HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection

PubMed Central

Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara

2014-01-01

Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

PubMed Central

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

Transcriptional silencing of a transgene by RNAi in the soma of C. elegans.

PubMed

Grishok, Alla; Sinskey, Jina L; Sharp, Phillip A

2005-03-15

The silencing of transgene expression at the level of transcription in the soma of Caenorhabditis elegans through an RNAi-dependent pathway has not been previously characterized. Most gene silencing due to RNAi in C. elegans occurs at the post-transcriptional level. We observed transcriptional silencing when worms containing the elt-2::gfp/LacZ transgene were fed RNA produced from the commonly used L4440 vector. The transgene and the vector share plasmid backbone sequences. This transgene silencing depends on multiple RNAi pathway genes, including dcr-1, rde-1, rde-4, and rrf-1. Unlike post-transcriptional gene silencing in worms, elt-2::gfp/LacZ silencing is dependent on the PAZ-PIWI protein Alg-1 and on the HP1 homolog Hpl-2. The latter is a chromatin silencing factor, and expression of the transgene is inhibited at the level of intron-containing precursor mRNA. This inhibition is accompanied by a decrease in the acetylation of histones associated with the transgene. This transcriptional silencing in the soma can be distinguished from transgene silencing in the germline by its inability to be transmitted across generations and its dependence on the rde-1 gene. We therefore define this type of silencing as RNAi-induced Transcriptional Gene Silencing (RNAi-TGS). Additional chromatin-modifying components affecting RNAi-TGS were identified in a candidate RNAi screen.

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Small silencing RNAs: state-of-the-art.

PubMed

Grimm, Dirk

2009-07-25

Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.

RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.

PubMed

Rytlewski, Julie A; Beronja, Slobodan

2015-01-01

The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

Novel Methods for Mosquito Control using RNAi.

USDA-ARS?s Scientific Manuscript database

The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

The role of Homer 1a in increasing locomotor activity and non-selective attention, and impairing learning and memory abilities.

PubMed

Yang, Lei; Hong, Qin; Zhang, Min; Liu, Xiao; Pan, Xiao-Qin; Guo, Mei; Fei, Li; Guo, Xi-Rong; Tong, Mei-Ling; Chi, Xia

2013-06-17

The current study aimed to investigate the possible role of Homer 1a in the etiology and pathogenesis of attention deficit hyperactivity disorder (ADHD). We divided 32 rats into four groups. The rats in the RNAi-MPH group were given the lentiviral vector containing Homer 1a-specific miRNA (Homer 1a-RNAi-LV) by intracerebroventricular injection, and 7 days later they were given three daily doses of methylphenidate (MPH) by intragastric gavage. The RNAi-SAL group was given Homer 1a-RNAi-LV and saline later. The NC-MPH group was given the negative control lentiviral vector (NC-LV) and MPH later. The NC-SAL group was given NC-LV and saline later. Rats that were given Homer 1a RNAi exhibited increased locomotor activity and non-selective attention, and impaired learning and memory abilities, which is in line with the behavioral findings of animal models of ADHD. However, MPH ameliorated these abnormal behaviors. All findings indicated that Homer 1a may play an important role in the etiology and pathogenesis of ADHD. Copyright © 2013 Elsevier B.V. All rights reserved.

E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

PubMed Central

Horn, Thomas; Boutros, Michael

2010-01-01

The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

PubMed

Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

2017-04-01

The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

Genome characterization of Sugarcane Yellow Leaf Virus with special reference to RNAi based molecular breeding.

PubMed

Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen

2018-05-04

Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.

A novel and efficient gene transfer strategy reduces glial reactivity and improves neuronal survival and axonal growth in vitro.

PubMed

Desclaux, Mathieu; Teigell, Marisa; Amar, Lahouari; Vogel, Roland; Gimenez Y Ribotta, Minerva; Privat, Alain; Mallet, Jacques

2009-07-14

The lack of axonal regeneration in the central nervous system is attributed among other factors to the formation of a glial scar. This cellular structure is mainly composed of reactive astrocytes that overexpress two intermediate filament proteins, the glial fibrillary acidic protein (GFAP) and vimentin. Indeed, in vitro, astrocytes lacking GFAP or both GFAP and vimentin were shown to be the substrate for increased neuronal plasticity. Moreover, double knockout mice lacking both GFAP and vimentin presented lower levels of glial reactivity in vivo, significant axonal regrowth and improved functional recovery in comparison with wild-type mice after spinal cord hemisection. From these results, our objective was to develop a novel therapeutic strategy for axonal regeneration, based on the targeted suppression of astroglial reactivity and scarring by lentiviral-mediated RNA-interference (RNAi). In this study, we constructed two lentiviral vectors, Lv-shGFAP and Lv-shVIM, which allow efficient and stable RNAi-mediated silencing of endogenous GFAP or vimentin in vitro. In cultured cortical and spinal reactive astrocytes, the use of these vectors resulted in a specific, stable and highly significant decrease in the corresponding protein levels. In a second model -- scratched primary cultured astrocytes -- Lv-shGFAP, alone or associated with Lv-shVIM, decreased astrocytic reactivity and glial scarring. Finally, in a heterotopic coculture model, cortical neurons displayed higher survival rates and increased neurite growth when cultured with astrocytes in which GFAP and vimentin had been invalidated by lentiviral-mediated RNAi. Lentiviral-mediated knockdown of GFAP and vimentin in astrocytes show that GFAP is a key target for modulating reactive gliosis and monitoring neuron/glia interactions. Thus, manipulation of reactive astrocytes with the Lv-shGFAP vector constitutes a promising therapeutic strategy for increasing glial permissiveness and permitting axonal regeneration after central nervous system lesions.

Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver.

PubMed

Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A

2010-09-01

shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.

Identification of the CAD gene from Eucalyptus urophylla GLU4 and its functional analysis in transgenic tobacco.

PubMed

Chen, B W; Xiao, Y F; Li, J J; Liu, H L; Qin, Z H; Gai, Y; Jiang, X N

2016-12-02

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the final step in lignin biosynthesis. The genus Eucalyptus belongs to the family Myrtaceae, which is the main cultivated species in China. Eucalyptus urophylla GLU4 (GLU4) is widely grown in Guangxi. It is preferred for pulping because of its excellent cellulose content and fiber length. Based on GLU4 and CAD gene expression, a Eucalyptus variety low in lignin content should be obtained using transgenic technology, which could reduce the cost of pulp and improve the pulping rate, and have favorable prospects for application. However, the role and function of CAD in GLU4 is still unclear. In the present study, EuCAD was cloned from GLU4 and identified using bioinformatic tools. Subsequently, in order to evaluate its impact on lignin synthesis, a full-length EuCAD RNAi vector was constructed, and transgenic tobacco was obtained via Agrobacterium-mediated transformation. A significant decrease in CAD expression and lignin content in transgenic tobacco demonstrated a key role for EuCAD in lignin biosynthesis and established a regulatory role for RNAi. In our study, the direct molecular basis of EuCAD expression was determined, and the potential regulatory effects of this RNAi vector on lignin biosynthesis in E. urophylla GLU4 were demonstrated. Our results provide a theoretical basis for the study of lignin biosynthesis in Eucalyptus.

Inhibition of prohormone convertase 1 (PC1) expression in cholecystokinin (CCK) expressing At-T20 cells decreased cellular content and secretion of CCK and caused a shift in molecular forms of CCK secreted.

PubMed

Beinfeld, Margery C; Vishnuvardhan, Daesety; Blum, Alissa; Reynolds, Nicole; Fannous, Sanya; Kitagawa, Kouki; Marchand, James E

2006-04-01

Two different RNAi methods were used to inhibit the expression of prohormone convertase 1 (PC1) in At-T20 cells. Transient transfection of double stranded RNA and stable expression of a vector expressing hairpin-loop RNA targeting PC1 reduced cholecystokinin (CCK) secretion from At-T20 cells. PC1 mRNA and protein were also decreased in the vector transfected cells. This treatment caused a shift in the forms of cholecystokinin (CCK) secreted, decreasing CCK 22 and increasing CCK 8. Stable expression of RNAi effectively decreased PC1 expression. The observed decrease in CCK seen with these RNAi treatments further supports a role for PC1 in CCK processing in these cells.

Effects of down-regulating ornithine decarboxylase upon putrescine-associated metabolism and growth in Nicotiana tabacum L.

PubMed Central

Dalton, Heidi L.; Blomstedt, Cecilia K.; Neale, Alan D.; Gleadow, Ros; DeBoer, Kathleen D.; Hamill, John D.

2016-01-01

Transgenic plants of Nicotiana tabacum L. homozygous for an RNAi construct designed to silence ornithine decarboxylase (ODC) had significantly lower concentrations of nicotine and nornicotine, but significantly higher concentrations of anatabine, compared with vector-only controls. Silencing of ODC also led to significantly reduced concentrations of polyamines (putrescine, spermidine and spermine), tyramine and phenolamides (caffeoylputrescine and dicaffeoylspermidine) with concomitant increases in concentrations of amino acids ornithine, arginine, aspartate, glutamate and glutamine. Root transcript levels of S-adenosyl methionine decarboxylase, S-adenosyl methionine synthase and spermidine synthase (polyamine synthesis enzymes) were reduced compared with vector controls, whilst transcript levels of arginine decarboxylase (putrescine synthesis), putrescine methyltransferase (nicotine production) and multi-drug and toxic compound extrusion (alkaloid transport) proteins were elevated. In contrast, expression of two other key proteins required for alkaloid synthesis, quinolinic acid phosphoribosyltransferase (nicotinic acid production) and a PIP-family oxidoreductase (nicotinic acid condensation reactions), were diminished in roots of odc-RNAi plants relative to vector-only controls. Transcriptional and biochemical differences associated with polyamine and alkaloid metabolism were exacerbated in odc-RNAi plants in response to different forms of shoot damage. In general, apex removal had a greater effect than leaf wounding alone, with a combination of these injury treatments producing synergistic responses in some cases. Reduced expression of ODC appeared to have negative effects upon plant growth and vigour with some leaves of odc-RNAi lines being brittle and bleached compared with vector-only controls. Together, results of this study demonstrate that ornithine decarboxylase has important roles in facilitating both primary and secondary metabolism in Nicotiana. PMID:27126795

Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

PubMed

Poller, W; Fechner, H

2010-01-01

Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi.

PubMed

Swevers, Luc; Liu, Jisheng; Smagghe, Guy

2018-05-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products.

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi

PubMed Central

Liu, Jisheng

2018-01-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products. PMID:29723993

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Silencing Genes in the Heart.

