast, a single immunization of hamsters with the NDV vectors via the intranasal, intramuscular, or intraperitoneal route resulted in rapid and rigorous antibody responses against the intracellular or extracellular forms of BmpA and OspC. When groups of hamsters were separately inoculated with various NDV vectors and challenged with B. burgdorferi (10(8)cells/animal), immunization with vector expressing either intracellular or extracellular BmpA was associated with a significant reduction of the pathogen load in the joints. Taken together, our studies highlighted the importance of NDV as vaccine vector that can be used for simple yet effective immunization of hosts against bacterial infections including Lyme disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. [Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

    PubMed

    Peng, Dongxian; He, Yuanli

    2015-02-01

    To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

  16. Support vector machine for automatic pain recognition

    NASA Astrophysics Data System (ADS)

    Monwar, Md Maruf; Rezaei, Siamak

    2009-02-01

    Facial expressions are a key index of emotion and the interpretation of such expressions of emotion is critical to everyday social functioning. In this paper, we present an efficient video analysis technique for recognition of a specific expression, pain, from human faces. We employ an automatic face detector which detects face from the stored video frame using skin color modeling technique. For pain recognition, location and shape features of the detected faces are computed. These features are then used as inputs to a support vector machine (SVM) for classification. We compare the results with neural network based and eigenimage based automatic pain recognition systems. The experiment results indicate that using support vector machine as classifier can certainly improve the performance of automatic pain recognition system.

  17. Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

    PubMed Central

    Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

    2013-01-01

    Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

  18. Mechanisms of inhibition of growth of human pancreatic carcinoma implanted in nude mice by somatostatin receptor subtype 2.

    PubMed

    Kumar, Manoj; Liu, Zheng-Ren; Thapa, Laxmi; Wang, Da-Yu; Tian, Rui; Qin, Ren-Yi

    2004-08-01

    Several studies reported that somatostatin receptor subtypes, especially subtype 2 (SSTR2), exerted their cytostatic and/or cytotoxic effects on various types of tumors. The aim of this study was to investigate the antitumor effect of SSTR2 gene transfer to the pancreatic cancer cell line PC-3 and the mechanisms involved in this effect. The full-length human SSTR2 cDNA was introduced into pancreatic cancer cell line PC-3 by lipofectamine-mediated transfection; positive clones were screened by G418, and stable expression of SSTR2 was detected by the immunohistochemical SABC method and RT-PCR. Athymic mice were separately xenografted with SSTR2-expressing cells (experimental group), vector control, and mock control cells. TUNEL assay was used to determine the apoptotic index (AI) in the tumors of these groups. The immunohistochemical SP method was used to determine expression of apoptosis-regulating genes Bcl-2 and Bax and re-expression of SSTR2 and to assess intratumoral microvessel density (MVD). Moreover, tumor volume and weight were compared among these 3 groups. Restoration of SSTR2 was observed in the experimental group both in vitro and in vivo. The AI was significantly higher in the experimental group (3.39 +/- 0.84%) compared with that in the vector control (0.69 +/- 0.08%) and mock control (0.68 +/- 0.09%) (P < 0.05). MVD was significantly lower in the experimental group (6.30 +/- 1.71) than that in the vector control (12.64 +/- 1.69) and mock control (13.50 +/- 1.86) (P < 0.05). Furthermore, a significant decrease in Bcl-2 and increase in Bax protein expression were detected in the experimental group compared with the vector control and mock control (P < 0.05). A significant negative correlation of protein expression between Bcl-2/Bax ratio and SSTR2 was observed in these tumors (P < 0.05). Tumor volume and weight were significantly decreased in the experimental group compared with the vector control and mock control (P < 0.05) groups. However, no significant differences were observed between the vector control and mock control (P > 0.05). Re-expression of the SSTR2 gene, the expression of which is frequently lost in human pancreatic adenocarcinoma, induces apoptosis, which may be mediated via down-regulation of Bcl-2 and up-regulation of Bax (alteration of Bcl-2/Bax ratio) and inhibits tumor angiogenesis in pancreatic carcinoma, resulting in inhibition of tumor growth.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gokumakulapalle, Madhuri; Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se

    The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were asmore » capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.« less

  20. Human gene therapy: a brief overview of the genetic revolution.

    PubMed

    Misra, Sanjukta

    2013-02-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The prelude to successful gene therapy i.e. the efficient transfer and expression of a variety of human gene into target cells has already been accomplished in several systems. Safe methods have been devised to do this, using several viral and no-viral vectors. Two main approaches emerged: in vivo modification and ex vivo modification. Retrovirus, adenovirus, adeno-associated virus are suitable for gene therapeutic approaches which are based on permanent expression of the therapeutic gene. Non-viral vectors are far less efficient than viral vectors, but they have advantages due to their low immunogenicity and their large capacity for therapeutic DNA. To improve the function of non-viral vectors, the addition of viral functions such as receptor mediated uptake and nuclear translocation of DNA may finally lead to the development of an artificial virus. Gene transfer protocols have been approved for human use in inherited diseases, cancers and acquired disorders. In 1990, the first successful clinical trial of gene therapy was initiated for adenosine deaminase deficiency. Since then, the number of clinical protocols initiated worldwide has increased exponentially. Although preliminary results of these trials are somewhat disappointing, but human gene therapy dreams of treating diseases by replacing or supplementing the product of defective or introducing novel therapeutic genes. So definitely human gene therapy is an effective addition to the arsenal of approaches to many human therapies in the 21st century.

  1. Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

    PubMed

    Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

    2002-05-01

    Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

  2. [Sendai virus vector: vector development and its application to health care and biotechnology].

    PubMed

    Iida, Akihiro

    2007-06-01

    Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

  3. Efficacy and safety of a clinically relevant foamy vector design in human hematopoietic repopulating cells.

    PubMed

    Everson, Elizabeth M; Hocum, Jonah D; Trobridge, Grant D

    2018-06-23

    Previous studies have shown that foamy viral (FV) vectors are a promising alternative to gammaretroviral and lentiviral vectors and insulators can improve FV vector safety. However, in a previous analysis of insulator effects on FV vector safety, strong viral promoters were used to elicit genotoxic events. Here we developed and analyzed the efficacy and safety of a high-titer, clinically relevant FV vector driven by the housekeeping promoter elongation factor-1α and insulated with an enhancer blocking A1 insulator (FV-EGW-A1). Human CD34 + cord blood cells were exposed to an enhanced green fluorescent protein expressing vector, FV-EGW-A1, at a multiplicity of infection of 10 and then maintained in vitro or transplanted into immunodeficient mice. Flow cytometry was used to measure engraftment and marking in vivo. FV vector integration sites were analyzed to assess safety. FV-EGW-A1 resulted in high-marking, multi-lineage engraftment of human repopulating cells with no evidence of silencing. Engraftment was highly polyclonal with no clonal dominance and a promising safety profile based on integration site analysis. An FV vector with an elongation factor-1α promoter and an A1 insulator is a promising vector design for use in the clinic. This article is protected by copyright. All rights reserved.

  4. Cytokine-independent growth and clonal expansion of a primary human CD8+ T-cell clone following retroviral transduction with the IL-15 gene

    PubMed Central

    Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.

    2007-01-01

    Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346

  5. Assessing the potential for AAV vector genotoxicity in a murine model

    PubMed Central

    Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

    2011-01-01

    Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

  6. Regulated Expression of Adenoviral Vectors-Based Gene Therapies

    PubMed Central

    Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.

    2008-01-01

    Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649

  7. Vaccination With a Highly Attenuated Recombinant Vesicular Stomatitis Virus Vector Protects Against Challenge With a Lethal Dose of Ebola Virus

    PubMed Central

    Matassov, Demetrius; Marzi, Andrea; Latham, Terri; Xu, Rong; Ota-Setlik, Ayuko; Feldmann, Friederike; Geisbert, Joan B.; Mire, Chad E.; Hamm, Stefan; Nowak, Becky; Egan, Michael A.; Geisbert, Thomas W.; Eldridge, John H.; Feldmann, Heinz; Clarke, David K.

    2015-01-01

    Previously, recombinant vesicular stomatitis virus (rVSV) pseudotypes expressing Ebolavirus glycoproteins (GPs) in place of the VSV G protein demonstrated protection of nonhuman primates from lethal homologous Ebolavirus challenge. Those pseudotype vectors contained no additional attenuating mutations in the rVSV genome. Here we describe rVSV vectors containing a full complement of VSV genes and expressing the Ebola virus (EBOV) GP from an additional transcription unit. These rVSV vectors contain the same combination of attenuating mutations used previously in the clinical development pathway of an rVSV/human immunodeficiency virus type 1 vaccine. One of these rVSV vectors (N4CT1-EBOVGP1), which expresses membrane-anchored EBOV GP from the first position in the genome (GP1), elicited a balanced cellular and humoral GP-specific immune response in mice. Guinea pigs immunized with a single dose of this vector were protected from any signs of disease following lethal EBOV challenge, while control animals died in 7–9 days. Subsequently, N4CT1-EBOVGP1 demonstrated complete, single-dose protection of 2 macaques following lethal EBOV challenge. A single sham-vaccinated macaque died from disease due to EBOV infection. These results demonstrate that highly attenuated rVSV vectors expressing EBOV GP may provide safer alternatives to current EBOV vaccines. PMID:26109675

  8. RGD capsid modification enhances mucosal protective immunity of a non-human primate adenovirus vector expressing Pseudomonas aeruginosa OprF

    PubMed Central

    Krause, A; Whu, W Z; Qiu, J; Wafadari, D; Hackett, N R; Sharma, A; Crystal, R G; Worgall, S

    2013-01-01

    Replication-deficient adenoviral (Ad) vectors of non-human serotypes can serve as Ad vaccine platforms to circumvent pre-existing anti-human Ad immunity. We found previously that, in addition to that feature, a non-human primate-based AdC7 vector expressing outer membrane protein F of P. aeruginosa (AdC7OprF) was more potent in inducing lung mucosal and protective immunity compared to a human Ad5-based vector. In this study we analysed if genetic modification of the AdC7 fibre to display an integrin-binding arginine–glycine–aspartic acid (RGD) sequence can further enhance lung mucosal immunogenicity of AdC7OprF. Intratracheal immunization of mice with either AdC7OprF.RGD or AdC7OprF induced robust serum levels of anti-OprF immunoglobulin (Ig)G up to 12 weeks that were higher compared to immunization with the human vectors Ad5OprF or Ad5OprF.RGD. OprF-specific cellular responses in lung T cells isolated from mice immunized with AdC7OprF.RGD and AdC7OprF were similar for T helper type 1 (Th1) [interferon (IFN)-γ in CD8+ and interleukin (IL)-12 in CD4+], Th2 (IL-4, IL-5 and IL-13 in CD4+) and Th17 (IL-17 in CD4+). Interestingly, AdC7OprF.RGD induced more robust protective immunity against pulmonary infection with P. aeruginosa compared to AdC7OprF or the control Ad5 vectors. The enhanced protective immunity induced by AdC7OprF.RGD was maintained in the absence of alveolar macrophages (AM) or CD1d natural killer T cells. Together, the data suggest that addition of RGD to the fibre of an AdC7-based vaccine is useful to enhance its mucosal protective immunogenicity. PMID:23607394

  9. Genetic engineering of human embryonic stem cells with lentiviral vectors.

    PubMed

    Xiong, Chen; Tang, Dong-Qi; Xie, Chang-Qing; Zhang, Li; Xu, Ke-Feng; Thompson, Winston E; Chou, Wayne; Gibbons, Gary H; Chang, Lung-Ji; Yang, Li-Jun; Chen, Yuqing E

    2005-08-01

    Human embryonic stem (hES) cells present a valuable source of cells with a vast therapeutic potential. However, the low efficiency of directed differentiation of hES cells remains a major obstacle in their uses for regenerative medicine. While differentiation may be controlled by the genetic manipulation, effective and efficient gene transfer into hES cells has been an elusive goal. Here, we show stable and efficient genetic manipulations of hES cells using lentiviral vectors. This method resulted in the establishment of stable gene expression without loss of pluripotency in hES cells. In addition, lentiviral vectors were effective in conveying the expression of an U6 promoter-driven small interfering RNA (siRNA), which was effective in silencing its specific target. Taken together, our results suggest that lentiviral gene delivery holds great promise for hES cell research and application.

  10. Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

    PubMed Central

    Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

    2008-01-01

    Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

  11. Resistance to human immunodeficiency virus type 1 (HIV-1) generated by lentivirus vector-mediated delivery of the CCR5Δ32 gene despite detectable expression of the HIV-1 co-receptors

    PubMed Central

    Jin, Qingwen; Marsh, Jon; Cornetta, Kenneth; Alkhatib, Ghalib

    2009-01-01

    It has previously been demonstrated that there are two distinct mechanisms for genetic resistance to human immunodeficiency virus type 1 (HIV-1) conferred by the CCR5Δ32 gene: the loss of wild-type CCR5 surface expression and the generation of CCR5Δ32 protein, which interacts with CXCR4. To analyse the protective effects of long-term expression of the CCR5Δ32 protein, recombinant lentiviral vectors were used to deliver the CCR5Δ32 gene into human cell lines and primary peripheral blood mononuclear cells that had been immortalized by human T-cell leukemia virus type 1. Blasticidin S-resistant cell lines expressing the lentivirus-encoded CCR5Δ32 showed a significant reduction in HIV-1 Env-mediated fusion assays. It was shown that CD4+ T lymphocytes expressing the lentivirus-encoded CCR5Δ32 gene were highly resistant to infection by a primary but not by a laboratory-adapted X4 strain, suggesting different infectivity requirements. In contrast to previous studies that analysed the CCR5Δ32 protective effects in a transient expression system, this study showed that long-term expression of CCR5Δ32 conferred resistance to HIV-1 despite cell-surface expression of the HIV co-receptors. The results suggest an additional unknown mechanism for generating the CCR5Δ32 resistance phenotype and support the hypothesis that the CCR5Δ32 protein acts as an HIV-suppressive factor by altering the stoichiometry of the molecules involved in HIV-1 entry. The lentiviral-CCR5Δ32 vectors offer a method of generating HIV-resistant cells by delivery of the CCR5Δ32 gene that may be useful for stem cell- or T-cell-based gene therapy for HIV-1 infection. PMID:18796731

  12. Protection of Non-Human Primates against Rabies with an Adenovirus Recombinant Vaccine

    PubMed Central

    Xiang, Z.Q.; Greenberg, L.; Ertl, H. C.; Rupprecht, C.E.

    2014-01-01

    Rabies remains a major neglected global zoonosis. New vaccine strategies are needed for human rabies prophylaxis. A single intramuscular immunization with a moderate dose of an experimental chimpanzee adenovirus (Ad) vector serotype SAd-V24, also termed AdC68, expressing the rabies virus glycoprotein, resulted in sustained titers of rabies virus neutralizing antibodies and protection against a lethal rabies virus challenge infection in a non-human primate model. Taken together, these data demonstrate the safety, immunogenicity, and efficacy of the recombinant Ad-rabies vector for further consideration in human clinical trials. PMID:24503087

  13. [Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

    PubMed

    Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

    2014-03-01

    To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

  14. [Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

    PubMed

    Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

    2014-06-01

    This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

  15. Posttranscriptional mRNA processing as a mechanism for regulation of human A1 adenosine receptor expression.

    PubMed Central

    Ren, H; Stiles, G L

    1994-01-01

    The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148

  16. Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

    PubMed

    Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

    2000-12-01

    Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

  17. Construction of Expression Vector for Anti-Alpha-Fetoprotein Gene and Its Inhibition Effects on Alpha-Fetoprotein Positive Hepg2 Cells

    NASA Astrophysics Data System (ADS)

    Wang, Ze; Zhang, Hui

    As research previously demonstrated, suppression of AFP expression or its biological activities might inhibit the proliferation of AFP positive human hepatocellular carcinoma cells. In this study, we constructed an anti-AFP gene vector and transfected it to HepG2 cells. RT-PCR showed AFP gene expression in the transfected cells was reduced. MTT assay suggested the proliferation of the transfected cells was also inhibited comparing with the untransfected cells. This result provides a new insight into AFP as the target for preventing and treating hepatocellular carcinoma.

  18. Product-Related Impurities in Clinical-Grade Recombinant AAV Vectors: Characterization and Risk Assessment

    PubMed Central

    Wright, J. Fraser

    2014-01-01

    Adeno-associated virus (AAV)-based vectors expressing therapeutic genes continue to demonstrate great promise for the treatment of a wide variety of diseases and together with other gene transfer vectors represent an emerging new therapeutic paradigm comparable in potential impact on human health to that achieved by recombinant proteins and vaccines. A challenge for the current pipeline of AAV-based investigational products as they advance through clinical development is the identification, characterization and lot-to-lot control of the process- and product-related impurities present in even highly purified preparations. Especially challenging are AAV vector product-related impurities that closely resemble the vector itself and are, in some cases, without clear precedent in established biotherapeutic products. The determination of acceptable levels of these impurities in vectors prepared for human clinical product development, with the goal of new product licensure, requires careful risk and feasibility assessment. This review focuses primarily on the AAV product-related impurities that have been described in vectors prepared for clinical development. PMID:28548061

  19. Live attenuated rubella vectors expressing SIV and HIV vaccine antigens replicate and elicit durable immune responses in rhesus macaques

    PubMed Central

    2013-01-01

    Background Live attenuated viruses are among our most potent and effective vaccines. For human immunodeficiency virus, however, a live attenuated strain could present substantial safety concerns. We have used the live attenuated rubella vaccine strain RA27/3 as a vector to express SIV and HIV vaccine antigens because its safety and immunogenicity have been demonstrated in millions of children. One dose protects for life against rubella infection. In previous studies, rubella vectors replicated to high titers in cell culture while stably expressing SIV and HIV antigens. Their viability in vivo, however, as well as immunogenicity and antibody persistence, were unknown. Results This paper reports the first successful trial of rubella vectors in rhesus macaques, in combination with DNA vaccines in a prime and boost strategy. The vectors grew robustly in vivo, and the protein inserts were highly immunogenic. Antibody titers elicited by the SIV Gag vector were greater than or equal to those elicited by natural SIV infection. The antibodies were long lasting, and they were boosted by a second dose of replication-competent rubella vectors given six months later, indicating the induction of memory B cells. Conclusions Rubella vectors can serve as a vaccine platform for safe delivery and expression of SIV and HIV antigens. By presenting these antigens in the context of an acute infection, at a high level and for a prolonged duration, these vectors can stimulate a strong and persistent immune response, including maturation of memory B cells. Rhesus macaques will provide an ideal animal model for demonstrating immunogenicity of novel vectors and protection against SIV or SHIV challenge. PMID:24041113

  20. Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

    PubMed

    Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

    2008-04-01

    Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

  1. Direct In Vivo Reprogramming with Sendai Virus Vectors Improves Cardiac Function after Myocardial Infarction.

    PubMed

    Miyamoto, Kazutaka; Akiyama, Mizuha; Tamura, Fumiya; Isomi, Mari; Yamakawa, Hiroyuki; Sadahiro, Taketaro; Muraoka, Naoto; Kojima, Hidenori; Haginiwa, Sho; Kurotsu, Shota; Tani, Hidenori; Wang, Li; Qian, Li; Inoue, Makoto; Ide, Yoshinori; Kurokawa, Junko; Yamamoto, Tsunehisa; Seki, Tomohisa; Aeba, Ryo; Yamagishi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

    2018-01-04

    Direct cardiac reprogramming holds great promise for regenerative medicine. We previously generated directly reprogrammed induced cardiomyocyte-like cells (iCMs) by overexpression of Gata4, Mef2c, and Tbx5 (GMT) using retrovirus vectors. However, integrating vectors pose risks associated with insertional mutagenesis and disruption of gene expression and are inefficient. Here, we show that Sendai virus (SeV) vectors expressing cardiac reprogramming factors efficiently and rapidly reprogram both mouse and human fibroblasts into integration-free iCMs via robust transgene expression. SeV-GMT generated 100-fold more beating iCMs than retroviral-GMT and shortened the duration to induce beating cells from 30 to 10 days in mouse fibroblasts. In vivo lineage tracing revealed that the gene transfer of SeV-GMT was more efficient than retroviral-GMT in reprogramming resident cardiac fibroblasts into iCMs in mouse infarct hearts. Moreover, SeV-GMT improved cardiac function and reduced fibrosis after myocardial infarction. Thus, efficient, non-integrating SeV vectors may serve as a powerful system for cardiac regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Viral Vectors for in Vivo Gene Transfer

    NASA Astrophysics Data System (ADS)

    Thévenot, E.; Dufour, N.; Déglon, N.

    The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

  3. Expression of exogenous human hepatic nuclear factor-1α by a lentiviral vector and its interactions with Plasmodium falciparum subtilisin-like protease 2.

    PubMed

    Liao, Shunyao; Liu, Yunqiang; Zheng, Bing; Cho, Pyo Yun; Song, Hyun Ok; Lee, Yun-Seok; Jung, Suk-Yul; Park, Hyun

    2011-12-01

    The onset, severity, and ultimate outcome of malaria infection are influenced by parasite-expressed virulence factors as well as by individual host responses to these determinants. In both humans and mice, liver injury follows parasite entry, persisting to the erythrocytic stage in the case of infection with the fatal strain of Plasmodium falciparum. Hepatic nuclear factor (HNF)-1α is a master regulator of not only the liver damage and adaptive responses but also diverse metabolic functions. In this study, we analyzed the expression of host HNF-1α in relation to malaria infection and evaluated its interaction with the 5'-untranslated region of subtilisin-like protease 2 (subtilase, Sub2). Recombinant human HNF-1α expressed by a lentiviral vector (LV HNF-1α) was introduced into mice. Interestingly, differences in the activity of the 5'-untranslated region of the Pf-Sub2 promoter were detected in 293T cells, and LV HNF-1α was observed to influence promoter activity, suggesting that host HNF-1α interacts with the Sub2 gene.

  4. Using HSV-TK/GCV suicide gene therapy to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification

    PubMed Central

    Jiang, Yong-Xiang; Liu, Tian-Jing; Yang, Jin; Chen, Yan; Fang, Yan-Wen

    2011-01-01

    Purpose To establish a novel, targeted lentivirus-based HSV-tk (herpes simplex virus thymidine kinase)/GCV (ganciclovir) gene therapy system to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification (PCO) after cataract surgery. Methods An enhanced Cre recombinase (Cre/loxP) system with a lentiviral vector expressing Cre under the control of the lens-specific promoter LEP503 (Lenti-LEP503-HSVtk-Cre [LTKCRE]) was constructed, as well as another lentiviral vector containing a switching unit. The latter vector contains a stuffer sequence encoding EGFP (Lenti-hPGK-Loxp-EGFP-pA-Loxp-HSVtk [PGFPTK]) with a functional polyadenylation signal between two loxP sites, followed by the herpes simplex virus thymidine kinase (HSV-tk) gene, both under the control of the human posphoglycerate kinase (hPGK) promoter. Expression of the downstream gene (HSV-tk) is activated by co-expression of Cre. Human lens epithelial cells (HLECs) or retinal pigmental epithelial cells (RPECs) were co-infected with LTKCRE and PGFPTK. The inhibitory effects on HLECs and RPECs infected by the enhanced specific lentiviral vector combination at the concentration of 20 µg/ml GCV were assayed and compared. Results The specific gene expression of Cre and HSV-tk in HLECs is activated by the LEP503 promoter. LTKCRE and PGFPTK co-infected HLECs, but not RPECs, expressed high levels of the HSV-tk protein. After 96 h of GCV treatment, the percentage of apoptotic HLECs infected by the enhanced specific lentiviral vector combination was 87.23%, whereas that of apoptotic RPECs was only 10.12%. Electron microscopy showed that GCV induced apoptosis and necrosis of the infected HLECs. Conclusions The enhanced specific lentiviral vector combination selectively and effectively expressed HSV-tk in HLECs. A concentration of 20 µg/ml, GCV is effective against the proliferation of HLECs in vitro. This cell-type-specific gene therapy using a Cre/loxP lentivirus system may be a feasible treatment strategy to prevent PCO. PMID:21283526

  5. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    PubMed

    Grandchamp, Nicolas; Altémir, Dorothée; Philippe, Stéphanie; Ursulet, Suzanna; Pilet, Héloïse; Serre, Marie-Claude; Lenain, Aude; Serguera, Che; Mallet, Jacques; Sarkis, Chamsy

    2014-01-01

    Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV) is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs) solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int) which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP) which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  6. CD30 Receptor-Targeted Lentiviral Vectors for Human Induced Pluripotent Stem Cell-Specific Gene Modification.

    PubMed

    Friedel, Thorsten; Jung-Klawitter, Sabine; Sebe, Attila; Schenk, Franziska; Modlich, Ute; Ivics, Zoltán; Schumann, Gerald G; Buchholz, Christian J; Schneider, Irene C

    2016-05-01

    Cultures of induced pluripotent stem cells (iPSCs) often contain cells of varying grades of pluripotency. We present novel lentiviral vectors targeted to the surface receptor CD30 (CD30-LV) to transfer genes into iPSCs that are truly pluripotent as demonstrated by marker gene expression. We demonstrate that CD30 expression is restricted to SSEA4(high) cells of human iPSC cultures and a human embryonic stem cell line. When CD30-LV was added to iPSCs during routine cultivation, efficient and exclusive transduction of cells positive for the pluripotency marker Oct-4 was achieved, while retaining their pluripotency. When added during the reprogramming process, CD30-LV solely transduced cells that became fully reprogrammed iPSCs as confirmed by co-expression of endogenous Nanog and the reporter gene. Thus, CD30-LV may serve as novel tool for the selective gene transfer into PSCs with broad applications in basic and therapeutic research.

  7. Improving the Transduction of Bone Marrow–Derived Cells with an Integrase-Defective Lentiviral Vector

    PubMed Central

    Pay, S. Louise; Qi, Xiaoping; Willard, Jeffrey F.; Godoy, Juliana; Sankhavaram, Kavya; Horton, Ranier; Mitter, Sayak K.; Quigley, Judith L.; Chang, Lung-Ji; Grant, Maria B.; Boulton, Michael E.

    2018-01-01

    In lentiviral vector (LV) applications where transient transgene expression is sufficient, integrase-defective lentiviral vectors (IDLVs) are beneficial for reducing the potential for off-target effects associated with insertional mutagenesis. It was previously demonstrated that human RPE65 mRNA expression from an integrating lentiviral vector (ILV) induces endogenous Rpe65 and Cralbp mRNA expression in murine bone marrow–derived cells (BMDCs), initiating programming of the cells to retinal pigment epithelium (RPE)-like cells. These cells regenerate RPE in retinal degeneration models when injected systemically. As transient expression of RPE65 is sufficient to activate endogenous RPE-associated genes for programming BMDCs, use of an ILV is an unnecessary risk. In this study, an IDLV expressing RPE65 (IDLV3-RPE65) was generated. Transduction with IDLV3-RPE65 is less efficient than the integrating vector (ILV3-RPE65). Therefore, IDLV3-RPE65 transduction was enhanced with a combination of preloading 20 × -concentrated viral supernatant on RetroNectin at a multiplicity of infection of 50 and transduction of BMDCs by low-speed centrifugation. RPE65 mRNA levels increased from ∼12-fold to ∼25-fold (p < 0.05) after modification of the IDLV3-RPE65 transduction protocol, achieving expression similar to the ∼27-fold (p < 0.05) increase observed with ILV3-RPE65. Additionally, the study shows that the same preparation of RetroNectin can be used to coat up to three wells with no reduction in transduction. Critically, IDLV3-RPE65 transduction initiates endogenous Rpe65 mRNA expression in murine BMDCs and Cralbp/CRALBP mRNA in both murine and human BMDCs, similar to expression observed in ILV3-RPE65-transduced cells. Systemic administration of ILV3-RPE65 or IDLV3-RPE65 programmed BMDCs in a mouse model of retinal degeneration is sufficient to retain visual function and reduce retinal degeneration compared to mice receiving no treatment or naïve BMDC. It is concluded that IDLV3-RPE65 is appropriate for programming BMDCs to RPE-like cells. PMID:29160102

  8. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  9. Recombinant adeno-associated virus targets passenger gene expression to cones in primate retina

    NASA Astrophysics Data System (ADS)

    Mancuso, Katherine; Hendrickson, Anita E.; Connor, Thomas B., Jr.; Mauck, Matthew C.; Kinsella, James J.; Hauswirth, William W.; Neitz, Jay; Neitz, Maureen

    2007-05-01

    Recombinant adeno-associated virus (rAAV) is a promising vector for gene therapy of photoreceptor-based diseases. Previous studies have demonstrated that rAAV serotypes 2 and 5 can transduce both rod and cone photoreceptors in rodents and dogs, and it can target rods, but not cones in primates. Here we report that using a human cone-specific enhancer and promoter to regulate expression of a green fluorescent protein (GFP) reporter gene in an rAAV-5 vector successfully targeted expression of the reporter gene to primate cones, and the time course of GFP expression was able to be monitored in a living animal using the RetCam II digital imaging system.

  10. A defective retroviral vector encoding human interferon-alpha2 can transduce human leukemic cell lines.

    PubMed

    Austruy, E; Bagnis, C; Carbuccia, N; Maroc, C; Birg, F; Dubreuil, P; Mannoni, P; Chabannon, C

    1998-01-01

    Using the LXSN backbone, a defective retroviral vector (LISN) was constructed that encodes the human interferon (IFN)-alpha2 (hIFN-alpha2) gene and the neomycin resistance gene; the hIFN-alpha2 gene was cloned from human placental genomic DNA. High titers of the LISN retrovirus were produced by the amphotropic packaging cell line GP+envAM12. LISN is able to infect three human hematopoietic and leukemic cell lines: K562, LAMA-84, and TF-1. G418-resistant cells were detected in a similar proportion after infection with either the LISN retroviral vector or the LnLSN retroviral vector (encoding the nlsLacZ gene instead of hIFN-alpha2), suggesting that hIFN-alpha2 does not inhibit (or only partially inhibits) the production of retroviral particles by the packaging cell line and the infection of human cells. LISN-infected cells express and secrete hIFN-alpha2 as demonstrated by Northern blot analysis of poly(A)+ RNA, detection of the intracellular protein by fluorescence-activated cell sorter analysis, and detection of secreted hIFN-alpha in cell supernatants using an enzyme-linked immunosorbent assay. Retrovirally produced hIFN-alpha2 is biologically active, as demonstrated by the partial inhibition of the growth of K562 and TF-1, the modulation of the expression of cell surface antigens, the induction of the (2'-5') oligoadenylate synthetase, and, for LAMA-84, the down-modulation of the BCR-ABL protein. We conclude that the infection of human leukemic cell lines with a retroviral vector encoding hIFN-alpha2 is feasible and induces the expected biological effects. This experimental model will be useful in investigating the possibility of transducing normal and leukemic cells and hematopoietic progenitors and in determining the consequences of the autocrine production of hIFN-alpha2 on the behavior of these cells.

  11. Immune Recognition of Gene Transfer Vectors: Focus on Adenovirus as a Paradigm

    PubMed Central

    Aldhamen, Yasser Ali; Seregin, Sergey S.; Amalfitano, Andrea

    2011-01-01

    Recombinant Adenovirus (Ad) based vectors have been utilized extensively as a gene transfer platform in multiple pre-clinical and clinical applications. These applications are numerous, and inclusive of both gene therapy and vaccine based approaches to human or animal diseases. The widespread utilization of these vectors in both animal models, as well as numerous human clinical trials (Ad-based vectors surpass all other gene transfer vectors relative to numbers of patients treated, as well as number of clinical trials overall), has shed light on how this virus vector interacts with both the innate and adaptive immune systems. The ability to generate and administer large amounts of this vector likely contributes not only to their ability to allow for highly efficient gene transfer, but also their elicitation of host immune responses to the vector and/or the transgene the vector expresses in vivo. These facts, coupled with utilization of several models that allow for full detection of these responses has predicted several observations made in human trials, an important point as lack of similar capabilities by other vector systems may prevent detection of such responses until only after human trials are initiated. Finally, induction of innate or adaptive immune responses by Ad vectors may be detrimental in one setting (i.e., gene therapy) and be entirely beneficial in another (i.e., prophylactic or therapeutic vaccine based applications). Herein, we review the current understanding of innate and adaptive immune responses to Ad vectors, as well some recent advances that attempt to capitalize on this understanding so as to further broaden the safe and efficient use of Ad-based gene transfer therapies in general. PMID:22566830

  12. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    PubMed Central

    Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

    2009-01-01

    RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

  13. Serotype-dependent transduction efficiencies of recombinant adeno-associated viral vectors in monkey neocortex

    PubMed Central

    Gerits, Annelies; Vancraeyenest, Pascaline; Vreysen, Samme; Laramée, Marie-Eve; Michiels, Annelies; Gijsbers, Rik; Van den Haute, Chris; Moons, Lieve; Debyser, Zeger; Baekelandt, Veerle; Arckens, Lutgarde; Vanduffel, Wim

    2015-01-01

    Abstract. Viral vector-mediated expression of genes (e.g., coding for opsins and designer receptors) has grown increasingly popular. Cell-type specific expression is achieved by altering viral vector tropism through crosspackaging or by cell-specific promoters driving gene expression. Detailed information about transduction properties of most recombinant adeno-associated viral vector (rAAV) serotypes in macaque cortex is gradually becoming available. Here, we compare transduction efficiencies and expression patterns of reporter genes in two macaque neocortical areas employing different rAAV serotypes and promoters. A short version of the calmodulin-kinase-II (CaMKIIα0.4) promoter resulted in reporter gene expression in cortical neurons for all tested rAAVs, albeit with different efficiencies for spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1 and proportion of transduced cells: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. In contrast to rodent studies, the cytomegalovirus (CMV) promoter appeared least efficient in macaque cortex. The human synapsin-1 promoter preceded by the CMV enhancer (enhSyn1) produced homogeneous reporter gene expression across all layers, while two variants of the CaMKIIα promoter resulted in different laminar transduction patterns and cell specificities. Finally, differences in expression patterns were observed when the same viral vector was injected in two neocortical areas. Our results corroborate previous findings that reporter-gene expression patterns and efficiency of rAAV transduction depend on serotype, promoter, cortical layer, and area. PMID:26839901

  14. Immunogenicity and Protection Against Influenza H7N3 in Mice by Modified Vaccinia Virus Ankara Vectors Expressing Influenza Virus Hemagglutinin or Neuraminidase.

    PubMed

    Meseda, Clement A; Atukorale, Vajini; Soto, Jackeline; Eichelberger, Maryna C; Gao, Jin; Wang, Wei; Weiss, Carol D; Weir, Jerry P

    2018-03-29

    Influenza subtypes such as H7 have pandemic potential since they are able to infect humans with severe consequences, as evidenced by the ongoing H7N9 infections in China that began in 2013. The diversity of H7 viruses calls for a broadly cross-protective vaccine for protection. We describe the construction of recombinant modified vaccinia virus Ankara (MVA) vectors expressing the hemagglutinin (HA) or neuraminidase (NA) from three H7 viruses representing both Eurasian and North American H7 lineages - A/mallard/Netherlands/12/2000 (H7N3), A/Canada/rv444/2004 (H7N3), and A/Shanghai/02/2013 (H7N9). These vectors were evaluated for immunogenicity and protective efficacy against H7N3 virus in a murine model of intranasal challenge. High levels of H7-, N3-, and N9-specific antibodies, including neutralizing antibodies, were induced by the MVA-HA and MVA-NA vectors. Mice vaccinated with MVA vectors expressing any of the H7 antigens were protected, suggesting cross-protection among H7 viruses. In addition, MVA vectors expressing N3 but not N9 elicited protection against H7N3 virus challenge. Similar outcomes were obtained when immune sera from MVA vector-immunized mice were passively transferred to naïve mice prior to challenge with the H7N3 virus. The results support the further development of an MVA vector platform as a candidate vaccine for influenza strains with pandemic potential.

  15. Disabled infectious single cycle-herpes simplex virus (DISC-HSV) as a vector for immunogene therapy of cancer.

    PubMed

    Rees, Robert C; McArdle, Stephanie; Mian, Shahid; Li, Geng; Ahmad, Murrium; Parkinson, Richard; Ali, Selman A

    2002-02-01

    Disabled infectious single cycle-herpes simplex viruses (DISC-HSV) have been shown to be safe for use in humans and may be considered efficacious as vectors for immunogene therapy in cancer. Preclinical studies show that DISC-HSV is an efficient delivery system for cytokine genes and antigens. DISC-HSV infects a high proportion of cells, resulting in rapid gene expression for at least 72 h. The DISC-HSV-mGM-CSF vector, when inoculated into tumors, induces tumor regression in a high percentage of animals, concomitant with establishing a cytotoxic T-cell response, which is MHC class I restricted and directed against peptides of known tumor antigens. The inherent properties of DISC-HSV makes it a suitable vector for consideration in human immunogene therapy trials.

  16. In Vivo Stable Transduction of Humanized Liver Tissue in Chimeric Mice via High-Capacity Adenovirus–Lentivirus Hybrid Vector

    PubMed Central

    Kataoka, Miho; Tateno, Chise; Yoshizato, Katsutoshi; Kawasaki, Yoshiko; Kimura, Takahiro; Faure-Kumar, Emmanuelle; Palmer, Donna J.; Ng, Philip; Okamura, Haruki; Kasahara, Noriyuki

    2010-01-01

    Abstract We developed hybrid vectors employing high-capacity adenovirus as a first-stage carrier encoding all the components required for in situ production of a second-stage lentivirus, thereby achieving stable transgene expression in secondary target cells. Such vectors have never previously been tested in normal tissues, because of the scarcity of suitable in vivo systems permissive for second-stage lentivirus assembly. Here we employed a novel murine model in which endogenous liver tissue is extensively reconstituted with engrafted human hepatocytes, and successfully achieved stable transduction by the second-stage lentivirus produced in situ from first-stage adenovirus. This represents the first demonstration of the functionality of adenoviral-lentiviral hybrid vectors in a normal parenchymal organ in vivo. PMID:19725756

  17. Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

    PubMed

    Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

    1996-07-15

    Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

  18. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    PubMed Central

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  19. Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression of human disseminated tumor.

    PubMed

    Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G; Scholler, John; Levine, Bruce L; Albelda, Steven M; June, Carl H

    2010-11-15

    Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor-reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CAR). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high-level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week after electroporation. Multiple injections of RNA CAR-electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(-/-) mice. Dramatic tumor reduction also occurred when the preexisting intraperitoneal human-derived tumors, which had been growing in vivo for >50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes showing that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA-engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. Copyright © 2010 AACR.

  20. Multiple injections of electroporated autologous T cells expressing a chimeric antigen receptor mediate regression of human disseminated tumor

    PubMed Central

    Zhao, Yangbing; Moon, Edmund; Carpenito, Carmine; Paulos, Chrystal M.; Liu, Xiaojun; Brennan, Andrea L; Chew, Anne; Carroll, Richard G.; Scholler, John; Levine, Bruce L.; Albelda, Steven M.; June, Carl H.

    2010-01-01

    Redirecting T lymphocyte antigen specificity by gene transfer can provide large numbers of tumor reactive T lymphocytes for adoptive immunotherapy. However, safety concerns associated with viral vector production have limited clinical application of T cells expressing chimeric antigen receptors (CARs). T lymphocytes can be gene modified by RNA electroporation without integration-associated safety concerns. To establish a safe platform for adoptive immunotherapy, we first optimized the vector backbone for RNA in vitro transcription to achieve high level transgene expression. CAR expression and function of RNA-electroporated T cells could be detected up to a week post electroporation. Multiple injections of RNA CAR electroporated T cells mediated regression of large vascularized flank mesothelioma tumors in NOD/scid/γc(−/−) mice. Dramatic tumor reduction also occurred when the pre-existing intraperitoneal human-derived tumors, that had been growing in vivo for over 50 days, were treated by multiple injections of autologous human T cells electroporated with anti-mesothelin CAR mRNA. This is the first report using matched patient tumor and lymphocytes demonstrating that autologous T cells from cancer patients can be engineered to provide an effective therapy for a disseminated tumor in a robust preclinical model. Multiple injections of RNA engineered T cells are a novel approach for adoptive cell transfer, providing flexible platform for the treatment of cancer that may complement the use of retroviral and lentiviral engineered T cells. This approach may increase the therapeutic index of T cells engineered to express powerful activation domains without the associated safety concerns of integrating viral vectors. PMID:20926399

  1. The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

    PubMed

    Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2012-01-01

    DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

  2. The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

    PubMed Central

    Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2012-01-01

    DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

  3. Production of non viral DNA vectors.

    PubMed

    Schleef, Martin; Blaesen, Markus; Schmeer, Marco; Baier, Ruth; Marie, Corinne; Dickson, George; Scherman, Daniel

    2010-12-01

    After some decades of research, development and first clinical approaches to use DNA vectors in gene therapy, cell therapy and DNA vaccination, the requirements for the pharmaceutical manufacturing of gene vectors has improved significantly step by step. Even the expression level and specificity of non viral DNA vectors were significantly modified and followed the success of viral vectors. The strict separation of "viral" and "non viral" gene transfer are historic borders between scientist and we will show that both fields together are able to allow the next step towards successful prevention and therapy. Here we summarize the features of producing and modifying these non-viral gene vectors to ensure the required quality to modify cells and to treat human and animals.

  4. HIV-1-based defective lentiviral vectors efficiently transduce human monocytes-derived macrophages and suppress replication of wild-type HIV-1

    PubMed Central

    Zeng, Lingbing; Planelles, Vicente; Sui, Ziye; Gartner, Suzanne; Maggirwar, Sanjay B.; Dewhurst, Stephen; Ye, Linbai; Nerurkar, Vivek R.; Yanagihara, Richard; Lu, Yuanan

    2010-01-01

    Background Human monocytes play an important role in mediating human immunodeficiency virus type 1 (HIV-1) infection of the central nervous system (CNS), and monocytes-derived macrophages (MDM) represent a major viral reservoir within the brain and other target organs. Current gene transduction of MDM is hindered by a limited efficiency. In this study we established a lentiviral vector-based technique for improved gene transfer into human MDM cultures in vitro and demonstrated significant protection of transduced MDM from super-infection with wild-type HIV-1. Methods HIV-1-based lentiviral vector stocks were prepared in 293T cells by the established calcium phosphate transfection method. Human monocytes were isolated from donors' blood by Ficoll-Paque separation and cultured in vitro. To establish an effective technique for vector-mediated gene transfer, primary cultures of human MDM were transduced at varying multiplicities of infection (MOI) and at a range of time points following initial isolation of cells (time-in-culture). Transduced cells were then examined for transgene (green fluorescent protein (GFP)) expression by fluorescent microscopy and reverse transcription polymerase chain reaction (RT-PCR). These cultures were then exposed to wild-type HIV-1, and viral replication was quantitated by p24 assay; production of neurotoxic effector molecules by the transduced MDM was also examined, using indicator neurons. Results We have demonstrated that primary human MDM could be efficiently transduced (>50%) with concentrated HIV-1-based defective lentiviral vectors (DLV). Furthermore, DLV-mediated gene transduction was stable, and the transduced cells exhibited no apparent difference from normal MDM in terms of their morphology, viability and neurotoxin secretion. Challenge of DLV-transduced MDM cultures with HIV-1Ba-L revealed a 4- to 5-fold reduction in viral replication, as measured by p24 antigen production. This effect was associated with the mobilization of the GFP-expressing DLV construct by the wild-type virus. Conclusions These data demonstrate the inhibition of HIV-1 replication in primary MDM, by a DLV vector that lacks any anti-HIV-1 transgene. These findings lay the initial groundwork for future studies on the ability of DLV-modified monocytes to introduce anti-HIV-1 genes into the CNS. Lentiviral vector-mediated gene delivery to the CNS by monocytes/macrophages is a promising, emerging strategy for treating neuro-AIDS. PMID:16142830

  5. [Novel bidirectional promoter from human genome].