PubMed

Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

2017-01-01

Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

Role of CCR5 and its ligands in the control of vascular inflammation and leukocyte recruitment required for acute excitotoxic seizure induction and neural damage

PubMed Central

Louboutin, Jean-Pierre; Chekmasova, Alena; Marusich, Elena; Agrawal, Lokesh; Strayer, David S.

2011-01-01

Chemokines may play a role in leukocyte migration across the blood-brain barrier (BBB) during neuroinflammation and other neuropathological processes, such as epilepsy. We investigated the role of the chemokine receptor CCR5 in seizures. We used a rat model based on intraperitoneal kainic acid (KA) administration. Four months before KA injection, adult rats were given femoral intramarrow inoculations of SV (RNAiR5-RevM10.AU1), which carries an interfering RNA (RNAi) against CCR5, plus a marker epitope (AU1), or its monofunctional RNAi-carrying homologue, SV(RNAiR5). This treatment lowered expression of CCR5 in circulating cells. In control rats, seizures induced elevated expression of CCR5 ligands MIP-1α and RANTES in the microvasculature, increased BBB leakage and CCR5+ cells, as well as neuronal loss, inflammation, and gliosis in the hippocampi. Animals given either the bifunctional or the monofunctional vector were largely protected from KA-induced seizures, neuroinflammation, BBB damage, and neuron loss. Brain CCR5 mRNA was reduced. Rats receiving RNAiR5-bearing vectors showed far greater repair responses: increased neuronal proliferation, and decreased production of MIP-1α and RANTES. Controls received unrelated SV(BUGT) vectors. Decrease in CCR5 in circulating cells strongly protected from excitotoxin-induced seizures, BBB leakage, CNS injury, and inflammation, and facilitated neurogenic repair.—Louboutin, J.-P., Chekmasova, A., Marusich, E., Agrawal, L., Strayer, D. S. Role of CCR5 and its ligands in the control of vascular inflammation and leukocyte recruitment required for acute excitotoxic seizure induction and neural damage. PMID:20940264

RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

USDA-ARS?s Scientific Manuscript database

The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

Identification of Short Hairpin RNA Targeting Foot-And-Mouth Disease Virus with Transgenic Bovine Fetal Epithelium Cells

PubMed Central

He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin

2012-01-01

Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

PubMed

Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

2017-01-01

The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

PubMed Central

Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

2017-01-01

ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

PubMed

Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

2017-01-01

Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

Construction of siRNA/miRNA expression vectors based on a one-step PCR process

PubMed Central

Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

2009-01-01

Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

The Transgenic RNAi Project at Harvard Medical School: Resources and Validation

PubMed Central

Perkins, Lizabeth A.; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J.; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E.; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

2015-01-01

To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT–qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT–qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). PMID:26320097

Improved annotation of the insect vector of citrus greening disease: biocuration by a diverse genomics community

PubMed Central

Hosmani, Prashant S.; Villalobos-Ayala, Krystal; Miller, Sherry; Shippy, Teresa; Flores, Mirella; Rosendale, Andrew; Cordola, Chris; Bell, Tracey; Mann, Hannah; DeAvila, Gabe; DeAvila, Daniel; Moore, Zachary; Buller, Kyle; Ciolkevich, Kathryn; Nandyal, Samantha; Mahoney, Robert; Van Voorhis, Joshua; Dunlevy, Megan; Farrow, David; Hunter, David; Morgan, Taylar; Shore, Kayla; Guzman, Victoria; Izsak, Allison; Dixon, Danielle E.; Cridge, Andrew; Cano, Liliana; Cao, Xiaolong; Jiang, Haobo; Leng, Nan; Johnson, Shannon; Cantarel, Brandi L.; Richards, Stephen; English, Adam; Shatters, Robert G.; Childers, Chris; Chen, Mei-Ju; Hunter, Wayne; Cilia, Michelle; Mueller, Lukas A.; Munoz-Torres, Monica; Nelson, David; Poelchau, Monica F.; Benoit, Joshua B.; Wiersma-Koch, Helen; D’Elia, Tom; Brown, Susan J.

2017-01-01

Abstract The Asian citrus psyllid (Diaphorina citri Kuwayama) is the insect vector of the bacterium Candidatus Liberibacter asiaticus (CLas), the pathogen associated with citrus Huanglongbing (HLB, citrus greening). HLB threatens citrus production worldwide. Suppression or reduction of the insect vector using chemical insecticides has been the primary method to inhibit the spread of citrus greening disease. Accurate structural and functional annotation of the Asian citrus psyllid genome, as well as a clear understanding of the interactions between the insect and CLas, are required for development of new molecular-based HLB control methods. A draft assembly of the D. citri genome has been generated and annotated with automated pipelines. However, knowledge transfer from well-curated reference genomes such as that of Drosophila melanogaster to newly sequenced ones is challenging due to the complexity and diversity of insect genomes. To identify and improve gene models as potential targets for pest control, we manually curated several gene families with a focus on genes that have key functional roles in D. citri biology and CLas interactions. This community effort produced 530 manually curated gene models across developmental, physiological, RNAi regulatory and immunity-related pathways. As previously shown in the pea aphid, RNAi machinery genes putatively involved in the microRNA pathway have been specifically duplicated. A comprehensive transcriptome enabled us to identify a number of gene families that are either missing or misassembled in the draft genome. In order to develop biocuration as a training experience, we included undergraduate and graduate students from multiple institutions, as well as experienced annotators from the insect genomics research community. The resulting gene set (OGS v1.0) combines both automatically predicted and manually curated gene models. Database URL: https://citrusgreening.org/ PMID:29220441

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.