    PubMed

    Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

    2011-01-01

    In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

  6. [Construction and identification of recombinant human platelet-derived growth factor-B adenoviral vector and transfection into periodontal ligament stem cells].

    PubMed

    Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong

    2008-10-01

    To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.

  7. Viral vector-based reversible neuronal inactivation and behavioral manipulation in the macaque monkey

    PubMed Central

    Nielsen, Kristina J.; Callaway, Edward M.; Krauzlis, Richard J.

    2012-01-01

    Viral vectors are promising tools for the dissection of neural circuits. In principle, they can manipulate neurons at a level of specificity not otherwise achievable. While many studies have used viral vector-based approaches in the rodent brain, only a few have employed this technique in the non-human primate, despite the importance of this animal model for neuroscience research. Here, we report evidence that a viral vector-based approach can be used to manipulate a monkey's behavior in a task. For this purpose, we used the allatostatin receptor/allatostatin (AlstR/AL) system, which has previously been shown to allow inactivation of neurons in vivo. The AlstR was expressed in neurons in monkey V1 by injection of an adeno-associated virus 1 (AAV1) vector. Two monkeys were trained in a detection task, in which they had to make a saccade to a faint peripheral target. Injection of AL caused a retinotopic deficit in the detection task in one monkey. Specifically, the monkey showed marked impairment for detection targets placed at the visual field location represented at the virus injection site, but not for targets shown elsewhere. We confirmed that these deficits indeed were due to the interaction of AlstR and AL by injecting saline, or AL at a V1 location without AlstR expression. Post-mortem histology confirmed AlstR expression in this monkey. We failed to replicate the behavioral results in a second monkey, as AL injection did not impair the second monkey's performance in the detection task. However, post-mortem histology revealed a very low level of AlstR expression in this monkey. Our results demonstrate that viral vector-based approaches can produce effects strong enough to influence a monkey's performance in a behavioral task, supporting the further development of this approach for studying how neuronal circuits control complex behaviors in non-human primates. PMID:22723770

  8. Annotated Differentially Expressed Salivary Proteins of Susceptible and Insecticide-Resistant Mosquitoes of Anopheles stephensi

    PubMed Central

    Vijay, Sonam; Rawal, Ritu; Kadian, Kavita; Raghavendra, Kamaraju; Sharma, Arun

    2015-01-01

    Vector control is one of the major global strategies for control of malaria. However, the major obstacle for vector control is the development of multiple resistances to organochlorine, organophosphorus insecticides and pyrethroids that are currently being used in public health for spraying and in bednets. Salivary glands of vectors are the first target organ for human-vector contact during biting and parasite-vector contact prior to parasite development in the mosquito midguts. The salivary glands secrete anti-haemostatic, anti-inflammatory biologically active molecules to facilitate blood feeding from the host and also inadvertently inject malaria parasites into the vertebrate host. The Anopheles stephensi mosquito, an urban vector of malaria to both human and rodent species has been identified as a reference laboratory model to study mosquito—parasite interactions. In this study, we adopted a conventional proteomic approach of 2D-electrophoresis coupled with MALDI-TOF mass spectrometry and bioinformatics to identify putative differentially expressed annotated functional salivary proteins between An. stephensi susceptible and multiresistant strains with same genetic background. Our results show 2D gel profile and MALDI-TOF comparisons that identified 31 differentially expressed putative modulated proteins in deltamethrin/DDT resistant strains of An. stephensi. Among these 15 proteins were found to be upregulated and 16 proteins were downregulated. Our studies interpret that An. stephensi (multiresistant) caused an upregulated expression of proteins and enzymes like cytochrome 450, short chain dehyrdogenase reductase, phosphodiesterase etc that may have an impact in insecticide resistance and xenobiotic detoxification. Our study elucidates a proteomic response of salivary glands differentially regulated proteins in response to insecticide resistance development which include structural, redox and regulatory enzymes of several pathways. These identified proteins may play a role in regulating mosquito biting behavior patterns and may have implications in the development of malaria parasites in resistant mosquitoes during parasite transmission. PMID:25742511

  9. Annotated differentially expressed salivary proteins of susceptible and insecticide-resistant mosquitoes of Anopheles stephensi.

    PubMed

    Vijay, Sonam; Rawal, Ritu; Kadian, Kavita; Raghavendra, Kamaraju; Sharma, Arun

    2015-01-01

    Vector control is one of the major global strategies for control of malaria. However, the major obstacle for vector control is the development of multiple resistances to organochlorine, organophosphorus insecticides and pyrethroids that are currently being used in public health for spraying and in bednets. Salivary glands of vectors are the first target organ for human-vector contact during biting and parasite-vector contact prior to parasite development in the mosquito midguts. The salivary glands secrete anti-haemostatic, anti-inflammatory biologically active molecules to facilitate blood feeding from the host and also inadvertently inject malaria parasites into the vertebrate host. The Anopheles stephensi mosquito, an urban vector of malaria to both human and rodent species has been identified as a reference laboratory model to study mosquito-parasite interactions. In this study, we adopted a conventional proteomic approach of 2D-electrophoresis coupled with MALDI-TOF mass spectrometry and bioinformatics to identify putative differentially expressed annotated functional salivary proteins between An. stephensi susceptible and multiresistant strains with same genetic background. Our results show 2D gel profile and MALDI-TOF comparisons that identified 31 differentially expressed putative modulated proteins in deltamethrin/DDT resistant strains of An. stephensi. Among these 15 proteins were found to be upregulated and 16 proteins were downregulated. Our studies interpret that An. stephensi (multiresistant) caused an upregulated expression of proteins and enzymes like cytochrome 450, short chain dehyrdogenase reductase, phosphodiesterase etc that may have an impact in insecticide resistance and xenobiotic detoxification. Our study elucidates a proteomic response of salivary glands differentially regulated proteins in response to insecticide resistance development which include structural, redox and regulatory enzymes of several pathways. These identified proteins may play a role in regulating mosquito biting behavior patterns and may have implications in the development of malaria parasites in resistant mosquitoes during parasite transmission.

  10. Targeted Adenoviral Vector Demonstrates Enhanced Efficacy for In Vivo Gene Therapy of Uterine Leiomyoma

    PubMed Central

    Abdelaziz, Mohamed; Sherif, Lotfy; ElKhiary, Mostafa; Nair, Sanjeeta; Shalaby, Shahinaz; Mohamed, Sara; Eziba, Noura; El-Lakany, Mohamed; Curiel, David; Ismail, Nahed; Diamond, Michael P.; Al-Hendy, Ayman

    2016-01-01

    Background: Gene therapy is a potentially effective non-surgical approach for the treatment of uterine leiomyoma. We demonstrated that targeted adenovirus vector, Ad-SSTR-RGD-TK/GCV, was highly effective in selectively inducing apoptosis and inhibiting proliferation of human leiomyoma cells in vitro while sparing normal myometrial cells. Study design: An in-vivo study, to compare efficacy and safety of modified adenovirus vector Ad-SSTR-RGD-TK/GCV versus untargeted vector for treatment of leiomyoma. Materials and methods: Female nude mice were implanted with rat leiomyoma cells subcutaneously. Then mice were randomized into three groups. Group 1 received Ad-LacZ (marker gene), Group 2 received untargeted Ad-TK, and Group 3 received the targeted Ad-SSTR-RGD-TK. Tumors were measured weekly for 4 weeks. Then mice were sacrificed and tissue samples were collected. Evaluation of markers of apoptosis, proliferation, extracellular matrix, and angiogenesis was performed using Western Blot & Immunohistochemistry. Statistical analysis was done using ANOVA. Dissemination of adenovirus was assessed by PCR. Results: In comparison with the untargeted vector, the targeted adenoviral vector significantly shrank leiomyoma size (P < 0.05), reduced expression of proliferation marker (PCNA) (P < 0.05), induced expression of apoptotic protein, c-PARP-1, (P < 0.05) and inhibited expression of extracellular matrix-related genes (TGF beta 3) and angiogenesis-related genes (VEGF & IGF-1) (P < 0.01). There were no detectable adenovirus in tested tissues other than leiomyoma lesions with both targeted and untargeted adenovirus. Conclusion: Targeted adenovirus, effectively reduces tumor size in leiomyoma without dissemination to other organs. Further evaluation of this localized targeted strategy for gene therapy is needed in appropriate preclinical humanoid animal models in preparation for a future pilot human trial. PMID:26884457

  11. Targeted Adenoviral Vector Demonstrates Enhanced Efficacy for In Vivo Gene Therapy of Uterine Leiomyoma.

    PubMed

    Abdelaziz, Mohamed; Sherif, Lotfy; ElKhiary, Mostafa; Nair, Sanjeeta; Shalaby, Shahinaz; Mohamed, Sara; Eziba, Noura; El-Lakany, Mohamed; Curiel, David; Ismail, Nahed; Diamond, Michael P; Al-Hendy, Ayman

    2016-04-01

    Gene therapy is a potentially effective non-surgical approach for the treatment of uterine leiomyoma. We demonstrated that targeted adenovirus vector, Ad-SSTR-RGD-TK/GCV, was highly effective in selectively inducing apoptosis and inhibiting proliferation of human leiomyoma cells in vitro while sparing normal myometrial cells. An in-vivo study, to compare efficacy and safety of modified adenovirus vector Ad-SSTR-RGD-TK/GCV versus untargeted vector for treatment of leiomyoma. Female nude mice were implanted with rat leiomyoma cells subcutaneously. Then mice were randomized into three groups. Group 1 received Ad-LacZ (marker gene), Group 2 received untargeted Ad-TK, and Group 3 received the targeted Ad-SSTR-RGD-TK. Tumors were measured weekly for 4 weeks. Then mice were sacrificed and tissue samples were collected. Evaluation of markers of apoptosis, proliferation, extracellular matrix, and angiogenesis was performed using Western Blot & Immunohistochemistry. Statistical analysis was done using ANOVA. Dissemination of adenovirus was assessed by PCR. In comparison with the untargeted vector, the targeted adenoviral vector significantly shrank leiomyoma size (P < 0.05), reduced expression of proliferation marker (PCNA) (P < 0.05), induced expression of apoptotic protein, c-PARP-1, (P < 0.05) and inhibited expression of extracellular matrix-related genes (TGF beta 3) and angiogenesis-related genes (VEGF & IGF-1) (P < 0.01). There were no detectable adenovirus in tested tissues other than leiomyoma lesions with both targeted and untargeted adenovirus. Targeted adenovirus, effectively reduces tumor size in leiomyoma without dissemination to other organs. Further evaluation of this localized targeted strategy for gene therapy is needed in appropriate preclinical humanoid animal models in preparation for a future pilot human trial. © The Author(s) 2016.

  12. Human adipose derived mesenchymal stromal cells transduced with GFP lentiviral vectors: assessment of immunophenotype and differentiation capacity in vitro.

    PubMed

    van Vollenstee, Fiona A; Jackson, Carlo; Hoffmann, Danie; Potgieter, Marnie; Durandt, Chrisna; Pepper, Michael S

    2016-10-01

    Adipose derived mesenchymal stromal/stem cells (ASCs) are a heterogeneous population characterized by (a) their ability to adhere to plastic; (b) immunophenotypic expression of certain cell surface markers, while lacking others; and (c) the capacity to differentiate into lineages of mesodermal origin including osteocytes, chondrocytes and adipocytes. The long-term goal is to utilize these cells for clinical translation into cell-based therapies. However, preclinical safety and efficacy need to be demonstrated in animal models. ASCs can also be utilized as biological vehicles for vector-based gene delivery systems, since they are believed to home to sites of inflammation and infection in vivo. These factors motivated the development of a labelling system for ASCs using lentiviral vector-based green fluorescent protein (GFP) transduction. Human ASCs were transduced with GFP-expressing lentiviral vectors. A titration study determined the viral titer required to transduce the maximum number of ASCs. The effect of the transduced GFP lentiviral vector on ASC immunophenotypic expression of surface markers as well as their ability to differentiate into osteocytes and adipocytes were assessed in vitro. A transduction efficiency in ASC cultures of approximately 80 % was observed with an MOI of ~118. No significant immunophenotypic differences were observed between transduced and non-transduced cells and both cell types successfully differentiated into adipocytes and osteocytes in vitro. We obtained >80 % transduction of ASCs using GFP lentiviral vectors. Transduced ASCs maintained plastic adherence, demonstrated ASC immunophenotype and the ability to differentiate into cells of the mesodermal lineage. This GFP-ASC transduction technique offers a potential tracking system for future pre-clinical studies.

  13. Safeguarding Stem Cell-Based Regenerative Therapy against Iatrogenic Cancerogenesis: Transgenic Expression of DNASE1, DNASE1L3, DNASE2, DFFB Controlled By POLA1 Promoter in Proliferating and Directed Differentiation Resisting Human Autologous Pluripotent Induced Stem Cells Leads to their Death

    PubMed Central

    Malecki, Marek; LaVanne, Christine; Alhambra, Dominique; Dodivenaka, Chaitanya; Nagel, Sarah; Malecki, Raf

    2014-01-01

    Introduction The worst possible complication of using stem cells for regenerative therapy is iatrogenic cancerogenesis. The ultimate goal of our work is to develop a self-triggering feedback mechanism aimed at causing death of all stem cells, which resist directed differentiation, keep proliferating, and can grow into tumors. Specific aim The specific aim was threefold: (1) to genetically engineer the DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter; (2) to bioengineer anti-SSEA-4 antibody guided vectors delivering transgenes to human undifferentiated and proliferating pluripotent stem cells; (3) to cause death of proliferating and directed differentiation resisting stem cells by transgenic expression of the human recombinant the DNases (hrDNases). Methods The DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter were genetically engineered. The vectors targeting specifically SSEA-4 expressing stem cells were bioengineered. The healthy volunteers’ bone marrow mononuclear cells (BMMCs) were induced into human, autologous, pluripotent stem cells with non-integrating plasmids. Directed differentiation of the induced stem cells into endothelial cells was accomplished with EGF and BMP. The anti-SSEA 4 antibodies’ guided DNA vectors delivered the transgenes for the human recombinant DNases’ into proliferating stem cells. Results Differentiation of the pluripotent induced stem cells into the endothelial cells was verified by highlighting formation of tight and adherens junctions through transgenic expression of recombinant fluorescent fusion proteins: VE cadherin, claudin, zona occludens 1, and catenin. Proliferation of the stem cells was determined through highlighting transgenic expression of recombinant fluorescent proteins controlled by POLA promoter, while also reporting expression of the transgenes for the hrDNases. Expression of the transgenes for the DNases resulted in complete collapse of the chromatin architecture and degradation of the proliferating cells’ genomic DNA. The proliferating stem cells, but not the differentiating ones, were effectively induced to die. Conclusion Herein, we describe attaining the proof-of-concept for the strategy, whereby transgenic expression of the genetically engineered human recombinant DNases in proliferating and directed differentiation resisting stem cells leads to their death. This novel strategy reduces the risk of iatrogenic neoplasms in stem cell therapy. PMID:25045589

  14. Evaluation of Biodistribution and Safety of Adenovirus Vectors Containing Group B Fibers after Intravenous Injection into Baboons

    PubMed Central

    NI, SHAOHENG; BERNT, KATHRIN; GAGGAR, ANUJ; LI, ZONG-YI; KIEM, HANS-PETER; LIEBER, ANDRÉ

    2005-01-01

    Vectors containing group B adenovirus (Ad) fibers are able to efficiently transduce gene therapy targets that are refractory to infection with standard Ad serotype 5 (Ad5) vectors, including malignant tumor cells, hematopoietic stem cells, and dendritic cells. Preliminary studies in mice indicate that, after intravenous injection, B-group fiber-containing Ads do not efficiently transduce most organs and cause less acute toxicity than Ad5 vectors. However, biodistribution and safety studies in mice are of limited value because the mouse analog of the B-group Ad receptor, CD46, is expressed only in the testis, whereas in humans, CD46 is expressed on all nucleated cells. Unlike mice, baboons have CD46 expression patterns and levels that closely mimic those in humans. We conducted a biodistribution and toxicity study of group B Ad fiber-containing vectors in baboons. Animals received phosphate-buffered saline, Ad5-bGal (a first-generation Ad5 vector), or B-group fiber-containing Ads (Ad5/35-bGal and Ad5/11-bGal) at a dose of 2 × 1012 VP/kg, and vector biodistribution and safety was analyzed over 3 days. The amount of Ad5/35-bGal and Ad5/11-bGal vector genomes was in most tissues one to three orders of magnitude below that of Ad5. Significant Ad5/35- and Ad5/11-mediated transgene (β-galactosidase) expression was seen only in the marginal zone of splenic follicles. Compared with the animal that received Ad5-bGal, all animals injected with B-group fiber-containing Ad vectors had lower elevations in serum proinflammatory cytokine levels. Gross and histopathology were normal in animals that received B-group Ad fiber-containing Ads, in contrast to the Ad5-infused animal, which showed widespread endothelial damage and inflammation. In a further study, a chimeric Ad5/35 vector carrying proapoptotic TRAIL and Ad E1A genes under tumor-specific regulation was well tolerated in a 30-day toxicity study. No major clinical, serologic, or pathologic abnormalities were noticed in this animal. OVERVIEW SUMMARY B-group Ad fiber-containing vectors are promising tools for gene therapy, for example, for the treatment of metastatic cancer or cardiovascular diseases, or for vaccination/immunotherapy. However, only a few studies of vectors containing B-group Ad fibers in mice have been conducted so far, and little is known about the mechanisms and effects of B-group Ad vector delivery in vivo. Before these vectors can be considered for clinical application, this knowledge gap must be filled. We performed biodistribution and safety studies after intravenous injection of chimeric Ad5 vectors containing Ad35 and Ad11 fibers into baboons. Our study suggests that Ad vectors possessing B-group Ad fibers have a better safety profile after intravenous injection than do conventional Ad5-based vectors. PMID:15960598

  15. Application of eGFP to label human periodontal ligament stem cells in periodontal tissue engineering.

    PubMed

    Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin

    2012-09-01

    To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

    PubMed

    Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

    2017-01-01

    Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

  17. HBx drives alpha fetoprotein expression to promote initiation of liver cancer stem cells through activating PI3K/AKT signal pathway.

    PubMed

    Zhu, Mingyue; Li, Wei; Lu, Yan; Dong, Xu; Lin, Bo; Chen, Yi; Zhang, Xueer; Guo, Junli; Li, Mengsen

    2017-03-15

    Hepatitis B virus (HBV)-X protein (HBx) plays critical role in inducing the malignant transformation of liver cells. Alpha fetoprotein (AFP) expression is closely related to hepatocarcinogenesis. We report that Oct4, Klf4, Sox2 and c-myc expression positively associated with AFP(+)/HBV(+) hepatocellular carcinoma(HCC) tissues, and the expression of the stemness markers CD44, CD133 and EpCAM was significantly higher in AFP(+)/HBV(+) HCC tissues compared to normal liver tissues or AFP (-)/HBV(-) HCC tissues. AFP expression turned on prior to expression of Oct4, Klf4, Sox2 and c-myc, and the stemness markers CD44, CD133 and EpCAM in the normal human liver L-02 cell line or CHL cell lines upon transfection with MCV-HBx vectors. Stem-like cells generated more tumour colonies compared to primary cells, and xenografts induced tumourigenesis in nude mice. Expression of reprogramming-related proteins was significantly enhanced in HLE cells while transfected with pcDNA3.1-afp vectors. The specific PI3K inhibitor Ly294002 inhibited the effects of pcDNA3.1-afp vectors. AFP-siRNA vectors were able to inhibit tumour colony formation and reprogramming-related gene expression. Altogether, HBx stimulates AFP expression to induce natural reprogramming of liver cells, and AFP plays a critical role in promoting the initiation of HCC progenitor/stem cells. AFP may be a potential novel biotarget for combating HBV-induced hepatocarcinogenesis. © 2016 UICC.

  18. Recent tissue engineering-based advances for effective rAAV-mediated gene transfer in the musculoskeletal system.

    PubMed

    Rey-Rico, Ana; Cucchiarini, Magali

    2016-04-01

    Musculoskeletal tissues are diverse and significantly different in their ability to repair upon injury. Current treatments often fail to reproduce the natural functions of the native tissue, leading to an imperfect healing. Gene therapy might improve the repair of tissues by providing a temporarily and spatially defined expression of the therapeutic gene(s) at the site of the injury. Several gene transfer vehicles have been developed to modify various human cells and tissues from musculoskeletal system among which the non-pathogenic, effective, and relatively safe recombinant adeno-associated viral (rAAV) vectors that have emerged as the preferred gene delivery system to treat human disorders. Adapting tissue engineering platforms to gene transfer approaches mediated by rAAV vectors is an attractive tool to circumvent both the limitations of the current therapeutic options to promote an effective healing of the tissue and the natural obstacles from these clinically adapted vectors to achieve an efficient and durable gene expression of the therapeutic sequences within the lesions.

  19. [Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

    PubMed

    Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

    2008-06-01

    This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

  20. Expression of human factor IX gene in murine plasma through lentiviral vector-infected haematopoietic stem cells.

    PubMed

    Chen, Haoming; Yao, Hengmei; Huang, Lu; Shen, Qi; Jia, William; Xue, Jinglun

    2006-12-01

    1. Haematopoietic stem cells (HSC) are an attractive target for gene therapy. Gene transfer to HSC can provide a potential cure for many inherited diseases. Moreover, recombinant lentiviral vectors can transfer genes efficiently to HSC. In the present study, we used the recombinant lentiviruses FUGW (Flip, ubiquitin promoter, GFP and WRE vector) and FUXW (Flip, ubiquitin promoter, F IX and WRE vector), which carry the enhanced green fluorescent protein (EGFP) and human factor IX (hFIX) gene, respectively, to infect HSC. 2. High titres of recombinant lentivirus were prepared from 293T cells by calcium phosphate-mediated transient cotransfection. Murine mononuclear cells (MNC) separated from murine bone marrow and HSC separated by magnetic cell sorting were cultured in vitro. Cells they were infected by the recombinant lentiviruses FUGW and FUXW. The expression of EGFP was observed under a fluorescent microscope and was analysed by fluorescence-activated cell sorting, whereas the expression of hFIX was detected by ELISA. 3. The results show that the lentiviral vectors can efficiently infect murine HSC in vitro and that transduction was more efficient following cytokine treatment with interleukin (IL)-3, IL-6 and stem cell factor. 4. Haematopoietic stem cells infected with lentivirus FUXW were transplanted into [(60)Co]-irradiated non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. The expression of hFIX in the blood plasma of the transplanted mice reached a peak of 44.9 +/- 7.6 ng/mL on Day 7. An assay of transaminase levels and a histological study of the liver showed that there was no significant damage following HSC transplantation to mice. 5. The results of the present study suggest that transplantation of HSC results in the persistant expression of hFIX in mice, which may be useful in haemophilia B gene therapy.

  1. Decreased hepatocyte membrane potential differences and GABAA-beta3 expression in human hepatocellular carcinoma.

    PubMed

    Minuk, Gerald Y; Zhang, Manna; Gong, Yuewen; Minuk, Leonard; Dienes, Hans; Pettigrew, Norman; Kew, Michael; Lipschitz, Jeremy; Sun, Dongfeng

    2007-03-01

    To determine whether hepatocyte membrane potential differences (PDs) are depolarized in human HCC and whether depolarization is associated with changes in GABAA receptor expression, hepatocyte PDs and gamma-aminobutyric acid (GABA)A receptor messenger RNA (mRNA) and protein expression were documented in HCC tissues via microelectrode impalement, real-time reverse-transcriptase polymerase chain reaction, and Western blot analysis, respectively. HCC tissues were significantly depolarized (-19.8+/-1.3 versus -25.9+/-3.2 mV, respectively [P<0.05]), and GABAA-beta3 expression was down-regulated (GABAA-beta3 mRNA and protein expression in HCC; 5,693+/-1,385 and 0.29+/-0.11 versus 11,046+/-4,979 copies/100 mg RNA and 0.62+/-0.16 optical density in adjacent tumor tissues, respectively [P=0.002 and P<0.0001, respectively]) when compared with adjacent nontumor tissues. To determine the physiological relevance of the down-regulation, human malignant hepatocytes deficient in GABAA-beta3 receptor expression (Huh-7 cells) were transfected with GABAA-beta3 complementary DNA (cDNA) or vector alone and injected into nu/nu nude mice (n=16-17 group). Tumors developed after a mean (+/-SD) of 51+/-6 days (range: 41-60 days) in 7/16 (44%) mice injected with vector-transfected cells and 70+/-12 days (range: 59-86 days) in 4/17 (24%) mice injected with GABAA-beta3 cDNA-transfected cells (P<0.005). The results of this study indicate that (1) human HCC tissues are depolarized compared with adjacent nontumor tissues, (2) hepatic GABAA-beta3 receptor expression is down-regulated in human HCC, and (3) restoration of GABAA-beta3 receptor expression results in attenuated in vivo tumor growth in nude mice.

  2. Persistence of hAQP1 expression in human salivary gland cells following AdhAQP1 transduction is associated with a lack of methylation of hCMV promoter

    PubMed Central

    Zheng, C; Baum, BJ; Liu, X; Goldsmith, CM; Perez, P; Jang, S-I; Cotrim, AP; McCullagh, L; Ambudkar, IS; Alevizos, I

    2017-01-01

    In 2012, we reported that 5 out of 11 subjects in a clinical trial (NCT00372320) administering AdhAQP1 to radiation-damaged parotid glands showed increased saliva flow rates and decreased symptoms over the initial 42 days. AdhAQP1 is a first-generation, E1-deleted, replication-defective, serotype 5 adenoviral vector encoding human aquaporin-1 (hAQP1). This vector uses the human cytomegalovirus enhancer/promoter (hCMVp). As subject peak responses were at times much longer (7–42 days) than expected, we hypothesized that the hCMVp may not be methylated in human salivary gland cells to the extent previously observed in rodent salivary gland cells. This hypothesis was supported in human salivary gland primary cultures and human salivary gland cell lines after transduction with AdhAQP1. Importantly, hAQP1 maintained its function in those cells. Conversely, when we transduced mouse and rat cell lines in vitro and submandibular glands in vivo with AdhAQP1, the hCMVp was gradually methylated over time and associated with decreased hAQP1 expression and function in vitro and decreased hAQP1 expression in vivo. These data suggest that the hCMVp in AdhAQP1was probably not methylated in transduced human salivary gland cells of responding subjects, resulting in an unexpectedly longer functional expression of hAQP1. PMID:26177970

  3. Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs

    PubMed Central

    Quan, Shuo; Yang, Liming; Abraham, Nader G.; Kappas, Attallah

    2001-01-01

    Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin. PMID:11593038

  4. Regulation of human heme oxygenase in endothelial cells by using sense and antisense retroviral constructs.

    PubMed

    Quan, S; Yang, L; Abraham, N G; Kappas, A

    2001-10-09

    Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin.

  5. Recombinant yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 gag induces SIV-specific CD8+ T-cell responses in rhesus macaques.

    PubMed

    Bonaldo, Myrna C; Martins, Mauricio A; Rudersdorf, Richard; Mudd, Philip A; Sacha, Jonah B; Piaskowski, Shari M; Costa Neves, Patrícia C; Veloso de Santana, Marlon G; Vojnov, Lara; Capuano, Saverio; Rakasz, Eva G; Wilson, Nancy A; Fulkerson, John; Sadoff, Jerald C; Watkins, David I; Galler, Ricardo

    2010-04-01

    Here we describe a novel vaccine vector for expressing human immunodeficiency virus (HIV) antigens. We show that recombinant attenuated yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 Gag sequences can be used as a vector to generate SIV-specific CD8(+) T-cell responses in the rhesus macaque. Priming with recombinant BCG expressing SIV antigens increased the frequency of these SIV-specific CD8(+) T-cell responses after recombinant YF17D boosting. These recombinant YF17D-induced SIV-specific CD8(+) T cells secreted several cytokines, were largely effector memory T cells, and suppressed viral replication in CD4(+) T cells.

  6. Production of Multiple Transgenic Yucatan Miniature Pigs Expressing Human Complement Regulatory Factors, Human CD55, CD59, and H-Transferase Genes

    PubMed Central

    Jang, Gun-Hyuk; Jeong, Yeun-Ik; Hwang, In-Sung; Jeong, Yeon-woo; Kim, Yu-Kyung; Shin, Taeyoung; Kim, Nam-Hyung; Hyun, Sang-Hwan; Jeung, Eui-Bae; Hwang, Woo-Suk

    2013-01-01

    The present study was conducted to generate transgenic pigs coexpressing human CD55, CD59, and H-transferase (HT) using an IRES-mediated polycistronic vector. The study focused on hyperacute rejection (HAR) when considering clinical xenotransplantation as an alternative source for human organ transplants. In total, 35 transgenic cloned piglets were produced by somatic cell nuclear transfer (SCNT) and were confirmed for genomic integration of the transgenes from umbilical cord samples by PCR analysis. Eighteen swine umbilical vein endothelial cells (SUVEC) were isolated from umbilical cord veins freshly obtained from the piglets. We observed a higher expression of transgenes in the transgenic SUVEC (Tg SUVEC) compared with the human umbilical vein endothelial cells (HUVEC). Among these genes, HT and hCD59 were expressed at a higher level in the tested Tg organs compared with non-Tg control organs, but there was no difference in hCD55 expression between them. The transgenes in various organs of the Tg clones revealed organ-specific and spatial expression patterns. Using from 0 to 50% human serum solutions, we performed human complement-mediated cytolysis assays. The results showed that, overall, the Tg SUVEC tested had greater survival rates than did the non-Tg SUVEC, and the Tg SUVEC with higher HT expression levels tended to have more down-regulated α-Gal epitope expression, resulting in greater protection against cytotoxicity. By contrast, several Tg SUVEC with low CD55 expression exhibited a decreased resistance response to cytolysis. These results indicated that the levels of HT expression were inversely correlated with the levels of α-Gal epitope expression and that the combined expression of hCD55, hCD59, and HT proteins in SUVECs markedly enhances a protective response to human serum-mediated cytolysis. Taken together, these results suggest that combining a polycistronic vector system with SCNT methods provides a fast and efficient alternative for the generation of transgenic large animals with multiple genetic modifications. PMID:23704897

  7. Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data

    PubMed Central

    2013-01-01

    Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200

  8. [Construction and expression of recombinant human serum albumin-EPO fusion protein].

    PubMed

    Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

    2011-05-01

    OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

  9. Employing a gain-of-function factor IX variant R338L to advance the efficacy and safety of hemophilia B human gene therapy: preclinical evaluation supporting an ongoing adeno-associated virus clinical trial.

    PubMed

    Monahan, Paul E; Sun, Junjiang; Gui, Tong; Hu, Genlin; Hannah, William B; Wichlan, David G; Wu, Zhijian; Grieger, Joshua C; Li, Chengwen; Suwanmanee, Thipparat; Stafford, Darrel W; Booth, Carmen J; Samulski, Jade J; Kafri, Tal; McPhee, Scott W J; Samulski, R Jude

    2015-02-01

    Vector capsid dose-dependent inflammation of transduced liver has limited the ability of adeno-associated virus (AAV) factor IX (FIX) gene therapy vectors to reliably convert severe to mild hemophilia B in human clinical trials. These trials also identified the need to understand AAV neutralizing antibodies and empty AAV capsids regarding their impact on clinical success. To address these safety concerns, we have used a scalable manufacturing process to produce GMP-grade AAV8 expressing the FIXR338L gain-of-function variant with minimal (<10%) empty capsid and have performed comprehensive dose-response, biodistribution, and safety evaluations in clinically relevant hemophilia models. The scAAV8.FIXR338L vector produced greater than 6-fold increased FIX specific activity compared with wild-type FIX and demonstrated linear dose responses from doses that produced 2-500% FIX activity, associated with dose-dependent hemostasis in a tail transection bleeding challenge. More importantly, using a bleeding model that closely mimics the clinical morbidity of hemophilic arthropathy, mice that received the scAAV8.FIXR338L vector developed minimal histopathological findings of synovitis after hemarthrosis, when compared with mice that received identical doses of wild-type FIX vector. Hemostatically normal mice (n=20) and hemophilic mice (n=88) developed no FIX antibodies after peripheral intravenous vector delivery. No CD8(+) T cell liver infiltrates were observed, despite the marked tropism of scAAV8.FIXR338L for the liver in a comprehensive biodistribution evaluation (n=60 animals). With respect to the role of empty capsids, we demonstrated that in vivo FIXR338L expression was not influenced by the presence of empty AAV particles, either in the presence or absence of various titers of AAV8-neutralizing antibodies. Necropsy of FIX(-/-) mice 8-10 months after vector delivery revealed no microvascular or macrovascular thrombosis in mice expressing FIXR338L (plasma FIX activity, 100-500%). These preclinical studies demonstrate a safety:efficacy profile supporting an ongoing phase 1/2 human clinical trial of the scAAV8.FIXR338L vector (designated BAX335).

  10. Efficient protection from methotrexate toxicity and selection of transduced human hematopoietic cells following gene transfer of dihydrofolate reductase mutants.

    PubMed

    Meisel, Roland; Bardenheuer, Walter; Strehblow, Claudia; Sorg, Ursula Regina; Elmaagacli, Ahmet; Seeber, Siegfried; Flasshove, Michael; Moritz, Thomas

    2003-12-01

    While retrovirally mediated gene transfer of dihydrofolate reductase mutants (mutDHFR) has convincingly been demonstrated to confer methotrexate (MTX) resistance to murine hematopoietic cells, clinical application of this technology will require high efficacy in human cells. Therefore, we investigated retroviral constructs expressing various point mutants of human DHFR for their ability to confer MTX resistance to human clonogenic progenitor cells (CFU-C) and to allow for in vitro selection of transduced CFU-C. Primary human hematopoietic cells were retrovirally transduced using MMLV- and SFFV/MESV-based vectors expressing DHFR(Ser31), DHFR(Phe22/Ser31), or DHFR(Tyr22/Gly31). MTX resistance of unselected and in vitro-selected CFU-C was determined using MTX-supplemented methylcellulose cultures and gene transfer efficiency was assesed by single-colony PCR analysis. While less than 1% mock-transduced CFU-C survived the presence of > or =5 x 10(-8) M MTX, MMLV- and SFFV/MESV-based vectors expressing DHFR(Ser31) significantly protected CFU-C from MTX at doses ranging from 2.5 to 30 x 10(-8) M. Vectors expressing DHFR(Phe22/Ser31) or DHFR(Tyr22/Gly31) were even more protective and MTX-resistant CFU-C were observed up to 1 x 10(-5) M MTX. Three-day suspension cultures in the presence of 10-20 x 10(-8) M MTX resulted in significant selection of mutDHFR-transduced CFU-C. The percentage of CFU-C resistant to 10 x 10(-8) M MTX increased fourfold to 20-fold and provirus-containing CFU-C increased from 27% to 79-100%. Gene transfer of DHFR using suitable retroviral backbones and DHFR mutants significantly increases MTX resistance of human CFU-C and allows efficient in vitro selection of transduced cells using a short-term selection procedure.

  11. Time-dependent biodistribution and transgene expression of a recombinant human adenovirus serotype 5-luciferase vector as a surrogate agent for rAd5-FMDV vaccines in cattle

    USDA-ARS?s Scientific Manuscript database

    Replication-defective recombinant adenovirus 5 (rAd5) vectors carrying foot-and-mouth disease virus (FMDV) transgenes elicit a robust immune response to FMDV challenge in cattle; however vaccine function mechanisms are incompletely understood. Recent efforts addressing critical interactions of rAd5 ...

  12. Assessment of brain metabolite correlates of adeno-associated virus-mediated over-expression of human alpha-synuclein in cortical neurons by in vivo (1) H-MR spectroscopy at 9.4 T.

    PubMed

    Cuellar-Baena, Sandra; Landeck, Natalie; Sonnay, Sarah; Buck, Kerstin; Mlynarik, Vladimir; In 't Zandt, René; Kirik, Deniz

    2016-06-01

    In this study, we used proton-localized spectroscopy ((1) H-MRS) for the acquisition of the neurochemical profile longitudinally in a novel rat model of human wild-type alpha-synuclein (α-syn) over-expression. Our goal was to find out if the increased α-syn load in this model could be linked to changes in metabolites in the frontal cortex. Animals injected with AAV vectors encoding for human α-syn formed the experimental group, whereas green fluorescent protein expressing animals were used as the vector-treated control group and a third group of uninjected animals were used as naïve controls. Data were acquired at 2, 4, and 8 month time points. Nineteen metabolites were quantified in the MR spectra using LCModel software. On the basis of 92 spectra, we evaluated any potential gender effect and found that lactate (Lac) levels were lower in males compared to females, while the opposite was observed for ascorbate (Asc). Next, we assessed the effect of age and found increased levels of GABA, Tau, and GPC+PCho. Finally, we analyzed the effect of treatment and found that Lac levels (p = 0.005) were specifically lower in the α-syn group compared to the green fluorescent protein and control groups. In addition, Asc levels (p = 0.05) were increased in the vector-injected groups, whereas glucose levels remained unchanged. This study indicates that the metabolic switch between glucose-lactate could be detectable in vivo and might be modulated by Asc. No concomitant changes were found in markers of neuronal integrity (e.g., N-acetylaspartate) consistent with the fact that α-syn over-expression in cortical neurons did not result in neurodegeneration in this model. We acquired the neurochemical profile longitudinally in a rat model of human wild-type alpha-synuclein (α-syn) over-expression in cortical neurons. We found that Lactate levels were reduced in the α-syn group compared to the control groups and Ascorbate levels were increased in the vector-injected groups. No changes were found in markers of neuronal integrity consistent with the fact that α-syn over-expression did not result in frank neurodegeneration. © 2016 International Society for Neurochemistry.

  13. Heterologous prime-boost immunization of Newcastle disease virus vectored vaccines protected broiler chickens against highly pathogenic avian influenza and Newcastle disease viruses.

    PubMed

    Kim, Shin-Hee; Samal, Siba K

    2017-07-24

    Avian Influenza virus (AIV) is an important pathogen for both human and animal health. There is a great need to develop a safe and effective vaccine for AI infections in the field. Live-attenuated Newcastle disease virus (NDV) vectored AI vaccines have shown to be effective, but preexisting antibodies to the vaccine vector can affect the protective efficacy of the vaccine in the field. To improve the efficacy of AI vaccine, we generated a novel vectored vaccine by using a chimeric NDV vector that is serologically distant from NDV. In this study, the protective efficacy of our vaccines was evaluated by using H5N1 highly pathogenic avian influenza virus (HPAIV) strain A/Vietnam/1203/2004, a prototype strain for vaccine development. The vaccine viruses were three chimeric NDVs expressing the hemagglutinin (HA) protein in combination with the neuraminidase (NA) protein, matrix 1 protein, or nonstructural 1 protein. Comparison of their protective efficacy between a single and prime-boost immunizations indicated that prime immunization of 1-day-old SPF chicks with our vaccine viruses followed by boosting with the conventional NDV vector strain LaSota expressing the HA protein provided complete protection of chickens against mortality, clinical signs and virus shedding. Further verification of our heterologous prime-boost immunization using commercial broiler chickens suggested that a sequential immunization of chickens with chimeric NDV vector expressing the HA and NA proteins following the boost with NDV vector expressing the HA protein can be a promising strategy for the field vaccination against HPAIVs and against highly virulent NDVs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Identification and characterization of highly versatile peptide-vectors that bind non-competitively to the low-density lipoprotein receptor for in vivo targeting and delivery of small molecules and protein cargos

    PubMed Central

    David, Marion; Lécorché, Pascaline; Masse, Maxime; Faucon, Aude; Abouzid, Karima; Gaudin, Nicolas; Varini, Karine; Gassiot, Fanny; Ferracci, Géraldine; Jacquot, Guillaume; Vlieghe, Patrick

    2018-01-01

    Insufficient membrane penetration of drugs, in particular biotherapeutics and/or low target specificity remain a major drawback in their efficacy. We propose here the rational characterization and optimization of peptides to be developed as vectors that target cells expressing specific receptors involved in endocytosis or transcytosis. Among receptors involved in receptor-mediated transport is the LDL receptor. Screening complex phage-displayed peptide libraries on the human LDLR (hLDLR) stably expressed in cell lines led to the characterization of a family of cyclic and linear peptides that specifically bind the hLDLR. The VH411 lead cyclic peptide allowed endocytosis of payloads such as the S-Tag peptide or antibodies into cells expressing the hLDLR. Size reduction and chemical optimization of this lead peptide-vector led to improved receptor affinity. The optimized peptide-vectors were successfully conjugated to cargos of different nature and size including small organic molecules, siRNAs, peptides or a protein moiety such as an Fc fragment. We show that in all cases, the peptide-vectors retain their binding affinity to the hLDLR and potential for endocytosis. Following i.v. administration in wild type or ldlr-/- mice, an Fc fragment chemically conjugated or fused in C-terminal to peptide-vectors showed significant biodistribution in LDLR-enriched organs. We have thus developed highly versatile peptide-vectors endowed with good affinity for the LDLR as a target receptor. These peptide-vectors have the potential to be further developed for efficient transport of therapeutic or imaging agents into cells -including pathological cells—or organs that express the LDLR. PMID:29485998

  15. A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

    PubMed

    Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

    2016-01-01

    The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

  16. Human heme oxygenase-1 gene transfer lowers blood pressure and promotes growth in spontaneously hypertensive rats.

    PubMed

    Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G

    2001-08-01

    Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.

  17. Expression of a model gene in prostate cancer cells lentivirally transduced in vitro and in vivo.

    PubMed

    Bastide, C; Maroc, N; Bladou, F; Hassoun, J; Maitland, N; Mannoni, P; Bagnis, C

    2003-01-01

    In a preclinical model for prostate cancer gene therapy, we have tested lentiviral vectors as a practical possibility for the transfer and long-term expression of the EGFP gene both in vitro and in vivo. The human prostate cancer cell lines DU145 and PC3 were transduced using experimental conditions which permitted analysis of the expression from a single proviral vector per cell. The transduced cells stably expressed the EGFP transgene for 4 months. After injection of the transduced cell populations into Nod-SCID mice a decrease in EGFP was only observed in a minority of cases, while the majority of tumors maintained transgene expression at in vitro levels. In vivo injection of viral vector preparations directly into pre-established subcutaneous or orthotopic tumor masses, obtained by implantation of untransduced PC3 and DU145 cells led to a high transduction efficiency. While the efficiency of direct intratumoral transduction was proportional to the dose of virus injected, the results indicated some technical limitations inherent in these approaches to prostate cancer gene therapy.

  18. Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

    PubMed

    Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

    2016-06-21

    To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

  19. Biological and immunogenic properties of rabies virus glycoprotein expressed by canine herpesvirus vector.

    PubMed

    Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H

    1998-01-01

    In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.

  20. [Cloning, expression and identification of functional fragment rC3B of human complement C3 in E. Coli].

    PubMed

    Gan, Hui; Zhou, Yong; Sun, Ping; Zhu, Xiao-Xia; Wang, Quan-Li; Zhan, Lin-Sheng

    2007-08-01

    This study was purposed to verify the binding part of human complement C3 to complement receptor III (CRIII) in monocytes, the peptide rC3B, including the binding-site, was expressed, purified and identified. rC3B, the binding part of human complement C3 to CRIII, was selected by computer-aided modeling and summarizing researches published. Then, rC3B gene fragment was amplified by PCR, and cloned into prokaryotic vector pQE30a. The fusion protein rC3B was expressed in E.coli M15 and purified by Ni(2+)-chelating affinity chromatography. The activity of rC3B was identified by Western blot and adherence assay with monocytes. The results showed that rC3B fragment was obtained, and a prokaryotic expression vector pQE30-rC3B was constructed. rC3B was efficiently expressed and purified. In Western blot, the target protein showed the activity of binding with C3 antibody, while the purified protein showed the activity of adherence with monocytes. It is concluded that the recombinant C3B was obtained and identified, and this study lay the basis for the further functional analysis of C3.

  1. Human Bocavirus Type-1 Capsid Facilitates the Transduction of Ferret Airways by Adeno-Associated Virus Genomes.

    PubMed

    Yan, Ziying; Feng, Zehua; Sun, Xingshen; Zhang, Yulong; Zou, Wei; Wang, Zekun; Jensen-Cody, Chandler; Liang, Bo; Park, Soo-Yeun; Qiu, Jianming; Engelhardt, John F

    2017-08-01

    Human bocavirus type-1 (HBoV1) has a high tropism for the apical membrane of human airway epithelia. The packaging of a recombinant adeno-associated virus 2 (rAAV2) genome into HBoV1 capsid produces a chimeric vector (rAAV2/HBoV1) that also efficiently transduces human airway epithelia. As such, this vector is attractive for use in gene therapies to treat lung diseases such as cystic fibrosis. However, preclinical development of rAAV2/HBoV1 vectors has been hindered by the fact that humans are the only known host for HBoV1 infection. This study reports that rAAV2/HBoV1 vector is capable of efficiently transducing the lungs of both newborn (3- to 7-day-old) and juvenile (29-day-old) ferrets, predominantly in the distal airways. Analyses of in vivo, ex vivo, and in vitro models of the ferret proximal airway demonstrate that infection of this particular region is less effective than it is in humans. Studies of vector binding and endocytosis in polarized ferret proximal airway epithelial cultures revealed that a lack of effective vector endocytosis is the main cause of inefficient transduction in vitro. While transgene expression declined proportionally with growth of the ferrets following infection at 7 days of age, reinfection of ferrets with rAAV2/HBoV1 at 29 days gave rise to approximately 5-fold higher levels of transduction than observed in naive infected 29-day-old animals. The findings presented here lay the foundation for clinical development of HBoV1 capsid-based vectors for lung gene therapy in cystic fibrosis using ferret models.

  2. Attenuated Human Parainfluenza Virus Type 1 Expressing Ebola Virus Glycoprotein GP Administered Intranasally Is Immunogenic in African Green Monkeys.

    PubMed

    Lingemann, Matthias; Liu, Xueqiao; Surman, Sonja; Liang, Bo; Herbert, Richard; Hackenberg, Ashley D; Buchholz, Ursula J; Collins, Peter L; Munir, Shirin

    2017-05-15

    The recent 2014-2016 Ebola virus (EBOV) outbreak prompted increased efforts to develop vaccines against EBOV disease. We describe the development and preclinical evaluation of an attenuated recombinant human parainfluenza virus type 1 (rHPIV1) expressing the membrane-anchored form of EBOV glycoprotein GP, as an intranasal (i.n.) EBOV vaccine. GP was codon optimized and expressed either as a full-length protein or as an engineered chimeric form in which its transmembrane and cytoplasmic tail (TMCT) domains were replaced with those of the HPIV1 F protein in an effort to enhance packaging into the vector particle and immunogenicity. GP was inserted either preceding the N gene (pre-N) or between the N and P genes (N-P) of rHPIV1 bearing a stabilized attenuating mutation in the P/C gene (C Δ170 ). The constructs grew to high titers and efficiently and stably expressed GP. Viruses were attenuated, replicating at low titers over several days, in the respiratory tract of African green monkeys (AGMs). Two doses of candidates expressing GP from the pre-N position elicited higher GP neutralizing serum antibody titers than the N-P viruses, and unmodified GP induced higher levels than its TMCT counterpart. Unmodified EBOV GP was packaged into the HPIV1 particle, and the TMCT modification did not increase packaging or immunogenicity but rather reduced the stability of GP expression during in vivo replication. In conclusion, we identified an attenuated and immunogenic i.n. vaccine candidate expressing GP from the pre-N position. It is expected to be well tolerated in humans and is available for clinical evaluation. IMPORTANCE EBOV hemorrhagic fever is one of the most lethal viral infections and lacks a licensed vaccine. Contact of fluids from infected individuals, including droplets or aerosols, with mucosal surfaces is an important route of EBOV spread during a natural outbreak, and aerosols also might be exploited for intentional virus spread. Therefore, vaccines that protect against mucosal as well as systemic inoculation are needed. We evaluated a version of human parainfluenza virus type 1 (HPIV1) bearing a stabilized attenuating mutation in the P/C gene (C Δ170 ) as an intranasal vaccine vector to express the EBOV glycoprotein GP. We evaluated expression from two different genome positions (pre-N and N-P) and investigated the use of vector packaging signals. African green monkeys immunized with two doses of the vector expressing GP from the pre-N position developed high titers of GP neutralizing serum antibodies. The attenuated vaccine candidate is expected to be safe and immunogenic and is available for clinical development. Copyright © 2017 American Society for Microbiology.

  3. Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells.

    PubMed

    Chang, Chia-Wei; Lai, Yi-Shin; Pawlik, Kevin M; Liu, Kaimao; Sun, Chiao-Wang; Li, Chao; Schoeb, Trenton R; Townes, Tim M

    2009-05-01

    We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3' long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic "hit and run" vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells.

  4. A recombinant chimeric Ad5/3 vector expressing a multi-stage Plasmodium antigen induces protective immunity in mice using heterologous prime-boost immunization regimens1

    PubMed Central

    Cabrera-Mora, Monica; Fonseca, Jairo Andres; Singh, Balwan; Zhao, Chunxia; Makarova, Natalia; Dmitriev, Igor; Curiel, David T.; Blackwell, Jerry; Moreno, Alberto

    2016-01-01

    An ideal malaria vaccine should target several stages of the parasite life cycle and induce anti-parasite and anti-disease immunity. We have reported a Plasmodium yoelii chimeric multi-stage recombinant protein (PyLPC/RMC), engineered to express several autologous T cell epitopes and sequences derived from the circumsporozoite protein (CSP) and the merozoite surface protein 1 (MSP-1). This chimeric protein elicits protective immunity, mediated by CD4+ T cells and neutralizing antibodies. However, experimental evidence from pre-erythrocytic vaccine candidates and irradiated sporozoites has shown that CD8+ T cells play a significant role in protection. Recombinant viral vectors have been used as a vaccine platform to elicit effective CD8+ T cell responses. The human adenovirus serotype 5 (Ad5) has been tested in malaria vaccine clinical trials with excellent safety profile. Nevertheless, a major concern for the use of Ad5 is the high prevalence of anti-vector neutralizing antibodies in humans, hampering its immunogenicity. To minimize the impact of anti-vector pre-existing immunity we developed a chimeric Ad5/3 vector in which the knob region of Ad5 was replaced with that of Ad3, conferring partial resistance to anti-Ad5 neutralizing antibodies. Furthermore, we implemented heterologous adenovirus/protein immunization regimens which include a single immunization with recombinant Ad vectors. Our data show that immunization with the recombinant Ad5/3 vector induces protective efficacy indistinguishable from that elicited by Ad5. Our study also demonstrate that the dose of the Ad vectors has an impact on the memory profile and protective efficacy. The results support further studies with Ad5/3 for malaria vaccine development. PMID:27574299

  5. Transduction of skeletal muscles with common reporter genes can promote muscle fiber degeneration and inflammation.

    PubMed

    Winbanks, Catherine E; Beyer, Claudia; Qian, Hongwei; Gregorevic, Paul

    2012-01-01

    Recombinant adeno-associated viral vectors (rAAV vectors) are promising tools for delivering transgenes to skeletal muscle, in order to study the mechanisms that control the muscle phenotype, and to ameliorate diseases that perturb muscle homeostasis. Many studies have employed rAAV vectors carrying reporter genes encoding for β-galactosidase (β-gal), human placental alkaline phosphatase (hPLAP), and green fluorescent protein (GFP) as experimental controls when studying the effects of manipulating other genes. However, it is not clear to what extent these reporter genes can influence signaling and gene expression signatures in skeletal muscle, which may confound the interpretation of results obtained in experimentally manipulated muscles. Herein, we report a strong pro-inflammatory effect of expressing reporter genes in skeletal muscle. Specifically, we show that the administration of rAAV6:hPLAP vectors to the hind limb muscles of mice is associated with dose- and time-dependent macrophage recruitment, and skeletal muscle damage. Dose-dependent expression of hPLAP also led to marked activity of established pro-inflammatory IL-6/Stat3, TNFα, IKKβ and JNK signaling in lysates obtained from homogenized muscles. These effects were independent of promoter type, as expression cassettes featuring hPLAP under the control of constitutive CMV and muscle-specific CK6 promoters both drove cellular responses when matched for vector dose. Importantly, the administration of rAAV6:GFP vectors did not induce muscle damage or inflammation except at the highest doses we examined, and administration of a transgene-null vector (rAAV6:MCS) did not cause damage or inflammation at any of the doses tested, demonstrating that GFP-expressing, or transgene-null vectors may be more suitable as experimental controls. The studies highlight the importance of considering the potential effects of reporter genes when designing experiments that examine gene manipulation in vivo.

  6. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  7. Virus-Vectored Influenza Virus Vaccines

    PubMed Central

    Tripp, Ralph A.; Tompkins, S. Mark

    2014-01-01

    Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

  8. A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

    PubMed

    Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

    2012-01-01

    Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

  9. Insect cells as factories for biomanufacturing.

    PubMed

    Drugmand, Jean-Christophe; Schneider, Yves-Jacques; Agathos, Spiros N

    2012-01-01

    Insect cells (IC) and particularly lepidopteran cells are an attractive alternative to mammalian cells for biomanufacturing. Insect cell culture, coupled with the lytic expression capacity of baculovirus expression vector systems (BEVS), constitutes a powerful platform, IC-BEVS, for the abundant and versatile formation of heterologous gene products, including proteins, vaccines and vectors for gene therapy. Such products can be manufactured on a large scale thanks to the development of efficient and scaleable production processes involving the integration of a cell growth stage and a stage of cell infection with the recombinant baculovirus vector. Insect cells can produce multimeric proteins functionally equivalent to the natural ones and engineered vectors can be used for efficient expression. Insect cells can be cultivated easily in serum- and protein-free media. A growing number of companies are currently developing an interest in producing therapeutics using IC-BEVS, and many products are today in clinical trials and on the market for veterinary and human applications. This review summarizes current knowledge on insect cell metabolism, culture conditions and applications. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Sustained AAV9-mediated expression of a non-self protein in the CNS of non-human primates after immunomodulation

    PubMed Central

    Ramsingh, Arlene I.; Gray, Steven J.; Reilly, Andrew; Koday, Michael; Bratt, Debbie; Koday, Merika Treants; Murnane, Robert; Hu, Yuhui; Messer, Anne

    2018-01-01

    A critical issue in transgene delivery studies is immune reactivity to the transgene- encoded protein and its impact on sustained gene expression. Here, we test the hypothesis that immunomodulation by rapamycin can decrease immune reactivity after intrathecal AAV9 delivery of a transgene (GFP) in non-human primates, resulting in sustained GFP expression in the CNS. We show that rapamycin treatment clearly reduced the overall immunogenicity of the AAV9/GFP vector by lowering GFP- and AAV9-specific antibody responses, and decreasing T cell responses including cytokine and cytolytic effector responses. Spinal cord GFP protein expression was sustained for twelve weeks, with no toxicity. Immune correlates of robust transgene expression include negligible GFP-specific CD4 and CD8 T cell responses, absence of GFP-specific IFN-γ producing T cells, and absence of GFP-specific cytotoxic T cells, which support the hypothesis that decreased T cell reactivity results in sustained transgene expression. These data strongly support the use of modest doses of rapamycin to modulate immune responses for intrathecal gene therapies, and potentially a much wider range of viral vector-based therapeutics. PMID:29874260

  11. Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.

    PubMed

    Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid

    2013-01-01

    Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.

  12. Advances in the development of bacterial vector technology.

    PubMed

    Kochi, Sims K; Killeen, Kevin P; Ryan, Una S

    2003-02-01

    The demand for new and improved vaccines against human diseases has continued unabated over the past century. While the need continues for traditional vaccines in areas such as infectious diseases, there is an increasing demand for new therapies in nontraditional areas, such as cancer treatment, bioterrorism and food safety. Prompted by these changes, there has been a renewed interest in the application and development of live, attenuated bacteria expressing foreign antigens as vaccines. The application of bacterial vector vaccines to human maladies has been studied most extensively in attenuted strains of Salmonella. Live, attenuated strains of Shigella, Listeria monocytogenes, Mycobacterium bovis-BCG and Vibrio cholerae provide unique alternatives in terms of antigen delivery and immune presentation, however and also show promise as potentially useful bacterial vectors.

  13. Attenuated Human Parainfluenza Virus Type 1 (HPIV1) Expressing the Fusion Glycoprotein of Human Respiratory Syncytial Virus (RSV) as a Bivalent HPIV1/RSV Vaccine

    PubMed Central

    Mackow, Natalie; Amaro-Carambot, Emérito; Liang, Bo; Surman, Sonja; Lingemann, Matthias; Yang, Lijuan; Collins, Peter L.

    2015-01-01

    ABSTRACT Live attenuated recombinant human parainfluenza virus type 1 (rHPIV1) was investigated as a vector to express the respiratory syncytial virus (RSV) fusion (F) glycoprotein, to provide a bivalent vaccine against RSV and HPIV1. The RSV F gene was engineered to include HPIV1 transcription signals and inserted individually into three gene locations in each of the two attenuated rHPIV1 backbones. Each backbone contained a single previously described attenuating mutation that was stabilized against deattenuation, specifically, a non-temperature-sensitive deletion mutation involving 6 nucleotides in the overlapping P/C open reading frames (ORFs) (CΔ170) or a temperature-sensitive missense mutation in the L ORF (LY942A). The insertion sites in the genome were pre-N (F1), N-P (F2), or P-M (F3) and were identical for both backbones. In vitro, the presence of the F insert reduced the rate of virus replication, but the final titers were the same as the final titer of wild-type (wt) HPIV1. High levels of RSV F expression in cultured cells were observed with rHPIV1-CΔ170-F1, -F2, and -F3 and rHPIV1-LY942A-F1. In hamsters, the rHPIV1-CΔ170-F1, -F2, and -F3 vectors were moderately restricted in the nasal turbinates, highly restricted in lungs, and genetically stable in vivo. Among the CΔ170 vectors, the F1 virus was the most immunogenic and protective against wt RSV challenge. The rHPIV1-LY942A vectors were highly restricted in vivo and were not detectably immunogenic or protective, indicative of overattenuation. The CΔ170-F1 construct appears to be suitably attenuated and immunogenic for further development as a bivalent intranasal pediatric vaccine. IMPORTANCE There are no vaccines for the pediatric respiratory pathogens RSV and HPIV. We are developing live attenuated RSV and HPIV vaccines for use in virus-naive infants. Live attenuated RSV strains in particular are difficult to develop due to their poor growth and physical instability, but these obstacles could be avoided by the use of a vaccine vector. We describe the development and preclinical evaluation of live attenuated rHPIV1 vectors expressing the RSV F protein. Two different attenuated rHPIV1 backbones were each engineered to express RSV F from three different gene positions. The rHPIV1-CΔ170-F1 vector, bearing an attenuating deletion mutation (CΔ170) in the P/C gene and expressing RSV F from the pre-N position, was attenuated, stable, and immunogenic against the RSV F protein and HPIV1 in the hamster model and provided substantial protection against RSV challenge. This study provides a candidate rHPIV1-RSV-F vaccine virus suitable for continued development as a bivalent vaccine against two major childhood pathogens. PMID:26223633

  14. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    PubMed

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  15. Production and purification of non replicative canine adenovirus type 2 derived vectors.

    PubMed

    Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

    2013-12-03

    Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

  16. Isolation, cloning and expression mapping of a gene encoding an anti-diuretic hormone and other CAPA-related peptides in the disease vector, Rhodnius prolixus

    USDA-ARS?s Scientific Manuscript database

    Following a blood meal, Rhodnius prolixus undergoes a rapid diuresis in order to eliminate excess water and salts. During the voiding of this primary urine, R. prolixus acts as a vector of Chagas’ disease, with the causative agent, Trypanosoma cruzi, infecting the human host via the urine. Diuresi...

  17. Construction of human artificial chromosome vectors by recombineering.

    PubMed

    Kotzamanis, George; Cheung, Wing; Abdulrazzak, Hassan; Perez-Luz, Sara; Howe, Steven; Cooke, Howard; Huxley, Clare

    2005-05-23

    Human artificial chromosomes (HACs) can be formed de novo by transfection of large fragments of cloned alphoid DNA into human HT1080 cells in tissue culture. In order to generate HACs carrying a gene of interest, one can either co-transfect the alphoid DNA and the gene of interest, or one can clone both into a single vector prior to transfection. Here we describe linking approximately 70 kb of alphoid DNA onto a 156-kb BAC carrying the human HPRT gene using Red homologous recombination in the EL350 Escherichia coli host [Lee et al., Genomics 73 (2001) 56-65]. A selectable marker and EGFP marker were then added by loxP/Cre recombination using the arabinose inducible cre gene in the EL350 bacteria. The final construct generates minichromosomes in HT1080 cells and the HPRT gene is expressed. The retrofitting vector can be used to add the approximately 70 kb of alphoid DNA to any BAC carrying a gene of interest to generate a HAC vector. The method can also be used to link any unrelated BAC or PAC insert onto another BAC clone. The EL350 bacteria are an excellent host for building up complex vectors by a combination of homologous and loxP/Cre recombination.

  18. Specific gene delivery to liver sinusoidal and artery endothelial cells.

    PubMed

    Abel, Tobias; El Filali, Ebtisam; Waern, Johan; Schneider, Irene C; Yuan, Qinggong; Münch, Robert C; Hick, Meike; Warnecke, Gregor; Madrahimov, Nodir; Kontermann, Roland E; Schüttrumpf, Jörg; Müller, Ulrike C; Seppen, Jurgen; Ott, Michael; Buchholz, Christian J

    2013-09-19

    Different types of endothelial cells (EC) fulfill distinct tasks depending on their microenvironment. ECs are therefore difficult to genetically manipulate ex vivo for functional studies or gene therapy. We assessed lentiviral vectors (LVs) targeted to the EC surface marker CD105 for in vivo gene delivery. The mouse CD105-specific vector, mCD105-LV, transduced only CD105-positive cells in primary liver cell cultures. Upon systemic injection, strong reporter gene expression was detected in liver where mCD105-LV specifically transduced liver sinusoidal ECs (LSECs) but not Kupffer cells, which were mainly transduced by nontargeted LVs. Tumor ECs were specifically targeted upon intratumoral vector injection. Delivery of the erythropoietin gene with mCD105-LV resulted in substantially increased erythropoietin and hematocrit levels. The human CD105-specific vector (huCD105-LV) transduced exclusively human LSECs in mice transplanted with human liver ECs. Interestingly, when applied at higher dose and in absence of target cells in the liver, huCD105-LV transduced ECs of a human artery transplanted into the descending mouse aorta. The data demonstrate for the first time targeted gene delivery to specialized ECs upon systemic vector administration. This strategy offers novel options to better understand the physiological functions of ECs and to treat genetic diseases such as those affecting blood factors.

  19. Developing de novo human artificial chromosomes in embryonic stem cells using HSV-1 amplicon technology.

    PubMed

    Moralli, Daniela; Monaco, Zoia L

    2015-02-01

    De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.

  20. Preparation for a first-in-man lentivirus trial in patients with cystic fibrosis

    PubMed Central

    Alton, Eric W F W; Beekman, Jeffery M; Boyd, A Christopher; Brand, June; Carlon, Marianne S; Connolly, Mary M; Chan, Mario; Conlon, Sinead; Davidson, Heather E; Davies, Jane C; Davies, Lee A; Dekkers, Johanna F; Doherty, Ann; Gea-Sorli, Sabrina; Gill, Deborah R; Griesenbach, Uta; Hasegawa, Mamoru; Higgins, Tracy E; Hironaka, Takashi; Hyndman, Laura; McLachlan, Gerry; Inoue, Makoto; Hyde, Stephen C; Innes, J Alastair; Maher, Toby M; Moran, Caroline; Meng, Cuixiang; Paul-Smith, Michael C; Pringle, Ian A; Pytel, Kamila M; Rodriguez-Martinez, Andrea; Schmidt, Alexander C; Stevenson, Barbara J; Sumner-Jones, Stephanie G; Toshner, Richard; Tsugumine, Shu; Wasowicz, Marguerite W; Zhu, Jie

    2017-01-01

    We have recently shown that non-viral gene therapy can stabilise the decline of lung function in patients with cystic fibrosis (CF). However, the effect was modest, and more potent gene transfer agents are still required. Fuson protein (F)/Hemagglutinin/Neuraminidase protein (HN)-pseudotyped lentiviral vectors are more efficient for lung gene transfer than non-viral vectors in preclinical models. In preparation for a first-in-man CF trial using the lentiviral vector, we have undertaken key translational preclinical studies. Regulatory-compliant vectors carrying a range of promoter/enhancer elements were assessed in mice and human air–liquid interface (ALI) cultures to select the lead candidate; cystic fibrosis transmembrane conductance receptor (CFTR) expression and function were assessed in CF models using this lead candidate vector. Toxicity was assessed and ‘benchmarked’ against the leading non-viral formulation recently used in a Phase IIb clinical trial. Integration site profiles were mapped and transduction efficiency determined to inform clinical trial dose-ranging. The impact of pre-existing and acquired immunity against the vector and vector stability in several clinically relevant delivery devices was assessed. A hybrid promoter hybrid cytosine guanine dinucleotide (CpG)- free CMV enhancer/elongation factor 1 alpha promoter (hCEF) consisting of the elongation factor 1α promoter and the cytomegalovirus enhancer was most efficacious in both murine lungs and human ALI cultures (both at least 2-log orders above background). The efficacy (at least 14% of airway cells transduced), toxicity and integration site profile supports further progression towards clinical trial and pre-existing and acquired immune responses do not interfere with vector efficacy. The lead rSIV.F/HN candidate expresses functional CFTR and the vector retains 90–100% transduction efficiency in clinically relevant delivery devices. The data support the progression of the F/HN-pseudotyped lentiviral vector into a first-in-man CF trial in 2017. PMID:27852956

  1. Effects of siRNA-mediated suppression of HPV-11 L1 expression on the proliferation and apoptosis of vaginal epithelial cells

    PubMed Central

    Zeng, Juan; Yang, Shumei; Wang, Xiaorui; Gao, Yan; Zhang, Mei

    2017-01-01

    The aim of the present study was to investigate the effects of human papillomavirus (HPV) infection on the gynecological disease of vaginitis and to demonstrate how the small interfering RNA (siRNA) method may be used for HPV prevention in the clinic. Human vaginal epithelial cells were transfected with HPV-11 L1 expression vector and siRNA-HPV-11 L1 vectors and a control group was transfected with scrambled siRNA. Cell proliferation in each group was analyzed using the MTT assay and the expression of apoptosis-associated proteins was measured by western blot analysis. Compared with the control group, HPV-11 L1 mRNA and protein levels were significantly increased following transfection with the HPV-11 L1 expression vector in cells (P<0.05), but this result was significantly reversed by silencing of HPV-11 L1 (P<0.05). In addition, cell proliferation in the HPV-11 group was lower than that in the control group; however, cell proliferation was significantly increased in cells transfected with silenced L1 compared with that in the control group (P<0.05). Furthermore, silencing of HPV-11 L1 significantly decreased caspase-3 and caspase-9 expressions in cells, whereas the expression was increased in the HPV-11 L1 group (P<0.05). The present study suggested that siRNA-mediated silencing of HPV-11 L1 may have potential therapeutic applications for treating gynecological diseases associated with HPV-11 infection. PMID:28413509

  2. Naturally enveloped AAV vectors for shielding neutralizing antibodies and robust gene delivery in vivo

    PubMed Central

    György, Bence; Fitzpatrick, Zachary; Crommentuijn, Matheus HW; Mu, Dakai; Maguire, Casey A.

    2014-01-01

    Recently adeno-associated virus (AAV) became the first clinically approved gene therapy product in the western world. To develop AAV for future clinical application in a widespread patient base, particularly in therapies which require intravenous (i.v.) administration of vector, the virus must be able to evade pre-existing antibodies to the wild type virus. Here we demonstrate that in mice, AAV vectors associated with extracellular vesicles (EVs) can evade human anti-AAV neutralizing antibodies. We observed different antibody evasion and gene transfer abilities with populations of EVs isolated by different centrifugal forces. EV-associated AAV vector (ev-AAV) was up to 136-fold more resistant over a range of neutralizing antibody concentrations relative to standard AAV vector in vitro. Importantly in mice, at a concentration of passively transferred human antibodies which decreased i.v. administered standard AAV transduction of brain by 80%, transduction of ev-AAV transduction was not reduced and was 4,000-fold higher. Finally, we show that expressing a brain targeting peptide on the EV surface allowed significant enhancement of transduction compared to untargeted ev-AAV. Using ev-AAV represents an effective, clinically relevant approach to evade human neutralizing anti-AAV antibodies after systemic administration of vector. PMID:24917028

  3. Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques

    PubMed Central

    Hodara, Vida L.; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.

    2005-01-01

    Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that expressed CD154. We found that this recombinant vector directed the expression of CD154 on the surface of infected CD4+ T cells and that expression of CD154 resulted in activation of B cells present in the same cultures. Experimental infection of rhesus macaques resulted in very low viral loads for the CD154-expressing virus and the control virus, indicating that expression of CD154 did not result in increased viral replication. Analyses of the anti-SIV immune responses and the phenotype of lymphocytes in blood and lymphoid tissues showed changes that occurred during the acute phase of infection only in animals infected with the CD154-expressing SIV, but that became indistinguishable from those seen in animals infected with the control virus at later time points. We conclude that the level of expression of CD154 in itself is not responsible for affecting the immune response to an attenuated virus. Considering that the CD154-expressing SIV vector and the virus control did not carry an active nef gene, our results suggest that, in CD4+ T cells infected with wild-type virus, Nef is the viral factor that interferes with the immune mechanisms that regulate expression of CD154. PMID:15795254

  4. Adenoviral Vector Immunity: Its Implications and circumvention strategies

    PubMed Central

    Ahi, Yadvinder S.; Bangari, Dinesh S.; Mittal, Suresh K.

    2014-01-01

    Adenoviral (Ad) vectors have emerged as a promising gene delivery platform for a variety of therapeutic and vaccine purposes during last two decades. However, the presence of preexisting Ad immunity and the rapid development of Ad vector immunity still pose significant challenges to the clinical use of these vectors. Innate inflammatory response following Ad vector administration may lead to systemic toxicity, drastically limit vector transduction efficiency and significantly abbreviate the duration of transgene expression. Currently, a number of approaches are being extensively pursued to overcome these drawbacks by strategies that target either the host or the Ad vector. In addition, significant progress has been made in the development of novel Ad vectors based on less prevalent human Ad serotypes and nonhuman Ad. This review provides an update on our current understanding of immune responses to Ad vectors and delineates various approaches for eluding Ad vector immunity. Approaches targeting the host and those targeting the vector are discussed in light of their promises and limitations. PMID:21453277

  5. Alphavirus Replicon DNA Vectors Expressing Ebola GP and VP40 Antigens Induce Humoral and Cellular Immune Responses in Mice

    PubMed Central

    Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan

    2018-01-01

    Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526

  6. Dissociable cognitive mechanisms underlying human path integration.

    PubMed

    Wiener, Jan M; Berthoz, Alain; Wolbers, Thomas

    2011-01-01

    Path integration is a fundamental mechanism of spatial navigation. In non-human species, it is assumed to be an online process in which a homing vector is updated continuously during an outward journey. In contrast, human path integration has been conceptualized as a configural process in which travelers store working memory representations of path segments, with the computation of a homing vector only occurring when required. To resolve this apparent discrepancy, we tested whether humans can employ different path integration strategies in the same task. Using a triangle completion paradigm, participants were instructed either to continuously update the start position during locomotion (continuous strategy) or to remember the shape of the outbound path and to calculate home vectors on basis of this representation (configural strategy). While overall homing accuracy was superior in the configural condition, participants were quicker to respond during continuous updating, strongly suggesting that homing vectors were computed online. Corroborating these findings, we observed reliable differences in head orientation during the outbound path: when participants applied the continuous updating strategy, the head deviated significantly from straight ahead in direction of the start place, which can be interpreted as a continuous motor expression of the homing vector. Head orientation-a novel online measure for path integration-can thus inform about the underlying updating mechanism already during locomotion. In addition to demonstrating that humans can employ different cognitive strategies during path integration, our two-systems view helps to resolve recent controversies regarding the role of the medial temporal lobe in human path integration.

  7. A simplified model for predicting malaria entomologic inoculation rates based on entomologic and parasitologic parameters relevant to control.

    PubMed

    Killeen, G F; McKenzie, F E; Foy, B D; Schieffelin, C; Billingsley, P F; Beier, J C

    2000-05-01

    Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other's effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (+/- SD) that are 1.13 +/- 0.37 (range = 0.84-1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education.

  8. Genetically modified rabies virus-vectored Ebola virus disease vaccines are safe and induce efficacious immune responses in mice and dogs.

    PubMed

    Shuai, Lei; Wang, Xijun; Wen, Zhiyuan; Ge, Jinying; Wang, Jinliang; Zhao, Dandan; Bu, Zhigao

    2017-10-01

    Ebola viruses (EBOVs) are zoonotic pathogens that cause EBOV disease (EVD) with high case fatality in humans. Currently, EVD vaccines are still under development in several countries. Here, we generated two recombinant rabies viruses (RABVs), rERAG 333E /ZGP and rERAG 333E /SGP, expressing the Zaire EBOV glycoprotein (ZGP) or Sudan EBOV glycoprotein (SGP) gene based on a modified ERA vaccine strain (rERAG 333E ) vector platform. The recombinant RABVs retained growth properties similar to those of the vector virus in BSR cell culture and efficiently expressed ZGP or SGP. After intracerebral (i.c.) inoculation with rERAG 333E /ZGP or rERAG 333E /SGP, all adult mice showed no signs of disease or weight loss and suckling mice maintained similar survivorship curve as those mice inoculated with control vector rERAG 333E , demonstrating that ZGP or SGP expression did not increase the virulence of the vector. Mouse immunization studies showed that vaccination with rERAG 333E /ZGP and rERAG 333E /SGP induced Zaire or Sudan EBOV neutralizing antibody (VNA) responses and IgG, IgG2a responses to ZGP or SGP, suggesting their potential as oral or inactivated bivalent vaccines against rabies and EVD. Most importantly, all dogs immunized orally with rERAG 333E /ZGP developed long-lasting ZEBOV and RABV VNA responses with or without previous rabies vaccine immunization history. Live rERAG 333E with EBOV GP thus appear to have the potential to be oral vaccines for free-roaming animals in endemic areas of EVD and rabies, and may serve as inactivated vaccines for use in humans. Copyright © 2017. Published by Elsevier B.V.

  9. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

    PubMed Central

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline; Karlsson, Ingrid; Krog, Jesper S; Williams, James A; Fomsgaard, Anders

    2015-01-01

    The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine expressed by next-generation vectors. These new vectors can improve gene expression, but they are also efficiently produced on large scales and comply with regulatory guidelines by avoiding antibiotic resistance genes. In addition, a new needle-free delivery of the vaccine, convenient for mass vaccinations, was compared with intradermal needle injection followed by electroporation. We report that when our DNA vaccine is expressed by the new vectors and delivered to the skin with the needle-free device in the rabbit model, it can elicit an antibody response with the same titers as a conventional vector with intradermal electroporation. The needle-free delivery is already in use for traditional protein vaccines in pigs but should be considered as a practical alternative for the mass administration of broadly protective influenza DNA vaccines. PMID:25746201

  10. Generation of Human Adult Mesenchymal Stromal/Stem Cells Expressing Defined Xenogenic Vascular Endothelial Growth Factor Levels by Optimized Transduction and Flow Cytometry Purification

    PubMed Central

    Helmrich, Uta; Marsano, Anna; Melly, Ludovic; Wolff, Thomas; Christ, Liliane; Heberer, Michael; Scherberich, Arnaud; Martin, Ivan

    2012-01-01

    Adult mesenchymal stromal/stem cells (MSCs) are a valuable source of multipotent progenitors for tissue engineering and regenerative medicine, but may require to be genetically modified to widen their efficacy in therapeutic applications. For example, overexpression of the angiogenic factor vascular endothelial growth factor (VEGF) at controlled levels is an attractive strategy to overcome the crucial bottleneck of graft vascularization and to avoid aberrant vascular growth. Since the regenerative potential of MSCs is rapidly lost during in vitro expansion, we sought to develop an optimized technique to achieve high-efficiency retroviral vector transduction of MSCs derived from both adipose tissue (adipose stromal cells, ASCs) or bone marrow (BMSCs) and rapidly select cells expressing desired levels of VEGF with minimal in vitro expansion. The proliferative peak of freshly isolated human ASCs and BMSCs was reached 4 and 6 days after plating, respectively. By performing retroviral vector transduction at this time point, >90% efficiency was routinely achieved before the first passage. MSCs were transduced with vectors expressing rat VEGF164 quantitatively linked to a syngenic cell surface marker (truncated rat CD8). Retroviral transduction and VEGF expression did not affect MSC phenotype nor impair their in vitro proliferation and differentiation potential. Transgene expression was also maintained during in vitro differentiation. Furthermore, three subpopulations of transduced BMSCs homogeneously producing specific low, medium, and high VEGF doses could be prospectively isolated by flow cytometry based on the intensity of their CD8 expression already at the first passage. In conclusion, this optimized platform allowed the generation of populations of genetically modified MSCs, expressing specific levels of a therapeutic transgene, already at the first passage, thereby minimizing in vitro expansion and loss of regenerative potential. PMID:22070632

  11. Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

    Cancer.gov

    The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

  12. Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease

    PubMed Central

    Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V.; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L.; Polishchuk, Roman S.; Auricchio, Alberto

    2015-01-01

    Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4−/− mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5′-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4−/− mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. PMID:26420842

  13. Development of Defective and Persistent Sendai Virus Vector

    PubMed Central

    Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

    2011-01-01

    The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

  14. Assembly and Functional Analysis of an S/MAR Based Episome with the Cystic Fibrosis Transmembrane Conductance Regulator Gene.

    PubMed

    De Rocco, Davide; Pompili, Barbara; Castellani, Stefano; Morini, Elena; Cavinato, Luca; Cimino, Giuseppe; Mariggiò, Maria A; Guarnieri, Simone; Conese, Massimo; Del Porto, Paola; Ascenzioni, Fiorentina

    2018-04-17

    Improving the efficacy of gene therapy vectors is still an important goal toward the development of safe and efficient gene therapy treatments. S/MAR (scaffold/matrix attached region)-based vectors are maintained extra-chromosomally in numerous cell types, which is similar to viral-based vectors. Additionally, when established as an episome, they show a very high mitotic stability. In the present study we tested the idea that addition of an S/MAR element to a CFTR (cystic fibrosis transmembrane conductance regulator) expression vector, may allow the establishment of a CFTR episome in bronchial epithelial cells. Starting from the observation that the S/MAR vector pEPI-EGFP (enhanced green fluorescence protein) is maintained as an episome in human bronchial epithelial cells, we assembled the CFTR vector pBQ-S/MAR. This vector, transfected in bronchial epithelial cells with mutated CFTR , supported long term wt CFTR expression and activity, which in turn positively impacted on the assembly of tight junctions in polarized epithelial cells. Additionally, the recovery of intact pBQ-S/MAR, but not the parental vector lacking the S/MAR element, from transfected cells after extensive proliferation, strongly suggested that pBQ-S/MAR was established as an episome. These results add a new element, the S/MAR, that can be considered to improve the persistence and safety of gene therapy vectors for cystic fibrosis pulmonary disease.

  15. Expression and purification of moricin CM4 and human β-defensins 4 in Escherichia coli using a new technology.

    PubMed

    Shen, Yang; Ai, Hong-Xin; Song, Ren; Liang, Zhen-Ning; Li, Jian-Feng; Zhang, Shuang-Quan

    2010-10-20

    Different strategies have been developed to produce small antimicrobial peptides using recombinant techniques. Here we report a new technology of biosynthesis of moricin CM4 and human β-defensins 4 (HβD4) in the Escherichia coli. The CM4 and HβD4 gene were cloned into a vector containing the tags elastin-like peptide (ELP) and intein to construct the expression vector pET-EI-CM4 and pET-EI-HβD4. All the peptides, expressed as soluble fusions, were isolated from the protein debris by the method called inverse transition cycling (ITC) rather than traditional immobilized metal affinity chromatography (IMAC) and separated from the fusion leader by self-cleavage. Fully reduced peptides that were purified exhibited expected antimicrobial activity. The approach described here is a low-cost, convenient and potential way for generating small antimicrobial peptide. Copyright © 2010 Elsevier GmbH. All rights reserved.

  16. Integration Site and Clonal Expansion in Human Chronic Retroviral Infection and Gene Therapy

    PubMed Central

    Niederer, Heather A.; Bangham, Charles R. M.

    2014-01-01

    Retroviral vectors have been successfully used therapeutically to restore expression of genes in a range of single-gene diseases, including several primary immunodeficiency disorders. Although clinical trials have shown remarkable results, there have also been a number of severe adverse events involving malignant outgrowth of a transformed clonal population. This clonal expansion is influenced by the integration site profile of the viral integrase, the transgene expressed, and the effect of the viral promoters on the neighbouring host genome. Infection with the pathogenic human retrovirus HTLV-1 also causes clonal expansion of cells containing an integrated HTLV-1 provirus. Although the majority of HTLV-1-infected people remain asymptomatic, up to 5% develop an aggressive T cell malignancy. In this review we discuss recent findings on the role of the genomic integration site in determining the clonality and the potential for malignant transformation of cells carrying integrated HTLV-1 or gene therapy vectors, and how these results have contributed to the understanding of HTLV-1 pathogenesis and to improvements in gene therapy vector safety. PMID:25365582

  17. Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

    PubMed Central

    Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

    2011-01-01

    Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

  18. Potentiation of anthrax vaccines using protective antigen-expressing viral replicon vectors.

    PubMed

    Wang, Hai-Chao; An, Huai-Jie; Yu, Yun-Zhou; Xu, Qing

    2015-02-01

    DNA vaccines require improvement for human use because they are generally weak stimulators of the immune system in humans. The efficacy of DNA vaccines can be improved using a viral replicon as vector to administer antigen of pathogen. In this study, we comprehensively evaluated the conventional non-viral DNA, viral replicon DNA or viral replicon particles (VRP) vaccines encoding different forms of anthrax protective antigen (PA) for specific immunity and protective potency against anthrax. Our current results clearly suggested that these viral replicon DNA or VRP vaccines derived from Semliki Forest virus (SFV) induced stronger PA-specific immune responses than the conventional non-viral DNA vaccines when encoding the same antigen forms, which resulted in potent protection against challenge with the Bacillus anthracis strain A16R. Additionally, the naked PA-expressing SFV replicon DNA or VRP vaccines without the need for high doses or demanding particular delivery regimens elicited robust immune responses and afforded completely protective potencies, which indicated the potential of the SFV replicon as vector of anthrax vaccines for use in clinical application. Therefore, our results suggest that these PA-expressing SFV replicon DNA or VRP vaccines may be suitable as candidate vaccines against anthrax. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

    PubMed

    Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

    1999-10-06

    The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

  20. Neonatal Systemic AAV Induces Tolerance to CNS Gene Therapy in MPS I Dogs and Nonhuman Primates

    PubMed Central

    Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Zhu, Yanqing; Yu, Hongwei; Lin, Gloria; Choa, Ruth; Gurda, Brittney L; Bagel, Jessica; O'Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Tarantal, Alice F; Casal, Margret L; Haskins, Mark E; Wilson, James M

    2015-01-01

    The potential host immune response to a nonself protein poses a fundamental challenge for gene therapies targeting recessive diseases. We demonstrate in both dogs and nonhuman primates that liver-directed gene transfer using an adeno-associated virus (AAV) vector in neonates induces a persistent state of immunological tolerance to the transgene product, substantially improving the efficacy of subsequent vector administration targeting the central nervous system (CNS). We applied this approach to a canine model of mucopolysaccharidosis type I (MPS I), a progressive neuropathic lysosomal storage disease caused by deficient activity of the enzyme α-l-iduronidase (IDUA). MPS I dogs treated systemically in the first week of life with a vector expressing canine IDUA did not develop antibodies against the enzyme and exhibited robust expression in the CNS upon intrathecal AAV delivery at 1 month of age, resulting in complete correction of brain storage lesions. Newborn rhesus monkeys treated systemically with AAV vector expressing human IDUA developed tolerance to the transgene, resulting in high cerebrospinal fluid (CSF) IDUA expression and no antibody induction after subsequent CNS gene therapy. These findings suggest that inducing tolerance to the transgene product during a critical period in immunological development can improve the efficacy and safety of gene therapy. PMID:26022732

  1. Neonatal Systemic AAV Induces Tolerance to CNS Gene Therapy in MPS I Dogs and Nonhuman Primates.

    PubMed

    Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Zhu, Yanqing; Yu, Hongwei; Lin, Gloria; Choa, Ruth; Gurda, Brittney L; Bagel, Jessica; O'Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Tarantal, Alice F; Casal, Margret L; Haskins, Mark E; Wilson, James M

    2015-08-01

    The potential host immune response to a nonself protein poses a fundamental challenge for gene therapies targeting recessive diseases. We demonstrate in both dogs and nonhuman primates that liver-directed gene transfer using an adeno-associated virus (AAV) vector in neonates induces a persistent state of immunological tolerance to the transgene product, substantially improving the efficacy of subsequent vector administration targeting the central nervous system (CNS). We applied this approach to a canine model of mucopolysaccharidosis type I (MPS I), a progressive neuropathic lysosomal storage disease caused by deficient activity of the enzyme α-l-iduronidase (IDUA). MPS I dogs treated systemically in the first week of life with a vector expressing canine IDUA did not develop antibodies against the enzyme and exhibited robust expression in the CNS upon intrathecal AAV delivery at 1 month of age, resulting in complete correction of brain storage lesions. Newborn rhesus monkeys treated systemically with AAV vector expressing human IDUA developed tolerance to the transgene, resulting in high cerebrospinal fluid (CSF) IDUA expression and no antibody induction after subsequent CNS gene therapy. These findings suggest that inducing tolerance to the transgene product during a critical period in immunological development can improve the efficacy and safety of gene therapy.

  2. High-Efficiency Promoter-Dependent Transduction by Adeno-Associated Virus Type 6 Vectors in Mouse Lung

    PubMed Central

    HALBERT, CHRISTINE L.; LAM, SIU-LING; MILLER, A. DUSTY

    2014-01-01

    The transduction efficiency of adeno-associated virus (AAV) vectors in various somatic tissues has been shown to depend heavily on the AAV type from which the vector capsid proteins are derived. Among the AAV types studied, AAV6 efficiently transduces cells of the airway epithelium, making it a good candidate for the treatment of lung diseases such as cystic fibrosis. Here we have evaluated the effects of various promoter sequences on transduction rates and gene expression levels in the lung. Of the strong viral promoters examined, the Rous sarcoma virus (RSV) promoter performed significantly better than a human cytomegalovirus (CMV) promoter in the airway epithelium. However, a hybrid promoter consisting of a CMV enhancer, β-actin promoter and splice donor, and a β-globin splice acceptor (CAG promoter) exhibited even higher expression than either of the strong viral promoters alone, showing a 38-fold increase in protein expression over the RSV promoter. In addition, we show that vectors containing either the RSV or CAG promoter expressed well in the nasal and tracheal epithelium. Transduction rates in the 90% range were achieved in many airways with the CAG promoter, showing that with the proper AAV capsid proteins and promoter sequences, highly efficient transduction can be achieved. PMID:17430088

  3. Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

    PubMed

    Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

    2016-01-01

    Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

  4. Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

    PubMed Central

    Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

    2016-01-01

    Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

  5. Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells.