PubMed

Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi

2011-01-01

Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.

The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight

PubMed Central

Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi

2011-01-01

Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

PubMed

Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

2014-07-01

Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

The Transgenic RNAi Project at Harvard Medical School: Resources and Validation.

PubMed

Perkins, Lizabeth A; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

2015-11-01

To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT-qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT-qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). Copyright © 2015 by the Genetics Society of America.

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

Preinfection of citrus by RB strains of Citrus tristeza virus (CTV) negatively affected expression of a modified T36 CTV vector

USDA-ARS?s Scientific Manuscript database

Genetically modified T36 Citrus tristeza virus (T36-mCTV) is showing promise in Florida to mitigate huanglongbing (HLB) by expressing antimicrobial peptides and RNAi against the presumed pathogen, “Candidatus Liberibacter asiaticus” (CLas), and its vector, the Asian citrus psyllid (ACP). To this end...

The MtDMI2-MtPUB2 Negative Feedback Loop Plays a Role in Nodulation Homeostasis1[OPEN

PubMed Central

Deng, Jie; Zhu, Fugui; Lu, Zheng

2018-01-01

DOES NOT MAKE INFECTION 2 (MtDMI2) is a Leu rich repeat-type receptor kinase required for signal transduction in the Medicago truncatula/Sinorhizobium meliloti symbiosis pathway. However, the mechanisms through which MtDMI2 participates in nodulation homeostasis are poorly understood. In this study, we identified MtPUB2—a novel plant U-box (PUB)–type E3 ligase—and showed that it interacts with MtDMI2. MtDMI2 and MtPUB2 accumulation were shown to be similar in various tissues. Roots of plants in which MtPUB2 was silenced by RNAi (MtPUB2-RNAi plants) exhibited impaired infection threads, fewer nodules, and shorter primary root lengths compared to those of control plants transformed with empty vector. Using liquid chromatography-tandem mass spectrometry, we showed that MtDMI2 phosphorylates MtPUB2 at Ser-316, Ser-421, and Thr-488 residues. When MtPUB2-RNAi plants were transformed with MtPUB2S421D, which mimics the phosphorylated state, MtDMI2 was persistently ubiquitinated and degraded by MtPUB2S421D, resulting in fewer nodules than observed in MtPUB2/MtPUB2-RNAi-complemented plants. However, MtPUB2S421A/MtPUB2-RNAi-complemented plants showed no MtPUB2 ubiquitination activity, and their nodulation phenotype was similar to that of MtPUB2-RNAi plants transformed with empty vector. Further studies demonstrated that these proteins form a negative feedback loop of the prey (MtDMI2)-predator (MtPUB2) type. Our results suggest that the MtDMI2-MtPUB2 negative feedback loop, which displays crosstalk with the long-distance autoregulation of nodulation via MtNIN, plays an important role in nodulation homeostasis. PMID:29440269

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

PubMed Central

Wuriyanghan, Hada; Falk, Bryce W.

2013-01-01

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

Highly efficient and specific modulation of cardiac calcium homeostasis by adenovector-derived short hairpin RNA targeting phospholamban.

PubMed

Fechner, H; Suckau, L; Kurreck, J; Sipo, I; Wang, X; Pinkert, S; Loschen, S; Rekittke, J; Weger, S; Dekkers, D; Vetter, R; Erdmann, V A; Schultheiss, H-P; Paul, M; Lamers, J; Poller, W

2007-02-01

Impaired function of the phospholamban (PLB)-regulated sarcoplasmic reticulum Ca(2+) pump (SERCA2a) contributes to cardiac dysfunction in heart failure (HF). PLB downregulation may increase SERCA2a activity and improve cardiac function. Small interfering (si)RNAs mediate efficient gene silencing by RNA interference (RNAi). However, their use for in vivo gene therapy is limited by siRNA instability in plasma and tissues, and by low siRNA transfer rates into target cells. To address these problems, we developed an adenoviral vector (AdV) transcribing short hairpin (sh)RNAs against rat PLB and evaluated its potential to silence the PLB gene and to modulate SERCA2a-mediated Ca(2+) sequestration in primary neonatal rat cardiomyocytes (PNCMs). Over a period of 13 days, vector transduction resulted in stable > 99.9% ablation of PLB-mRNA at a multiplicity of infection of 100. PLB protein gradually decreased until day 7 (7+/-2% left), whereas SERCA, Na(+)/Ca(2+) exchanger (NCX1), calsequestrin and troponin I protein remained unchanged. PLB silencing was associated with a marked increase in ATP-dependent oxalate-supported Ca(2+) uptake at 0.34 microM of free Ca(2+), and rapid loss of responsiveness to protein kinase A-dependent stimulation of Ca(2+) uptake was maintained until day 7. In summary, these results indicate that AdV-derived PLB-shRNA mediates highly efficient, specific and stable PLB gene silencing and modulation of active Ca(2+) sequestration in PNCMs. The availability of the new vector now enables employment of RNAi for the treatment of HF in vivo.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

PubMed

Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

2018-03-21

Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

HR38, an ortholog of NR4A family nuclear receptors, mediates 20-hydroxyecdysone regulation of carbohydrate metabolism during mosquito reproduction.