    PubMed

    Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S

    2000-11-15

    Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.

  6. Transformation to continuous growth of primary human T lymphocytes by human T-cell leukemia virus type I X-region genes transduced by a herpesvirus saimiri vector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grassmann, R.; Dengler, C.; Mueller-Fleckenstein, I.

    1989-05-01

    The role of the X region of the genome of the human T-cell leukemia virus type I (HTLV-I) in the immortalization of lymphocytes has been difficult to distinguish from its role in viral replication as this region encodes at least two genes, tax and rex, required for replication and the expression of viral proteins. To determine whether the X region does encode immortalizing functions, a fragment of the HTLV-I provirus capable of expressing known X-region proteins was inserted into the genome of a transformation-defective, replication-competent Herpesvirus saimiri. Infection of fresh mitogen-activated human cord blood and thymocytes yielded immortal T-cell linesmore » that had the same phenotype (CD4{sup +}, Cd5{sup +}, HLA class II{sup +}, interleukin 2 receptor {alpha}-chain +) as lymphocytes transformed by cocultivation with HTLV-I. These experiments demonstrate that the X region encodes the functions of HTLV-I that immortalize a distinct subpopulation of human T cells. The experiments also demonstrate the utility of the H. saimiri vector for the transduction of heterologous genes into human T cells.« less

  7. AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes

    PubMed Central

    Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena

    2015-01-01

    Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings. PMID:26445723

  8. AAV capsid CD8+ T-cell epitopes are highly conserved across AAV serotypes.

    PubMed

    Hui, Daniel J; Edmonson, Shyrie C; Podsakoff, Gregory M; Pien, Gary C; Ivanciu, Lacramioara; Camire, Rodney M; Ertl, Hildegund; Mingozzi, Federico; High, Katherine A; Basner-Tschakarjan, Etiena

    2015-01-01

    Adeno-associated virus (AAV) has become one of the most promising vectors in gene transfer in the last 10 years with successful translation to clinical trials in humans and even market approval for a first gene therapy product in Europe. Administration to humans, however, revealed that adaptive immune responses against the vector capsid can present an obstacle to sustained transgene expression due to the activation and expansion of capsid-specific T cells. The limited number of peripheral blood mononuclear cells (PBMCs) obtained from samples within clinical trials allows for little more than monitoring of T-cell responses. We were able to identify immunodominant major histocompatibility complex (MHC) class I epitopes for common human leukocyte antigen (HLA) types by using spleens isolated from subjects undergoing splenectomy for non-malignant indications as a source of large numbers of lymphocytes and restimulating them with single AAV capsid peptides in vitro. Further experiments confirmed that these epitopes are naturally processed and functionally relevant. The design of more effective and less immunogenic AAV vectors, and precise immune monitoring of vector-infused subjects, are facilitated by these findings.

  9. Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

    PubMed

    Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

    2005-12-01

    Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

  10. Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

  11. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    DOEpatents

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  12. A super gene expression system enhances the anti-glioma effects of adenovirus-mediated REIC/Dkk-3 gene therapy

    NASA Astrophysics Data System (ADS)

    Oka, Tetsuo; Kurozumi, Kazuhiko; Shimazu, Yosuke; Ichikawa, Tomotsugu; Ishida, Joji; Otani, Yoshihiro; Shimizu, Toshihiko; Tomita, Yusuke; Sakaguchi, Masakiyo; Watanabe, Masami; Nasu, Yasutomo; Kumon, Hiromi; Date, Isao

    2016-09-01

    Reduced expression in immortalized cells/Dickkopf-3 (REIC/Dkk-3) is a tumor suppressor and therapeutic gene in many human cancers. Recently, an adenovirus REIC vector with the super gene expression system (Ad-SGE-REIC) was developed to increase REIC/Dkk-3 expression and enhance therapeutic effects compared with the conventional adenoviral vector (Ad-CAG-REIC). In this study, we investigated the in vitro and in vivo effects of Ad-SGE-REIC on malignant glioma. In U87ΔEGFR and GL261 glioma cells, western blotting confirmed that robust upregulation of REIC/Dkk-3 expression occurred in Ad-SGE-REIC-transduced cells, most notably after transduction at a multiplicity of infection of 10. Cytotoxicity assays showed that Ad-SGE-REIC resulted in a time-dependent and significant reduction in the number of malignant glioma cells attaching to the bottom of culture wells. Xenograft and syngeneic mouse intracranial glioma models treated with Ad-SGE-REIC had significantly longer survival than those treated with the control vector Ad-LacZ or with Ad-CAG-REIC. This study demonstrated the anti-glioma effect of Ad-SGE-REIC, which may represent a promising strategy for the treatment of malignant glioma.

  13. A potyvirus-based gene vector allows producing active human S-COMT and animal GFP, but not human sorcin, in vector-infected plants.

    PubMed

    Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T

    2006-05-01

    Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.

  14. A Simple Method to Increase the Transduction Efficiency of Single-Stranded Adeno-Associated Virus Vectors In Vitro and In Vivo

    PubMed Central

    Ma, Wenqin; Li, Baozheng; Ling, Chen; Jayandharan, Giridhara R.; Byrne, Barry J.

    2011-01-01

    Abstract We have recently shown that co-administration of conventional single-stranded adeno-associated virus 2 (ssAAV2) vectors with self-complementary (sc) AAV2-protein phosphatase 5 (PP5) vectors leads to a significant increase in the transduction efficiency of ssAAV2 vectors in human cells in vitro as well as in murine hepatocytes in vivo. In the present study, this strategy has been further optimized by generating a mixed population of ssAAV2-EGFP and scAAV2-PP5 vectors at a 10:1 ratio to achieve enhanced green fluorescent protein (EGFP) transgene expression at approximately 5- to 10-fold higher efficiency, both in vitro and in vivo. This simple coproduction method should be adaptable to any ssAAV serotype vector containing transgene cassettes that are too large to be encapsidated in scAAV vectors. PMID:21219084

  15. Specific Mutation of a Gammaherpesvirus-Expressed Antigen in Response to CD8 T Cell Selection In Vivo

    PubMed Central

    Loh, Joy; Popkin, Daniel L.; Droit, Lindsay; Braaten, Douglas C.; Zhao, Guoyan; Zhang, Xin; Vachharajani, Punit; Myers, Nancy; Hansen, Ted H.

    2012-01-01

    Herpesviruses are thought to be highly genetically stable, and their use as vaccine vectors has been proposed. However, studies of the human gammaherpesvirus, Epstein-Barr virus, have found viral isolates containing mutations in HLA class I-restricted epitopes. Using murine gammaherpesvirus 68 expressing ovalbumin (OVA), we examined the stability of a gammaherpesvirus antigenic locus under strong CD8 T cell selection in vivo. OVA-specific CD8 T cells selected viral isolates containing mutations in the OVA locus but minimal alterations in other genomic regions. Thus, a CD8 T cell response to a gammaherpesvirus-expressed antigen that is not essential for replication or pathogenesis can result in selective mutation of that antigen in vivo. This finding may have relevance for the use of herpesvirus vectors for chronic antigen expression in vivo. PMID:22171269

  16. Expression and Biochemical Properties of a Recombinant Acetylcholinesterase 1 of the Sand Fly, Phlebotomus papatasi (Scopoli) Insensitive to Organophosphate Inhibition

    USDA-ARS?s Scientific Manuscript database

    Phlebotomine sand flies are small hematophagous flies present throughout tropical and subtropical areas of the world and are vectors of human and zoonotic leishmaniases. Human cutaneous leishmaniasis is a debilitating disease presenting major problems for U.S. military operations in the Middle East,...

  17. HDM2 promotes WIP1-mediated medulloblastoma growth

    PubMed Central

    Buss, Meghan C.; Read, Tracy-Ann; Schniederjan, Matthew J.; Gandhi, Khanjan; Castellino, Robert C.

    2012-01-01

    Medulloblastoma is the most common malignant childhood brain tumor. The protein phosphatase and oncogene WIP1 is over-expressed or amplified in a significant number of primary human medulloblastomas and cell lines. In the present study, we examine an important mechanism by which WIP1 promotes medulloblastoma growth using in vitro and in vivo models. Human cell lines and intracerebellar xenografted animal models were used to study the role of WIP1 and the major TP53 regulator, HDM2, in medulloblastoma growth. Stable expression of WIP1 enhances growth of TP53 wild-type medulloblastoma cells, compared with cells with stable expression of an empty-vector or mutant WIP1. In an animal model, WIP1 enhances proliferation and reduces the survival of immunodeficient mice bearing intracerebellar xenografted human medulloblastoma cells. Cells with increased WIP1 expression also exhibit increased expression of HDM2. HDM2 knockdown or treatment with the HDM2 inhibitor Nutlin-3a, the active enantomer of Nutlin-3, specifically inhibits the growth of medulloblastoma cells with increased WIP1 expression. Nutlin-3a does not affect growth of medulloblastoma cells with stable expression of an empty vector or of mutant WIP1. Knockdown of WIP1 or treatment with the WIP1 inhibitor CCT007093 results in increased phosphorylation of known WIP1 targets, reduced HDM2 expression, and reduced growth specifically in WIP1 wild-type and high-expressing medulloblastoma cells. Combined WIP1 and HDM2 inhibition is more effective than WIP1 inhibition alone in blocking growth of WIP1 high-expressing medulloblastoma cells. Our preclinical study supports a role for therapies that target WIP1 and HDM2 in the treatment of medulloblastoma. PMID:22379189

  18. A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

    PubMed Central

    Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

    2012-01-01

    Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

  19. Enhanced Neutralizing Antibody Response Induced by Respiratory Syncytial Virus Prefusion F Protein Expressed by a Vaccine Candidate

    PubMed Central

    Liang, Bo; Surman, Sonja; Amaro-Carambot, Emerito; Kabatova, Barbora; Mackow, Natalie; Lingemann, Matthias; Yang, Lijuan; McLellan, Jason S.; Graham, Barney S.; Kwong, Peter D.; Schaap-Nutt, Anne; Collins, Peter L.

    2015-01-01

    ABSTRACT Respiratory syncytial virus (RSV) and human parainfluenza virus type 3 (HPIV3) are the first and second leading viral agents of severe respiratory tract disease in infants and young children worldwide. Vaccines are not available, and an RSV vaccine is particularly needed. A live attenuated chimeric recombinant bovine/human PIV3 (rB/HPIV3) vector expressing the RSV fusion (F) glycoprotein from an added gene has been under development as a bivalent vaccine against RSV and HPIV3. Previous clinical evaluation of this vaccine candidate suggested that increased genetic stability and immunogenicity of the RSV F insert were needed. This was investigated in the present study. RSV F expression was enhanced 5-fold by codon optimization and by modifying the amino acid sequence to be identical to that of an early passage of the original clinical isolate. This conferred a hypofusogenic phenotype that presumably reflects the original isolate. We then compared vectors expressing stabilized prefusion and postfusion versions of RSV F. In a hamster model, prefusion F induced increased quantity and quality of RSV-neutralizing serum antibodies and increased protection against wild-type (wt) RSV challenge. In contrast, a vector expressing the postfusion F was less immunogenic and protective. The genetic stability of the RSV F insert was high and was not affected by enhanced expression or the prefusion or postfusion conformation of RSV F. These studies provide an improved version of the previously well-tolerated rB/HPIV3-RSV F vaccine candidate that induces a superior RSV-neutralizing serum antibody response. IMPORTANCE Respiratory syncytial virus (RSV) and human parainfluenza virus type 3 (HPIV3) are two major causes of pediatric pneumonia and bronchiolitis. The rB/HPIV3 vector expressing RSV F protein is a candidate bivalent live vaccine against HPIV3 and RSV. Previous clinical evaluation indicated the need to increase the immunogenicity and genetic stability of the RSV F insert. Here, we increased RSV F expression by codon optimization and by modifying the RSV F amino acid sequence to conform to that of an early passage of the original isolate. This resulted in a hypofusogenic phenotype, which likely represents the original phenotype before adaptation to cell culture. We also included stabilized versions of prefusion and postfusion RSV F protein. Prefusion RSV F induced a larger quantity and higher quality of RSV-neutralizing serum antibodies and was highly protective. This provides an improved candidate for further clinical evaluation. PMID:26157122

  20. Enhanced Neutralizing Antibody Response Induced by Respiratory Syncytial Virus Prefusion F Protein Expressed by a Vaccine Candidate.

    PubMed

    Liang, Bo; Surman, Sonja; Amaro-Carambot, Emerito; Kabatova, Barbora; Mackow, Natalie; Lingemann, Matthias; Yang, Lijuan; McLellan, Jason S; Graham, Barney S; Kwong, Peter D; Schaap-Nutt, Anne; Collins, Peter L; Munir, Shirin

    2015-09-01

    Respiratory syncytial virus (RSV) and human parainfluenza virus type 3 (HPIV3) are the first and second leading viral agents of severe respiratory tract disease in infants and young children worldwide. Vaccines are not available, and an RSV vaccine is particularly needed. A live attenuated chimeric recombinant bovine/human PIV3 (rB/HPIV3) vector expressing the RSV fusion (F) glycoprotein from an added gene has been under development as a bivalent vaccine against RSV and HPIV3. Previous clinical evaluation of this vaccine candidate suggested that increased genetic stability and immunogenicity of the RSV F insert were needed. This was investigated in the present study. RSV F expression was enhanced 5-fold by codon optimization and by modifying the amino acid sequence to be identical to that of an early passage of the original clinical isolate. This conferred a hypofusogenic phenotype that presumably reflects the original isolate. We then compared vectors expressing stabilized prefusion and postfusion versions of RSV F. In a hamster model, prefusion F induced increased quantity and quality of RSV-neutralizing serum antibodies and increased protection against wild-type (wt) RSV challenge. In contrast, a vector expressing the postfusion F was less immunogenic and protective. The genetic stability of the RSV F insert was high and was not affected by enhanced expression or the prefusion or postfusion conformation of RSV F. These studies provide an improved version of the previously well-tolerated rB/HPIV3-RSV F vaccine candidate that induces a superior RSV-neutralizing serum antibody response. Respiratory syncytial virus (RSV) and human parainfluenza virus type 3 (HPIV3) are two major causes of pediatric pneumonia and bronchiolitis. The rB/HPIV3 vector expressing RSV F protein is a candidate bivalent live vaccine against HPIV3 and RSV. Previous clinical evaluation indicated the need to increase the immunogenicity and genetic stability of the RSV F insert. Here, we increased RSV F expression by codon optimization and by modifying the RSV F amino acid sequence to conform to that of an early passage of the original isolate. This resulted in a hypofusogenic phenotype, which likely represents the original phenotype before adaptation to cell culture. We also included stabilized versions of prefusion and postfusion RSV F protein. Prefusion RSV F induced a larger quantity and higher quality of RSV-neutralizing serum antibodies and was highly protective. This provides an improved candidate for further clinical evaluation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. [Preparation and characterization of mouse polyclonal antibody against conserved region of human FOXO3].

    PubMed

    Li, Lei; Lyu, Dan

    2017-06-01

    Objective To purify the recombinant protein specific to conserved region of forkhead box O3 (FOXO3) and prepare mouse anti-human FOXO3 polyclonal antibody. Methods The DNA fragment (aa290-472) encoding conserved domain of FOXO3 was amplified by PCR, and subsequently cloned into pET28a vector. Following transformation into E.coli BL21, the soluble fusion protein His-FOXO3 was induced by IPTG and purified by Ni-NTA affinity chromatography. The purified protein was used to immunize BALB/c mice to generate polyclonal antibody. The characteristics of the polyclonal antibody were assessed by ELISA, Western blotting and immunoprecipitation assays. Results We successfully prepared the expression vector pET28a-FOXO3 (aa290-472) and expressed the purified fusion protein in a soluble form. By immunizing mice with the fusion protein, we obtained anti-human FOXO3 polyclonal antibody. ELISA and Western blotting showed that the mouse antibody could recognize specifically the endogenous FOXO3 protein. Conclusion The polyclonal antibody against conserved domain of FOXO3 can identify the endogenous FOXO3 protein. It can be used to analyze the endogenous FOXO3 expression level.

  2. Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

    PubMed

    Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

    1986-09-01

    The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

  3. Defining the bacteroides ribosomal binding site.

    PubMed

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  4. The human estrogen receptor can regulate exogenous but not endogenous vitellogenin gene promoters in a Xenopus cell line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seiler-Tuyns, A.; Merillat, A.M.; Haefliger, D.N.

    Transfection of a human estrogen receptor cDNA expression vector (HEO) into cultured Xenopus kidney cells confers estrogen responsiveness to the recipient cells as demonstrated by the hormone dependent expression of co-transfected Xenopus vitellogenin-CAT chimeric genes. The estrogen stimulation of these vit-CAT genes is dependent upon the presence of the vitellogenin estrogen responsive element (ERE) in their 5{prime} flanking region. Thus, functional human estrogen receptor (hER) can be synthesized in heterologous lower vertebrate cells and can act as a trans-acting regulatory factor that is necessary, together with estradiol, for the induction of the vit-CAT constructs in these cells. In addition, vitellogeninmore » minigenes co-transfected with the HEO expression vector also respond to hormonal stimulation. Their induction is not higher than that of the vit-CAT chimeric genes. It suggests that in the Xenopus kidney cell line B 3.2, the structural parts of the vitellogenin minigenes do not play a role in the induction process. Furthermore, no stabilizing effect of estrogen on vitellogenin mRNA is observed in these cells.« less

  5. Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

    PubMed

    Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

    2015-01-01

    To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

  6. CXCR4 Is Required by a Nonprimate Lentivirus: Heterologous Expression of Feline Immunodeficiency Virus in Human, Rodent, and Feline Cells

    PubMed Central

    Poeschla, Eric M.; Looney, David J.

    1998-01-01

    A heterologous feline immunodeficiency virus (FIV) expression system permitted high-level expression of FIV proteins and efficient production of infectious FIV in human cells. These results identify the FIV U3 element as the sole restriction to the productive phase of replication in nonfeline cells. Heterologous FIV expression in a variety of human cell lines resulted in profuse syncytial lysis that was FIV env specific, CD4 independent, and restricted to cells that express CXCR4, the coreceptor for T-cell-line-adapted strains of human immunodeficiency virus. Stable expression of human CXCR4 in CXCR4-negative human and rodent cell lines resulted in extensive FIV Env-mediated, CXCR4-dependent cell fusion and infection. In feline cells, stable overexpression of human CXCR4 resulted in increased FIV infectivity and marked syncytium formation during FIV replication or after infection with FIV Env-expressing vectors. The use of CXCR4 is a fundamental feature of lentivirus biology independent of CD4 and a shared cellular link to infection and cytopathicity for distantly related lentiviruses that cause AIDS. Their conserved use implicates chemokine receptors as primordial lentivirus receptors. PMID:9658135

  7. Gene transfer with a vector expressing Maxi-K from a smooth muscle-specific promoter restores erectile function in the aging rat.

    PubMed

    Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J

    2008-03-01

    Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.

  8. Production of Human Papilloma Virus Type 16 E6 Oncoprotein as a Recombinant Protein in Eukaryotic Cells

    PubMed Central

    Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM

    2012-01-01

    Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534

  9. A SIMPLIFIED MODEL FOR PREDICTING MALARIA ENTOMOLOGIC INOCULATION RATES BASED ON ENTOMOLOGIC AND PARASITOLOGIC PARAMETERS RELEVANT TO CONTROL

    PubMed Central

    KILLEEN, GERRY F.; McKENZIE, F. ELLIS; FOY, BRIAN D.; SCHIEFFELIN, CATHERINE; BILLINGSLEY, PETER F.; BEIER, JOHN C.

    2008-01-01

    Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other’s effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (± SD) that are 1.13 ± 0.37 (range = 0.84–1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education. PMID:11289661

  10. Parainfluenza virus 5-based vaccine vectors expressing vaccinia virus (VACV) antigens provide long-term protection in mice from lethal intranasal VACV challenge.

    PubMed

    Clark, Kimberly M; Johnson, John B; Kock, Nancy D; Mizel, Steven B; Parks, Griffith D

    2011-10-25

    To test the potential for parainfluenza virus 5 (PIV5)-based vectors to provide protection from vaccinia virus (VACV) infection, PIV5 was engineered to express secreted VACV L1R and B5R proteins, two important antigens for neutralization of intracellular mature (IMV) and extracellular enveloped (EEV) virions, respectively. Protection of mice from lethal intranasal VACV challenge required intranasal immunization with PIV5-L1R/B5R in a prime-boost protocol, and correlated with low VACV-induced pathology in the respiratory tract and anti-VACV neutralizing antibody. Mice immunized with PIV5-L1R/B5R showed some disease symptoms following VACV challenge such as loss of weight and hunching, but these symptoms were delayed and less severe than with unimmunized control mice. While immunization with PIV5 expressing B5R alone conferred at least some protection, the most effective immunization included the PIV5 vector expressing L1R alone or in combination with PIV5-B5R. PIV5-L1R/B5R vectors elicited protection from VACV challenge even when CD8+ cells were depleted, but not in the case of mice that were defective in B cell production. Mice were protected from VACV challenge out to at least 1.5 years after immunization with PIV5-L1R/B5R vectors, and showed significant levels of anti-VACV neutralizing antibodies. These results demonstrate the potential for PIV5-based vectors to provide long lasting protection against complex human respiratory pathogens such as VACV, but also highlight the need to understand mechanisms for the generation of strong immune responses against poorly immunogenic viral proteins. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Improved dual AAV vectors with reduced expression of truncated proteins are safe and effective in the retina of a mouse model of Stargardt disease.

    PubMed

    Trapani, Ivana; Toriello, Elisabetta; de Simone, Sonia; Colella, Pasqualina; Iodice, Carolina; Polishchuk, Elena V; Sommella, Andrea; Colecchi, Linda; Rossi, Settimio; Simonelli, Francesca; Giunti, Massimo; Bacci, Maria L; Polishchuk, Roman S; Auricchio, Alberto

    2015-12-01

    Stargardt disease (STGD1) due to mutations in the large ABCA4 gene is the most common inherited macular degeneration in humans. We have shown that dual adeno-associated viral (AAV) vectors effectively transfer ABCA4 to the retina of Abca4-/- mice. However, they express both lower levels of transgene compared with a single AAV and truncated proteins. To increase productive dual AAV concatemerization, which would overcome these limitations, we have explored the use of either various regions of homology or heterologous inverted terminal repeats (ITR). In addition, we tested the ability of various degradation signals to decrease the expression of truncated proteins. We found the highest levels of transgene expression using regions of homology based on either alkaline phosphatase or the F1 phage (AK). The use of heterologous ITR does not decrease the levels of truncated proteins relative to full-length ABCA4 and impairs AAV vector production. Conversely, the inclusion of the CL1 degradation signal results in the selective degradation of truncated proteins from the 5'-half without affecting full-length protein production. Therefore, we developed dual AAV hybrid ABCA4 vectors including homologous ITR2, the photoreceptor-specific G protein-coupled receptor kinase 1 promoter, the AK region of homology and the CL1 degradation signal. We show that upon subretinal administration these vectors are both safe in pigs and effective in Abca4-/- mice. Our data support the use of improved dual AAV vectors for gene therapy of STGD1. © The Author 2015. Published by Oxford University Press.

  12. Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

    PubMed

    Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

    2013-03-05

    A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

  13. GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.

    PubMed

    Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G

    2016-09-13

    The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

    PubMed

    Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

    2015-05-01

    Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

  15. Optimized AAV rh.10 Vectors That Partially Evade Neutralizing Antibodies during Hepatic Gene Transfer

    PubMed Central

    Selot, Ruchita; Arumugam, Sathyathithan; Mary, Bertin; Cheemadan, Sabna; Jayandharan, Giridhara R.

    2017-01-01

    Of the 12 common serotypes used for gene delivery applications, Adeno-associated virus (AAV)rh.10 serotype has shown sustained hepatic transduction and has the lowest seropositivity in humans. We have evaluated if further modifications to AAVrh.10 at its phosphodegron like regions or predicted immunogenic epitopes could improve its hepatic gene transfer and immune evasion potential. Mutant AAVrh.10 vectors were generated by site directed mutagenesis of the predicted targets. These mutant vectors were first tested for their transduction efficiency in HeLa and HEK293T cells. The optimal vector was further evaluated for their cellular uptake, entry, and intracellular trafficking by quantitative PCR and time-lapse confocal microscopy. To evaluate their potential during hepatic gene therapy, C57BL/6 mice were administered with wild-type or optimal mutant AAVrh.10 and the luciferase transgene expression was documented by serial bioluminescence imaging at 14, 30, 45, and 72 days post-gene transfer. Their hepatic transduction was further verified by a quantitative PCR analysis of AAV copy number in the liver tissue. The optimal AAVrh.10 vector was further evaluated for their immune escape potential, in animals pre-immunized with human intravenous immunoglobulin. Our results demonstrate that a modified AAVrh.10 S671A vector had enhanced cellular entry (3.6 fold), migrate rapidly to the perinuclear region (1 vs. >2 h for wild type vectors) in vitro, which further translates to modest increase in hepatic gene transfer efficiency in vivo. More importantly, the mutant AAVrh.10 vector was able to partially evade neutralizing antibodies (~27–64 fold) in pre-immunized animals. The development of an AAV vector system that can escape the circulating neutralizing antibodies in the host will substantially widen the scope of gene therapy applications in humans. PMID:28769791

  16. Contrasting Effects of Human, Canine, and Hybrid Adenovirus Vectors on the Phenotypical and Functional Maturation of Human Dendritic Cells: Implications for Clinical Efficacy▿

    PubMed Central

    Perreau, Matthieu; Mennechet, Franck; Serratrice, Nicolas; Glasgow, Joel N.; Curiel, David T.; Wodrich, Harald; Kremer, Eric J.

    2007-01-01

    Antipathogen immune responses create a balance between immunity, tolerance, and immune evasion. However, during gene therapy most viral vectors are delivered in substantial doses and are incapable of expressing gene products that reduce the host's ability to detect transduced cells. Gene transfer efficacy is also modified by the in vivo transduction of dendritic cells (DC), which notably increases the immunogenicity of virions and vector-encoded genes. In this study, we evaluated parameters that are relevant to the use of canine adenovirus serotype 2 (CAV-2) vectors in the clinical setting by assaying their effect on human monocyte-derived DC (hMoDC). We compared CAV-2 to human adenovirus (HAd) vectors containing the wild-type virion, functional deletions in the penton base RGD motif, and the CAV-2 fiber knob. In contrast to the HAd type 5 (HAd5)-based vectors, CAV-2 poorly transduced hMoDC, provoked minimal upregulation of major histocompatibility complex class I/II and costimulatory molecules (CD40, CD80, and CD86), and induced negligible morphological changes indicative of DC maturation. Functional maturation assay results (e.g., reduced antigen uptake; tumor necrosis factor alpha, interleukin-1β [IL-1β], gamma interferon [IFN-γ], IL-10, IL-12, and IFN-α/β secretion; and stimulation of heterologous T-cell proliferation) were also significantly lower for CAV-2. Our data suggested that this was due, in part, to the use of an alternative receptor and a block in vesicular escape. Additionally, HAd5 vector-induced hMoDC maturation was independent of the aforementioned cytokines. Paradoxically, an HAd5/CAV-2 hybrid vector induced the greatest phenotypical and functional maturation of hMoDC. Our data suggest that CAV-2 and the HAd5/CAV-2 vector may be the antithesis of Adenoviridae immunogenicity and that each may have specific clinical advantages. PMID:17229706

  17. Adenovirus-mediated gene transfer of pathogen-associated molecular patterns for cancer immunotherapy.

    PubMed

    Tosch, C; Geist, M; Ledoux, C; Ziller-Remi, C; Paul, S; Erbs, P; Corvaia, N; Von Hoegen, P; Balloul, J-M; Haegel, H

    2009-04-01

    The delivery of stimulatory signals to dendritic cells (DCs) in the tumor microenvironment could be an effective means to break tumor-induced tolerance. The work presented here evaluates the immunostimulatory properties of pathogen-associated molecular patterns (PAMPs), microbial molecules which bind Toll-like receptors and deliver activating signals to immune cells, when expressed in tumor cells using adenoviral (Ad) vectors. In vitro, transduction of A549 tumor cells with Ad vectors expressing either flagellin from Listeria monocytogenes or P40 protein from Klebsiella pneumoniae induced the maturation of human monocyte-derived DCs in co-cultures. In mixed lymphocyte reactions (MLRs), Ad-flagellin and Ad-P40 transduction of tumor cells stimulated lymphocyte proliferation and the secretion of IFN-gamma. In vivo, these vectors were used either as stand-alone immunoadjuvants injected intratumorally or as vaccine adjuvants combined with a tumor antigen-expressing vector. When Ad-PAMPs were administered intratumorally to mice bearing subcutaneous syngeneic B16F0-CAR (cocksackie-adenovirus receptor) melanomas, tumor progression was transiently inhibited by Ad-P40. In a therapeutic vaccine setting, the combination of Ad-MUC1 and Ad-PAMP vectors injected subcutaneously delayed the growth of implanted RenCa-MUC1 tumors and improved tumor rejection when compared with vaccination with Ad-MUC1 alone. These results suggest that Ad-PAMPs could be effective immunoadjuvants for cancer immunotherapy.

  18. T Cell Responses Induced by Adenoviral Vectored Vaccines Can Be Adjuvanted by Fusion of Antigen to the Oligomerization Domain of C4b-Binding Protein

    PubMed Central

    Forbes, Emily K.; de Cassan, Simone C.; Llewellyn, David; Biswas, Sumi; Goodman, Anna L.; Cottingham, Matthew G.; Long, Carole A.; Pleass, Richard J.; Hill, Adrian V. S.; Hill, Fergal; Draper, Simon J.

    2012-01-01

    Viral vectored vaccines have been shown to induce both T cell and antibody responses in animals and humans. However, the induction of even higher level T cell responses may be crucial in achieving vaccine efficacy against difficult disease targets, especially in humans. Here we investigate the oligomerization domain of the α-chain of C4b-binding protein (C4 bp) as a candidate T cell “molecular adjuvant” when fused to malaria antigens expressed by human adenovirus serotype 5 (AdHu5) vectored vaccines in BALB/c mice. We demonstrate that i) C-terminal fusion of an oligomerization domain can enhance the quantity of antigen-specific CD4+ and CD8+ T cell responses induced in mice after only a single immunization of recombinant AdHu5, and that the T cells maintain similar functional cytokine profiles; ii) an adjuvant effect is observed for AdHu5 vectors expressing either the 42 kDa C-terminal domain of Plasmodium yoelii merozoite surface protein 1 (PyMSP142) or the 83 kDa ectodomain of P. falciparum strain 3D7 apical membrane antigen 1 (PfAMA1), but not a candidate 128kDa P. falciparum MSP1 biallelic fusion antigen; iii) following two homologous immunizations of AdHu5 vaccines, antigen-specific T cell responses are further enhanced, however, in both BALB/c mice and New Zealand White rabbits no enhancement of functional antibody responses is observed; and iv) that the T cell adjuvant activity of C4 bp is not dependent on a functional Fc-receptor γ-chain in the host, but is associated with the oligomerization of small (<80 kDa) antigens expressed by recombinant AdHu5. The oligomerization domain of C4 bp can thus adjuvant T cell responses induced by AdHu5 vectors against selected antigens and its clinical utility as well as mechanism of action warrant further investigation. PMID:22984589

  19. Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

    PubMed Central

    Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

    1990-01-01

    Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

  20. Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

    PubMed

    Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

    1990-01-01

    Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

  1. SHIP, a novel factor to ameliorate extracellular matrix accumulation via suppressing PI3K/Akt/CTGF signaling in diabetic kidney disease.

    PubMed

    Li, Fan; Li, Lisha; Cheng, Meijuan; Wang, Xiumin; Hao, Jun; Liu, Shuxia; Duan, Huijun

    2017-01-22

    Tubular interstitial extracellular matrix accumulation, which plays a key role in the pathogenesis and progression of diabetic kidney disease (DKD), is believed to be mediated by activation of PI3K/Akt signal pathway. However, it is still not clear whether SH2 domain-containing inositol 5'-phosphatase (SHIP), known as a negative regulator of PI3K/Akt pathway is also involved in extracellular matrix metabolism of diabetic kidney. In the present study, decreased SHIP and increased phospho-Akt (Ser 473, Thr 308) were found in renal tubular cells of diabetic mice accompanied by overexpression of connective tissue growth factor (CTGF) and extracellular matrix deposition versus normal mice. Again, high glucose attenuated SHIP expression in a time-dependent manner, concomitant with activation of PI3K/Akt signaling and extracellular matrix production in human renal proximal tubular epithelial cells (HK2) cultured in vitro, which was significantly prevented by transfection of M90-SHIP vector. Furthermore, in vivo delivery of rAd-INPP5D vector (SHIP expression vector) via intraperitoneal injection in diabetic mice increased SHIP expression by 3.36 times followed by 65.26%, 70.38% and 46.71% decreases of phospho-Akt (Ser 473), phospho-Akt (Thr 308) and CTGF expression versus diabetic mice receiving rAd-EGFP vector. Meanwhile, increased renal extracellular matrix accumulation of diabetic mice was also inhibited with intraperitoneal injection of rAd-INPP5D vector. These above data suggested that overexpression of SHIP might be a potent method to lessen renal extracellular matrix accumulation via inactivation of PI3K/Akt pathway and suppression of CTGF expression in DKD. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Pathology Associated with AAV Mediated Expression of Beta Amyloid or C100 in Adult Mouse Hippocampus and Cerebellum

    PubMed Central

    Drummond, Eleanor S.; Muhling, Jill; Martins, Ralph N.; Wijaya, Linda K.; Ehlert, Erich M.; Harvey, Alan R.

    2013-01-01

    Accumulation of beta amyloid (Aβ) in the brain is a primary feature of Alzheimer’s disease (AD) but the exact molecular mechanisms by which Aβ exerts its toxic actions are not yet entirely clear. We documented pathological changes 3 and 6 months after localised injection of recombinant, bi-cistronic adeno-associated viral vectors (rAAV2) expressing human Aβ40-GFP, Aβ42-GFP, C100-GFP or C100V717F-GFP into the hippocampus and cerebellum of 8 week old male mice. Injection of all rAAV2 vectors resulted in wide-spread transduction within the hippocampus and cerebellum, as shown by expression of transgene mRNA and GFP protein. Despite the lack of accumulation of Aβ protein after injection with AAV vectors, injection of rAAV2-Aβ42-GFP and rAAV2- C100V717F-GFP into the hippocampus resulted in significantly increased microgliosis and altered permeability of the blood brain barrier, the latter revealed by high levels of immunoglobulin G (IgG) around the injection site and the presence of IgG positive cells. In comparison, injection of rAAV2-Aβ40-GFP and rAAV2-C100-GFP into the hippocampus resulted in substantially less neuropathology. Injection of rAAV2 vectors into the cerebellum resulted in similar types of pathological changes, but to a lesser degree. The use of viral vectors to express different types of Aβ and C100 is a powerful technique with which to examine the direct in vivo consequences of Aβ expression in different regions of the mature nervous system and will allow experimentation and analysis of pathological AD-like changes in a broader range of species other than mouse. PMID:23516609

  3. The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

    PubMed Central

    Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

    2004-01-01

    Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

  4. Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

    PubMed Central

    Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

    2015-01-01

    Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

  5. [Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

    PubMed

    Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

    2009-04-01

    This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

  6. Coordinate cytokine regulatory sequences

    DOEpatents

    Frazer, Kelly A.; Rubin, Edward M.; Loots, Gabriela G.

    2005-05-10

    The present invention provides CNS sequences that regulate the cytokine gene expression, expression cassettes and vectors comprising or lacking the CNS sequences, host cells and non-human transgenic animals comprising the CNS sequences or lacking the CNS sequences. The present invention also provides methods for identifying compounds that modulate the functions of CNS sequences as well as methods for diagnosing defects in the CNS sequences of patients.

  7. Conditional immortalization of Gunn rat hepatocytes: an ex vivo model for evaluating methods for bilirubin-UDP-glucuronosyltransferase gene transfer.

    PubMed

    Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R

    1995-03-01

    Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful for ex vivo evaluation of bilirubin-UGT gene transfer vectors.

  8. Single-Step Conversion of Cells to Retrovirus Vector Producers with Herpes Simplex Virus–Epstein-Barr Virus Hybrid Amplicons

    PubMed Central

    Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.

    1999-01-01

    We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361

  9. DNA modification and functional delivery into human cells using Escherichia coli DH10B

    PubMed Central

    Narayanan, Kumaran; Warburton, Peter E.

    2003-01-01

    The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ∼200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies. PMID:12711696

  10. Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells.

    PubMed

    Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal

    2015-01-01

    In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.

  11. Broadly Neutralizing Human Immunodeficiency Virus Type 1 Antibody Gene Transfer Protects Nonhuman Primates from Mucosal Simian-Human Immunodeficiency Virus Infection

    PubMed Central

    Saunders, Kevin O.; Wang, Lingshu; Joyce, M. Gordon; Yang, Zhi-Yong; Balazs, Alejandro B.; Cheng, Cheng; Ko, Sung-Youl; Kong, Wing-Pui; Rudicell, Rebecca S.; Georgiev, Ivelin S.; Duan, Lijie; Foulds, Kathryn E.; Donaldson, Mitzi; Xu, Ling; Schmidt, Stephen D.; Todd, John-Paul; Baltimore, David; Roederer, Mario; Haase, Ashley T.; Kwong, Peter D.; Rao, Srinivas S.

    2015-01-01

    ABSTRACT Broadly neutralizing antibodies (bnAbs) can prevent lentiviral infection in nonhuman primates and may slow the spread of human immunodeficiency virus type 1 (HIV-1). Although protection by passive transfer of human bnAbs has been demonstrated in monkeys, durable expression is essential for its broader use in humans. Gene-based expression of bnAbs provides a potential solution to this problem, although immune responses to the viral vector or to the antibody may limit its durability and efficacy. Here, we delivered an adeno-associated viral vector encoding a simianized form of a CD4bs bnAb, VRC07, and evaluated its immunogenicity and protective efficacy. The expressed antibody circulated in macaques for 16 weeks at levels up to 66 μg/ml, although immune suppression with cyclosporine (CsA) was needed to sustain expression. Gene-delivered simian VRC07 protected against simian-human immunodeficiency virus (SHIV) infection in monkeys 5.5 weeks after treatment. Gene transfer of an anti-HIV antibody can therefore protect against infection by viruses that cause AIDS in primates when the host immune responses are controlled. IMPORTANCE Sustained interventions that can prevent HIV-1 infection are needed to halt the spread of the HIV-1 pandemic. The protective capacity of anti-HIV antibody gene therapy has been established in mouse models of HIV-1 infection but has not been established for primates. We show here a proof-of-concept that gene transfer of anti-HIV antibody genes can protect against infection by viruses that cause AIDS in primates when host immune responses are controlled. PMID:26041300

  12. Differential gene expression in laboratory strains of human head and body lice when challenged with Bartonella quintana, a pathogenic bacterium

    PubMed Central

    Previte, D.; Olds, B. P.; Yoon, K.; Sun, W.; Muir, W.; Paige, K. N.; Lee, S. H.; Clark, J.; Koehler, J. E.; Pittendrigh, B. R.

    2014-01-01

    Human head and body lice are obligatory hematophagous ectoparasites that belong to a single species, Pediculus humanus. Only body lice, however, are vectors of the infectious Gram-negative bacterium Bartonella quintana. Because of their near identical genomes, yet differential vector competence, head and body lice provide a unique model system to study the gain or loss of vector competence. Using our in vitro louse-rearing system, we infected head and body lice with blood containing B. quintana in order to detect both differences in the proliferation of B. quintana and transcriptional differences of immune-related genes in the lice. B. quintana proliferated rapidly in body lice at 6 days postinfection, but plateaued in head lice at 4 days postinfection. RNAseq and quantitative real-time PCR validation analyses determined gene expression differences. Eight immunoresponse genes were observed to be significantly different with many associated with the Toll pathway: Fibrinogen-like protein, Spaetzle, Defensin 1, Serpin, Scavenger receptor A and Apolipoporhrin 2. Our findings support the hypothesis that body lice, unlike head lice, fight infection from B. quintana only at the later stages of its proliferation. PMID:24404961

  13. Differential gene expression in laboratory strains of human head and body lice when challenged with Bartonella quintana, a pathogenic bacterium.

    PubMed

    Previte, D; Olds, B P; Yoon, K; Sun, W; Muir, W; Paige, K N; Lee, S H; Clark, J; Koehler, J E; Pittendrigh, B R

    2014-04-01

    Human head and body lice are obligatory hematophagous ectoparasites that belong to a single species, Pediculus humanus. Only body lice, however, are vectors of the infectious Gram-negative bacterium Bartonella quintana. Because of their near identical genomes, yet differential vector competence, head and body lice provide a unique model system to study the gain or loss of vector competence. Using our in vitro louse-rearing system, we infected head and body lice with blood containing B. quintana in order to detect both differences in the proliferation of B. quintana and transcriptional differences of immune-related genes in the lice. B. quintana proliferated rapidly in body lice at 6 days post-infection, but plateaued in head lice at 4 days post-infection. RNAseq and quantitative real-time PCR validation analyses determined gene expression differences. Eight immunoresponse genes were observed to be significantly different with many associated with the Toll pathway: Fibrinogen-like protein, Spaetzle, Defensin 1, Serpin, Scavenger receptor A and Apolipoporhrin 2. Our findings support the hypothesis that body lice, unlike head lice, fight infection from B. quintana only at the later stages of its proliferation. © 2014 The Royal Entomological Society.

  14. A direct comparison of two nonviral gene therapy vectors for somatic integration: in vivo evaluation of the bacteriophage integrase phiC31 and the Sleeping Beauty transposase.

    PubMed

    Ehrhardt, Anja; Xu, Hui; Huang, Zan; Engler, Jeffrey A; Kay, Mark A

    2005-05-01

    In this study we performed a head-to-head comparison of the integrase phiC31 derived from a Streptomyces phage and the Sleeping Beauty (SB) transposase, a member of the TC1/mariner superfamily of transposable elements. Mouse liver was cotransfused with a vector containing our most robust human coagulation factor IX expression cassette and the appropriate recombinase recognition site and either a phiC31- or a SB transposase-expressing vector. To analyze transgene persistence and to prove somatic integration in vivo we induced cell cycling of mouse hepatocytes and found that the transgene expression levels dropped by only 16 to 21% and 56 to 66% in mice that received phiC31 and SB, respectively. Notably, no difference in the toxicity profile was detected in mice treated with either recombinase. Moreover we observed that with the integrase-mediated gene transfer, transgene expression levels were dependent on the remaining noncoding vector sequences, which also integrate into the host genome. Further analyses of a hot spot of integration after phiC31-mediated integration revealed small chromosomal deletions at the target site and that the recombination process was not dependent on the orientation in which the phiC31 recognition site attached to the pseudo-recognition sites in the host genome. Coupled together with ongoing improvements in both systems this study suggests that both nonviral vector systems will have important roles in achieving stable gene transfer in vivo.

  15. Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

    PubMed Central

    Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

    2012-01-01

    The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

  16. Efficient production of recombinant adeno-associated viral vector, serotype DJ/8, carrying the GFP gene.

    PubMed

    Hashimoto, Haruo; Mizushima, Tomoko; Chijiwa, Tsuyoshi; Nakamura, Masato; Suemizu, Hiroshi

    2017-06-15

    The purpose of this study was to establish an efficient method for the preparation of an adeno-associated viral (AAV), serotype DJ/8, carrying the GFP gene (AAV-DJ/8-GFP). We compared the yields of AAV-DJ/8 vector, which were produced by three different combination methods, consisting of two plasmid DNA transfection methods (lipofectamine and calcium phosphate co-precipitation; CaPi) and two virus DNA purification methods (iodixanol and cesium chloride; CsCl). The results showed that the highest yield of AAV-DJ/8-GFP vector was accomplished with the combination method of lipofectamine transfection and iodixanol purification. The viral protein expression levels and the transduction efficacy in HEK293 and CHO cells were not different among four different combination methods for AAV-DJ/8-GFP vectors. We confirmed that the AAV-DJ/8-GFP vector could transduce to human and murine hepatocyte-derived cell lines. These results show that AAV-DJ/8-GFP, purified by the combination of lipofectamine and iodixanol, produces an efficient yield without altering the characteristics of protein expression and AAV gene transduction. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

    PubMed Central

    Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

    2008-01-01

    Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

  18. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    PubMed

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Relevance Vector Machine Learning for Neonate Pain Intensity Assessment Using Digital Imaging

    PubMed Central

    Gholami, Behnood; Tannenbaum, Allen R.

    2011-01-01

    Pain assessment in patients who are unable to verbally communicate is a challenging problem. The fundamental limitations in pain assessment in neonates stem from subjective assessment criteria, rather than quantifiable and measurable data. This often results in poor quality and inconsistent treatment of patient pain management. Recent advancements in pattern recognition techniques using relevance vector machine (RVM) learning techniques can assist medical staff in assessing pain by constantly monitoring the patient and providing the clinician with quantifiable data for pain management. The RVM classification technique is a Bayesian extension of the support vector machine (SVM) algorithm, which achieves comparable performance to SVM while providing posterior probabilities for class memberships and a sparser model. If classes represent “pure” facial expressions (i.e., extreme expressions that an observer can identify with a high degree of confidence), then the posterior probability of the membership of some intermediate facial expression to a class can provide an estimate of the intensity of such an expression. In this paper, we use the RVM classification technique to distinguish pain from nonpain in neonates as well as assess their pain intensity levels. We also correlate our results with the pain intensity assessed by expert and nonexpert human examiners. PMID:20172803

  20. Protection of non-human primates against rabies with an adenovirus recombinant vaccine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiang, Z.Q.; Greenberg, L.; Ertl, H.C., E-mail: ertl@wistar.upenn.edu

    Rabies remains a major neglected global zoonosis. New vaccine strategies are needed for human rabies prophylaxis. A single intramuscular immunization with a moderate dose of an experimental chimpanzee adenovirus (Ad) vector serotype SAd-V24, also termed AdC68, expressing the rabies virus glycoprotein, resulted in sustained titers of rabies virus neutralizing antibodies and protection against a lethal rabies virus challenge infection in a non-human primate model. Taken together, these data demonstrate the safety, immunogenicity, and efficacy of the recombinant Ad-rabies vector for further consideration in human clinical trials. - Highlights: • Pre-exposure vaccination with vaccine based on a chimpanzee derived adenovirus protectsmore » against rabies. • Protection is sustained. • Protection is achieved with single low-dose of vaccine given intramuscularly. • Protection is not affected by pre-existing antibodies to common human serotypes of adenovirus.« less

  1. Adenovirus Vector Pseudotyping in Fiber-Expressing Cell Lines: Improved Transduction of Epstein-Barr Virus-Transformed B Cells

    PubMed Central

    Von Seggern, Dan J.; Huang, Shuang; Fleck, Shonna Kaye; Stevenson, Susan C.; Nemerow, Glen R.

    2000-01-01

    While adenovirus (Ad) gene delivery vectors are useful in many gene therapy applications, their broad tropism means that they cannot be directed to a specific target cell. There are also a number of cell types involved in human disease which are not transducible with standard Ad vectors, such as Epstein-Barr virus (EBV)-transformed B lymphocytes. Adenovirus binds to host cells via the viral fiber protein, and Ad vectors have previously been retargeted by modifying the fiber gene on the viral chromosome. This requires that the modified fiber be able to bind to the cell in which the vector is grown, which prevents truly specific vector targeting. We previously reported a gene delivery system based on a fiber gene-deleted Ad type 5 (Ad5) vector (Ad5.βgal.ΔF) and packaging cells that express the viral fiber protein. Expression of different fibers in packaging cells will allow Ad retargeting without modifying the viral chromosome. Importantly, fiber proteins which can no longer bind to the producer cells can also be used. Using this approach, we generated for the first time pseudotyped Ad5.βgal.ΔF particles containing either the wild-type Ad5 fiber protein or a chimeric fiber with the receptor-binding knob domain of the Ad3 fiber. Particles equipped with the chimeric fiber bound to the Ad3 receptor rather than the coxsackievirus-adenovirus receptor protein used by Ad5. EBV-transformed B lymphocytes were infected efficiently by the Ad3-pseudotyped particles but poorly by virus containing the Ad5 fiber protein. The strategy described here represents a broadly applicable method for targeting gene delivery to specific cell types. PMID:10590124

  2. Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Guodong; Peng, Tao; Zhou, Xuhong

    2013-11-01

    Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messengermore » RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and senescence and, therefore, the tumor cells regression.« less

  3. Expression and activity analysis of a new fusion protein targeting ovarian cancer cells.

    PubMed

    Su, Manman; Chang, Weiqin; Wang, Dingding; Cui, Manhua; Lin, Yang; Wu, Shuying; Xu, Tianmin

    2015-09-01

    The aim of the present study was to develop a new therapeutic drug to improve the prognosis of ovarian cancer patients. Human urokinase-type plasminogen activator (uPA)17-34-kunitz-type protease inhibitor (KPI) eukaryotic expression vector was constructed and recombinant human uPA17-34-KPI (rhuPA17-34-KPI) in P. pastoris was expressed. In the present study, the DNA sequences that encode uPA 17-34 amino acids were created according to the native amino acids sequence and inserted into the KPI-pPICZαC vector, which was constructed. Then, uPA17‑34-KPI-pPICZαC was transformed into P. pastoris X-33, and rhuPA17-34-KPI was expressed by induction of methanol. The bioactivities of a recombinant fusion protein were detected with trypsin inhibition analysis, and the inhibitory effects on the growth of ovarian cancer cells were identified using the TUNEL assay, in vitro wound‑healing assay and Matrigel model analysis. The results of the DNA sequence analysis of the recombinant vector uPA17-34-KPI‑pPICZα demonstrated that the DNA‑encoding human uPA 17-34 amino acids, 285-288 amino acids of amyloid precursor protein (APP) and 1-57 amino acids of KPI were correctly inserted into the pPICZαC vector. Following induction by methonal, the fusion protein with a molecular weight of 8.8 kDa was observed using SDS-PAGE and western blot analysis. RhuPA17-34-KPI was expressed in P. pastoris with a yield of 50 mg/l in a 50-ml tube. The recombinant fusion protein was able to inhibit the activity of trypsin, inhibit growth and induce apoptosis of SKOV3 cells, and inhibit the invasion and metastasis of ovarian cancer cells. By considering uPA17-34 amino acid specific binding uPAR as the targeted part of fusion protein and utilizing the serine protease inhibitor activity of KPI, it was found that the recombinant fusion protein uPA17-34-KPI inhibited the invasion and metastasis of ovarian tumors, and may therefore be regarded as effective in targeted treatment.

  4. AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

    PubMed

    Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

    2017-09-01

    Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

  5. [RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].

    PubMed

    Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli

    2017-08-25

    This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.

  6. Transcriptomic profiles of human foreskin fibroblast cells in response to orf virus.

    PubMed

    Chen, Daxiang; Long, Mingjian; Xiao, Bin; Xiong, Yufeng; Chen, Huiqin; Chen, Yu; Kuang, Zhenzhan; Li, Ming; Wu, Yingsong; Rock, Daniel L; Gong, Daoyuan; Wang, Yong; He, Haijian; Liu, Fang; Luo, Shuhong; Hao, Wenbo

    2017-08-29

    Orf virus has been utilized as a safe and efficient viral vector against not only diverse infectious diseases, but also against tumors. However, the nature of the genes triggered by the vector in human cells is poorly characterized. Using RNA sequencing technology, we compared specific changes in the transcriptomic profiles in human foreskin fibroblast cells following infection by the orf virus. The results indicated that orf virus upregulates or downregulates expression of a variety of genes, including genes involved in antiviral immune response, apoptosis, cell cycle and a series of signaling pathways, such as the IFN and p53-signaling pathways. The orf virus stimulates or inhibits immune gene expression such as chemokines, chemokine receptors, cytokines, cytokine receptors, and molecules involved in antigen uptake and processing after infection. Expression of pro-apoptotic genes increased at 8 hours post-infection. The p53 signaling pathway was activated to induce apoptosis at the same time. However, the cell cycle program was promoted after infection, which may be due to the immunomodulatory genes of the orf virus. This presents the first description of transcription profile changes in human foreskin fibroblast cells after orf virus infection and provides an in-depth analysis of the interaction between the host and orf virus. These data offer new insights into the understanding of the mechanisms of infection by orf virus and identify potential targets for future studies.

  7. Superior In vivo Transduction of Human Hepatocytes Using Engineered AAV3 Capsid.

    PubMed

    Vercauteren, Koen; Hoffman, Brad E; Zolotukhin, Irene; Keeler, Geoffrey D; Xiao, Jing W; Basner-Tschakarjan, Etiena; High, Katherine A; Ertl, Hildegund Cj; Rice, Charles M; Srivastava, Arun; de Jong, Ype P; Herzog, Roland W

    2016-06-01

    Adeno-associated viral (AAV) vectors are currently being tested in multiple clinical trials for liver-directed gene transfer to treat the bleeding disorders hemophilia A and B and metabolic disorders. The optimal viral capsid for transduction of human hepatocytes has been under active investigation, but results across various models are inconsistent. We tested in vivo transduction in "humanized" mice. Methods to quantitate percent AAV transduced human and murine hepatocytes in chimeric livers were optimized using flow cytometry and confocal microscopy with image analysis. Distinct transduction efficiencies were noted following peripheral vein administration of a self-complementary vector expressing a gfp reporter gene. An engineered AAV3 capsid with two amino acid changes, S663V+T492V (AAV3-ST), showed best efficiency for human hepatocytes (~3-times, ~8-times, and ~80-times higher than for AAV9, AAV8, and AAV5, respectively). AAV5, 8, and 9 were more efficient in transducing murine than human hepatocytes. AAV8 yielded the highest transduction rate of murine hepatocytes, which was 19-times higher than that for human hepatocytes. In summary, our data show substantial differences among AAV serotypes in transduction of human and mouse hepatocytes, are the first to report on AAV5 in humanized mice, and support the use of AAV3-based vectors for human liver gene transfer.

  8. [Eukaryotic Expression and Immunogenic Research of Recombination Ebola Virus Membrane Protein Gp-Fc].

    PubMed

    Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi

    2016-01-01

    We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.

  9. CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes.

    PubMed

    Ehrke-Schulz, Eric; Schiwon, Maren; Leitner, Theo; Dávid, Stephan; Bergmann, Thorsten; Liu, Jing; Ehrhardt, Anja

    2017-12-07

    The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system revolutionized the field of gene editing but viral delivery of the CRISPR/Cas9 system has not been fully explored. Here we adapted clinically relevant high-capacity adenoviral vectors (HCAdV) devoid of all viral genes for the delivery of the CRISPR/Cas9 machinery using a single viral vector. We present a platform enabling fast transfer of the Cas9 gene and gRNA expression units into the HCAdV genome including the option to choose between constitutive or inducible Cas9 expression and gRNA multiplexing. Efficacy and versatility of this pipeline was exemplified by producing different CRISPR/Cas9-HCAdV targeting the human papillomavirus (HPV) 18 oncogene E6, the dystrophin gene causing Duchenne muscular dystrophy (DMD) and the HIV co-receptor C-C chemokine receptor type 5 (CCR5). All CRISPR/Cas9-HCAdV proved to be efficient to deliver the respective CRISPR/Cas9 expression units and to introduce the desired DNA double strand breaks at their intended target sites in immortalized and primary cells.

  10. Non-replicating adenovirus vectors expressing avian influenza virus hemagglutinin and nucleocapsid proteins induce chicken specific effector, memory and effector memory CD8+ T lymphocytes

    PubMed Central

    Singh, Shailbala; Toro, Haroldo; Tang, De-Chu; Briles, Worthie E.; Yates, Linda M.; Kopulos, Renee T.; Collisson, Ellen W.

    2010-01-01

    Avian influenza virus (AIV) specific CD8+ T lymphocyte responses stimulated by intramuscular administration of an adenovirus (Ad) vector expressing either HA or NP were evaluated in chickens following ex vivo stimulation by non-professional antigen presenting cells. The CD8+ T lymphocyte responses were AIV specific, MHC-I restricted, and cross-reacted with heterologousH7N2 AIV strain. Specific effector responses, at 10 days post-inoculation (p.i.), were undetectable at 2 weeks p.i., and memory responses were detected from 3 to 8 weeks p.i. Effector memory responses, detected 1 week following a booster inoculation, were significantly greater than the primary responses and, within 7 days, declined to undetectable levels. Inoculation of an Ad-vector expressing human NP resulted in significantly greater MHC restricted, activation of CD8+ T cell responses specific for AIV. Decreases in all responses with time were most dramatic with maximum activation of T cells as observed following effector and effector memory responses. PMID:20557918

  11. Paratransgenesis applied for control of tsetse transmitted sleeping sickness.

    PubMed

    Aksoy, Serap; Weiss, Brian; Attardo, Geoffrey

    2008-01-01

    African trypanosomiasis (sleeping sickness) is a major cause of morbidity and mortality in Subsaharan Africa for human and animal health. In the absence of effective vaccines and efficacious drugs, vector control is an alternative intervention tool to break the disease cycle. This chapter describes the vectorial and symbiotic biology of tsetse with emphasis on the current knowledge on tsetse symbiont genomics and functional biology, and tsetse's trypanosome transmission capability. The ability to culture one of tsetse's commensal symbiotic microbes, Sodalis in vitro has allowed for the development of a genetic transformation system for this organism. Tsetse can be repopulated with the modified Sodalis symbiont, which can express foreign gene products (an approach we refer to as paratransgenic expression system). Expanding knowledge on tsetse immunity effectors, on genomics of tsetse symbionts and on tsetse's parasite transmission biology stands to enhance the development and potential application of paratransgenesis as a new vector-control strategy. We describe the hallmarks of the paratransgenic transformation technology where the modified symbionts expressing trypanocidal compounds can be used to manipulate host functions and lead to the control of trypanosomiasis by blocking trypanosome transmission in the tsetse vector.

  12. New gorilla adenovirus vaccine vectors induce potent immune responses and protection in a mouse malaria model.

    PubMed

    Limbach, Keith; Stefaniak, Maureen; Chen, Ping; Patterson, Noelle B; Liao, Grant; Weng, Shaojie; Krepkiy, Svetlana; Ekberg, Greg; Torano, Holly; Ettyreddy, Damodar; Gowda, Kalpana; Sonawane, Sharvari; Belmonte, Arnel; Abot, Esteban; Sedegah, Martha; Hollingdale, Michael R; Moormann, Ann; Vulule, John; Villasante, Eileen; Richie, Thomas L; Brough, Douglas E; Bruder, Joseph T

    2017-07-03

    A DNA-human Ad5 (HuAd5) prime-boost malaria vaccine has been shown to protect volunteers against a controlled human malaria infection. The potency of this vaccine, however, appeared to be affected by the presence of pre-existing immunity against the HuAd5 vector. Since HuAd5 seroprevalence is very high in malaria-endemic areas of the world, HuAd5 may not be the most appropriate malaria vaccine vector. This report describes the evaluation of the seroprevalence, immunogenicity and efficacy of three newly identified gorilla adenoviruses, GC44, GC45 and GC46, as potential malaria vaccine vectors. The seroprevalence of GC44, GC45 and GC46 is very low, and the three vectors are not efficiently neutralized by human sera from Kenya and Ghana, two countries where malaria is endemic. In mice, a single administration of GC44, GC45 and GC46 vectors expressing a murine malaria gene, Plasmodium yoelii circumsporozoite protein (PyCSP), induced robust PyCSP-specific T cell and antibody responses that were at least as high as a comparable HuAd5-PyCSP vector. Efficacy studies in a murine malaria model indicated that a prime-boost regimen with DNA-PyCSP and GC-PyCSP vectors can protect mice against a malaria challenge. Moreover, these studies indicated that a DNA-GC46-PyCSP vaccine regimen was significantly more efficacious than a DNA-HuAd5-PyCSP regimen. These data suggest that these gorilla-based adenovectors have key performance characteristics for an effective malaria vaccine. The superior performance of GC46 over HuAd5 highlights its potential for clinical development.

  13. Nonviral vectors for cancer gene therapy: prospects for integrating vectors and combination therapies.

    PubMed

    Ohlfest, John R; Freese, Andrew B; Largaespada, David A

    2005-12-01

    Gene therapy has the potential to improve the clinical outcome of many cancers by transferring therapeutic genes into tumor cells or normal host tissue. Gene transfer into tumor cells or tumor-associated stroma is being employed to induce tumor cell death, stimulate anti-tumor immune response, inhibit angiogenesis, and control tumor cell growth. Viral vectors have been used to achieve this proof of principle in animal models and, in select cases, in human clinical trials. Nevertheless, there has been considerable interest in developing nonviral vectors for cancer gene therapy. Nonviral vectors are simpler, more amenable to large-scale manufacture, and potentially safer for clinical use. Nonviral vectors were once limited by low gene transfer efficiency and transient or steadily declining gene expression. However, recent improvements in plasmid-based vectors and delivery methods are showing promise in circumventing these obstacles. This article reviews the current status of nonviral cancer gene therapy, with an emphasis on combination strategies, long-term gene transfer using transposons and bacteriophage integrases, and future directions.

  14. Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

    PubMed

    Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

    2017-09-15

    Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

  15. Proviruses with Long-Term Stable Expression Accumulate in Transcriptionally Active Chromatin Close to the Gene Regulatory Elements: Comparison of ASLV-, HIV- and MLV-Derived Vectors

    PubMed Central

    Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří

    2018-01-01

    Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993

  16. Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

    PubMed

    Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

    2016-05-01

    Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  17. Derivation of simple rules for complex flow vector fields on the lower part of the human face for robot face design.

    PubMed

    Ishihara, Hisashi; Ota, Nobuyuki; Asada, Minoru

    2017-11-27

    It is quite difficult for android robots to replicate the numerous and various types of human facial expressions owing to limitations in terms of space, mechanisms, and materials. This situation could be improved with greater knowledge regarding these expressions and their deformation rules, i.e. by using the biomimetic approach. In a previous study, we investigated 16 facial deformation patterns and found that each facial point moves almost only in its own principal direction and different deformation patterns are created with different combinations of moving lengths. However, the replication errors caused by moving each control point of a face in only their principal direction were not evaluated for each deformation pattern at that time. Therefore, we calculated the replication errors in this study using the second principal component scores of the 16 sets of flow vectors at each point on the face. More than 60% of the errors were within 1 mm, and approximately 90% of them were within 3 mm. The average error was 1.1 mm. These results indicate that robots can replicate the 16 investigated facial expressions with errors within 3 mm and 1 mm for about 90% and 60% of the vectors, respectively, even if each point on the robot face moves in only its own principal direction. This finding seems promising for the development of robots capable of showing various facial expressions because significantly fewer types of movements than previously predicted are necessary.

  18. Overexpression of the DNA mismatch repair factor, PMS2, confers hypermutability and DNA damage tolerance.

    PubMed

    Gibson, Shannon L; Narayanan, Latha; Hegan, Denise Campisi; Buermeyer, Andrew B; Liskay, R Michael; Glazer, Peter M

    2006-12-08

    Inherited defects in genes associated with DNA mismatch repair (MMR) have been linked to familial colorectal cancer. Cells deficient in MMR are genetically unstable and demonstrate a tolerance phenotype in response to certain classes of DNA damage. Some sporadic human cancers also show abnormalities in MMR gene function, typically due to diminished expression of one of the MutL homologs, MLH1. Here, we report that overexpression of the MutL homolog, human PMS2, can also cause a disruption of the MMR pathway in mammalian cells, resulting in hypermutability and DNA damage tolerance. A mouse fibroblast cell line carrying a recoverable lambda phage shuttle vector for mutation detection was transfected with either a vector designed to express hPMS2 or with an empty vector control. Cells overexpressing hPMS2 were found to have elevated spontaneous mutation frequencies at the cII reporter gene locus. They also showed an increase in the level of mutations induced by the alkylating agent, methynitrosourea (MNU). Clonogenic survival assays demonstrated increased survival of the PMS2-overexpressing cells following exposure to MNU, consistent with the induction of a damage tolerance phenotype. Similar results were seen in cells expressing a mutant PMS2 gene, containing a premature stop codon at position 134 and representing a variant found in an individual with familial colon cancer. These results show that dysregulation of PMS2 gene expression can disrupt MMR function in mammalian cells and establish an additional carcinogenic mechanism by which cells can develop genetic instability and acquire resistance to cytotoxic cancer therapies.

  19. Stability of Lentiviral Vector-Mediated Transgene Expression in the Brain in the Presence of Systemic Antivector Immune Responses

    PubMed Central

    ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.

    2009-01-01

    Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605

  20. Local immunotherapy of spontaneous feline fibrosarcomas using recombinant poxviruses expressing interleukin 2 (IL2).

    PubMed

    Jourdier, T-M; Moste, C; Bonnet, M-C; Delisle, F; Tafani, J-P; Devauchelle, P; Tartaglia, J; Moingeon, P

    2003-12-01

    We tested the canarypox virus vector ALVAC and the genetically attenuated vaccinia virus vector NYVAC as vehicles for achieving local immunomodulation in domestic animals bearing spontaneous tumours. Following intratumoral administration of ALVAC-, or NYVAC-luciferase in dogs with melanoma, it was demonstrated that viral recombinants remained localized along the needle track, with no virus detectable in the periphery of the tumour. Given these distribution characteristics and their well-documented safety profile, ALVAC- or NYVAC-based recombinants expressing feline or human IL2, respectively, were administered to domestic cats, in order to prevent the recurrence of spontaneous fibrosarcomas. In the absence of immunotherapy, tumour recurrence was observed in 61% of animals within a 12-month follow-up period after treatment with surgery and iridium-based radiotherapy. In contrast, only 39 and 28% of cats receiving either NYVAC-human IL2 or ALVAC-feline IL2, respectively, exhibited tumour recurrences. Based on such results, and in the context of ongoing clinical studies conducted in humans, we discuss the utilization of ALVAC- or NYVAC-based recombinants as viable therapeutic modalities for local immunotherapy or therapeutic vaccination against cancer, both in humans and companion animals.

  1. Induction of pluripotent stem cells from a cynomolgus monkey using a polycistronic simian immunodeficiency virus-based vector, differentiation toward functional cardiomyocytes, and generation of stably expressing reporter lines.

    PubMed

    Wunderlich, Stephanie; Haase, Alexandra; Merkert, Sylvia; Beier, Jennifer; Schwanke, Kristin; Schambach, Axel; Glage, Silke; Göhring, Gudrun; Curnow, Eliza C; Martin, Ulrich

    2012-12-01

    Induced pluripotent stem cells (iPSCs) represent a novel cell source for regenerative therapies. Many emerging iPSC-based therapeutic concepts will require preclinical evaluation in suitable large animal models. Among the large animal species frequently used in preclinical efficacy and safety studies, macaques show the highest similarities to humans at physiological, cellular, and molecular levels. We have generated iPSCs from cynomolgus monkeys (Macaca fascicularis) as a segue to regenerative therapy model development in this species. Because typical human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors show poor transduction of simian cells, a simian immunodeficiency virus (SIV)-based vector was chosen for efficient transduction of cynomolgus skin fibroblasts. A corresponding polycistronic vector with codon-optimized reprogramming factors was constructed for reprogramming. Growth characteristics as well as cell and colony morphology of the resulting cynomolgus iPSCs (cyiPSCs) were demonstrated to be almost identical to cynomolgus embryonic stem cells (cyESCs), and cyiPSCs expressed typical pluripotency markers including OCT4, SOX2, and NANOG. Furthermore, differentiation in vivo and in vitro into derivatives of all three germ layers, as well as generation of functional cardiomyocytes, could be demonstrated. Finally, a highly efficient technique for generation of transgenic cyiPSC clones with stable reporter expression in undifferentiated cells as well as differentiated transgenic cyiPSC progeny was developed to enable cell tracking in recipient animals. In conclusion, our data indicate that cyiPSCs represent a valuable cell source for establishment of macaque-based allogeneic and autologous preclinical cell transplantation models for various fields of regenerative medicine.

  2. Virally delivered Channelrhodopsin-2 Safely and Effectively Restores Visual Function in Multiple Mouse Models of Blindness

    PubMed Central

    Doroudchi, M Mehdi; Greenberg, Kenneth P; Liu, Jianwen; Silka, Kimberly A; Boyden, Edward S; Lockridge, Jennifer A; Arman, A Cyrus; Janani, Ramesh; Boye, Shannon E; Boye, Sanford L; Gordon, Gabriel M; Matteo, Benjamin C; Sampath, Alapakkam P; Hauswirth, William W; Horsager, Alan

    2011-01-01

    Previous work established retinal expression of channelrhodopsin-2 (ChR2), an algal cation channel gated by light, restored physiological and behavioral visual responses in otherwise blind rd1 mice. However, a viable ChR2-based human therapy must meet several key criteria: (i) ChR2 expression must be targeted, robust, and long-term, (ii) ChR2 must provide long-term and continuous therapeutic efficacy, and (iii) both viral vector delivery and ChR2 expression must be safe. Here, we demonstrate the development of a clinically relevant therapy for late stage retinal degeneration using ChR2. We achieved specific and stable expression of ChR2 in ON bipolar cells using a recombinant adeno-associated viral vector (rAAV) packaged in a tyrosine-mutated capsid. Targeted expression led to ChR2-driven electrophysiological ON responses in postsynaptic retinal ganglion cells and significant improvement in visually guided behavior for multiple models of blindness up to 10 months postinjection. Light levels to elicit visually guided behavioral responses were within the physiological range of cone photoreceptors. Finally, chronic ChR2 expression was nontoxic, with transgene biodistribution limited to the eye. No measurable immune or inflammatory response was observed following intraocular vector administration. Together, these data indicate that virally delivered ChR2 can provide a viable and efficacious clinical therapy for photoreceptor disease-related blindness. PMID:21505421

  3. Antibody-mediated targeting of replication-competent retroviral vectors.

    PubMed

    Tai, Chien-Kuo; Logg, Christopher R; Park, Jinha M; Anderson, W French; Press, Michael F; Kasahara, Noriyuki

    2003-05-20

    Replication-competent murine leukemia virus (MLV) vectors can be engineered to achieve high efficiency gene transfer to solid tumors in vivo and tumor-restricted replication, however their safety can be further enhanced by redirecting tropism of the virus envelope. We have therefore tested the targeting capability and replicative stability of ecotropic and amphotropic replication-competent retrovirus (RCR) vectors containing two tandem repeats from the immunoglobulin G-binding domain of Staphylococcal protein A inserted into the proline-rich "hinge" region of the envelope, which enables modular use of antibodies of various specificities for vector targeting. The modified envelopes were efficiently expressed and incorporated into virions, were capable of capturing monoclonal anti-HER2 antibodies, and mediated efficient binding of the virus-antibody complex to HER2-positive target cells. While infectivity was markedly reduced by pseudotyping with targeted envelopes alone, coexpression of wild-type envelope rescued efficient cellular entry. Both ecotropic and amphotropic RCR vector/anti-HER2 antibody complexes achieved significant enhancement of transduction on murine target cells overexpressing HER2, which could be competed by preincubation with excess free antibodies. Interestingly, HER2-expressing human breast cancer cells did not show enhancement of transduction despite efficient antibody-mediated cell surface binding, suggesting that target cell-specific parameters markedly affect the efficiency of post-binding entry processes. Serial replication of targeted vectors resulted in selection of Z domain deletion variants, but reduction of the overall size of the vector genome enhanced its stability. Application of antibody-mediated targeting to the initial localization of replication-competent virus vectors to tumor sites will thus require optimized target selection and vector design.

  4. Recombinant human adenovirus-5 expressing capsid proteins of Indian vaccine strains of foot-and-mouth disease virus elicits effective antibody response in cattle

    USDA-ARS?s Scientific Manuscript database

    Recombinant adenovirus-5 vectored foot-and-mouth disease constructs (Ad5- FMD) were made for three Indian vaccine virus serotypes O,A and Asia 1. Constructs co-expressing foot-and- mouth disease virus (FMDV) capsid and viral 3C protease sequences, were evaluated for their ability to induce a neutral...

  5. Increased expression of the WNT antagonist sFRP-1 in glaucoma elevates intraocular pressure

    PubMed Central

    Wang, Wan-Heng; McNatt, Loretta G.; Pang, Iok-Hou; Millar, J. Cameron; Hellberg, Peggy E.; Hellberg, Mark H.; Steely, H. Thomas; Rubin, Jeffrey S.; Fingert, John H.; Sheffield, Val C.; Stone, Edwin M.; Clark, Abbot F.

    2008-01-01

    Elevated intraocular pressure (IOP) is the principal risk factor for glaucoma and results from excessive impedance of the fluid outflow from the eye. This abnormality likely originates from outflow pathway tissues such as the trabecular meshwork (TM), but the associated molecular etiology is poorly understood. We discovered what we believe to be a novel role for secreted frizzled-related protein-1 (sFRP-1), an antagonist of Wnt signaling, in regulating IOP. sFRP1 was overexpressed in human glaucomatous TM cells. Genes involved in the Wnt signaling pathway were expressed in cultured TM cells and human TM tissues. Addition of recombinant sFRP-1 to ex vivo perfusion-cultured human eyes decreased outflow facility, concomitant with reduced levels of β-catenin, the Wnt signaling mediator, in the TM. Intravitreal injection of an adenoviral vector encoding sFRP1 in mice produced a titer-dependent increase in IOP. Five days after vector injection, IOP increased 2 fold, which was significantly reduced by topical ocular administration of an inhibitor of a downstream suppressor of Wnt signaling. Thus, these data indicate that increased expression of sFRP1 in the TM appears to be responsible for elevated IOP in glaucoma and restoring Wnt signaling in the TM may be a novel disease intervention strategy for treating glaucoma. PMID:18274669

  6. A safe and efficient BCG vectored vaccine to prevent the disease caused by the human Respiratory Syncytial Virus.

    PubMed

    Rey-Jurado, Emma; Soto, Jorge; Gálvez, Nicolás; Kalergis, Alexis M

    2017-09-02

    The human Respiratory Syncytial Virus (hRSV) causes lower respiratory tract infections including pneumonia and bronchiolitis. Such infections also cause a large number of hospitalizations and affects mainly newborns, young children and the elderly worldwide. Symptoms associated with hRSV infection are due to an exacerbated immune response characterized by low levels of IFN-γ, recruitment of neutrophils and eosinophils to the site of infection and lung damage. Although hRSV is a major health problem, no vaccines are currently available. Different immunization approaches have been developed to achieve a vaccine that activates the immune system, without triggering an unbalanced inflammation. These approaches include live attenuated vaccine, DNA or proteins technologies, and the use of vectors to express proteins of the virus. In this review, we discuss the host immune response to hRSV and the immunological mechanisms underlying an effective and safe BCG vectored vaccine against hRSV.

  7. Practical Integration-Free Episomal Methods for Generating Human Induced Pluripotent Stem Cells.

    PubMed

    Kime, Cody; Rand, Tim A; Ivey, Kathryn N; Srivastava, Deepak; Yamanaka, Shinya; Tomoda, Kiichiro

    2015-10-06

    The advent of induced pluripotent stem (iPS) cell technology has revolutionized biomedicine and basic research by yielding cells with embryonic stem (ES) cell-like properties. The use of iPS-derived cells for cell-based therapies and modeling of human disease holds great potential. While the initial description of iPS cells involved overexpression of four transcription factors via viral vectors that integrated within genomic DNA, advances in recent years by our group and others have led to safer and higher quality iPS cells with greater efficiency. Here, we describe commonly practiced methods for non-integrating induced pluripotent stem cell generation using nucleofection of episomal reprogramming plasmids. These methods are adapted from recent studies that demonstrate increased hiPS cell reprogramming efficacy with the application of three powerful episomal hiPS cell reprogramming factor vectors and the inclusion of an accessory vector expressing EBNA1. Copyright © 2015 John Wiley & Sons, Inc.

  8. Genetic stability of RSV-F expression and the restricted growth phenotype of a live attenuated PIV3 vectored RSV vaccine candidate (MEDI-534) following restrictive growth in human lung cells.

    PubMed

    Nelson, Christine L; Tang, Roderick S; Stillman, Elizabeth A

    2013-08-12

    MEDI-534 is the first live, attenuated and vectored respiratory syncytial virus (RSV) vaccine to be evaluated in seronegative children. It consists of a bovine/human parainfluenza virus type 3 (PIV3) backbone with the RSV fusion glycoprotein (RSV-F) expressed from the second position. The PIV3 fusion and hemaglutinin-neuraminidase proteins are human-derived. No small animal appropriately replicates the restrictive growth of bovine PIV3 (bPIV3) based viruses relative to human PIV3 (hPIV3) observed in the respiratory tract of rhesus monkeys and humans, making analysis of the genetic stability of the attenuation phenotype and maintenance of RSV-F expression difficult. Screening of multiple cell-lines identified MRC-5 cells as supporting permissive growth of hPIV3 while restricting bPIV3 and MEDI-534 growth. In MRC-5 cells, the peak titers of MEDI-534 were more than 20-fold lower compared to hPIV3 peak titers. After more than 10 multicycle passages in MRC-5 cells, genetic alterations were detected in MEDI-534 that contributed to a partial loss in restricted growth in MRC-5 cells and a decrease in RSV-F expression. These adaptive mutations did not occur in the RSV-F gene but were found in the polyA sequence upstream of the transgene. MRC-5 adapted MEDI-534 viruses (1) lost some attenuation but did not replicate to the level of hPIV3 in this cell line, (2) did not completely lose RSV-F expression and (3) were able to elicit a protective anti-RSV immune response in hamsters despite lower levels of RSV-F expression. Interestingly analysis of shed MEDI-534 from a recent clinical trial indicates that in some recipients similar mutations arise by day 7 or day 12 post immunization (in press) suggesting that these mutations can arise rapidly in the human host. The utility and limits of MRC-5 cells for characterizing the attenuation and RSV-F expression of MEDI-534 is discussed. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Helper-Free Foamy Virus Vectors

    PubMed Central

    TROBRIDGE, GRANT D.; RUSSELL, DAVID W.

    2010-01-01

    Retroviral vectors based on human foamy virus (HFV) have been developed and show promise as gene therapy vehicles. Here we describe a method for the production of HFV vector stocks free of detectable helper virus. The helper and vector plasmid constructs used both lack the HFV bel genes, so recombination between these constructs cannot create a wild-type virus. A fusion promoter that combines portions of the cytomegalovirus (CMV) immediate-early and HFV long terminal repeat (LTR) promoters was used to drive expression of both the helper and vector constructs. The CMV–LTR fusion promoter allows for HFV vector production in the absence of the Bel-1 trans-activator protein, which would otherwise be necessary for efficient transcription from the HFV LTR. Vector stocks containing either neomycin phosphotransferase or alkaline phosphatase reporter genes were produced by transient transfection at titers greater than 105 transducing units/ml. G418-resistant BHK-21 cells obtained by transduction with neo vectors contained randomly integrated HFV vector proviruses without detectable deletions or rearrangements. The vector stocks generated were free of replication-competent retrovirus (RCR), as determined by assays for LTR trans-activation and a marker rescue assay developed here for the detection of Bel-independent RCR. OVERVIEW SUMMARY Vectors based on human foamy virus have been developed but low titers and the presence of replication-competent retrovirus (RCR) in vector stocks have prevented their use in preclinical animal experiments. We have developed a transient transfection method that can be used to produce replication-incompetent HFV vector stocks at titers greater than 105/ml, and that does not produce contaminating RCR. The use of CMV-HFV LTR fusion promoters in the helper and vector constructs has circumvented the requirement for the HFV Bel-1 trans-activator protein. Consequently, the potential for generating wild-type HFV by recombination between helper and vector constructs during vector production has been eliminated. Here we describe HFV vector production using this Bel-independent system. PMID:9853518

  10. Distinct Immunogenicity and Efficacy of Poxvirus-Based Vaccine Candidates against Ebola Virus Expressing GP and VP40 Proteins.

    PubMed

    Lázaro-Frías, Adrián; Gómez-Medina, Sergio; Sánchez-Sampedro, Lucas; Ljungberg, Karl; Ustav, Mart; Liljeström, Peter; Muñoz-Fontela, César; Esteban, Mariano; García-Arriaza, Juan

    2018-06-01

    Zaire and Sudan ebolavirus species cause a severe disease in humans and nonhuman primates (NHPs) characterized by a high mortality rate. There are no licensed therapies or vaccines against Ebola virus disease (EVD), and the recent 2013 to 2016 outbreak in West Africa highlighted the need for EVD-specific medical countermeasures. Here, we generated and characterized head-to-head the immunogenicity and efficacy of five vaccine candidates against Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV) based on the highly attenuated poxvirus vector modified vaccinia virus Ankara (MVA) expressing either the virus glycoprotein (GP) or GP together with the virus protein 40 (VP40) forming virus-like particles (VLPs). In a human monocytic cell line, the different MVA vectors (termed MVA-EBOVs and MVA-SUDVs) triggered robust innate immune responses, with production of beta interferon (IFN-β), proinflammatory cytokines, and chemokines. Additionally, several innate immune cells, such as dendritic cells, neutrophils, and natural killer cells, were differentially recruited in the peritoneal cavity of mice inoculated with MVA-EBOVs. After immunization of mice with a homologous prime/boost protocol (MVA/MVA), total IgG antibodies against GP or VP40 from Zaire and Sudan ebolavirus were differentially induced by these vectors, which were mainly of the IgG1 and IgG3 isotypes. Remarkably, an MVA-EBOV construct coexpressing GP and VP40 protected chimeric mice challenged with EBOV to a greater extent than a vector expressing GP alone. These results support the consideration of MVA-EBOVs and MVA-SUDVs expressing GP and VP40 and producing VLPs as best-in-class potential vaccine candidates against EBOV and SUDV. IMPORTANCE EBOV and SUDV cause a severe hemorrhagic fever affecting humans and NHPs. Since their discovery in 1976, they have caused several sporadic epidemics, with the recent outbreak in West Africa from 2013 to 2016 being the largest and most severe, with more than 11,000 deaths being reported. Although some vaccines are in advanced clinical phases, less expensive, safer, and more effective licensed vaccines are desirable. We generated and characterized head-to-head the immunogenicity and efficacy of five novel vaccines against EBOV and SUDV based on the poxvirus MVA expressing GP or GP and VP40. The expression of GP and VP40 leads to the formation of VLPs. These MVA-EBOV and MVA-SUDV recombinants triggered robust innate and humoral immune responses in mice. Furthermore, MVA-EBOV recombinants expressing GP and VP40 induced high protection against EBOV in a mouse challenge model. Thus, MVA expressing GP and VP40 and producing VLPs is a promising vaccine candidate against EBOV and SUDV. Copyright © 2018 American Society for Microbiology.

  11. Adeno-associated virus vector-mediated transduction in the cat brain.

    PubMed

    Vite, Charles H; Passini, Marco A; Haskins, Mark E; Wolfe, John H

    2003-10-01

    Adeno-associated virus (AAV) vectors are capable of delivering a therapeutic gene to the mouse brain that can result in long-term and widespread protein production. However, the human infant brain is more than 1000 times larger than the mouse brain, which will make the treatment of global neurometabolic disorders in children more difficult. In this study, we evaluated the ability of three AAV serotypes (1,2, and 5) to transduce cells in the cat brain as a model of a large mammalian brain. The human lysosomal enzyme beta-glucuronidase (GUSB) was used as a reporter gene, because it can be distinguished from feline GUSB by heat stability. The vectors were injected into the cerebral cortex, caudate nucleus, thalamus, corona radiata, internal capsule, and centrum semiovale of 8-week-old cats. The brains were evaluated for gene expression using in situ hybridization and enzyme histochemistry 10 weeks after surgery. The AAV2 vector was capable of transducing cells in the gray matter, while the AAV1 vector resulted in greater transduction of the gray matter than AAV2 as well as transduction of the white matter. AAV5 did not result in detectable transduction in the cat brain.

  12. Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

    PubMed

    Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

    2015-01-01

    Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A cross-species bi-clustering approach to identifying conserved co-regulated genes.

    PubMed

    Sun, Jiangwen; Jiang, Zongliang; Tian, Xiuchun; Bi, Jinbo

    2016-06-15

    A growing number of studies have explored the process of pre-implantation embryonic development of multiple mammalian species. However, the conservation and variation among different species in their developmental programming are poorly defined due to the lack of effective computational methods for detecting co-regularized genes that are conserved across species. The most sophisticated method to date for identifying conserved co-regulated genes is a two-step approach. This approach first identifies gene clusters for each species by a cluster analysis of gene expression data, and subsequently computes the overlaps of clusters identified from different species to reveal common subgroups. This approach is ineffective to deal with the noise in the expression data introduced by the complicated procedures in quantifying gene expression. Furthermore, due to the sequential nature of the approach, the gene clusters identified in the first step may have little overlap among different species in the second step, thus difficult to detect conserved co-regulated genes. We propose a cross-species bi-clustering approach which first denoises the gene expression data of each species into a data matrix. The rows of the data matrices of different species represent the same set of genes that are characterized by their expression patterns over the developmental stages of each species as columns. A novel bi-clustering method is then developed to cluster genes into subgroups by a joint sparse rank-one factorization of all the data matrices. This method decomposes a data matrix into a product of a column vector and a row vector where the column vector is a consistent indicator across the matrices (species) to identify the same gene cluster and the row vector specifies for each species the developmental stages that the clustered genes co-regulate. Efficient optimization algorithm has been developed with convergence analysis. This approach was first validated on synthetic data and compared to the two-step method and several recent joint clustering methods. We then applied this approach to two real world datasets of gene expression during the pre-implantation embryonic development of the human and mouse. Co-regulated genes consistent between the human and mouse were identified, offering insights into conserved functions, as well as similarities and differences in genome activation timing between the human and mouse embryos. The R package containing the implementation of the proposed method in C ++ is available at: https://github.com/JavonSun/mvbc.git and also at the R platform https://www.r-project.org/ jinbo@engr.uconn.edu. © The Author 2016. Published by Oxford University Press.

  14. Effects of Human Metapneumovirus and Respiratory Syncytial Virus Antigen Insertion in Two 3′ Proximal Genome Positions of Bovine/Human Parainfluenza Virus Type 3 on Virus Replication and Immunogenicity

    PubMed Central

    Tang, Roderick S.; Schickli, Jeanne H.; MacPhail, Mia; Fernandes, Fiona; Bicha, Leenas; Spaete, Joshua; Fouchier, Ron A. M.; Osterhaus, Albert D. M. E.; Spaete, Richard; Haller, Aurelia A.