PubMed

Dong, Dujuan; Zhang, Yang; Smykal, Vlastimil; Ling, Lin; Raikhel, Alexander S

2018-05-01

The Aedes aegypti mosquito is the principal vector for many dangerous human viral diseases. Carbohydrate metabolism (CM) is essential for supplying the energy necessary for host seeking, blood digestion and rapid egg development of this vector insect. The steroid hormone 20-hydroxyecdysone (20E) and the ecdysone receptor (EcR) are important regulators of CM, coordinating it with female reproductive events. We report here that the NR4A nuclear receptor AHR38 plays a critical role in mediating these actions of 20E and EcR. AHR38 RNA interference (RNAi) depletion in female mosquitoes blocked the transcriptional activation of CM genes encoding phosphoglucomutase (PGM) and trehalose-6-phophate synthase (TPS); it caused an increase of glycogen accumulation and a decrease of the circulating sugar trehalose. This treatment also resulted in a dramatic reduction in fecundity. Considering that these phenotypes resulting from AHR38 RNAi depletion are similar to those of EcR RNAi, we investigated a possible connection between these transcription factors in CM regulation. EcR RNAi inhibits the AHR38 gene expression. Moreover, the 20E-induced EcR complex directly activates AHR38 by binding to the ecdysone response element (EcRE) in the upstream regulatory region of this gene. The present work has implicated AHR38 in the 20E-mediated control of CM and provided new insight into mechanisms of 20E regulation of metabolism during female mosquito reproduction. © 2018 Published by Elsevier Ltd.

Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

PubMed

Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

2008-03-17

RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

PubMed

Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

2015-09-01

Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

Dendrimer Nanovectors for SiRNA Delivery.

PubMed

Liu, Xiaoxuan; Peng, Ling

2016-01-01

Small interfering RNA (SiRNA) delivery remains a major challenge in RNAi-based therapy. Dendrimers are emerging as appealing nonviral vectors for SiRNA delivery thanks to their well-defined architecture and their unique cooperativity and multivalency confined within a nanostructure. We have recently demonstrated that structurally flexible poly(amidoamine) (PAMAM) dendrimers are safe and effective nanovectors for SiRNA delivery in various disease models in vitro and in vivo. The present chapter showcases these dendrimers can package different SiRNA molecules into stable and nanosized particles, which protect SiRNA from degradation and promote cellular uptake of SiRNA, resulting in potent gene silencing at both mRNA and protein level in the prostate cancer cell model. Our results demonstrate this set of flexible PAMAM dendrimers are indeed safe and effective nonviral vectors for SiRNA delivery and hold great promise for further applications in functional genomics and RNAi-based therapies.

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

Automated cell analysis tool for a genome-wide RNAi screen with support vector machine based supervised learning

NASA Astrophysics Data System (ADS)

Remmele, Steffen; Ritzerfeld, Julia; Nickel, Walter; Hesser, Jürgen

2011-03-01

RNAi-based high-throughput microscopy screens have become an important tool in biological sciences in order to decrypt mostly unknown biological functions of human genes. However, manual analysis is impossible for such screens since the amount of image data sets can often be in the hundred thousands. Reliable automated tools are thus required to analyse the fluorescence microscopy image data sets usually containing two or more reaction channels. The herein presented image analysis tool is designed to analyse an RNAi screen investigating the intracellular trafficking and targeting of acylated Src kinases. In this specific screen, a data set consists of three reaction channels and the investigated cells can appear in different phenotypes. The main issue of the image processing task is an automatic cell segmentation which has to be robust and accurate for all different phenotypes and a successive phenotype classification. The cell segmentation is done in two steps by segmenting the cell nuclei first and then using a classifier-enhanced region growing on basis of the cell nuclei to segment the cells. The classification of the cells is realized by a support vector machine which has to be trained manually using supervised learning. Furthermore, the tool is brightness invariant allowing different staining quality and it provides a quality control that copes with typical defects during preparation and acquisition. A first version of the tool has already been successfully applied for an RNAi-screen containing three hundred thousand image data sets and the SVM extended version is designed for additional screens.

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

PubMed

Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

2018-06-01

Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

Clathrin-mediated Endocytosis and Subsequent Endo-Lysosomal Trafficking of Adeno-associated Virus/Phage*

PubMed Central

Stoneham, Charlotte A.; Hollinshead, Michael; Hajitou, Amin

2012-01-01

Adeno-associated virus/phage (AAVP) is a gene delivery vector constructed as a hybrid between adeno-associated virus and filamentous phage. Tumor targeting following systemic administration has previously been demonstrated in several in vivo cancer models, with tumor specificity achieved through display of an αv integrin-targeting ligand on the capsid. However, high titers of AAVP are required for transduction of large numbers of mammalian cells. This study is the first to investigate the mechanisms involved in entry and intracellular trafficking of AAVP. Using a combination of flow cytometry, confocal, and electron microscopy techniques, together with pharmacological agents, RNAi and dominant negative mutants, we have demonstrated that targeted AAVP endocytosis is both dynamin and clathrin-dependent. Following entry, the majority of AAVP particles are sequestered by the endosomal-lysosomal degradative pathway. Finally, we have demonstrated that disruption of this pathway leads to improved transgene expression by AAVP, thus demonstrating that escape from the late endosomes/lysosomes is a critical step for improving gene delivery by AAVP. These findings have important implications for the rational design of improved AAVP and RGD-targeted vectors. PMID:22915587

RNAi-mediated down-regulation of SHATTERPROOF gene in transgenic oilseed rape.