    2003-01-01

    A live attenuated bovine parainfluenza virus type 3 (PIV3), harboring the fusion (F) and hemagglutinin-neuraminidase (HN) genes of human PIV3, was used as a virus vector to express surface glycoproteins derived from two human pathogens, human metapneumovirus (hMPV) and respiratory syncytial virus (RSV). RSV and hMPV are both paramyxoviruses that cause respiratory disease in young children, the elderly, and immunocompromised individuals. RSV has been known for decades to cause acute lower respiratory tract infections in young children, which often result in hospitalization, while hMPV has only been recently identified as a novel human respiratory pathogen. In this study, the ability of bovine/human PIV3 to express three different foreign transmembrane surface glycoproteins and to induce a protective immune response was evaluated. The RNA-dependent RNA polymerase of paramyxoviruses binds to a single site at the 3′ end of the viral RNA genome to initiate transcription of viral genes. The genome position of the viral gene determines its level of gene expression. The promoter-proximal gene is transcribed with the highest frequency, and each downstream gene is transcribed less often due to attenuation of transcription at each gene junction. This feature of paramyxoviruses was exploited using the PIV3 vector by inserting the foreign viral genes at the 3′ terminus, at position 1 or 2, of the viral RNA genome. These locations were expected to yield high levels of foreign viral protein expression stimulating a protective immune response. The immunogenicity and protection results obtained with a hamster model showed that bovine/human PIV3 can be employed to generate bivalent PIV3/RSV or PIV3/hMPV vaccine candidates that will be further evaluated for safety and efficacy in primates. PMID:14512532

  15. Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

    PubMed Central

    Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

  16. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines

    PubMed Central

    2011-01-01

    Food-grade Lactic Acid Bacteria (LAB) have been safely consumed for centuries by humans in fermented foods. Thus, they are good candidates to develop novel oral vectors, constituting attractive alternatives to attenuated pathogens, for mucosal delivery strategies. Herein, this review summarizes our research, up until now, on the use of LAB as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Most of our work has been based on the model LAB Lactococcus lactis, for which we have developed efficient genetic tools, including expression signals and host strains, for the heterologous expression of therapeutic proteins such as antigens, cytokines and enzymes. Resulting recombinant lactococci strains have been tested successfully for their prophylactic and therapeutic effects in different animal models: i) against human papillomavirus type 16 (HPV-16)-induced tumors in mice, ii) to partially prevent a bovine β-lactoglobulin (BLG)-allergic reaction in mice and iii) to regulate body weight and food consumption in obese mice. Strikingly, all of these tools have been successfully transposed to the Lactobacillus genus, in recent years, within our laboratory. Notably, anti-oxidative Lactobacillus casei strains were constructed and tested in two chemically-induced colitis models. In parallel, we also developed a strategy based on the use of L. lactis to deliver DNA at the mucosal level, and were able to show that L. lactis is able to modulate the host response through DNA delivery. Today, we consider that all of our consistent data, together with those obtained by other groups, demonstrate and reinforce the interest of using LAB, particularly lactococci and lactobacilli strains, to develop novel therapeutic protein mucosal delivery vectors which should be tested now in human clinical trials. PMID:21995317

  18. Verification of 2A peptide cleavage.

    PubMed

    Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

    2012-02-01

    The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. The easiest and most effective way to assess 2A cleavage is to perform transient transfection of 293T cells (human embryonic kidney cells) followed by western blot analysis, as described in this protocol. 293T cells are easy to grow and can be efficiently transfected with a variety of vectors. Cleavage can be assessed by detection with antibodies against the target proteins or anti-2A serum.

  19. Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes

    PubMed Central

    Kita-Matsuo, Hiroko; Barcova, Maria; Prigozhina, Natalie; Salomonis, Nathan; Wei, Karen; Jacot, Jeffrey G.; Nelson, Brandon; Spiering, Sean; Haverslag, René; Kim, Changsung; Talantova, Maria; Bajpai, Ruchi; Calzolari, Diego; Terskikh, Alexey; McCulloch, Andrew D.; Price, Jeffrey H.; Conklin, Bruce R.; Chen, H. S. Vincent; Mercola, Mark

    2009-01-01

    Background Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes. Methodology/Principal Findings Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK) promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and α-myosin heavy chain (αMHC) promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function. Conclusion/Significance The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications. PMID:19352491

  20. Vector platforms for gene therapy of inherited retinopathies

    PubMed Central

    Trapani, Ivana; Puppo, Agostina; Auricchio, Alberto

    2014-01-01

    Inherited retinopathies (IR) are common untreatable blinding conditions. Most of them are inherited as monogenic disorders, due to mutations in genes expressed in retinal photoreceptors (PR) and in retinal pigment epithelium (RPE). The retina’s compatibility with gene transfer has made transduction of different retinal cell layers in small and large animal models via viral and non-viral vectors possible. The ongoing identification of novel viruses as well as modifications of existing ones based either on rational design or directed evolution have generated vector variants with improved transduction properties. Dozens of promising proofs of concept have been obtained in IR animal models with both viral and non-viral vectors, and some of them have been relayed to clinical trials. To date, recombinant vectors based on the adeno-associated virus (AAV) represent the most promising tool for retinal gene therapy, given their ability to efficiently deliver therapeutic genes to both PR and RPE and their excellent safety and efficacy profiles in humans. However, AAVs’ limited cargo capacity has prevented application of the viral vector to treatments requiring transfer of genes with a coding sequence larger than 5 kb. Vectors with larger capacity, i.e. nanoparticles, adenoviral and lentiviral vectors are being exploited for gene transfer to the retina in animal models and, more recently, in humans. This review focuses on the available platforms for retinal gene therapy to fight inherited blindness, highlights their main strengths and examines the efforts to overcome some of their limitations. PMID:25124745

  1. Reverse Genetics for Newcastle Disease Virus as a Vaccine Vector.

    PubMed

    Kim, Shin-Hee; Samal, Siba K

    2018-02-22

    Newcastle disease virus (NDV) is an economically important pathogen in the poultry industry worldwide. Recovery of infectious NDV from cDNA using reverse genetics has made it possible to manipulate the genome of NDV. This has greatly contributed to our understanding of the molecular biology and pathogenesis of NDV. Furthermore, NDV has modular genome and accommodates insertion of a foreign gene as a transcriptional unit, thus enabling NDV as a vaccine vector against diseases of humans and animals. Avirulent NDV strains (e.g., LaSota and B1) have been commonly used as vaccine vectors. In this protocol, we have described reverse genetics of NDV to be used as a vaccine vector by exemplifying the recovery of NDV vectored avian influenza virus vaccine. Specifically, cloning and recovery of NDV expressing the hemagglutinin protein of highly pathogenic influenza virus were explained. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

  2. Structural Analysis of the Dimerization Domain of the Human Estrogen Receptor and a Peptide Inhibitor of Dimerization

    DTIC Science & Technology

    1998-08-01

    communication). Various hER fragments were expressed in Esherichia coli (E. coli ) as glutathione-S-transferace (GST) fusion proteins, separated by...Using an E. coli expression vector, we successfully overexpressed hER[253-341] as a fusion protein with an N-terminal poly-histidine tag (Figure 1A...of hER fused to GST were expressed in E. coli , and they were then separated on SDS PAGE, and then transferred to a blotting membrane. The membrane was

  3. Non-transmissible Sendai virus vector encoding c-myc suppressor FBP-interacting repressor for cancer therapy

    PubMed Central

    Matsushita, Kazuyuki; Shimada, Hideaki; Ueda, Yasuji; Inoue, Makoto; Hasegawa, Mamoru; Tomonaga, Takeshi; Matsubara, Hisahiro; Nomura, Fumio

    2014-01-01

    AIM: To investigate a novel therapeutic strategy to target and suppress c-myc in human cancers using far up stream element (FUSE)-binding protein-interacting repressor (FIR). METHODS: Endogenous c-Myc suppression and apoptosis induction by a transient FIR-expressing vector was examined in vivo via a HA-tagged FIR (HA-FIR) expression vector. A fusion gene-deficient, non-transmissible, Sendai virus (SeV) vector encoding FIR cDNA, SeV/dF/FIR, was prepared. SeV/dF/FIR was examined for its gene transduction efficiency, viral dose dependency of antitumor effect and apoptosis induction in HeLa (cervical squamous cell carcinoma) cells and SW480 (colon adenocarcinoma) cells. Antitumor efficacy in a mouse xenograft model was also examined. The molecular mechanism of the anti-tumor effect and c-Myc suppression by SeV/dF/FIR was examined using Spliceostatin A (SSA), a SAP155 inhibitor, or SAP155 siRNA which induce c-Myc by increasing FIR∆exon2 in HeLa cells. RESULTS: FIR was found to repress c-myc transcription and in turn the overexpression of FIR drove apoptosis through c-myc suppression. Thus, FIR expressing vectors are potentially applicable for cancer therapy. FIR is alternatively spliced by SAP155 in cancer cells lacking the transcriptional repression domain within exon 2 (FIR∆exon2), counteracting FIR for c-Myc protein expression. Furthermore, FIR forms a complex with SAP155 and inhibits mutual well-established functions. Thus, both the valuable effects and side effects of exogenous FIR stimuli should be tested for future clinical application. SeV/dF/FIR, a cytoplasmic RNA virus, was successfully prepared and showed highly efficient gene transduction in in vivo experiments. Furthermore, in nude mouse tumor xenograft models, SeV/dF/FIR displayed high antitumor efficiency against human cancer cells. SeV/dF/FIR suppressed SSA-activated c-Myc. SAP155 siRNA, potentially produces FIR∆exon2, and led to c-Myc overexpression with phosphorylation at Ser62. HA-FIR suppressed endogenous c-Myc expression and induced apoptosis in HeLa and SW480 cells. A c-myc transcriptional suppressor FIR expressing SeV/dF/FIR showed high gene transduction efficiency with significant antitumor effects and apoptosis induction in HeLa and SW480 cells. CONCLUSION: SeV/dF/FIR showed strong tumor growth suppression with no significant side effects in an animal xenograft model, thus SeV/dF/FIR is potentially applicable for future clinical cancer treatment. PMID:24764668

  4. A Facile Method to Establish Human Induced Pluripotent Stem Cells From Adult Blood Cells Under Feeder-Free and Xeno-Free Culture Conditions: A Clinically Compliant Approach

    PubMed Central

    Chou, Bin-Kuan; Gu, Haihui; Gao, Yongxing; Dowey, Sarah N.; Wang, Ying; Shi, Jun; Li, Yanxin; Ye, Zhaohui; Cheng, Tao

    2015-01-01

    Reprogramming human adult blood mononuclear cells (MNCs) cells by transient plasmid expression is becoming increasingly popular as an attractive method for generating induced pluripotent stem (iPS) cells without the genomic alteration caused by genome-inserting vectors. However, its efficiency is relatively low with adult MNCs compared with cord blood MNCs and other fetal cells and is highly variable among different adult individuals. We report highly efficient iPS cell derivation under clinically compliant conditions via three major improvements. First, we revised a combination of three EBNA1/OriP episomal vectors expressing five transgenes, which increased reprogramming efficiency by ≥10–50-fold from our previous vectors. Second, human recombinant vitronectin proteins were used as cell culture substrates, alleviating the need for feeder cells or animal-sourced proteins. Finally, we eliminated the previously critical step of manually picking individual iPS cell clones by pooling newly emerged iPS cell colonies. Pooled cultures were then purified based on the presence of the TRA-1-60 pluripotency surface antigen, resulting in the ability to rapidly expand iPS cells for subsequent applications. These new improvements permit a consistent and reliable method to generate human iPS cells with minimal clonal variations from blood MNCs, including previously difficult samples such as those from patients with paroxysmal nocturnal hemoglobinuria. In addition, this method of efficiently generating iPS cells under feeder-free and xeno-free conditions allows for the establishment of clinically compliant iPS cell lines for future therapeutic applications. PMID:25742692

  5. A paramyxovirus-vectored intranasal vaccine against Ebola virus is immunogenic in vector-immune animals.

    PubMed

    Yang, Lijuan; Sanchez, Anthony; Ward, Jerrold M; Murphy, Brian R; Collins, Peter L; Bukreyev, Alexander

    2008-08-01

    Ebola virus (EBOV) causes outbreaks of a highly lethal hemorrhagic fever in humans. The virus can be transmitted by direct contact as well as by aerosol and is considered a potential bioweapon. Because direct immunization of the respiratory tract should be particularly effective against infection of mucosal surfaces, we previously developed an intranasal vaccine based on replication-competent human parainfluenza virus type 3 (HPIV3) expressing EBOV glycoprotein GP (HPIV3/EboGP) and showed that it is immunogenic and protective against a high dose parenteral EBOV challenge. However, because the adult human population has considerable immunity to HPIV3, which is a common human pathogen, replication and immunogenicity of the vaccine in this population might be greatly restricted. Indeed, in the present study, replication of the vaccine in the respiratory tract of HPIV3-immune guinea pigs was found to be restricted to undetectable levels. This restriction appeared to be based on both neutralizing antibodies and cellular or other components of the immunity to HPIV3. Surprisingly, even though replication of HPIV3/EboGP was highly restricted in HPIV3-immune animals, it induced a high level of EBOV-specific antibodies that nearly equaled that obtained in HPIV3-naive animals. We also show that the previously demonstrated presence of functional GP in the vector particle was not associated with increased replication in the respiratory tract nor with spread beyond the respiratory tract of HPIV3-naive guinea pigs, indicating that expression and functional incorporation of the attachment/penetration glycoprotein of this systemic virus did not mediate a change in tissue tropism.

  6. Single-dose live-attenuated Nipah virus vaccines confer complete protection by eliciting antibodies directed against surface glycoproteins

    PubMed Central

    DeBuysscher, Blair L.; Scott, Dana; Marzi, Andrea; Prescott, Joseph; Feldmann, Heinz

    2016-01-01

    Background Nipah virus (NiV), a zoonotic pathogen causing severe respiratory illness and encephalitis in humans, emerged in Malaysia in 1998 with subsequent outbreaks on an almost annual basis since 2001 in parts of the Indian subcontinent. The high case fatality rate, human-to-human transmission, wide-ranging reservoir distribution and lack of licensed intervention options are making NiV a serious regional and potential global public health problem. The objective of this study was to develop a fast-acting, single-dose NiV vaccine that could be implemented in a ring vaccination approach during outbreaks. Methods In this study we have designed new live-attenuated vaccine vectors based on recombinant vesicular stomatitis viruses (rVSV) expressing NiV glycoproteins (G or F) or nucleoprotein (N) and evaluated their protective efficacy in Syrian hamsters, an established NiV animal disease model. We further characterized the humoral immune response to vaccination in hamsters using ELISA and neutralization assays and performed serum transfer studies. Results Vaccination of Syrian hamsters with a single dose of the rVSV vaccine vectors resulted in strong humoral immune responses with neutralizing activities found only in those animals vaccinated with rVSV expressing NiV G or F proteins. Vaccinated animals with neutralizing antibody responses were completely protected from lethal NiV disease, whereas animals vaccinated with rVSV expressing NiV N showed only partial protection. Protection of NiV G or F vaccinated animals was conferred by antibodies, most likely the neutralizing fraction, as demonstrated by serum transfer studies. Protection of N-vaccinated hamsters was not antibody-dependent indicating a role of adaptive cellular responses for protection. Conclusions The rVSV vectors expressing Nipah virus G or F are prime candidates for new ‘emergency vaccines’ to be utilized for NiV outbreak management. PMID:24631094

  7. Single-dose live-attenuated Nipah virus vaccines confer complete protection by eliciting antibodies directed against surface glycoproteins.

    PubMed

    DeBuysscher, Blair L; Scott, Dana; Marzi, Andrea; Prescott, Joseph; Feldmann, Heinz

    2014-05-07

    Nipah virus (NiV), a zoonotic pathogen causing severe respiratory illness and encephalitis in humans, emerged in Malaysia in 1998 with subsequent outbreaks on an almost annual basis since 2001 in parts of the Indian subcontinent. The high case fatality rate, human-to-human transmission, wide-ranging reservoir distribution and lack of licensed intervention options are making NiV a serious regional and potential global public health problem. The objective of this study was to develop a fast-acting, single-dose NiV vaccine that could be implemented in a ring vaccination approach during outbreaks. In this study we have designed new live-attenuated vaccine vectors based on recombinant vesicular stomatitis viruses (rVSV) expressing NiV glycoproteins (G or F) or nucleoprotein (N) and evaluated their protective efficacy in Syrian hamsters, an established NiV animal disease model. We further characterized the humoral immune response to vaccination in hamsters using ELISA and neutralization assays and performed serum transfer studies. Vaccination of Syrian hamsters with a single dose of the rVSV vaccine vectors resulted in strong humoral immune responses with neutralizing activities found only in those animals vaccinated with rVSV expressing NiV G or F proteins. Vaccinated animals with neutralizing antibody responses were completely protected from lethal NiV disease, whereas animals vaccinated with rVSV expressing NiV N showed only partial protection. Protection of NiV G or F vaccinated animals was conferred by antibodies, most likely the neutralizing fraction, as demonstrated by serum transfer studies. Protection of N-vaccinated hamsters was not antibody-dependent indicating a role of adaptive cellular responses for protection. The rVSV vectors expressing Nipah virus G or F are prime candidates for new 'emergency vaccines' to be utilized for NiV outbreak management. Published by Elsevier Ltd.

  8. Single-Dose Intracardiac Injection of Pro-Regenerative MicroRNAs Improves Cardiac Function After Myocardial Infarction.

    PubMed

    Lesizza, Pierluigi; Prosdocimo, Giulia; Martinelli, Valentina; Sinagra, Gianfranco; Zacchigna, Serena; Giacca, Mauro

    2017-04-14

    Recent evidence indicates that a few human microRNAs (miRNAs), in particular hsa-miR-199a-3p and hsa-miR-590-3p, stimulate proliferation of cardiomyocytes and, once expressed in the mouse heart using viral vectors, induce cardiac regeneration after myocardial infarction. Viral vectors, however, are not devoid of safety issues and, more notably, drive expression of the encoded miRNAs for indefinite periods of time, which might not be desirable in light of human therapeutic application. As an alternative to the use of viral vectors, we wanted to assess the efficacy of synthetic miRNA mimics in inducing myocardial repair after single intracardiac injection using synthetic lipid formulations. We comparatively analyzed the efficacy of different lipid formulations in delivering hsa-miR-199a-3p and hsa-miR-590-3p both in primary neonatal mouse cardiomyocytes and in vivo. We established a transfection protocol allowing persistence of these 2 mimics for at least 12 days after a single intracardiac injection, with minimal dispersion to other organs and long-term preservation of miRNA functional activity, as assessed by monitoring the expression of 2 mRNA targets. Administration of this synthetic formulation immediately after myocardial infarction in mice resulted in marked reduction of infarct size and persistent recovery of cardiac function. A single administration of synthetic miRNA-lipid formulations is sufficient to stimulate cardiac repair and restoration of cardiac function. © 2017 American Heart Association, Inc.

  9. Expression cloning of human B cell immunoglobulins.

    PubMed

    Wardemann, Hedda; Kofer, Juliane

    2013-01-01

    The majority of lymphomas originate from B cells at the germinal center stage or beyond. Preferential selection of B cell clones by a limited set of antigens has been suggested to drive lymphoma development. However, little is known about the specificity of the antibodies expressed by lymphoma cells, and the role of antibody-specificity in lymphomagenesis remains elusive. Here, we describe a strategy to characterize the antibody reactivity of human B cells. The approach allows the unbiased characterization of the human antibody repertoire on a single cell level through the generation of recombinant monoclonal antibodies from single primary human B cells of defined origin. This protocol offers a detailed description of the method starting from the flow cytometric isolation of single human B cells, to the RT-PCR-based amplification of the expressed Igh, Igκ, and Igλ chain genes, and Ig gene expression vector cloning for the in vitro production of monoclonal antibodies. The strategy may be used to obtain information on the clonal evolution of B cell lymphomas by single cell Ig gene sequencing and on the antibody reactivity of human lymphoma B cells.

  10. Focal expression of mutated tau in entorhinal cortex neurons of rats impairs spatial working memory.

    PubMed

    Ramirez, Julio J; Poulton, Winona E; Knelson, Erik; Barton, Cole; King, Michael A; Klein, Ronald L

    2011-01-01

    Entorhinal cortex neuropathology begins very early in Alzheimer's disease (AD), a disorder characterized by severe memory disruption. Indeed, loss of entorhinal volume is predictive of AD and two of the hallmark neuroanatomical markers of AD, amyloid plaques and neurofibrillary tangles (NFTs), are particularly prevalent in the entorhinal area of AD-afflicted brains. Gene transfer techniques were used to create a model neurofibrillary tauopathy by injecting a recombinant adeno-associated viral vector with a mutated human tau gene (P301L) into the entorhinal cortex of adult rats. The objective of the present investigation was to determine whether adult onset, spatially restricted tauopathy could be sufficient to reproduce progressive deficits in mnemonic function. Spatial memory on a Y-maze was tested for approximately 3 months post-surgery. Upon completion of behavioral testing the brains were assessed for expression of human tau and evidence of tauopathy. Rats injected with the tau vector became persistently impaired on the task after about 6 weeks of postoperative testing, whereas the control rats injected with a green fluorescent protein vector performed at criterion levels during that period. Histological analysis confirmed the presence of hyperphosphorylated tau and NFTs in the entorhinal cortex and neighboring retrohippocampal areas as well as limited synaptic degeneration of the perforant path. Thus, highly restricted vector-induced tauopathy in retrohippocampal areas is sufficient for producing progressive impairment in mnemonic ability in rats, successfully mimicking a key aspect of tauopathies such as AD. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. AAV-mediated RLBP1 gene therapy improves the rate of dark adaptation in Rlbp1 knockout mice

    PubMed Central

    Choi, Vivian W; Bigelow, Chad E; McGee, Terri L; Gujar, Akshata N; Li, Hui; Hanks, Shawn M; Vrouvlianis, Joanna; Maker, Michael; Leehy, Barrett; Zhang, Yiqin; Aranda, Jorge; Bounoutas, George; Demirs, John T; Yang, Junzheng; Ornberg, Richard; Wang, Yu; Martin, Wendy; Stout, Kelly R; Argentieri, Gregory; Grosenstein, Paul; Diaz, Danielle; Turner, Oliver; Jaffee, Bruce D; Police, Seshidhar R; Dryja, Thaddeus P

    2015-01-01

    Recessive mutations in RLBP1 cause a form of retinitis pigmentosa in which the retina, before its degeneration leads to blindness, abnormally slowly recovers sensitivity after exposure to light. To develop a potential gene therapy for this condition, we tested multiple recombinant adeno-associated vectors (rAAVs) composed of different promoters, capsid serotypes, and genome conformations. We generated rAAVs in which sequences from the promoters of the human RLBP1, RPE65, or BEST1 genes drove the expression of a reporter gene (green fluorescent protein). A promoter derived from the RLBP1 gene mediated expression in the retinal pigment epithelium and Müller cells (the intended target cell types) at qualitatively higher levels than in other retinal cell types in wild-type mice and monkeys. With this promoter upstream of the coding sequence of the human RLBP1 gene, we compared the potencies of vectors with an AAV2 versus an AAV8 capsid in transducing mouse retinas, and we compared vectors with a self-complementary versus a single-stranded genome. The optimal vector (scAAV8-pRLBP1-hRLBP1) had serotype 8 capsid and a self-complementary genome. Subretinal injection of scAAV8-pRLBP1-hRLBP1 in Rlbp1 nullizygous mice improved the rate of dark adaptation based on scotopic (rod-plus-cone) and photopic (cone) electroretinograms (ERGs). The effect was still present after 1 year. PMID:26199951

  12. Nucleotide Sequence of the Hantaan Virus S RNA Segment and Expression of Encoded Proteins

    DTIC Science & Technology

    1987-11-03

    human vaccinia vaccination ). A second dose of virus was given in the same ...vaccinia vector. A necessary first step in vaccine investigation woul d be to determine if animals infected with the two HTV recombinant viruses can ...vaccinia virus (Buller et al., 1985). Mice were infected by tail scarification since it is identical to the method used to vaccinate 169 humans

  13. Wide Awake and Ready to Move: 20 Years of Non-Viral Therapeutic Genome Engineering with the Sleeping Beauty Transposon System.

    PubMed

    Hodge, Russ; Narayanavari, Suneel A; Izsvák, Zsuzsanna; Ivics, Zoltán

    2017-10-01

    Gene therapies will only become a widespread tool in the clinical treatment of human diseases with the advent of gene transfer vectors that integrate genetic information stably, safely, effectively, and economically. Two decades after the discovery of the Sleeping Beauty (SB) transposon, it has been transformed into a vector system that is fulfilling these requirements. SB may well overcome some of the limitations associated with viral gene transfer vectors and transient non-viral gene delivery approaches that are being used in the majority of ongoing clinical trials. The SB system has achieved a high level of stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, representing crucial steps that may permit its clinical use in the near future. This article reviews the most important aspects of SB as a tool for gene therapy, including aspects of its vectorization and genomic integration. As an illustration, the clinical development of the SB system toward gene therapy of age-related macular degeneration and cancer immunotherapy is highlighted.

  14. Feeder-free reprogramming of human fibroblasts with messenger RNA.

    PubMed

    Warren, Luigi; Wang, Jiwu

    2013-11-13

    This unit describes a feeder-free protocol for deriving induced pluripotent stem cells (iPSCs) from human fibroblasts by transfection of synthetic mRNA. The reprogramming of somatic cells requires transient expression of a set of transcription factors that collectively activate an endogenous gene regulatory network specifying the pluripotent phenotype. The necessary ectopic factor expression was first effected using retroviruses; however, as viral integration into the genome is problematic for cell therapy applications, the use of footprint-free vectors such as mRNA is increasingly preferred. Strong points of the mRNA approach include high efficiency, rapid kinetics, and obviation of a clean-up phase to purge the vector. Still, the method is relatively laborious and has, up to now, involved the use of feeder cells, which brings drawbacks including poor applicability to clinically oriented iPSC derivation. Using the methods described here, mRNA reprogramming can be performed without feeders at much-reduced labor and material costs relative to established protocols. Copyright © 2013 John Wiley & Sons, Inc.

  15. Recombinant soluble adenovirus receptor

    DOEpatents

    Freimuth, Paul I.

    2002-01-01

    Disclosed are isolated polypeptides from human CAR (coxsackievirus and adenovirus receptor) protein which bind adenovirus. Specifically disclosed are amino acid sequences which corresponds to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2. In other aspects, the disclosure relates to nucleic acid sequences encoding these domains as well as expression vectors which encode the domains and bacterial cells containing such vectors. Also disclosed is an isolated fusion protein comprised of the D1 polypeptide sequence fused to a polypeptide sequence which facilitates folding of D1 into a functional, soluble domain when expressed in bacteria. The functional D1 domain finds application for example in a therapeutic method for treating a patient infected with a virus which binds to D1, and also in a method for identifying an antiviral compound which interferes with viral attachment. Also included is a method for specifically targeting a cell for infection by a virus which binds to D1.

  16. Zinc finger protein designed to target 2-long terminal repeat junctions interferes with human immunodeficiency virus integration.

    PubMed

    Sakkhachornphop, Supachai; Barbas, Carlos F; Keawvichit, Rassamee; Wongworapat, Kanlaya; Tayapiwatana, Chatchai

    2012-09-01

    Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine-adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future.

  17. Engineering HSV-1 vectors for gene therapy.

    PubMed

    Goins, William F; Huang, Shaohua; Cohen, Justus B; Glorioso, Joseph C

    2014-01-01

    Virus vectors have been employed as gene transfer vehicles for various preclinical and clinical gene therapy applications, and with the approval of Glybera (alipogene tiparvovec) as the first gene therapy product as a standard medical treatment (Yla-Herttuala, Mol Ther 20: 1831-1832, 2013), gene therapy has reached the status of being a part of standard patient care. Replication-competent herpes simplex virus (HSV) vectors that replicate specifically in actively dividing tumor cells have been used in Phase I-III human trials in patients with glioblastoma multiforme, a fatal form of brain cancer, and in malignant melanoma. In fact, T-VEC (talimogene laherparepvec, formerly known as OncoVex GM-CSF) displayed efficacy in a recent Phase III trial when compared to standard GM-CSF treatment alone (Andtbacka et al. J Clin Oncol 31: sLBA9008, 2013) and may soon become the second FDA-approved gene therapy product used in standard patient care. In addition to the replication-competent oncolytic HSV vectors like T-VEC, replication-defective HSV vectors have been employed in Phase I-II human trials and have been explored as delivery vehicles for disorders such as pain, neuropathy, and other neurodegenerative conditions. Research during the last decade on the development of HSV vectors has resulted in the engineering of recombinant vectors that are totally replication defective, nontoxic, and capable of long-term transgene expression in neurons. This chapter describes methods for the construction of recombinant genomic HSV vectors based on the HSV-1 replication-defective vector backbones, steps in their purification, and their small-scale production for use in cell culture experiments as well as preclinical animal studies.

  18. CPT1{alpha} over-expression increases long-chain fatty acid oxidation and reduces cell viability with incremental palmitic acid concentration in 293T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jambor de Sousa, Ulrike L.; Koss, Michael D.; Fillies, Marion

    2005-12-16

    To test the cellular response to an increased fatty acid oxidation, we generated a vector for an inducible expression of the rate-limiting enzyme carnitine palmitoyl-transferase 1{alpha} (CPT1{alpha}). Human embryonic 293T kidney cells were transiently transfected and expression of the CPT1{alpha} transgene in the tet-on vector was activated with doxycycline. Fatty acid oxidation was measured by determining the conversion of supplemented, synthetic cis-10-heptadecenoic acid (C17:1n-7) to C15:ln-7. CPT1{alpha} over-expression increased mitochondrial long-chain fatty acid oxidation about 6-fold. Addition of palmitic acid (PA) decreased viability of CPT1{alpha} over-expressing cells in a concentration-dependent manner. Both, PA and CPT1{alpha} over-expression increased cell death. Interestingly,more » PA reduced total cell number only in cells over-expressing CPT1{alpha}, suggesting an effect on cell proliferation that requires PA translocation across the mitochondrial inner membrane. This inducible expression system should be well suited to study the roles of CPT1 and fatty acid oxidation in lipotoxicity and metabolism in vivo.« less

  19. Regulated Apoptosis of Genetically-Modified Hematopoietic Stem and Progenitor Cells via an Inducible Caspase-9 Suicide Gene in Rhesus Macaques

    PubMed Central

    Barese, Cecilia N.; Felizardo, Tania C.; Sellers, Stephanie E.; Keyvanfar, Keyvan; Di Stasi, Antonio; Metzger, Mark E.; Krouse, Allen E.; Donahue, Robert E.; Spencer, David M.; Dunbar, Cynthia E.

    2014-01-01

    The high risk of insertional oncogenesis reported in clinical trials utilizing integrating retroviral vectors to genetically-modify hematopoietic stem and progenitor cells (HSPC) requires the development of safety strategies to minimize risks associated with novel cell and gene therapies. The ability to ablate genetically modified cells in vivo is desirable, should an abnormal clone emerge. Inclusion of “suicide genes” in vectors to facilitate targeted ablation of vector-containing abnormal clones in vivo is one potential safety approach. We tested whether the inclusion of the “inducible Caspase-9” (iCasp9) suicide gene in a gamma-retroviral vector facilitated efficient elimination of vector-containing HSPCs and their hematopoietic progeny in vivo long-term, in an autologous non-human primate transplantation model. Following stable engraftment of iCasp9 expressing hematopoietic cells in rhesus macaques, administration of AP1903, a chemical inducer of dimerization able to activate iCasp9, specifically eliminated vector-containing cells in all hematopoietic lineages long-term, suggesting activity at the HSPC level. Between 75–94% of vector-containing cells were eliminated by well-tolerated AP1903 dosing, but lack of complete ablation was linked to lower iCasp9 expression in residual cells. Further investigation of resistance mechanisms demonstrated upregulation of Bcl-2 in hematopoietic cell lines transduced with the vector and resistant to AP1903 ablation. These results demonstrate both the potential and the limitations of safety approaches utilizing iCasp9 to HSPC-targeted gene therapy settings, in a model with great relevance to clinical development. PMID:25330775

  20. The reference transcriptome of the adult female biting midge (Culicoides sonorensis) and differential gene expression profiling during teneral, blood, and sucrose feeding conditions.

    PubMed

    Nayduch, Dana; Lee, Matthew B; Saski, Christopher A

    2014-01-01

    Unlike other important vectors such as mosquitoes and sandflies, genetic and genomic tools for Culicoides biting midges are lacking, despite the fact that they vector a large number of arboviruses and other pathogens impacting humans and domestic animals world-wide. In North America, female Culicoides sonorensis midges are important vectors of bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV), orbiviruses that cause significant disease in livestock and wildlife. Libraries of tissue-specific transcripts expressed in response to feeding and oral orbivirus challenge in C. sonorensis have previously been reported, but extensive genome-wide expression profiling in the midge has not. Here, we successfully used deep sequencing technologies to construct the first adult female C. sonorensis reference transcriptome, and utilized genome-wide expression profiling to elucidate the genetic response to blood and sucrose feeding over time. The adult female midge unigene consists of 19,041 genes, of which less than 7% are differentially expressed during the course of a sucrose meal, while up to 52% of the genes respond significantly in blood-fed midges, indicating hematophagy induces complex physiological processes. Many genes that were differentially expressed during blood feeding were associated with digestion (e.g. proteases, lipases), hematophagy (e.g., salivary proteins), and vitellogenesis, revealing many major metabolic and biological factors underlying these critical processes. Additionally, key genes in the vitellogenesis pathway were identified, which provides the first glimpse into the molecular basis of anautogeny for C. sonorensis. This is the first extensive transcriptome for this genus, which will serve as a framework for future expression studies, RNAi, and provide a rich dataset contributing to the ultimate goal of informing a reference genome assembly and annotation. Moreover, this study will serve as a foundation for subsequent studies of genome-wide expression analyses during early orbivirus infection and dissecting the molecular mechanisms behind vector competence in midges.

  1. A 3,387 bp 5'-flanking sequence of the goat alpha-S1-casein gene provides correct tissue-specific expression of human granulocyte colony-stimulating factor (hG-CSF) in the mammary gland of transgenic mice.

    PubMed

    Serova, Irina A; Dvoryanchikov, Gennady A; Andreeva, Ludmila E; Burkov, Ivan A; Dias, Luciene P B; Battulin, Nariman R; Smirnov, Alexander V; Serov, Oleg L

    2012-06-01

    A new expression vector containing the 1,944 bp 5'-flanking regulatory region together with exon 1 and intron 1 of the goat alpha-S1-casein gene (CSN1S1), the full-sized human granulocyte colony-stimulating factor gene (hGCSF) and the 3'-flanking sequence of the bovine CSN1S1, was created. The vector DNA was used for generation of four mouse transgenic lines. The transgene was integrated into chromosomes 8 and 12 of two founders as 2 and 5 copies, respectively. Tissue-specific secretion of hG-CSF into the milk of transgenic mice was in the range of 19-40 μg/ml. RT-PCR analysis of various tissues of the transgenic mice demonstrated that expression of hGCSF was detected in only the mammary gland in the progeny of all founders. Moreover, cells were shown to be positive for hG-CSF by immunofluorescent analysis in the mammary glands but not in any other tissues. There were no signs of mosaic expression in the mammary gland. Trace amounts of hG-CSF were detected in the serum of females of two transgenic lines during lactation only. However, no transgenic mice showed any changes in hematopoiesis based on the number of granulocytes in blood. Immunoblotting of hG-CSF in the milk of transgenic mice revealed two forms, presumably the glycosylated and non-glycosylated forms. The hematopoietic activity of hG-CSF in the milk of transgenic females is comparable to that of recombinant G-CSF. In general, the data obtained in this study show that the new expression vector is able to provide correct tissue-specific expression of hG-CSF with high biological activity in transgenic mice.

  2. Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

    PubMed

    Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

    2013-11-01

    We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

  3. Efficient production of human acidic fibroblast growth factor in pea (Pisum sativum L.) plants by agroinfection of germinated seeds

    PubMed Central

    2011-01-01

    Background For efficient and large scale production of recombinant proteins in plants transient expression by agroinfection has a number of advantages over stable transformation. Simple manipulation, rapid analysis and high expression efficiency are possible. In pea, Pisum sativum, a Virus Induced Gene Silencing System using the pea early browning virus has been converted into an efficient agroinfection system by converting the two RNA genomes of the virus into binary expression vectors for Agrobacterium transformation. Results By vacuum infiltration (0.08 Mpa, 1 min) of germinating pea seeds with 2-3 cm roots with Agrobacteria carrying the binary vectors, expression of the gene for Green Fluorescent Protein as marker and the gene for the human acidic fibroblast growth factor (aFGF) was obtained in 80% of the infiltrated developing seedlings. Maximal production of the recombinant proteins was achieved 12-15 days after infiltration. Conclusions Compared to the leaf injection method vacuum infiltration of germinated seeds is highly efficient allowing large scale production of plants transiently expressing recombinant proteins. The production cycle of plants for harvesting the recombinant protein was shortened from 30 days for leaf injection to 15 days by applying vacuum infiltration. The synthesized aFGF was purified by heparin-affinity chromatography and its mitogenic activity on NIH 3T3 cells confirmed to be similar to a commercial product. PMID:21548923

  4. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.

    PubMed

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation.

  5. Heterologous Prime-Boost Regimens with a Recombinant Chimpanzee Adenoviral Vector and Adjuvanted F4 Protein Elicit Polyfunctional HIV-1-Specific T-Cell Responses in Macaques

    PubMed Central

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation. PMID:25856308

  6. An Overview of Trypanosoma brucei Infections: An Intense Host-Parasite Interaction.

    PubMed

    Ponte-Sucre, Alicia

    2016-01-01

    Trypanosoma brucei rhodesiense and T. brucei gambiense , the causative agents of Human African Trypanosomiasis, are transmitted by tsetse flies. Within the vector, the parasite undergoes through transformations that prepares it to infect the human host. Sequentially these developmental stages are the replicative procyclic (in which the parasite surface is covered by procyclins) and trypo-epimastigote forms, as well as the non-replicative, infective, metacyclic form that develops in the vector salivary glands. As a pre-adaptation to their life in humans, metacyclic parasites begin to express and be densely covered by the Variant Surface Glycoprotein (VSG). Once the metacyclic form invades the human host the parasite develops into the bloodstream form. Herein the VSG triggers a humoral immune response. To avoid this humoral response, and essential for survival while in the bloodstream, the parasite changes its cover periodically and sheds into the surroundings the expressed VSG, thus evading the consequences of the immune system activation. Additionally, tools comparable to quorum sensing are used by the parasite for the successful parasite transmission from human to insect. On the other hand, the human host promotes clearance of the parasite triggering innate and adaptive immune responses and stimulating cytokine and chemokine secretion. All in all, the host-parasite interaction is extremely active and leads to responses that need multiple control sites to develop appropriately.

  7. The yellow fever 17D virus as a platform for new live attenuated vaccines.

    PubMed

    Bonaldo, Myrna C; Sequeira, Patrícia C; Galler, Ricardo

    2014-01-01

    The live-attenuated yellow fever 17D virus is one of the most outstanding human vaccines ever developed. It induces efficacious immune responses at a low production cost with a well-established manufacture process. These advantages make the YF17D virus attractive as a vector for the development of new vaccines. At the beginning of vector development studies, YF17D was genetically manipulated to express other flavivirus prM and E proteins, components of the viral envelope. While these 17D recombinants are based on the substitution of equivalent YF17D genes, other antigens from unrelated pathogens have also been successfully expressed and delivered by recombinant YF17D viruses employing alternative strategies for genetic manipulation of the YF17D genome. Herein, we discuss these strategies in terms of possibilities of single epitope or larger sequence expression and the main properties of these replication-competent viral platforms.

  8. The yellow fever 17D virus as a platform for new live attenuated vaccines

    PubMed Central

    Bonaldo, Myrna C; Sequeira, Patrícia C; Galler, Ricardo

    2014-01-01

    The live-attenuated yellow fever 17D virus is one of the most outstanding human vaccines ever developed. It induces efficacious immune responses at a low production cost with a well-established manufacture process. These advantages make the YF17D virus attractive as a vector for the development of new vaccines. At the beginning of vector development studies, YF17D was genetically manipulated to express other flavivirus prM and E proteins, components of the viral envelope. While these 17D recombinants are based on the substitution of equivalent YF17D genes, other antigens from unrelated pathogens have also been successfully expressed and delivered by recombinant YF17D viruses employing alternative strategies for genetic manipulation of the YF17D genome. Herein, we discuss these strategies in terms of possibilities of single epitope or larger sequence expression and the main properties of these replication-competent viral platforms. PMID:24553128

  9. [Effect of EMP-1 gene on human esophageal cancer cell line].

    PubMed

    Wang, Hai-tao; Liu, Zhi-hua; Wang, Xiu-qin; Wu, Min

    2002-03-01

    EMP-1 was selected from a series of differential expressed genes obtained from cDNA microarray in the authors' lab. Epithelial membrane pnteiu-1 gene (EMP-1) was expressed 6 fold lower in esophageal cancer than in normal tissue. The authors further designed the experiment to study the effect of human EMP-1 gene on human esophageal cancer cell line in order to explain the function of this gene on the carcinogensis and progression esophageal cancer. EMP-1 gene was cloned into eukaryotic vector and transfected into the human esophageal cancer cell line. The transfection effect was qualified by Western blot and RT-PCR method. The cell growth curve was observed and the cell cycle was checked by FACS method. EMP-1 was transfected into EC9706 cell line and its expression was up-regulated. The cell growth is accelerated and expression of EMP-1 is linked to induction of S phase arrest. EMP-1 gene has some relationship with carcinogenesis of esophagus.

  10. Retrovirus-mediated transfer of a hygromycin phosphotransferase-thymidine kinase fusion gene into human CD34+ bone marrow cells.

    PubMed

    Akatsuka, Y; Emi, N; Kato, H; Abe, A; Tanimoto, M; Lupton, S D; Saito, H

    1994-12-01

    Retrovirus-mediated gene transfer into human hematopoietic stem cells has been proposed as a means of therapy for various inherited diseases and as a method of gene marking. The transduction efficiency of an amphotropic retroviral vector (PA317/HyTK) containing a hygromycin phosphotransferase-thymidine kinase fusion gene was examined with human CD34+ bone marrow cells in the presence of interleukin-3 (IL-3), interleukin-6 (IL-6), and stem cell factor. Transduction efficiencies determined from the ability of transduced granulocyte-macrophage colony forming units (CFU-GM) to grow in hygromycin B and from polymerase chain reaction analysis of individual transduced CFU-GM growing in the presence of hygromycin B were 0.3-3.0% (mean +/- S.D., 1.1 +/- 0.9%) and 0.1-1.2% (mean +/- S.D., 0.5 +/- 0.4%), respectively. Ganciclovir at a dose of approximately 1 microM reduced the number of CFU-GM derived from vector-infected CD34+ cells by 50%. These findings demonstrate that human hematopoietic stem cells infected with this retroviral vector are susceptible to ganciclovir, offering the potential to control transduced gene expression in vivo.

  11. Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

    PubMed

    Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

    2017-06-05

    Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

  12. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    PubMed

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  13. Immune responses in pigs induced by recombinant canine adenovirus 2 expressing the glycoprotein 5 of porcine reproductive and respiratory syndrome virus.