PubMed

Kord, Hadis; Shakib, Ali Mohammad; Daneshvar, Mohammad Hossein; Azadi, Pejman; Bayat, Vahid; Mashayekhi, Mohsen; Zarea, Mahboobeh; Seifi, Alireza; Ahmad-Raji, Mana

2015-06-01

Oilseed rape is one of the important oil plants. Pod shattering is one of the problems in oilseed rape production especially in regions with dry conditions. One of the important genes in Brassica pod opening is SHATTERPROOF1 (SHP1). Down-regulation of BnSHP1 expression by RNAi can increase resistance to pod shattering. A 470 bp of the BnSHP1 cDNA sequence constructed in an RNAi-silencing vector was transferred to oilseed rape cv. SLM046. Molecular analysis of T2 transgenic plants by RT-PCR and Real-time PCR showed that expression of the BnSHP alleles was highly decreased in comparison with control plants. Morphologically, transgenic plants were normal and produced seeds at greenhouse conditions. At ripening, stage pods failed to shatter, and a finger pressure was needed for pod opening.

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

[GPER silence inhibits the stimulation of growth and inhibition of apoptosis induced by tamoxifen in breast cancer-associated fibroblasts].

PubMed

Yan, Yuzhao; Yu, Tenghua; Tu, Gang; Liu, Manran; Yuan, Jie; Yang, Guanglun

2015-09-01

To construct a lentiviral vector (Lenti-GPER-shRNA) targeting G-protein coupled estrogen receptor (GPER) and explore the role of GPER in the effect of tamoxifen on cell proliferation and apoptosis in breast cancer associated fibroblasts (BCAFs). The target sequence of GPER gene and negative control were cloned into lentiviral vectors. The recombinant lentivirus and control were extracted after HEK293T cells were transfected with the recombinant vector and helper vectors. After infection of BCAFs with the GPER lentiviral vector under the best interfering condition, GPER expression was detected by real-time quantitative PCR and Western blotting. BCAFs were divided into negative control group, GPER-RNAi group, negative control combined with tamoxifen (10(-8) mmol/L) group and GPER-RNAi combined with tamoxifen (10(-8) mmol/L) group. CCK-8 assay was used to detect the proliferation and annexin V-fluorescein isothiocyanate/propidium iodide (annexin V-FITC/PI) combined with flow cytometry was used to detect the apoptosis of BCAFs after the treatment of tamoxifen. Lenti-GPER-shRNA significantly interfered the expression of GPER in BCAFs. Tamoxifen promoted the growth of BCAFs, which could be attenuated by knockdown of GPER. Moreover, the apoptosis of BCAFs was reduced by tamoxifen, which was also reversed by knockdown of GPER. Lenti-GPER-shRNA could effectively silence the GPER expression in BCAFs. The ability of tamoxifen to accelerate cell proliferation and decrease cell apoptosis could be weakened by knockdown of GPER.

Role of RNA interference in plant improvement

NASA Astrophysics Data System (ADS)

Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

2011-06-01

Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

RNAi screening comes of age: improved techniques and complementary approaches

PubMed Central

Mohr, Stephanie E.; Smith, Jennifer A.; Shamu, Caroline E.; Neumüller, Ralph A.; Perrimon, Norbert

2014-01-01

Gene silencing through sequence-specific targeting of mRNAs by RNAi has enabled genome-wide functional screens in cultured cells and in vivo in model organisms. These screens have resulted in the identification of new cellular pathways and potential drug targets. Considerable progress has been made to improve the quality of RNAi screen data through the development of new experimental and bioinformatics approaches. The recent availability of genome-editing strategies, such as the CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system, when combined with RNAi, could lead to further improvements in screen data quality and follow-up experiments, thus promoting our understanding of gene function and gene regulatory networks. PMID:25145850

Research Area 14.3 Microbiology and Biodegradation: Development of RNA-based Vectors for in vivo Delivery of siRNAs

DTIC Science & Technology

2014-09-08

P.O. Box 12211 Research Triangle Park, NC 27709-2211 Vector, RNAi, delivery REPORT DOCUMENTATION PAGE 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 10...suggesstions for reducing this burden, to Washington Headquarters Services , Directorate for Information Operations and Reports, 1215 Jefferson Davis...Shapiro, Alissa M Pham, Benjamin R tenOever. In Vivo Delivery of Cytoplasmic RNA Virus-derived miRNAs, Molecular Therapy, (11 2011): 0. doi

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

PubMed Central

Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

PubMed

Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

PubMed

Galdeano, Diogo Manzano; Breton, Michèle Claire; Lopes, João Roberto Spotti; Falk, Bryce W; Machado, Marcos Antonio

2017-01-01

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB). The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi) has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA). In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

Design of a peptide-based vector, PepFect6, for efficient delivery of siRNA in cell culture and systemically in vivo

PubMed Central

EL Andaloussi, Samir; Lehto, Taavi; Mäger, Imre; Rosenthal-Aizman, Katri; Oprea, Iulian I.; Simonson, Oscar E.; Sork, Helena; Ezzat, Kariem; Copolovici, Dana M.; Kurrikoff, Kaido; Viola, Joana R.; Zaghloul, Eman M.; Sillard, Rannar; Johansson, Henrik J.; Said Hassane, Fatouma; Guterstam, Peter; Suhorutšenko, Julia; Moreno, Pedro M. D.; Oskolkov, Nikita; Hälldin, Jonas; Tedebark, Ulf; Metspalu, Andres; Lebleu, Bernard; Lehtiö, Janne; Smith, C. I. Edvard; Langel, Ülo