    PubMed

    Zhou, J-X; Xue, J-D; Yu, T; Zhang, J-B; Liu, Y; Jiang, N; Li, Y-L; Hu, R-L

    2010-04-01

    To develop a new type vaccine for porcine reproductive and respiratory syndrome (PRRS) prevention by using canine adenovirus 2(CAV-2) as vector, the Glycoprotein 5(GP5) gene from PRRSV strain JL was amplified by RT-PCR, and the expression cassette of GP5 was constructed using the human cytomegalovirus (HCMV) promoter and the simian virus 40 (SV40) early mRNA polyadenylation signal. The expression cassette of Glycoprotein 5 was cloned into the CAV-2 genome in which E3 region had been partly deleted, and the recombinant virus (CAV-2-GP5) was obtained by transfecting the recombinant CAV-2-GP5 genome into MDCK cells together with Lipofectamine 2000. Immunization trial in pigs with the recombinant virus CAV-2-GP5 showed that CAV-2-GP5 could stimulate a specific immune response to PRRSV. Immune response to the GP5 and PRRSV was confirmed by ELISA, neutralization test and lymphocyte proliferative responses, and western blotting confirmed expression of GP5 by the vector in cells. These results indicated that CAV-2 may serve as a vector for development of PRRSV vaccine in pigs, and the CAV-2-GP5 might be a candidate vaccine to be tested for preventing PRRSV infection.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Hui; Wu Jihong; Li Huiming

    The interaction of vascular endothelial growth factor (VEGF) and its receptors (Flt-1, Flk-1/KDR) is correlated with neovascularization in the eyes. Therefore, blocking the binding of VEGF and the corresponding receptor has become critical for inhibiting corneal neovascularization. In this study, we have expressed the cDNA for sFlk-1 under the control of cytomegalovirus immediate-early promoter (CMV) from an E1/partial E3 deleted replication defective recombinant adenovirus, and Ad.sflk-1 expression was determined by Western blotting. We have shown that conditioned media from Ad.sflk-1-infected ARPE-19 cells significantly reduced VEGF-induced human umbilical vein endothelial cells (HUVEC) and murine endothelial cells (SVEC) proliferation in vitro comparedmore » with the control vector. In vivo, adenoviral vectors expressing green fluorescent protein alone (Ad.GFP) were utilized to monitor gene transfer to the cornea. Moreover, in the models of corneal neovascularization, the injection of Ad.sflk-1 (10{sup 8} PFU) into the anterior chamber could significantly inhibit angiogenic changes compared with Ad.null-injected and vehicle-injected models. Immunohistochemical analysis showed that corneal endothelial cells and corneal stroma of cauterized rat eyes were efficiently transduced and expressed sFlk-1. These results not only support that adenoviral vectors are capable of high-level transgene expression but also demonstrate that Ad.sflk-1 gene therapy might be a feasible approach for inhibiting the development of corneal neovascularization.« less

  15. Over-expression of angiotensin II type 2 receptor gene induces cell death in lung adenocarcinoma cells.

    PubMed

    Pickel, Lara; Matsuzuka, Takaya; Doi, Chiyo; Ayuzawa, Rie; Maurya, Dharmendra Kumar; Xie, Sheng-Xue; Berkland, Cory; Tamura, Masaaki

    2010-02-01

    The endogenous angiotensin II (Ang II) type 2 receptor (AT 2) has been shown to mediate apoptosis in cardiovascular tissues. Thus, the aim of this study was to explore the anti-cancer effect of AT 2 over-expression on lung adenocarcinoma cells in vitro using adenoviral (Ad), FuGENE, and nanoparticle vectors. All three gene transfection methods efficiently transfected AT 2 cDNA into lung cancer cells but caused minimal gene transfection in normal lung epithelial cells. Ad-AT 2 significantly attenuated multiple human lung cancer cell growth (A549 and H358) as compared to the control viral vector, Ad-LacZ, when cell viability was examined by direct cell count. Examination of annexin V by flow cytometry revealed the activation of the apoptotic pathway via AT 2 over-expression. Western Blot analysis confirmed the activation of caspase-3. Similarly, poly (lactide-co-glycolic acid) (PLGA) biodegradable nanoparticles encapsulated AT 2 plasmid DNA were shown to be effectively taken up into the lung cancer cell. Nanoparticle-based AT 2 gene transfection markedly increased AT 2 expression and resultant cell death in A549 cells. These results indicate that AT 2 over-expression effectively attenuates growth of lung adenocarcinoma cells through intrinsic apoptosis. Our results also suggest that PLGA nanoparticles can be used as an efficient gene delivery vector for lung adenocarcinoma targeted therapy.

  16. Insulated piggyBac vectors for insect transgenesis

    PubMed Central

    Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J

    2006-01-01

    Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846

  17. A respiratory syncytial virus (RSV) vaccine based on parainfluenza virus 5 (PIV5)

    PubMed Central

    Phan, Shannon I.; Chen, Zhenhai; Xu, Pei; Li, Zhuo; Gao, Xiudan; Foster, Stephanie L.; Teng, Michael N.; Tripp, Ralph A.; Sakamoto, Kaori; He, Biao

    2014-01-01

    Human respiratory syncytial virus (RSV) is a leading cause of severe respiratory disease and hospitalizations in infants and young children. It also causes significant morbidity and mortality in elderly and immune compromised individuals. No licensed vaccine currently exists. Parainfluenza virus 5 (PIV5) is a paramyxovirus that causes no known human illness and has been used as a platform for vector-based vaccine development. To evaluate the efficacy of PIV5 as a RSV vaccine vector, we generated two recombinant PIV5 viruses - one expressing the fusion (F) protein and the other expressing the attachment glycoprotein (G) of RSV strain A2 (RSV A2). The vaccine strains were used separately for single-dose vaccinations in BALB/c mice. The results showed that both vaccines induced RSV antigen-specific antibody responses, with IgG2a/IgG1 ratios similar to those seen in wild-type RSV A2 infection. After challenging the vaccinated mice with RSV A2, histopathology of lung sections showed that the vaccines did not exacerbate lung lesions relative to RSV A2-immunized mice. Importantly, both F and G vaccines induced protective immunity. Therefore, PIV5 presents an attractive platform for vector-based vaccines against RSV infection. PMID:24717150

  18. A Recombinant Adenovirus Expressing P12A and 3C Protein of the Type O Foot-and-Mouth Disease Virus Stimulates Systemic and Mucosal Immune Responses in Mice

    PubMed Central

    Gao, Peng

    2016-01-01

    Foot-and-mouth disease (FMD) is a highly contagious livestock disease of cloven-hoofed animals which causes severe economic losses. The replication-deficient, human adenovirus-vectored FMD vaccine has been proven effective against FMD. However, the role of T-cell-mediated antiviral responses and the mucosae-mediated antiviral responses induced by the adenovirus-vectored FMD vaccine was rarely examined. Here, the capsid protein precursor P1-2A and viral protease 3C of the type O FMDV were expressed in replicative-deficient human adenovirus type 5 vector. BALB/c mice immunized intramuscularly and intraperitoneally with recombinant adenovirus rAdv-P12A3C elicited higher FMDV-specific IgG antibodies, IFN-γ, and IL-4 cytokines than those in mice immunized with inactivated FMDV vaccine. Moreover, BALB/c mice immunized with recombinant adenovirus rAdv-P12A3C by oral and intraocular-nasal immunization induced high FMDV-specific IgA antibodies. These results show that the recombinant adenovirus rAdv-P12A3C could resist FMDV comprehensively. This study highlights the potential of rAdv-P12A3C to serve as a type O FMDV vaccine. PMID:27478836

  19. Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

    PubMed Central

    Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

    2011-01-01

    Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

  20. Amiloride-enhanced gene transfection of octa-arginine functionalized calcium phosphate nanoparticles.

    PubMed

    Vanegas Sáenz, Juan Ramón; Tenkumo, Taichi; Kamano, Yuya; Egusa, Hiroshi; Sasaki, Keiichi

    2017-01-01

    Nanoparticles represent promising gene delivery systems in biomedicine to facilitate prolonged gene expression with low toxicity compared to viral vectors. Specifically, nanoparticles of calcium phosphate (nCaP), the main inorganic component of human bone, exhibit high biocompatibility and good biodegradability and have been reported to have high affinity for protein or DNA, having thus been used as gene transfer vectors. On the other hand, Octa-arginine (R8), which has a high permeability to cell membrane, has been reported to improve intracellular delivery systems. Here, we present an optimized method for nCaP-mediated gene delivery using an octa-arginine (R8)-functionalized nCaP vector containing a marker or functional gene construct. nCaP particle size was between 220-580 nm in diameter and all R8-functionalized nCaPs carried a positive charge. R8 concentration significantly improved nCaP transfection efficiency with high cell compatibility in human mesenchymal stem cells (hMSC) and human osteoblasts (hOB) in particular, suggesting nCaPs as a good option for non-viral vector gene delivery. Furthermore, pre-treatment with different endocytosis inhibitors identified that the endocytic pathway differed among cell lines and functionalized nanoparticles, with amiloride increasing transfection efficiency of R8-functionalized nCaPs in hMSC and hOB.

  1. Human interleukin-10 delivered intrathecally by self-complementary adeno-associated virus 8 induces xenogeneic transgene immunity without clinical neurotoxicity in swine.

    PubMed

    Unger, Mark D; Pleticha, Josef; Heilmann, Lukas F; Newman, Laura K; Maus, Timothy P; Beutler, Andreas S

    2018-05-25

    Intrathecal interleukin-10 delivered by plasmid or viral gene vectors has been proposed for clinical testing because it is effective for chronic pain in rodents, a potential therapeutic for various human diseases, and was found to be non-toxic in dogs, when the human interleukin-10 ortholog was tested. However, recent studies in swine testing porcine interleukin-10 demonstrated fatal neurotoxicity. To deliver vector-encoded human interleukin-10 in swine, measure expression of the transgene in cerebrospinal fluid, and monitor animals for signs of neurotoxicity. Human interleukin-10 levels peaked 2 weeks after vector administration followed by a rapid decline that occurred concomitant with the emergence of anti-human interleukin-10 antibodies in the cerebrospinal fluid and serum. Animals remained neurologically healthy throughout the study period. This study suggests that swine are not idiosyncratically sensitive to intrathecal interleukin-10 because, recapitulating previous reports in dogs, they suffered no clinical neurotoxicity from the human ortholog. These results strongly infer that toxicity of intrathecal interleukin-10 in large animal models was previously overlooked because of a species mismatch between transgene and host. The present study further suggests that swine were protected from interleukin-10 by a humoral immune response against the xenogeneic cytokine. Future safety studies of interleukin-10 or related therapeutics may require syngeneic large animal models. This article is protected by copyright. All rights reserved.

  2. Potential of Equine Herpesvirus 1 as a Vector for Immunization

    PubMed Central

    Trapp, Sascha; von Einem, Jens; Hofmann, Helga; Köstler, Josef; Wild, Jens; Wagner, Ralf; Beer, Martin; Osterrieder, Nikolaus

    2005-01-01

    Key problems using viral vectors for vaccination and gene therapy are antivector immunity, low transduction efficiencies, acute toxicity, and limited capacity to package foreign genetic information. It could be demonstrated that animal and human cells were efficiently transduced with equine herpesvirus 1 (EHV-1) reconstituted from viral DNA maintained and manipulated in Escherichia coli. Between 13 and 23% of primary human CD3+, CD4+, CD8+, CD11b+, and CD19+ cells and more than 70% of CD4+ MT4 cells or various human tumor cell lines (MeWo, Huh7, HeLa, 293T, or H1299) could be transduced with one infectious unit of EHV-1 per cell. After intranasal instillation of EHV-1 into mice, efficient transgene expression in lungs was detectable. Successful immunization using EHV-1 was shown after delivery of the human immunodeficiency virus type 1 Pr55gag precursor by the induction of a Gag-specific CD8+ immune response in mice. Because EHV-1 was not neutralized by human sera containing high titers of antibodies directed against human herpesviruses 1 to 5, it is concluded that this animal herpesvirus has enormous potential as a vaccine vector, because it is able to efficiently transduce a variety of animal and human cells, has high DNA packaging capacity, and can conveniently be maintained and manipulated in prokaryotic cells. PMID:15827159

  3. Construction of an agglutination tool: recombinant Fab fragments biotinylated in vitro.

    PubMed

    Czerwinski, Marcin; Krop-Watorek, Anna; Wasniowska, Kazimiera; Smolarek, Dorota; Spitalnik, Steven L

    2009-11-30

    The pComb3H vector system is used for constructing and panning recombinant antibody libraries. It allows for expression of monovalent Fab fragments, either on the surface of M13 phage, or in the form of soluble proteins secreted into the periplasmic space of bacteria. We constructed a modified pComb3H vector containing cDNA encoding for a 23-amino acid fragment of the Escherichia coli biotin carboxy carrier protein (BCCP), which is an acceptor sequence for biotinylation. The vector was used to express the Fab fragment recognizing human glycophorin A. The purified Fab fragment containing this biotin acceptor sequence was effectively biotinylated in vitro using biotin ligase (BirA). The specificity and avidity of the biotinylated Fab fragments were similar to the previously produced, unmodified Fab fragments. An avidin-alkaline phosphatase conjugate was used to detect the recombinant Fab fragments, instead of secondary antibody. In addition, when biotinylated Fab fragments were mixed with avidin, red blood cells were directly agglutinated.

  4. Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.

    PubMed

    Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo

    2018-03-20

    DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.

  5. [Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

    PubMed

    Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

    2010-01-01

    The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

  6. Translational Data from Adeno-Associated Virus-Mediated Gene Therapy of Hemophilia B in Dogs

    PubMed Central

    Whitford, Margaret H.; Arruda, Valder R.; Stedman, Hansell H.; Kay, Mark A.; High, Katherine A.

    2015-01-01

    Abstract Preclinical testing of new therapeutic strategies in relevant animal models is an essential part of drug development. The choice of animal models of disease that are used in these studies is driven by the strength of the translational data for informing about safety, efficacy, and success or failure of human clinical trials. Hemophilia B is a monogenic, X-linked, inherited bleeding disorder that results from absent or dysfunctional coagulation factor IX (FIX). Regarding preclinical studies of adeno-associated virus (AAV)-mediated gene therapy for hemophilia B, dogs with severe hemophilia B (<1% FIX) provide well-characterized phenotypes and genotypes in which a species-specific transgene can be expressed in a mixed genetic background. Correction of the hemophilic coagulopathy by sustained expression of FIX, reduction of bleeding events, and a comprehensive assessment of the humoral and cell-mediated immune responses to the expressed transgene and recombinant AAV vector are all feasible end points in these dogs. This review compares the preclinical studies of AAV vectors used to treat dogs with hemophilia B with the results obtained in subsequent human clinical trials using muscle- and liver-based approaches. PMID:25675273

  7. Translational data from adeno-associated virus-mediated gene therapy of hemophilia B in dogs.

    PubMed

    Nichols, Timothy C; Whitford, Margaret H; Arruda, Valder R; Stedman, Hansell H; Kay, Mark A; High, Katherine A

    2015-03-01

    Preclinical testing of new therapeutic strategies in relevant animal models is an essential part of drug development. The choice of animal models of disease that are used in these studies is driven by the strength of the translational data for informing about safety, efficacy, and success or failure of human clinical trials. Hemophilia B is a monogenic, X-linked, inherited bleeding disorder that results from absent or dysfunctional coagulation factor IX (FIX). Regarding preclinical studies of adeno-associated virus (AAV)-mediated gene therapy for hemophilia B, dogs with severe hemophilia B (<1% FIX) provide well-characterized phenotypes and genotypes in which a species-specific transgene can be expressed in a mixed genetic background. Correction of the hemophilic coagulopathy by sustained expression of FIX, reduction of bleeding events, and a comprehensive assessment of the humoral and cell-mediated immune responses to the expressed transgene and recombinant AAV vector are all feasible end points in these dogs. This review compares the preclinical studies of AAV vectors used to treat dogs with hemophilia B with the results obtained in subsequent human clinical trials using muscle- and liver-based approaches.

  8. Tissue-specific, tumor-selective, replication-competent adenovirus vector for cancer gene therapy.

    PubMed

    Doronin, K; Kuppuswamy, M; Toth, K; Tollefson, A E; Krajcsi, P; Krougliak, V; Wold, W S

    2001-04-01

    We have previously described two replication-competent adenovirus vectors, named KD1 and KD3, for potential use in cancer gene therapy. KD1 and KD3 have two small deletions in the E1A gene that restrict efficient replication of these vectors to human cancer cell lines. These vectors also have increased capacity to lyse cells and spread from cell to cell because they overexpress the adenovirus death protein, an adenovirus protein required for efficient cell lysis and release of adenovirus from the cell. We now describe a new vector, named KD1-SPB, which is the KD1 vector with the E4 promoter replaced by the promoter for surfactant protein B (SPB). SPB promoter activity is restricted in the adult to type II alveolar epithelial cells and bronchial epithelial cells. Because KD1-SPB has the E1A mutations, it should replicate within and destroy only alveolar and bronchial cancer cells. We show that KD1-SPB replicates, lyses cells, and spreads from cell to cell as well as does KD1 in H441 cells, a human cancer cell line where the SPB promoter is active. KD1-SPB replicates, lyses cells, and spreads only poorly in Hep3B liver cancer cells. Replication was determined by expression of the E4ORF3 protein, viral DNA accumulation, fiber synthesis, and virus yield. Cell lysis and vector spread were measured by lactate dehydrogenase release and a "vector spread" assay. In addition to Hep3B cells, KD1-SPB also did not express E4ORF3 in HT29.14S (colon), HeLa (cervix), KB (nasopharynx), or LNCaP (prostate) cancer cell lines, in which the SPB promoter is not expected to be active. Following injection into H441 or Hep3B tumors growing in nude mice, KD1-SPB caused a three- to fourfold suppression of growth of H441 tumors, similar to that seen with KD1. KD1-SPB had only a minimal effect on the growth of Hep3B tumors, whereas KD1 again caused a three- to fourfold suppression. These results establish that the adenovirus E4 promoter can be replaced by a tissue-specific promoter in a replication-competent vector. The vector has three engineered safety features: the tissue-specific promoter, the mutations in E1A that preclude efficient replication in nondividing cells, and a deletion of the E3 genes which shield the virus from attack by the immune system. KD1-SPB may have use in treating human lung cancers in which the SPB promoter is active.

  9. Development of Third-generation Cocal Envelope Producer Cell Lines for Robust Lentiviral Gene Transfer into Hematopoietic Stem Cells and T-cells.

    PubMed

    Humbert, Olivier; Gisch, Don W; Wohlfahrt, Martin E; Adams, Amie B; Greenberg, Phil D; Schmitt, Tom M; Trobridge, Grant D; Kiem, Hans-Peter

    2016-08-01

    Lentiviral vectors (LVs) pseudotyped with vesicular stomatitis virus envelope glycoprotein (VSV-G) have demonstrated great promise in gene therapy trials employing hematopoietic stem cell and T-cells. The VSV-G envelope confers broad tropism and stability to the vector but is toxic when constitutively expressed, which has impeded efforts to generate stable producer cell lines. We previously showed that cocal pseudotyped LVs offer an excellent alternative to VSV-G vectors because of their broad tropism and resistance to human serum inactivation. In this study, we demonstrate that cocal LVs transduce CD34(+) and CD4(+) T-cells more efficiently than VSV-G LVs and share the same receptor(s) for cell entry. 293T-cells stably expressing the cocal envelope produced significantly higher LV titers than VSV-G expressing cells. We developed cocal pseudotyped, third-generation, self-inactivating LV producer cell lines for a GFP reporter and for a WT1 tumor-specific T-cell receptor, which achieved concentrated titers above 10(8) IU/ml and were successfully adapted for growth in suspension, serum-free culture. The resulting LVs were at least as effective as standard LVs in transducing CD34(+) and CD4(+) T-cells. Our stable cocal LV producer cell lines should facilitate the production of large-scale, high titer clinical grade vectors.

  10. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  11. Vector modifications to eliminate transposase expression following piggyBac-mediated transgenesis

    PubMed Central

    Chakraborty, Syandan; Ji, HaYeun; Chen, Jack; Gersbach, Charles A.; Leong, Kam W.

    2014-01-01

    Transgene insertion plays an important role in gene therapy and in biological studies. Transposon-based systems that integrate transgenes by transposase-catalyzed “cut-and-paste” mechanism have emerged as an attractive system for transgenesis. Hyperactive piggyBac transposon is particularly promising due to its ability to integrate large transgenes with high efficiency. However, prolonged expression of transposase can become a potential source of genotoxic effects due to uncontrolled transposition of the integrated transgene from one chromosomal locus to another. In this study we propose a vector design to decrease post-transposition expression of transposase and to eliminate the cells that have residual transposase expression. We design a single plasmid construct that combines the transposase and the transpositioning transgene element to share a single polyA sequence for termination. Consequently, the separation of the transposase element from the polyA sequence after transposition leads to its deactivation. We also co-express Herpes Simplex Virus thymidine kinase (HSV-tk) with the transposase. Therefore, cells having residual transposase expression can be eliminated by the administration of ganciclovir. We demonstrate the utility of this combination transposon system by integrating and expressing a model therapeutic gene, human coagulation Factor IX, in HEK293T cells. PMID:25492703

  12. A Single-Vector, Single-Injection Trivalent Filovirus Vaccine: Proof of Concept Study in Outbred Guinea Pigs.

    PubMed

    Mire, Chad E; Geisbert, Joan B; Versteeg, Krista M; Mamaeva, Natalia; Agans, Krystle N; Geisbert, Thomas W; Connor, John H

    2015-10-01

    The filoviruses, Marburg marburgvirus (MARV), Zaire ebolavirus (ZEBOV), and Sudan ebolavirus (SEBOV), cause severe and often fatal hemorrhagic fever in humans and nonhuman primates (NHPs). Monovalent recombinant vesicular stomatitis virus (rVSV)-based vaccine vectors, which encode a filovirus glycoprotein (GP) in place of the VSV glycoprotein, have shown 100% efficacy against homologous filovirus challenge in rodent and NHP studies. Here, we examined the utility of a single-vector, single-injection trivalent rVSV vector expressing MARV, ZEBOV, and SEBOV GPs to protect against MARV-, ZEBOV-, and SEBOV-induced disease in outbred Hartley guinea pigs where we observed protection from effects of all 3 filoviruses. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. The genetics of chemoreception in the labella and tarsi of Aedes aegypti.

    PubMed

    Sparks, Jackson T; Bohbot, Jonathan D; Dickens, Joseph C

    2014-05-01

    The yellow-fever mosquito Aedes aegypti is a major vector of human diseases, such as dengue, yellow fever, chikungunya and West Nile viruses. Chemoreceptor organs on the labella and tarsi are involved in human host evaluation and thus serve as potential foci for the disruption of blood feeding behavior. In addition to host detection, these contact chemoreceptors mediate feeding, oviposition and conspecific recognition; however, the molecular landscape of chemoreception in these tissues remains mostly uncharacterized. Here we report the expression profile of all putative chemoreception genes in the labella and tarsi of both sexes of adult Ae. aegypti and discuss their possible roles in the physiology and behavior of this important disease vector. Published by Elsevier Ltd.

  14. An equine herpesvirus type 1 (EHV-1) vector expressing Rift Valley fever virus (RVFV) Gn and Gc induces neutralizing antibodies in sheep.

    PubMed

    Said, Abdelrahman; Elmanzalawy, Mona; Ma, Guanggang; Damiani, Armando Mario; Osterrieder, Nikolaus

    2017-08-14

    Rift Valley fever virus (RVFV) is an arthropod-borne bunyavirus that can cause serious and fatal disease in humans and animals. RVFV is a negative-sense RNA virus of the Phlebovirus genus in the Bunyaviridae family. The main envelope RVFV glycoproteins, Gn and Gc, are encoded on the M segment of RVFV and known inducers of protective immunity. In an attempt to develop a safe and efficacious RVF vaccine, we constructed and tested a vectored equine herpesvirus type 1 (EHV-1) vaccine that expresses RVFV Gn and Gc. The Gn and Gc genes were custom-synthesized after codon optimization and inserted into EHV-1 strain RacH genome. The rH_Gn-Gc recombinant virus grew in cultured cells with kinetics that were comparable to those of the parental virus and stably expressed Gn and Gc. Upon immunization of sheep, the natural host, neutralizing antibodies against RVFV were elicited by rH_Gn-Gc and protective titers reached to 1:320 at day 49 post immunization but not by parental EHV-1, indicating that EHV-1 is a promising vector alternative in the development of a safe marker RVFV vaccine.

  15. Episome-generated N-myc antisense RNA restricts the differentiation potential of primitive neuroectodermal cell lines.

    PubMed Central

    Whitesell, L; Rosolen, A; Neckers, L M

    1991-01-01

    Neuroectodermal tumors of childhood provide a unique opportunity to examine the role of genes potentially regulating neuronal growth and differentiation because many cell lines derived from these tumors are composed of at least two distinct morphologic cell types. These types display variant phenotypic characteristics and spontaneously interconvert, or transdifferentiate, in vitro. The factors that regulate transdifferentiation are unknown. Application of antisense approaches to the transdifferentiation process has allowed us to explore the precise role that N-myc may play in regulating developing systems. We now report construction of an episomally replicating expression vector designed to generate RNA antisense to part of the human N-myc gene. Such a vector is able to specifically inhibit N-myc expression in cell lines carrying both normal and amplified N-myc alleles. Inhibition of N-myc expression blocks transdifferentiation in these lines, with accumulation of cells of an intermediate phenotype. A concomitant decrease in growth rate but not loss of tumorigenicity was observed in the N-myc nonamplified cell line CHP-100. Vector-generated antisense RNA should allow identification of genes specifically regulated by the proto-oncogene N-myc. Images PMID:1996098

  16. Transient Expression of Lumbrokinase (PI239) in Tobacco (Nicotiana tabacum) Using a Geminivirus-Based Single Replicon System Dissolves Fibrin and Blood Clots.

    PubMed

    Dickey, Alexia; Wang, Nan; Cooper, Edwin; Tull, Lauren; Breedlove, Drew; Mason, Hugh; Liu, Dehu; Wang, Kevin Yueju

    2017-01-01

    Lumbrokinases, a group of fibrinolytic enzymes extracted from earthworm, have been widely used to prevent and treat various cardiovascular diseases. They specifically target fibrin to effectively degrade thrombi without major side effects. Plant expression systems are becoming potential alternative expression platforms for producing pharmaceutical proteins. In this work, a lumbrokinase (PI239) was produced from a plant system. Both wild-type (WT) and plant codon-optimized (OP) PI239 gene sequences were synthesized and cloned into a geminivirus-based single-vector DNA replicon system. Both vectors were independently expressed in tobacco (Nicotiana tabacum) leaves transiently by agroinfiltration. Overexpressed PI239 resulted in sudden tissue necrosis 3 days after infiltration. Remaining proteins were purified through His-tag affinity chromatography and analyzed with SDS-PAGE and Western blot methods. Purified PI239 successfully degraded artificial fibrin with relative activity of 13,400 U/mg when compared with commercial lumbrokinase product. In vitro tests demonstrated that plant-derived PI239 dissolved human blood clots and that the plant expression system is capable of producing functional PI239.

  17. Evaluation of the concentration and bioactivity of adenovirus vectors for gene therapy.

    PubMed Central

    Mittereder, N; March, K L; Trapnell, B C

    1996-01-01

    Development of adenovirus vectors as potential therapeutic agents for multiple applications of in vivo human gene therapy has resulted in numerous preclinical and clinical studies. However, lack of standardization of the methods for quantifying the physical concentration and functionally active fraction of virions in these studies has often made comparison between various studies difficult or impossible. This study was therefore carried out to define the variables for quantification of the concentration of adenovirus vectors. The methods for evaluation of total virion concentration included electron microscopy and optical absorbance. The methods for evaluation of the concentration of functional virions included detection of gene transfer (transgene transfer and expression) and the plaque assay on 293 cells. Enumeration of total virion concentration by optical absorbance was found to be a precise procedure, but accuracy was dependent on physical disruption of the virion to eliminate artifacts from light scattering and also on a correct value for the extinction coefficient. Both biological assays for enumerating functional virions were highly dependent on the assay conditions and in particular the time of virion adsorption and adsorption volume. Under optimal conditions, the bioactivity of the vector, defined as the fraction of total virions which leads to detected target cell infection, was determined to be 0.10 in the plaque assay and 0.29 in the gene transfer assay. This difference is most likely due to the fact that detection by gene transfer requires only measurement of levels of transgene expression in the infected cell whereas plaque formation is dependent on a series of biological events of much greater complexity. These results show that the exact conditions for determination of infectious virion concentration and bioactivity of recombinant adenovirus vectors are critical and must be standardized for comparability. These observations may be very useful in comparison of data from different preclinical and clinical studies and may also have important implications for how adenovirus vectors can optimally be used in human gene therapy. PMID:8892868

  18. Recombinant poxviruses as mucosal vaccine vectors.

    PubMed

    Gherardi, M Magdalena; Esteban, Mariano

    2005-11-01

    The majority of infections initiate their departure from a mucosal surface, such as Human immunodeficiency virus (HIV), a sexually transmitted virus. Therefore, the induction of mucosal immunity is a high priority in the development of vaccines against mucosal pathogens. The selection of an appropriate antigen delivery system is necessary to induce an efficient mucosal immune response. Poxvirus vectors have been the most intensively studied live recombinant vector, and numerous studies have demonstrated their ability to induce mucosal immune responses against foreign expressed antigens. Previous studies have demonstrated that recombinants based on the attenuated modified vaccinia virus Ankara (MVA) vector were effective in inducing protective responses against different respiratory viruses, such as influenza and respiratory syncytial virus, following immunization via mucosal routes. Recent studies performed in the murine and macaque models have shown that recombinant MVA (rMVA) does not only stimulate HIV-specific immunity in the genital and rectal tracts following mucosal delivery, but can also control simian/human immunodeficiency viraemia and disease progression. In addition, a prime-boost vaccination approach against tuberculosis emphasized the importance of the intranasal rMVA antigen delivery to induce protective immunity against Mycobacterium tuberculosis. The aim of this review is to summarize the studies employing recombinant poxviruses, specifically rMVA as a mucosal delivery vector. The results demonstrate that rMVAs can activate specific immune responses at mucosal surfaces, and encourage further studies to characterize and improve the MVA mucosal immunogenicity of poxvirus vectors.

  19. Purification and characterization of human pancreatic polypeptide expressed in E. coli.

    PubMed

    Griko, Y V; Kapanadze, M D

    1995-08-04

    The region of cDNA encoding human pancreatic polypeptide (hPP) was obtained by polymerase chain reaction (PCR) and subcloned into an expression vector. The pancreatic polypeptide gene was expressed in Escherichia coli in two versions: as a cleavable fusion protein with IgG-binding synthetic ZZ domains of protein A from Staphylococcus aureus or with the 1-48 fragment of lambda Cro repressor. Site-specific hydrolysis by hydroxylamine was used to cleave the fusion protein, releasing the human polypeptide. The structure of the obtained hPP has been studied by scanning microcalorimetry and circular dichroism spectrometry. It has been shown that hPP in solutions close to neutral has a compact and unique spatial structure with an extended hydrophobic core. This structure is stable at 20 degrees C and co-operatively breaks down upon heating from this temperature.

  20. Successful gene therapy in older Rpe65-deficient dogs following subretinal injection of an adeno-associated vector expressing RPE65.

    PubMed

    Annear, Matthew J; Mowat, Freya M; Bartoe, Joshua T; Querubin, Janice; Azam, Selina A; Basche, Mark; Curran, Paul G; Smith, Alexander J; Bainbridge, James W B; Ali, Robin R; Petersen-Jones, Simon M

    2013-10-01

    Young Rpe65-deficient dogs have been used as a model for human RPE65 Leber congenital amaurosis (RPE65-LCA) in proof-of-concept trials of recombinant adeno-associated virus (rAAV) gene therapy. However, there are relatively few reports of the outcome of rAAV gene therapy in Rpe65-deficient dogs older than 2 years of age. The purpose of this study was to investigate the success of this therapy in older Rpe65-deficient dogs. Thirteen eyes were treated in dogs between 2 and 6 years old. An rAAV2 vector expressing the human RPE65 cDNA driven by the human RPE65 promoter was delivered by subretinal injection. Twelve of the 13 eyes had improved retinal function as assessed by electroretinography, and all showed improvement in vision at low lighting intensities. Histologic examination of five of the eyes was performed but found no correlation between electroretinogram (ERG) rescue and numbers of remaining photoreceptors. We conclude that functional rescue is still possible in older dogs and that the use of older Rpe65-deficient dogs, rather than young Rpe65-deficient dogs that have very little loss of photoreceptors, more accurately models the situation when treating human RPE65-LCA patients.

  1. Geminivirus vectors for high-level expression of foreign proteins in plant cells.

    PubMed

    Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

    2003-02-20

    Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

  2. Generation of Human Induced Pluripotent Stem Cells from Peripheral Blood Mononuclear Cells Using Sendai Virus.

    PubMed

    Soares, Filipa A C; Pedersen, Roger A; Vallier, Ludovic

    2016-01-01

    This protocol describes the efficient isolation of peripheral blood mononuclear cells from circulating blood via density gradient centrifugation and subsequent generation of integration-free human induced pluripotent stem cells. Peripheral blood mononuclear cells are cultured for 9 days to allow expansion of the erythroblast population. The erythroblasts are then used to derive human induced pluripotent stem cells using Sendai viral vectors, each expressing one of the four reprogramming factors Oct4, Sox2, Klf4, and c-Myc.

  3. Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

    PubMed

    Tolmachov, Oleg E

    2010-04-01

    Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

  4. Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

    PubMed

    Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

    2015-10-01

    A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Phage display vectors for in vivo recombination of immunoglobulin heavy and light chain genes to make large combinatorial libraries.

    PubMed

    Tsurushita, N; Fu, H; Warren, C

    1996-06-12

    New phage display vectors for in vivo recombination of immunoglobulin (Ig) heavy (VH) and light (VL) chain variable genes, to make single-chain Fv fragments (scFv), were constructed. The VH and VL genes of monoclonal antibody (mAb) EP-5C7, which binds to both human E- and P-selectin, were cloned into a pUC19-derived plasmid vector, pCW93, and a pACYC184-derived phagemid vector, pCW99, respectively. Upon induction of Cre recombinase (phage P1 recombinase), the VH and VL genes were efficiently recombined into the same plasmid via the two loxP sites (phage P1 recombination sites), one located downstream from a VH gene in pCW93 and another upstream from a VL gene in pCW99. In the resulting phagemid, the loxP sequence also encodes a polypeptide linker connecting the VH and VL domains to form a scFv of EP-5C7. Whether expressed on the phage surface or as a soluble form, the EP-5C7 scFv showed specific binding to human E- and P-selectin. This phagemid vector system provides a way to recombine VH and VL gene libraries efficiently in vivo to make extremely large Ig combinatorial libraries.

  6. Mechanism of estrogen activation of c-myc oncogene expression.

    PubMed

    Dubik, D; Shiu, R P

    1992-08-01

    The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.

  7. Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

    PubMed

    Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

    2017-04-01

    Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

  8. Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

    PubMed Central

    Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

    2012-01-01

    Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

  9. Definition of Contravariant Velocity Components

    NASA Technical Reports Server (NTRS)

    Hung, Ching-moa; Kwak, Dochan (Technical Monitor)

    2002-01-01

    In this paper we have reviewed the basics of tensor analysis in an attempt to clarify some misconceptions regarding contravariant and covariant vector components as used in fluid dynamics. We have indicated that contravariant components are components of a given vector expressed as a unique combination of the covariant base vector system and, vice versa, that the covariant components are components of a vector expressed with the contravariant base vector system. Mathematically, expressing a vector with a combination of base vector is a decomposition process for a specific base vector system. Hence, the contravariant velocity components are decomposed components of velocity vector along the directions of coordinate lines, with respect to the covariant base vector system. However, the contravariant (and covariant) components are not physical quantities. Their magnitudes and dimensions are controlled by their corresponding covariant (and contravariant) base vectors.

  10. Cloning and expression of codon-optimized recombinant darbepoetin alfa in Leishmania tarentolae T7-TR.

    PubMed

    Kianmehr, Anvarsadat; Golavar, Raziyeh; Rouintan, Mandana; Mahrooz, Abdolkarim; Fard-Esfahani, Pezhman; Oladnabi, Morteza; Khajeniazi, Safoura; Mostafavi, Seyede Samaneh; Omidinia, Eskandar

    2016-02-01

    Darbepoetin alfa is an engineered and hyperglycosylated analog of recombinant human erythropoietin (EPO) which is used as a drug in treating anemia in patients with chronic kidney failure and cancer. This study desribes the secretory expression of a codon-optimized recombinant form of darbepoetin alfa in Leishmania tarentolae T7-TR. Synthetic codon-optimized gene was amplified by PCR and cloned into the pLEXSY-I-blecherry3 vector. The resultant expression vector, pLEXSYDarbo, was purified, digested, and electroporated into the L. tarentolae. Expression of recombinant darbepoetin alfa was evaluated by ELISA, reverse-transcription PCR (RT-PCR), Western blotting, and biological activity. After codon optimization, codon adaptation index (CAI) of the gene raised from 0.50 to 0.99 and its GC% content changed from 56% to 58%. Expression analysis confirmed the presence of a protein band at 40 kDa. Furthermore, reticulocyte experiment results revealed that the activity of expressed darbepoetin alfa was similar to that of its equivalent expressed in Chinese hamster ovary (CHO) cells. These data suggested that the codon optimization and expression in L. tarentolae host provided an efficient approach for high level expression of darbepoetin alfa. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Under-Expression of Chemosensory Genes in Domiciliary Bugs of the Chagas Disease Vector Triatoma brasiliensis

    PubMed Central

    Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam

    2016-01-01

    Background In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses—a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. Methodology/Principal Finding In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Conclusion/Significance Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication. PMID:27792774

  12. Under-Expression of Chemosensory Genes in Domiciliary Bugs of the Chagas Disease Vector Triatoma brasiliensis.

    PubMed

    Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam

    2016-10-01

    In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses-a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication.

  13. Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

    PubMed

    Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

    2010-01-01

    In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

  14. Transgenesis and paratransgenesis to control insect-borne diseases: Current status and future challenges

    PubMed Central

    Coutinho-Abreu, Iliano V.; Zhu, Kun Yan; Ramalho-Ortigao, Marcelo

    2009-01-01

    Insect-borne diseases cause significant human morbidity and mortality. Current control and preventive methods against vector-borne diseases rely mainly on insecticides. The emergence of insecticide resistance in many disease vectors highlights the necessity to develop new strategies to control these insects. Vector transgenesis and paratransgenesis are novel strategies that aim at reducing insect vectorial capacity, or seek to eliminate transmission of pathogens such as Plasmodium sp., Trypanosoma sp., and Dengue virus currently being developed. Vector transgenesis relies on direct genetic manipulation of disease vectors making them incapable of functioning as vectors of a given pathogen. Paratransgenesis focuses on utilizing genetically modified insect symbionts to express molecules within the vector that are deleterious to pathogens they transmit. Despite the many successes achieved in developing such techniques in the last several years, many significant barriers remain and need to be overcome prior to any of these approaches become a reality. Here, we highlight the current status of these strategies, pointing out advantages and constraints, and also explore issues that need to be resolved before the establishment of transgenesis and paratransgenesis as tools to prevent vector-borne diseases. PMID:19819346

  15. Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

    PubMed

    Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

    2017-06-06

    Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

  16. Self-entanglement of long linear DNA vectors using transient non-B-DNA attachment points: a new concept for improvement of non-viral therapeutic gene delivery.

    PubMed

    Tolmachov, Oleg E

    2012-05-01

    The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II topoisomerases. The technology for such self-entanglement can be an avenue for the improvement of gene delivery with high-molecular-weight naked DNA using therapeutically important methods associated with considerable shear stress. Priority applications include in vivo muscle electroporation and sonoporation for Duchenne muscular dystrophy patients, aerosol inhalation to reach the target lung cells of cystic fibrosis patients and bio-ballistic delivery to skin melanomas with the vector DNA adsorbed on gold or tungsten projectiles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Lentiviral vector-mediated genetic modification of human neural progenitor cells for ex vivo gene therapy.

    PubMed

    Capowski, Elizabeth E; Schneider, Bernard L; Ebert, Allison D; Seehus, Corey R; Szulc, Jolanta; Zufferey, Romain; Aebischer, Patrick; Svendsen, Clive N

    2007-07-30

    Human neural progenitor cells (hNPC) hold great potential as an ex vivo system for delivery of therapeutic proteins to the central nervous system. When cultured as aggregates, termed neurospheres, hNPC are capable of significant in vitro expansion. In the current study, we present a robust method for lentiviral vector-mediated gene delivery into hNPC that maintains the differentiation and proliferative properties of neurosphere cultures while minimizing the amount of viral vector used and controlling the number of insertion sites per population. This method results in long-term, stable expression even after differentiation of the hNPC to neurons and astrocytes and allows for generation of equivalent transgenic populations of hNPC. In addition, the in vitro analysis presented predicts the behavior of transgenic lines in vivo when transplanted into a rodent model of Parkinson's disease. The methods presented provide a powerful tool for assessing the impact of factors such as promoter systems or different transgenes on the therapeutic utility of these cells.

  18. TMV-Gate vectors: Gateway compatible tobacco mosaic virus based expression vectors for functional analysis of proteins

    PubMed Central

    Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin

    2012-01-01

    Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857

  19. EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

    PubMed

    Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

    2017-07-21

    Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

  20. Zinc Finger Protein Designed to Target 2-Long Terminal Repeat Junctions Interferes with Human Immunodeficiency Virus Integration

    PubMed Central

    Sakkhachornphop, Supachai; Barbas, Carlos F.; Keawvichit, Rassamee; Wongworapat, Kanlaya

    2012-01-01

    Abstract Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine–adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future. PMID:22429108

  1. Hexons from adenovirus serotypes 5 and 48 differentially protect adenovirus vectors from neutralization by mouse and human serum

    PubMed Central

    Harmon, Andrew W.; Moitra, Rituparna; Xu, Zhili

    2018-01-01

    Adenovirus vectors are widely used in gene therapy clinical trials, and preclinical studies with these vectors are often conducted in mice. It is therefore critical to understand whether mouse studies adequately predict the behavior of adenovirus vectors in humans. The most commonly-used adenovirus vectors are derived from adenovirus serotype 5 (Ad5). The Ad5 hexon protein can bind coagulation factor X (FX), and binding of FX has a major impact on vector interactions with other blood proteins. In mouse serum, FX protects Ad5 vectors from neutralization by natural antibodies and complement. In the current study, we similarly find that human FX inhibits neutralization of Ad5 vectors by human serum, and this finding is consistent among individual human sera. We show that human IgM and human IgG can each induce complement-mediated neutralization when Ad5 vectors are not protected by FX. Although mouse and human serum had similar effects on Ad5 vectors, we found that this was not true for a chimeric Ad5 vector that incorporated hexon regions from adenovirus serotype 48. Interestingly, this hexon-chimeric vector was neutralized by human serum, but not by mouse serum. These findings indicate that studies in mouse serum accurately predict the behavior of Ad5 vectors in human serum, but mouse serum is not an accurate model system for all adenovirus vectors. PMID:29401488

  2. Transduction of skin-migrating dendritic cells by human adenovirus 5 occurs via an actin-dependent phagocytic pathway.

    PubMed

    Guzman, Efrain; Taylor, Geraldine; Hope, Jayne; Herbert, Rebecca; Cubillos-Zapata, Carolina; Charleston, Bryan

    2016-10-01

    Dendritic cells (DC) are central to the initiation of immune responses, and various approaches have been used to target vaccines to DC in order to improve immunogenicity. Cannulation of lymphatic vessels allows for the collection of DC that migrate from the skin. These migrating DC are involved in antigen uptake and presentation following vaccination. Human replication-deficient adenovirus (AdV) 5 is a promising vaccine vector for delivery of recombinant antigens. Although the mechanism of AdV attachment and penetration has been extensively studied in permissive cell lines, few studies have addressed the interaction of AdV with DC. In this study, we investigated the interaction of bovine skin-migrating DC and replication-deficient AdV-based vaccine vectors. We found that, despite lack of expression of Coxsackie B-Adenovirus Receptor and other known adenovirus receptors, AdV readily enters skin-draining DC via an actin-dependent endocytosis. Virus exit from endosomes was pH independent, and neutralizing antibodies did not prevent virus entry but did prevent virus translocation to the nucleus. We also show that combining adenovirus with adjuvant increases the absolute number of intracellular virus particles per DC but not the number of DC containing intracellular virus. This results in increased trans-gene expression and antigen presentation. We propose that, in the absence of Coxsackie B-Adenovirus Receptor and other known receptors, AdV5-based vectors enter skin-migrating DC using actin-dependent endocytosis which occurs in skin-migrating DC, and its relevance to vaccination strategies and vaccine vector targeting is discussed.

  3. Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

    PubMed

    Nakashima, N; Tamura, T

    2013-06-01

    Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

  4. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  5. Artificial genetic selection for an efficient translation initiation site for expression of human RACK1 gene in Escherichia coli

    PubMed Central

    Zhelyabovskaya, Olga B.; Berlin, Yuri A.; Birikh, Klara R.

    2004-01-01

    In bacterial expression systems, translation initiation is usually the rate limiting and the least predictable stage of protein synthesis. Efficiency of a translation initiation site can vary dramatically depending on the sequence context. This is why many standard expression vectors provide very poor expression levels of some genes. This notion persuaded us to develop an artificial genetic selection protocol, which allows one to find for a given target gene an individual efficient ribosome binding site from a random pool. In order to create Darwinian pressure necessary for the genetic selection, we designed a system based on translational coupling, in which microorganism survival in the presence of antibiotic depends on expression of the target gene, while putting no special requirements on this gene. Using this system we obtained superproducing constructs for the human protein RACK1 (receptor for activated C kinase). PMID:15034151

  6. Pathogen-mediated manipulation of arthropod microbiota to promote infection

    PubMed Central

    Abraham, Nabil M.; Liu, Lei; Jutras, Brandon Lyon; Yadav, Akhilesh K.; Narasimhan, Sukanya; Gopalakrishnan, Vissagan; Ansari, Juliana M.; Jefferson, Kimberly K.; Cava, Felipe; Jacobs-Wagner, Christine; Fikrig, Erol

    2017-01-01

    Arthropods transmit diverse infectious agents; however, the ways microbes influence their vector to enhance colonization are poorly understood. Ixodes scapularis ticks harbor numerous human pathogens, including Anaplasma phagocytophilum, the agent of human granulocytic anaplasmosis. We now demonstrate that A. phagocytophilum modifies the I. scapularis microbiota to more efficiently infect the tick. A. phagocytophilum induces ticks to express Ixodes scapularis antifreeze glycoprotein (iafgp), which encodes a protein with several properties, including the ability to alter bacterial biofilm formation. IAFGP thereby perturbs the tick gut microbiota, which influences the integrity of the peritrophic matrix and gut barrier—critical obstacles for Anaplasma colonization. Mechanistically, IAFGP binds the terminal d-alanine residue of the pentapeptide chain of bacterial peptidoglycan, resulting in altered permeability and the capacity of bacteria to form biofilms. These data elucidate the molecular mechanisms by which a human pathogen appropriates an arthropod antibacterial protein to alter the gut microbiota and more effectively colonize the vector. PMID:28096373

  7. The tripartite leader sequence is required for ectopic expression of HAdV-B and HAdV-E E3 CR1 genes.

    PubMed

    Bair, Camden R; Kotha Lakshmi Narayan, Poornima; Kajon, Adriana E

    2017-05-01

    The unique repertoire of genes that characterizes the early region 3 (E3) of the different species of human adenovirus (HAdV) likely contributes to their distinct pathogenic traits. The function of many E3 CR1 proteins remains unknown possibly due to unidentified intrinsic properties that make them difficult to express ectopically. This study shows that the species HAdV-B- and HAdV-E-specific E3 CR1 genes can be expressed from vectors carrying the HAdV tripartite leader (TPL) sequence but not from traditional mammalian expression vectors. Insertion of the TPL sequence upstream of the HAdV-B and HAdV-E E3 CR1 open reading frames was sufficient to rescue protein expression from pCI-neo constructs in transfected 293T cells. The detection of higher levels of HAdV-B and HAdV-E E3 CR1 transcripts suggests that the TPL sequence may enhance gene expression at both the transcriptional and translational levels. Our findings will facilitate the characterization of additional AdV E3 proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. TimesVector: a vectorized clustering approach to the analysis of time series transcriptome data from multiple phenotypes.

    PubMed

    Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun

    2017-12-01

    Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  9. Population biology of human onchocerciasis.

    PubMed Central

    Basáñez, M G; Boussinesq, M

    1999-01-01

    Human onchocerciasis (river blindness) is the filarial infection caused by Onchocerca volvulus and transmitted among people through the bites of the Simulium vector. Some 86 million people around the world are at risk of acquiring the nematode, with 18 million people infected and 600,000 visually impaired, half of them partially or totally blind. 99% of cases occur in tropical Africa; scattered foci exist in Latin America. Until recently control programmes, in operation since 1975, have consisted of antivectorial measures. With the introduction of ivermectin in 1988, safe and effective chemotherapy is now available. With the original Onchocerciasis Control Programme of West Africa coming to an end, both the new African Programme for Onchocerciasis Control and the Onchocerciasis Elimination Programme for the Americas, rely heavily on ivermectin self-sustained mass delivery. In consequence, the need for understanding the processes regulating parasite abundance in human and simuliid populations is of utmost importance. We present a simple mathematical framework built around recent analyses of exposure- and density-dependent processes operating, respectively, within the human and vector hosts. An expression for the basic reproductive ratio, R0, is derived and related to the minimum vector density required for parasite persistence in localities of West Africa in general and northern Cameroon in particular. Model outputs suggest that constraints acting against parasite establishment in both humans and vectors are necessary to reproduce field observations, but those in humans may not fully protect against reinfection. Analyses of host age-profiles of infection prevalence, intensity, and aggregation for increasing levels of endemicity and intensity of transmission in the Vina valley of northern Cameroon are in agreement with these results and discussed in light of novel work on onchocerciasis immunology. PMID:10365406

  10. SPARC Expression Is Selectively Suppressed in Tumor Initiating Urospheres Isolated from As+3- and Cd+2-Transformed Human Urothelial Cells (UROtsa) Stably Transfected with SPARC.

    PubMed

    Slusser-Nore, Andrea; Larson-Casey, Jennifer L; Zhang, Ruowen; Zhou, Xu Dong; Somji, Seema; Garrett, Scott H; Sens, Donald A; Dunlevy, Jane R

    2016-01-01

    This laboratory previously analyzed the expression of SPARC in the parental UROtsa cells, their arsenite (As(+3)) and cadmium (Cd(+2))-transformed cell lines, and tumor transplants generated from the transformed cells. It was demonstrated that SPARC expression was down-regulated to background levels in Cd(+2)-and As(+3)-transformed UROtsa cells and tumor transplants compared to parental cells. In the present study, the transformed cell lines were stably transfected with a SPARC expression vector to determine the effect of SPARC expression on the ability of the cells to form tumors in immune-compromised mice. Real time PCR, western blotting, immunohistochemistry, and immunofluorescence were used to define the expression of SPARC in the As(+3)-and Cd(+2)-transformed cell lines, and urospheres isolated from these cell lines, following their stable transfection with an expression vector containing the SPARC open reading frame (ORF). Transplantation of the cultured cells into immune-compromised mice by subcutaneous injection was used to assess the effect of SPARC expression on tumors generated from the above cell lines and urospheres. It was shown that the As(+3)-and Cd(+2)-transformed UROtsa cells could undergo stable transfection with a SPARC expression vector and that the transfected cells expressed both SPARC mRNA and secreted protein. Tumors formed from these SPARC-transfected cells were shown to have no expression of SPARC. Urospheres isolated from cultures of the SPARC-transfected As(+3)-and Cd(+2)-transformed cell lines were shown to have only background expression of SPARC. Urospheres from both the non-transfected and SPARC-transfected cell lines were tumorigenic and thus fit the definition for a population of tumor initiating cells. Tumor initiating cells isolated from SPARC-transfected As(+3)-and Cd(+2)-transformed cell lines have an inherent mechanism to suppress the expression of SPARC mRNA.

  11. SPARC Expression Is Selectively Suppressed in Tumor Initiating Urospheres Isolated from As+3- and Cd+2-Transformed Human Urothelial Cells (UROtsa) Stably Transfected with SPARC

    PubMed Central

    Slusser-Nore, Andrea; Larson-Casey, Jennifer L.; Zhang, Ruowen; Zhou, Xu Dong; Somji, Seema; Garrett, Scott H.; Sens, Donald A.; Dunlevy, Jane R.

    2016-01-01

    Background This laboratory previously analyzed the expression of SPARC in the parental UROtsa cells, their arsenite (As+3) and cadmium (Cd+2)-transformed cell lines, and tumor transplants generated from the transformed cells. It was demonstrated that SPARC expression was down-regulated to background levels in Cd+2-and As+3-transformed UROtsa cells and tumor transplants compared to parental cells. In the present study, the transformed cell lines were stably transfected with a SPARC expression vector to determine the effect of SPARC expression on the ability of the cells to form tumors in immune-compromised mice. Methods Real time PCR, western blotting, immunohistochemistry, and immunofluorescence were used to define the expression of SPARC in the As+3-and Cd+2-transformed cell lines, and urospheres isolated from these cell lines, following their stable transfection with an expression vector containing the SPARC open reading frame (ORF). Transplantation of the cultured cells into immune-compromised mice by subcutaneous injection was used to assess the effect of SPARC expression on tumors generated from the above cell lines and urospheres. Results It was shown that the As+3-and Cd+2-transformed UROtsa cells could undergo stable transfection with a SPARC expression vector and that the transfected cells expressed both SPARC mRNA and secreted protein. Tumors formed from these SPARC-transfected cells were shown to have no expression of SPARC. Urospheres isolated from cultures of the SPARC-transfected As+3-and Cd+2-transformed cell lines were shown to have only background expression of SPARC. Urospheres from both the non-transfected and SPARC-transfected cell lines were tumorigenic and thus fit the definition for a population of tumor initiating cells. Conclusions Tumor initiating cells isolated from SPARC-transfected As+3-and Cd+2-transformed cell lines have an inherent mechanism to suppress the expression of SPARC mRNA. PMID:26783756

  12. Human adenovirus serotypes 4p and 11p are efficiently expressed in cell lines of neural tumour origin.

    PubMed

    Skog, Johan; Mei, Ya-Fang; Wadell, Göran

    2002-06-01

    Most currently used adenovirus vectors are based upon adenovirus serotypes 2 and 5 (Ad2 and Ad5), which have limited efficiencies for gene transfer to human neural cells. Both serotypes bind to the known adenovirus receptor, CAR (coxsackievirus and adenovirus receptor), and have restricted cell tropism. The purpose of this study was to find vector candidates that are superior to Ad5 in infecting human neural tumours. Using flow cytometry, the vector candidates Ad4p, Ad11p and Ad17p were compared to the commonly used adenovirus vector Ad5v for their binding capacity to neural cell lines derived from glioblastoma, medulloblastoma and neuroblastoma cell lines. The production of viral structural proteins and the CAR-binding properties of the different serotypes were also assessed in these cells. Computer-based models of the fibre knobs of Ad4p and Ad17 were created based upon the crystallized fibre knob structure of adenoviruses and analysed for putative receptor-interacting regions that differed from the fibre knob of Ad5. The non CAR-binding vector candidate Ad11p showed clearly the best binding capacity to all of the neural cell lines, binding more than 90% of cells of all of the neural cell lines tested, in contrast to 20% or less for the commonly used vector Ad5v. Ad4p and Ad11p were also internalized and produced viral proteins more successfully than Ad5. Ad4p showed a low binding ability but a very efficient capacity for infection in cell culture. Ad17p virions neither bound or efficiently infected any of the neural cell lines studied.

  13. AAV vector encoding human VEGF165-transduced pectineus muscular flaps increase the formation of new tissue through induction of angiogenesis in an in vivo chamber for tissue engineering: A technique to enhance tissue and vessels in microsurgically engineered tissue.

    PubMed

    Moimas, Silvia; Manasseri, Benedetto; Cuccia, Giuseppe; Stagno d'Alcontres, Francesco; Geuna, Stefano; Pattarini, Lucia; Zentilin, Lorena; Giacca, Mauro; Colonna, Michele R

    2015-01-01

    In regenerative medicine, new approaches are required for the creation of tissue substitutes, and the interplay between different research areas, such as tissue engineering, microsurgery and gene therapy, is mandatory. In this article, we report a modification of a published model of tissue engineering, based on an arterio-venous loop enveloped in a cross-linked collagen-glycosaminoglycan template, which acts as an isolated chamber for angiogenesis and new tissue formation. In order to foster tissue formation within the chamber, which entails on the development of new vessels, we wondered whether we might combine tissue engineering with a gene therapy approach. Based on the well-described tropism of adeno-associated viral vectors for post-mitotic tissues, a muscular flap was harvested from the pectineus muscle, inserted into the chamber and transduced by either AAV vector encoding human VEGF165 or AAV vector expressing the reporter gene β-galactosidase, as a control. Histological analysis of the specimens showed that muscle transduction by AAV vector encoding human VEGF165 resulted in enhanced tissue formation, with a significant increase in the number of arterioles within the chamber in comparison with the previously published model. Pectineus muscular flap, transduced by adeno-associated viral vectors, acted as a source of the proangiogenic factor vascular endothelial growth factor, thus inducing a consistent enhancement of vessel growth into the newly formed tissue within the chamber. In conclusion, our present findings combine three different research fields such as microsurgery, tissue engineering and gene therapy, suggesting and showing the feasibility of a mixed approach for regenerative medicine.

  14. Disabled infectious single cycle herpes simplex virus (DISC-HSV) is a candidate vector system for gene delivery/expression of GM-CSF in human prostate cancer therapy.

    PubMed

    Parkinson, Richard J; Mian, Shahid; Bishop, Michael C; Gray, Trevor; Li, Geng; McArdle, Stephanie E B; Ali, Selman; Rees, Robert C

    2003-06-15

    DISC-HSV is a replication incompetent herpes simplex virus that is a highly efficient vector for the transduction of genes in vivo and in vitro. We examine the ability of DISC-HSV to infect human prostate cancer cell-lines and xenograft tumor models, and induce expression of reporter and therapeutic cytokine genes. Infection was confirmed by cellular staining for the beta-galactosidase reporter gene product, and by EM. Human GM-CSF production following DISC-hGMCSF infection was measured using ELISA. The metabolic activity of infected cells was determined by NADP/NADPH assay. Cell death was estimated by cell-cycle analysis using flow cytometry with propidium iodide staining. Infection of DU145, PC3 and LNCaP cells with DISC-HSV was dose dependent. Cells infected with DISC-hGM-CSF released significant levels of hGM-CSF for 3 days. NADP/NADPH assay suggested that infected cells continued to be metabolically active for 3 days post-infection, which was consistent with flow cytometry findings that cell death did not occur within 7 days of infection. Tumor xenografts injected with DISC-HSV expressed beta-galactosidase, and intracellular viral particles were demonstrated using EM. We have previously reported the rejection of established tumors following intra-tumoral injection of DISC-GMCSF. This study demonstrates the ability of DISC-HSV to infect prostate cancer and express GMCSF at significant levels. We suggest that prostate cancer is a potential target for therapy using DISC-HSV containing GM-CSF. Copyright 2003 Wiley-Liss, Inc.

  15. Mifepristone-inducible transgene expression in neural progenitor cells in vitro and in vivo

    PubMed Central

    Hjelm, BE; Grunseich, C; Gowing, G; Avalos, P; Tian, J; Shelley, BC; Mooney, M; Narwani, K; Shi, Y; Svendsen, CN; Wolfe, JH; Fischbeck, KH; Pierson, TM

    2016-01-01

    Numerous gene and cell therapy strategies are being developed for the treatment of neurodegenerative disorders. Many of these strategies use constitutive expression of therapeutic transgenic proteins, and although functional in animal models of disease, this method is less likely to provide adequate flexibility for delivering therapy to humans. Ligand-inducible gene expression systems may be more appropriate for these conditions, especially within the central nervous system (CNS). Mifepristone’s ability to cross the blood–brain barrier makes it an especially attractive ligand for this purpose. We describe the production of a mifepristone-inducible vector system for regulated expression of transgenes within the CNS. Our inducible system used a lentivirus-based vector platform for the ex vivo production of mifepristone-inducible murine neural progenitor cells that express our transgenes of interest. These cells were processed through a series of selection steps to ensure that the cells exhibited appropriate transgene expression in a dose-dependent and temporally controlled manner with minimal background activity. Inducible cells were then transplanted into the brains of rodents, where they exhibited appropriate mifepristone-inducible expression. These studies detail a strategy for regulated expression in the CNS for use in the development of safe and efficient gene therapy for neurological disorders. PMID:26863047

  16. Engineering human T cells for resistance to methotrexate and mycophenolate mofetil as an in vivo cell selection strategy.

    PubMed

    Jonnalagadda, Mahesh; Brown, Christine E; Chang, Wen-Chung; Ostberg, Julie R; Forman, Stephen J; Jensen, Michael C

    2013-01-01

    Gene transfer and drug selection systems that enforce ongoing transgene expression in vitro and in vivo which are compatible with human pharmaceutical drugs are currently underdeveloped. Here, we report on the utility of incorporating human enzyme muteins that confer resistance to the lymphotoxic/immunosuppressive drugs methotrexate (MTX) and mycophenolate mofetil (MMF) in a multicistronic lentiviral vector for in vivo T lymphocyte selection. We found that co-expression of human dihydrofolate reductase (DHFR(FS); L22F, F31S) and inosine monophosphate dehydrogenase II (IMPDH2(IY); T333I, S351Y) conferred T cell resistance to the cytocidal and anti-proliferative effects of these drugs at concentrations that can be achieved clinically (up to 0.1 µM MTX and 1.0 µM MPA). Furthermore, using a immunodeficient mouse model that supports the engraftment of central memory derived human T cells, in vivo selection studies demonstrate that huEGFRt(+)DHFR(FS+)IMPDH2(IY+) T cells could be enriched following adoptive transfer either by systemic administration of MTX alone (4.4 -fold), MMF alone (2.9-fold), or combined MTX and MMF (4.9-fold). These findings demonstrate the utility of both DHFR(FS)/MTX and IMPDH2(IY)/MMF for in vivo selection of lentivirally transduced human T cells. Vectors incorporating these muteins in combination with other therapeutic transgenes may facilitate the selective engraftment of therapeutically active cells in recipients.

  17. Production of a Human Antibody Library in the Phage-Display Vector pSEX81.

    PubMed

    Welschof, M; Little, M; Dörsam, H

    1998-01-01

    Human monoclonal antibodies (MAbs) are more suitable than MAbs of animal origin for clinical applications because of lower hypersensitivity reactions, less formation of circulating immune complexes and lower anti-immunoglobulin responses The classical production of human MAbs via the hybridoma technique or Epstein-Barr virus (EBV) transformation is limited by the instability of cell lines, low antibody production, and the problems of imununizing humans with certain antigens (1,2). A promising alternative 1s the production of human recombinant antibodies (3). Recombinant DNA technology has made it possible to clone human antibody genes in vectors and to generate antibody expression libraries (4-7). One approach has been to amplify and recombine the IgG repertoire of an "immunized" donor. This has been used to isolate several antibodies related to diseases (8,9). In order to obtain more universal antibody libraries the naive IgM repertoire of several "unimmunized" donors were pooled (10,12). The complexity of the combinatorial libraries has been further increased by creating the so-called "semisynthetic" antibody libraries (22-14).

  18. Genetic modification of neurons to express bevacizumab for local anti-angiogenesis treatment of glioblastoma.

    PubMed

    Hicks, Martin J; Funato, Kosuke; Wang, Lan; Aronowitz, Eric; Dyke, Jonathan P; Ballon, Douglas J; Havlicek, David F; Frenk, Esther Z; De, Bishnu P; Chiuchiolo, Maria J; Sondhi, Dolan; Hackett, Neil R; Kaminsky, Stephen M; Tabar, Viviane; Crystal, Ronald G

    2015-01-01

    The median survival of glioblastoma multiforme (GBM) is approximately 1 year. Following surgical removal, systemic therapies are limited by the blood-brain barrier. To circumvent this, we developed a method to modify neurons with the genetic sequence for therapeutic monoclonal antibodies using adeno-associated virus (AAV) gene transfer vectors, directing persistent, local expression in the tumor milieu. The human U87MG GBM cell line or patient-derived early passage GBM cells were administered to the striatum of NOD/SCID immunodeficient mice. AAVrh.10BevMab, an AAVrh.10-based vector coding for bevacizumab (Avastin), an anti-human vascular endothelial growth factor (VEGF) monoclonal antibody, was delivered to the area of the GBM xenograft. Localized expression of bevacizumab was demonstrated by quantitative PCR, ELISA and western blotting. Immunohistochemistry showed that bevacizumab was expressed in neurons. Concurrent administration of AAVrh.10BevMab with the U87MG tumor reduced tumor blood vessel density and tumor volume, and increased survival. Administration of AAVrh.10BevMab 1 week after U87MG xenograft reduced growth and increased survival. Studies with patient-derived early passage GBM primary cells showed a reduction in primary tumor burden with an increased survival. These data support the strategy of AAV-mediated central nervous system gene therapy to treat GBM, overcoming the blood-brain barrier through local, persistent delivery of an anti-angiogenesis monoclonal antibody.

  19. Generation of TALE nickase-mediated gene-targeted cows expressing human serum albumin in mammary glands.

    PubMed

    Luo, Yan; Wang, Yongsheng; Liu, Jun; Cui, Chenchen; Wu, Yongyan; Lan, Hui; Chen, Qi; Liu, Xu; Quan, Fusheng; Guo, Zekun; Zhang, Yong

    2016-02-08

    Targeting exogenous genes at milk protein loci via gene-targeting technology is an ideal strategy for producing large quantities of pharmaceutical proteins. Transcription-activator-like effector (TALE) nucleases (TALENs) are an efficient genome-editing tool. However, the off-target effects may lead to unintended gene mutations. In this study, we constructed TALENs and TALE nickases directed against exon 2 of the bovine β-lactoglobulin (BLG) locus. The nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and nonhomologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs. After co-transfecting the bovine fetal fibroblasts with human serum albumin (HSA) gene-targeting vector and TALE nickase expression vectors, approximately 4.8% (40/835) of the cell clones contained HSA at BLG locus. Unexpectedly, one homozygous gene-targeted cell clone (1/835, 0.1%) was obtained by targeting both alleles of BLG in a single round of transfection. The recombinant protein mimicking the endogenous BLG was highly expressed and correctly folded in the mammary glands of the targeted cows, and the expression level of HSA was significantly increased in the homozygous targeted cows. Results suggested that the combination of TALE nickase-mediated gene targeting and somatic cell nuclear transfer is a feasible and safe approach in producing gene-targeted livestock.

  20. Lentiviral vectors and cardiovascular diseases: a genetic tool for manipulating cardiomyocyte differentiation and function.

    PubMed

    Di Pasquale, E; Latronico, M V G; Jotti, G S; Condorelli, G

    2012-06-01

    Engineered recombinant viral vectors are a powerful tool for vehiculating genetic information into mammalian cells. Because of their ability to infect both dividing and non-dividing cells with high efficiency, lentiviral vectors have gained particular interest for basic research and preclinical studies in the cardiovascular field. We review here the major applications for lentiviral-vector technology in the cardiovascular field: we will discuss their use in trailing gene expression during the induction of differentiation, in protocols for the isolation of cardiac cells and in the tracking of cardiac cells after transplantation in vivo; we will also describe lentivirally-mediated gene delivery uses, such as the induction of a phenotype of interest in a target cell or the treatment of cardiovascular diseases. In addition, a section of the review will be dedicated to reprogramming approaches, focusing attention on the generation of pluripotent stem cells and on transdifferentiation, two emerging strategies for the production of cardiac myocytes from human cells and for the investigation of human diseases. Finally, in order to give a perspective on their future clinical use we will critically discuss advantages and disadvantages of lentivirus-based strategies for the treatment of cardiovascular diseases.

  1. Long-term correction of canine hemophilia B by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector.

    PubMed

    Herzog, R W; Yang, E Y; Couto, L B; Hagstrom, J N; Elwell, D; Fields, P A; Burton, M; Bellinger, D A; Read, M S; Brinkhous, K M; Podsakoff, G M; Nichols, T C; Kurtzman, G J; High, K A

    1999-01-01

    Hemophilia B is a severe X-linked bleeding diathesis caused by the absence of functional blood coagulation factor IX, and is an excellent candidate for treatment of a genetic disease by gene therapy. Using an adeno-associated viral vector, we demonstrate sustained expression (>17 months) of factor IX in a large-animal model at levels that would have a therapeutic effect in humans (up to 70 ng/ml, adequate to achieve phenotypic correction, in an animal injected with 8.5x10(12) vector particles/kg). The five hemophilia B dogs treated showed stable, vector dose-dependent partial correction of the whole blood clotting time and, at higher doses, of the activated partial thromboplastin time. In contrast to other viral gene delivery systems, this minimally invasive procedure, consisting of a series of percutaneous intramuscular injections at a single timepoint, was not associated with local or systemic toxicity. Efficient gene transfer to muscle was shown by immunofluorescence staining and DNA analysis of biopsied tissue. Immune responses against factor IX were either absent or transient. These data provide strong support for the feasibility of the approach for therapy of human subjects.

  2. Gene Therapy with the Sleeping Beauty Transposon System.

    PubMed

    Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

    2017-11-01

    The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Plasmids for increased efficiency of vector construction and genetic engineering in filamentous fungi.

    PubMed

    Schoberle, Taylor J; Nguyen-Coleman, C Kim; May, Gregory S

    2013-01-01

    Fungal species are continuously being studied to not only understand disease in humans and plants but also to identify novel antibiotics and other metabolites of industrial importance. Genetic manipulations, such as gene deletion, gene complementation, and gene over-expression, are common techniques to investigate fungal gene functions. Although advances in transformation efficiency and promoter usage have improved genetic studies, some basic steps in vector construction are still laborious and time-consuming. Gateway cloning technology solves this problem by increasing the efficiency of vector construction through the use of λ phage integrase proteins and att recombination sites. We developed a series of Gateway-compatible vectors for use in genetic studies in a range of fungal species. They contain nutritional and drug-resistance markers and can be utilized to manipulate different filamentous fungal genomes. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. RNA-seq de novo Assembly Reveals Differential Gene Expression in Glossina palpalis gambiensis Infected with Trypanosoma brucei gambiense vs. Non-Infected and Self-Cured Flies

    PubMed Central

    Hamidou Soumana, Illiassou; Klopp, Christophe; Ravel, Sophie; Nabihoudine, Ibouniyamine; Tchicaya, Bernadette; Parrinello, Hugues; Abate, Luc; Rialle, Stéphanie; Geiger, Anne

    2015-01-01

    Trypanosoma brucei gambiense (Tbg), causing the sleeping sickness chronic form, completes its developmental cycle within the tsetse fly vector Glossina palpalis gambiensis (Gpg) before its transmission to humans. Within the framework of an anti-vector disease control strategy, a global gene expression profiling of trypanosome infected (susceptible), non-infected, and self-cured (refractory) tsetse flies was performed, on their midguts, to determine differential genes expression resulting from in vivo trypanosomes, tsetse flies (and their microbiome) interactions. An RNAseq de novo assembly was achieved. The assembled transcripts were mapped to reference sequences for functional annotation. Twenty-four percent of the 16,936 contigs could not be annotated, possibly representing untranslated mRNA regions, or Gpg- or Tbg-specific ORFs. The remaining contigs were classified into 65 functional groups. Only a few transposable elements were present in the Gpg midgut transcriptome, which may represent active transpositions and play regulatory roles. One thousand three hundred and seventy three genes differentially expressed (DEGs) between stimulated and non-stimulated flies were identified at day-3 post-feeding; 52 and 1025 between infected and self-cured flies at 10 and 20 days post-feeding, respectively. The possible roles of several DEGs regarding fly susceptibility and refractoriness are discussed. The results provide new means to decipher fly infection mechanisms, crucial to develop anti-vector control strategies. PMID:26617594

  5. Amiloride-enhanced gene transfection of octa-arginine functionalized calcium phosphate nanoparticles

    PubMed Central

    Tenkumo, Taichi; Kamano, Yuya; Egusa, Hiroshi; Sasaki, Keiichi

    2017-01-01

    Nanoparticles represent promising gene delivery systems in biomedicine to facilitate prolonged gene expression with low toxicity compared to viral vectors. Specifically, nanoparticles of calcium phosphate (nCaP), the main inorganic component of human bone, exhibit high biocompatibility and good biodegradability and have been reported to have high affinity for protein or DNA, having thus been used as gene transfer vectors. On the other hand, Octa-arginine (R8), which has a high permeability to cell membrane, has been reported to improve intracellular delivery systems. Here, we present an optimized method for nCaP-mediated gene delivery using an octa-arginine (R8)-functionalized nCaP vector containing a marker or functional gene construct. nCaP particle size was between 220–580 nm in diameter and all R8-functionalized nCaPs carried a positive charge. R8 concentration significantly improved nCaP transfection efficiency with high cell compatibility in human mesenchymal stem cells (hMSC) and human osteoblasts (hOB) in particular, suggesting nCaPs as a good option for non-viral vector gene delivery. Furthermore, pre-treatment with different endocytosis inhibitors identified that the endocytic pathway differed among cell lines and functionalized nanoparticles, with amiloride increasing transfection efficiency of R8-functionalized nCaPs in hMSC and hOB. PMID:29145481

  6. A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

    PubMed

    Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

    2012-09-01

    Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.

  8. KIT Signaling Promotes Growth of Colon Xenograft Tumors in Mice and Is Up-Regulated in a Subset of Human Colon Cancers.

    PubMed

    Chen, Evan C; Karl, Taylor A; Kalisky, Tomer; Gupta, Santosh K; O'Brien, Catherine A; Longacre, Teri A; van de Rijn, Matt; Quake, Stephen R; Clarke, Michael F; Rothenberg, Michael E

    2015-09-01

    Receptor tyrosine kinase (RTK) inhibitors have advanced colon cancer treatment. We investigated the role of the RTK KIT in development of human colon cancer. An array of 137 patient-derived colon tumors and their associated xenografts were analyzed by immunohistochemistry to measure levels of KIT and its ligand KITLG. KIT and/or KITLG was stably knocked down by expression of small hairpin RNAs from lentiviral vectors in DLD1, HT29, LS174T, and COLO320 DM colon cancer cell lines, and in UM-COLON#8 and POP77 xenografts; cells transduced with only vector were used as controls. Cells were analyzed by real-time quantitative reverse transcription polymerase chain reaction, single-cell gene expression analysis, flow cytometry, and immunohistochemical, immunoblot, and functional assays. Xenograft tumors were grown from control and KIT-knockdown DLD1 and UM-COLON#8 cells in immunocompromised mice and compared. Some mice were given the RTK inhibitor imatinib after injection of cancer cells; tumor growth was measured based on bioluminescence. We assessed tumorigenicity using limiting dilution analysis. KIT and KITLG were expressed heterogeneously by a subset of human colon tumors. Knockdown of KIT decreased proliferation of colon cancer cell lines and growth of xenograft tumors in mice compared with control cells. KIT knockdown cells had increased expression of enterocyte markers, decreased expression of cycling genes, and, unexpectedly, increased expression of LGR5 associated genes. No activating mutations in KIT were detected in DLD1, POP77, or UM-COLON#8 cells. However, KITLG-knockdown DLD1 cells formed smaller xenograft tumors than control cells. Gene expression analysis of single CD44(+) cells indicated that KIT can promote growth via KITLG autocrine and/or paracrine signaling. Imatinib inhibited growth of KIT(+) colon cancer organoids in culture and growth of xenograft tumors in mice. Cancer cells with endogenous KIT expression were more tumorigenic in mice. KIT and KITLG are expressed by a subset of human colon tumors. KIT signaling promotes growth of colon cancer cells and organoids in culture and xenograft tumors in mice via its ligand, KITLG, in an autocrine or paracrine manner. Patients with KIT-expressing colon tumors can benefit from KIT RTK inhibitors. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. KIT Signaling Promotes Growth of Colon Xenograft Tumors in Mice and is Upregulated in a Subset of Human Colon Cancers

    PubMed Central

    Chen, Evan C.; Karl, Taylor A.; Kalisky, Tomer; Gupta, Santosh K.; O’Brien, Catherine A.; Longacre, Teri A.; van de Rijn, Matt; Quake, Stephen R.; Clarke, Michael F.; Rothenberg, Michael E.

    2015-01-01

    Background & Aims Receptor tyrosine kinase (RTK) inhibitors have advanced colon cancer treatment. We investigated the role of the RTK KIT in development of human colon cancer. Methods An array of 137 patient-derived colon tumors and their associated xenografts were analyzed by immunohistochemistry to measure levels of KIT and its ligand KITLG. KIT and/or KITLG was stably knocked down by expression of small hairpin RNAs from lentiviral vectors in DLD1, HT29, LS174T, and COLO320 colon cancer cell lines, and in UM-COLON#8 and POP77 xenografts; cells transduced with only vector were used as controls. Cells were analyzed by real-time quantitative reverse transcription PCR, single-cell gene expression analysis, flow cytometry, and immunohistochemical, immunoblot, and functional assays. Xenograft tumors were grown from control and KIT-knockdown DLD1 and UM-COLON#8 cells in immunocompromised mice and compared. Some mice were given the RTK inhibitor imatinib following injection of cancer cells; tumor growth was measured based on bioluminescence. We assessed tumorigenicity using limiting dilution analysis. Results KIT and KITLG were expressed heterogeneously by a subset of human colon tumors. Knockdown of KIT decreased proliferation of colon cancer cell lines and growth of xenograft tumors in mice, compared with control cells. KIT knockdown cells had increased expression of enterocyte markers, decreased expression of cycling genes, and, unexpectedly, increased expression of LGR5-associated genes. No activating mutations in KIT were detected in DLD1, POP77, or UM-COLON#8 cell lines. However, KITLG-knockdown DLD1 cells formed smaller xenograft tumors than control cells. Gene expression analysis of single CD44+ cells indicated that KIT may promote growth via KITLG autocrine and/or paracrine signaling. Imatinib inhibited growth of KIT+ colon cancer organoids in culture and growth of xenograft tumors in mice. Cancer cells with endogenous KIT expression were more tumorigenic in mice. Conclusions KIT and KITLG are expressed by a subset of human colon tumors. KIT signaling promotes growth of colon cancer cells and organoids in culture and xenograft tumors in mice via its ligand, KITLG, in an autocrine or paracrine manner. Patients with KIT-expressing colon tumors may benefit from KIT RTK inhibitors. PMID:26026391

  10. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    PubMed

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  11. Immunization of pigs with an attenuated pseudorabies virus recombinant expressing the haemagglutinin of pandemic swine origin H1N1 influenza A virus.

    PubMed

    Klingbeil, Katharina; Lange, Elke; Teifke, Jens P; Mettenleiter, Thomas C; Fuchs, Walter

    2014-04-01

    Pigs can be severely harmed by influenza, and represent important reservoir hosts, in which new human pathogens such as the recent pandemic swine-origin H1N1 influenza A virus can arise by mutation and reassortment of genome segments. To obtain novel, safe influenza vaccines for pigs, and to investigate the antigen-specific immune response, we modified an established live-virus vaccine against Aujeszky's disease of swine, pseudorabies virus (PrV) strain Bartha (PrV-Ba), to serve as vector for the expression of haemagglutinin (HA) of swine-origin H1N1 virus. To facilitate transgene insertion, the genome of PrV-Ba was cloned as a bacterial artificial chromosome. HA expression occurred under control of the human or murine cytomegalovirus immediate early promoters (P-HCMV, P-MCMV), but could be substantially enhanced by synthetic introns and adaptation of the codon usage to that of PrV. However, despite abundant expression, the heterologous glycoprotein was not detectably incorporated into mature PrV particles. Replication of HA-expressing PrV in cell culture was only slightly affected compared to that of the parental virus strain. A single immunization of pigs with the PrV vector expressing the codon-optimized HA gene under control of P-MCMV induced high levels of HA-specific antibodies. The vaccinated animals were protected from clinical signs after challenge with a related swine-origin H1N1 influenza A virus, and challenge virus shedding was significantly reduced.

  12. Development of an acid-resistant Salmonella Typhi Ty21a attenuated vector for improved oral vaccine delivery

    USDA-ARS?s Scientific Manuscript database

    The licensed oral, live-attenuated bacterial vaccine for typhoid fever, Salmonella Typhi strain Ty21a, has also been utilized as a vaccine delivery platform for expression of diverse foreign antigens that stimulate protection against shigellosis, anthrax, plague, or human papilloma virus. However, T...

  13. Recombinant acetylcholinesterase 1 of the sand fly Phlebotomus papatasi (Scopoli): expression, biochemical properties, and insensitivity to organophosphate inhibition

    USDA-ARS?s Scientific Manuscript database

    Phlebotomine sand flies are small hematophagous vectors of human and zoonotic leishmaniases present throughout tropical and subtropical areas of the world. These flies present serious problems for military operations and resident populations in the Middle East and other areas where they are endemic....

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kubo, Yoshinao; Yoshii, Hiroaki; Kamiyama, Haruka

    Ezrin, radixin, and moesin (ERM) proteins supply functional linkage between integral membrane proteins and cytoskeleton in mammalian cells to regulate membrane protein dynamisms and cytoskeleton rearrangement. To assess potential role of the ERM proteins in HIV-1 lifecycle, we examined if suppression of ERM function in human cells expressing HIV-1 infection receptors influences HIV-1 envelope (Env)-mediated HIV-1-vector transduction and cell-cell fusion. Expression of an ezrin dominant negative mutant or knockdown of ezrin, radixin, or moesin with siRNA uniformly decreased transduction titers of HIV-1 vectors having X4-tropic Env. In contrast, transduction titers of R5-tropic Env HIV-1 vectors were decreased only by radixinmore » knockdown: ezrin knockdown had no detectable effects and moesin knockdown rather increased transduction titer. Each of the ERM suppressions had no detectable effects on cell surface expression of CD4, CCR5, and CXCR4 or VSV-Env-mediated HIV-1 vector transductions. Finally, the individual knockdown of ERM mRNAs uniformly decreased efficiency of cell-cell fusion mediated by X4- or R5-tropic Env and HIV-1 infection receptors. These results suggest that (i) the ERM proteins function as positive regulators of infection by X4-tropic HIV-1, (ii) moesin additionally functions as a negative regulator of R5-tropic HIV-1 virus infection at the early step(s) after the membrane fusion, and (iii) receptor protein dynamisms are regulated differently in R5- and X4-tropic HIV-1 infections.« less

  15. Dual AAV therapy ameliorates exercise-induced muscle injury and functional ischemia in murine models of Duchenne muscular dystrophy.

    PubMed

    Zhang, Yadong; Yue, Yongping; Li, Liang; Hakim, Chady H; Zhang, Keqing; Thomas, Gail D; Duan, Dongsheng

    2013-09-15

    Neuronal nitric oxide synthase (nNOS) membrane delocalization contributes to the pathogenesis of Duchenne muscular dystrophy (DMD) by promoting functional muscle ischemia and exacerbating muscle injury during exercise. We have previously shown that supra-physiological expression of nNOS-binding mini-dystrophin restores normal blood flow regulation and prevents functional ischemia in transgenic mdx mice, a DMD model. A critical next issue is whether systemic dual adeno-associated virus (AAV) gene therapy can restore nNOS-binding mini-dystrophin expression and mitigate muscle activity-related functional ischemia and injury. Here, we performed systemic gene transfer in mdx and mdx4cv mice using a pair of dual AAV vectors that expressed a 6 kb nNOS-binding mini-dystrophin gene. Vectors were packaged in tyrosine mutant AAV-9 and co-injected (5 × 10(12) viral genome particles/vector/mouse) via the tail vein to 1-month-old dystrophin-null mice. Four months later, we observed 30-50% mini-dystrophin positive myofibers in limb muscles. Treatment ameliorated histopathology, increased muscle force and protected against eccentric contraction-induced injury. Importantly, dual AAV therapy successfully prevented chronic exercise-induced muscle force drop. Doppler hemodynamic assay further showed that therapy attenuated adrenergic vasoconstriction in contracting muscle. Our results suggest that partial transduction can still ameliorate nNOS delocalization-associated functional deficiency. Further evaluation of nNOS binding mini-dystrophin dual AAV vectors is warranted in dystrophic dogs and eventually in human patients.

  16. Expression of human choline kinase in NIH 3T3 fibroblasts increases the mitogenic potential of insulin and insulin-like growth factor I.

    PubMed

    Chung, T; Huang, J S; Mukherjee, J J; Crilly, K S; Kiss, Z

    2000-05-01

    In mammalian cells, growth factors, oncogenes, and carcinogens stimulate phosphocholine (PCho) synthesis by choline kinase (CK), suggesting that PCho may regulate cell growth. To validate the role of PCho in mitogenesis, we determined the effects of insulin, insulin-like growth factor I (IGF-I), and other growth factors on DNA synthesis in NIH 3T3 fibroblast sublines highly expressing human choline kinase (CK) without increasing phosphatidylcholine synthesis. In serum-starved CK expressor cells, insulin and IGF-I stimulated DNA synthesis, p70 S6 kinase (p70 S6K) activity, phosphatidylinositol 3-kinase (PI3K) activity, and activating phosphorylation of p42/p44 mitogen-activated protein kinases (MAPK) to greater extents than in the corresponding vector control cells. Furthermore, the CK inhibitor hemicholinium-3 (HC-3) inhibited insulin- and IGF-I-induced DNA synthesis in the CK overexpressors, but not in the vector control cells. The results indicate that high cellular levels of PCho potentiate insulin- and IGF-I-induced DNA synthesis by MAPK- and p70 S6K-regulated mechanisms.

  17. Safe and stable noninvasive focal gene delivery to the mammalian brain following focused ultrasound.

    PubMed

    Stavarache, Mihaela A; Petersen, Nicholas; Jurgens, Eric M; Milstein, Elizabeth R; Rosenfeld, Zachary B; Ballon, Douglas J; Kaplitt, Michael G

    2018-04-27

    OBJECTIVE Surgical infusion of gene therapy vectors has provided opportunities for biological manipulation of specific brain circuits in both animal models and human patients. Transient focal opening of the blood-brain barrier (BBB) by MR-guided focused ultrasound (MRgFUS) raises the possibility of noninvasive CNS gene therapy to target precise brain regions. However, variable efficiency and short follow-up of studies to date, along with recent suggestions of the potential for immune reactions following MRgFUS BBB disruption, all raise questions regarding the viability of this approach for clinical translation. The objective of the current study was to evaluate the efficiency, safety, and long-term stability of MRgFUS-mediated noninvasive gene therapy in the mammalian brain. METHODS Focused ultrasound under the control of MRI, in combination with microbubbles consisting of albumin-coated gas microspheres, was applied to rat striatum, followed by intravenous infusion of an adeno-associated virus serotype 1/2 (AAV1/2) vector expressing green fluorescent protein (GFP) as a marker. Following recovery, animals were followed from several hours up to 15 months. Immunostaining for GFP quantified transduction efficiency and stability of expression. Quantification of neuronal markers was used to determine histological safety over time, while inflammatory markers were examined for evidence of immune responses. RESULTS Transitory disruption of the BBB by MRgFUS resulted in efficient delivery of the AAV1/2 vector to the targeted rodent striatum, with 50%-75% of striatal neurons transduced on average. GFP transgene expression appeared to be stable over extended periods of time, from 2 weeks to 6 months, with evidence of ongoing stable expression as long as 16 months in a smaller cohort of animals. No evidence of substantial toxicity, tissue injury, or neuronal loss was observed. While transient inflammation from BBB disruption alone was noted for the first few days, consistent with prior observations, no evidence of brain inflammation was observed from 2 weeks to 6 months following MRgFUS BBB opening, despite delivery of a virus and expression of a foreign protein in target neurons. CONCLUSIONS This study demonstrates that transitory BBB disruption using MRgFUS can be a safe and efficient method for site-specific delivery of viral vectors to the brain, raising the potential for noninvasive focal human gene therapy for neurological disorders.

  18. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2013-07-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  19. Vaccination with Lentiviral Vector Expressing the nfa1 Gene Confers a Protective Immune Response to Mice Infected with Naegleria fowleri

    PubMed Central

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun

    2013-01-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321

  20. Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

    PubMed

    Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

    2013-01-01

    We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

Top