2011-01-01

While small interfering RNAs (siRNAs) have been rapidly appreciated to silence genes, efficient and non-toxic vectors for primary cells and for systemic in vivo delivery are lacking. Several siRNA-delivery vehicles, including cell-penetrating peptides (CPPs), have been developed but their utility is often restricted by entrapment following endocytosis. Hence, developing CPPs that promote endosomal escape is a prerequisite for successful siRNA implementation. We here present a novel CPP, PepFect 6 (PF6), comprising the previously reported stearyl-TP10 peptide, having pH titratable trifluoromethylquinoline moieties covalently incorporated to facilitate endosomal release. Stable PF6/siRNA nanoparticles enter entire cell populations and rapidly promote endosomal escape, resulting in robust RNAi responses in various cell types (including primary cells), with minimal associated transcriptomic or proteomic changes. Furthermore, PF6-mediated delivery is independent of cell confluence and, in most cases, not significantly hampered by serum proteins. Finally, these nanoparticles promote strong RNAi responses in different organs following systemic delivery in mice without any associated toxicity. Strikingly, similar knockdown in liver is achieved by PF6/siRNA nanoparticles and siRNA injected by hydrodynamic infusion, a golden standard technique for liver transfection. These results imply that the peptide, in addition to having utility for RNAi screens in vitro, displays therapeutic potential. PMID:21245043

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome-wide RNAi screening identifies host restriction factors critical for in vivo AAV transduction

PubMed Central

Mano, Miguel; Ippodrino, Rudy; Zentilin, Lorena; Zacchigna, Serena; Giacca, Mauro

2015-01-01

Viral vectors based on the adeno-associated virus (AAV) hold great promise for in vivo gene transfer; several unknowns, however, still limit the vectors’ broader and more efficient application. Here, we report the results of a high-throughput, whole-genome siRNA screening aimed at identifying cellular factors regulating AAV transduction. We identified 1,483 genes affecting vector efficiency more than 4-fold and up to 50-fold, either negatively or positively. Most of these factors have not previously been associated to AAV infection. The most effective siRNAs were independent from the virus serotype or analyzed cell type and were equally evident for single-stranded and self-complementary AAV vectors. A common characteristic of the most effective siRNAs was the induction of cellular DNA damage and activation of a cell cycle checkpoint. This information can be exploited for the development of more efficient AAV-based gene delivery procedures. Administration of the most effective siRNAs identified by the screening to the liver significantly improved in vivo AAV transduction efficiency. PMID:26305933

Nonionic surfactant vesicles for delivery of RNAi therapeutics

PubMed Central

Paecharoenchai, Orapan; Teng, Lesheng; Yung, Bryant C; Teng, Lirong; Opanasopit, Praneet; Lee, Robert J

2014-01-01

RNAi is a promising potential therapeutic approach for many diseases. A major barrier to its clinical translation is the lack of efficient delivery systems for siRNA. Among nonviral vectors, nonionic surfactant vesicles (niosomes) have shown a great deal of promise in terms of their efficacy and toxicity profiles. Nonionic surfactants have been shown to be a superior alternative to phospholipids in several studies. There is a large selection of surfactants with various properties that have been incorporated into niosomes. Therefore, there is great potential for innovation in terms of nisome composition. This article summarizes recent advancements in niosome technology for the delivery of siRNA. PMID:24156490

Suppressing tawny crazy ant (Nylanderia fulva) by RNAi technology.

PubMed

Meng, Jia; Lei, Jiaxin; Davitt, Andrew; Holt, Jocelyn R; Huang, Jian; Gold, Roger; Vargo, Edward L; Tarone, Aaron M; Zhu-Salzman, Keyan

2018-05-22

The tawny crazy ant (Nylanderia fulva) is a new invasive pest in the United States. At present, its management mainly relies on the use of synthetic insecticides, which are generally ineffective at producing lasting control of the pest, necessitating alternative environmentally friendly measures. In this study, we evaluated the feasibility of gene silencing to control this ant species. Six housekeeping genes encoding actin (NfActin), coatomer subunit β (NfCOPβ), arginine kinase (NfArgK), and V-type proton ATPase subunits A (NfvATPaseA), B (NfvATPaseB) and E (NfvATPaseE) were cloned. Phylogenetic analysis revealed high sequence similarity to homologs from other ant species, particularly the Florida carpenter ant (Camponotus floridanus). To silence these genes, vector L4440 was used to generate 6 specific RNAi constructs for bacterial expression. Heat-inactivated, dsRNA-expressing Escherichia coli were incorporated into artificial diet. Worker ants exhibited reduced endogenous gene expression after feeding on such diet for 9 days. However, only ingestion of dsRNAs of NfCOPβ (a gene involved in protein trafficking) and NfArgK (a cellular energy reserve regulatory gene in invertebrates) caused modest but significantly higher ant mortality than the control. These results suggest that bacterially expressed dsRNA can be orally delivered to ant cells as a mean to target its vulnerabilities. Improved efficacy is necessary for the RNAi-based approach to be useful in tawny crazy ant management. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Selective gene silencing by viral delivery of short hairpin RNA

PubMed Central

2010-01-01

RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

Transmission bottlenecks and RNAi collectively influence tick-borne flavivirus evolution.

PubMed

Grubaugh, Nathan D; Rückert, Claudia; Armstrong, Philip M; Bransfield, Angela; Anderson, John F; Ebel, Gregory D; Brackney, Doug E

2016-07-01

Arthropod-borne RNA viruses exist within hosts as heterogeneous populations of viral variants and, as a result, possess great genetic plasticity. Understanding the micro-evolutionary forces shaping these viruses can provide insights into how they emerge, adapt, and persist in new and changing ecological niches. While considerable attention has been directed toward studying the population dynamics of mosquito-borne viruses, little is known about tick-borne virus populations. Therefore, using a mouse and Ixodes scapularis tick transmission model, we examined Powassan virus (POWV; Flaviviridae, Flavivirus ) populations in and between both the vertebrate host and arthropod vector. We found that genetic bottlenecks, RNAi-mediated diversification, and selective constraints collectively influence POWV evolution. Together, our data provide a mechanistic explanation for the slow, long-term evolutionary trends of POWV, and suggest that all arthropod-borne viruses encounter similar selective pressures at the molecular level (i.e. RNAi), yet evolve much differently due to their unique rates and modes of transmission.

Effect of NeuroD gene silencing on the migration and invasion of human pancreatic cancer cells PANC-1.

PubMed

Wang, Yang; Su, Dong Wei; Gao, Li; Ding, Gui Ling; Ni, Can Rong; Zhu, Ming Hua

2014-07-01

The aim of this study is to investigate the influence of Lenti-EGFP-NeuroD-miR, RNAi lentiviral expression vector, on the expression level of NeuroD and migration, and invasion of PANC-1 cell line. PANC-1 cells were cultured and cotransfected with Lenti-EGFP-NeuroD-miR and Lenti-GFP. The infection rate of lentivirus was determined by fluorescence. The interfering effection by the expression of NeuroD mRNA in PANC-1 cells was analyzed by real-time PCR after transfected. Biological behavior of PANC-1 cells transinfected was observed, and the migration and invasion were studied by transwell assay. Intrapancreatic allografts model in nude mice was established to observe the effects of NeuroD on tumorigenesis, tumor growth, and invasion in vivo. The expression of NeuroD mRNA decreased significantly after RNAi lentivirus transinfecting PANC-1 cell. The cell's migration and invasion ability decreased obviously as soon as down regulate of NeuroD in PANC-1 cells. Comparing with control group, the tumors were smaller in size and the invasiveness was inhibited after 8 weeks intrapancreatic allografts in nude mice. Lenti-EGFP-NeuroD-miR transfected into PANC-1 cells shows a stable, effective, and especial blocking expression of NeuroD in mRNA level. The RNAi of lentiviral vector target NeuroD can reduce the migration and invasion abilities of PANC-1 cells.

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

In vivo RNAi: Today and Tomorrow

PubMed Central

Perrimon, Norbert; Ni, Jian-Quan; Perkins, Lizabeth

2010-01-01

SUMMARY RNA interference (RNAi) provides a powerful reverse genetics approach to analyze gene functions both in tissue culture and in vivo. Because of its widespread applicability and effectiveness it has become an essential part of the tool box kits of model organisms such as Caenorhabditis elegans, Drosophila, and the mouse. In addition, the use of RNAi in animals in which genetic tools are either poorly developed or nonexistent enables a myriad of fundamental questions to be asked. Here, we review the methods and applications of in vivo RNAi to characterize gene functions in model organisms and discuss their impact to the study of developmental as well as evolutionary questions. Further, we discuss the applications of RNAi technologies to crop improvement, pest control and RNAi therapeutics, thus providing an appreciation of the potential for phenomenal applications of RNAi to agriculture and medicine. PMID:20534712

RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.

PubMed

Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu

2017-04-01

Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

PubMed Central

Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

2014-01-01

In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

RNAi technologies in agricultural biotechnology: The Toxicology Forum 40th Annual Summer Meeting.

PubMed

Sherman, James H; Munyikwa, Tichafa; Chan, Stephen Y; Petrick, Jay S; Witwer, Kenneth W; Choudhuri, Supratim

2015-11-01

During the 40th Annual Meeting of The Toxicology Forum, the current and potential future science, regulations, and politics of agricultural biotechnology were presented and discussed. The meeting session described herein focused on the technology of RNA interference (RNAi) in agriculture. The general process by which RNAi works, currently registered RNAi-based plant traits, example RNAi-based traits in development, potential use of double stranded RNA (dsRNA) as topically applied pesticide active ingredients, research related to the safety of RNAi, biological barriers to ingested dsRNA, recent regulatory RNAi science reviews, and regulatory considerations related to the use of RNAi in agriculture were discussed. Participants generally agreed that the current regulatory framework is robust and appropriate for evaluating the safety of RNAi employed in agricultural biotechnology and were also supportive of the use of RNAi to develop improved crop traits. However, as with any emerging technology, the potential range of future products, potential future regulatory frameworks, and public acceptance of the technology will continue to evolve. As such, continuing dialogue was encouraged to promote education of consumers and science-based regulations. Copyright © 2015 Elsevier Inc. All rights reserved.

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

RNAi-based strategy for Asian citrus psyllid (Diaphorina citri) Control: A method to reduce the spread of citrus greening disease

USDA-ARS?s Scientific Manuscript database

Citrus greening disease is a serious bacterial disease of citrus worldwide and is vectored by the Asian citrus pysllid (Diaphorina Citri). The only effective control strategy includes vigorous control of the psyllid, primarily through heavy reliance on pesticides. As a more sustainable and environm...

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

Transgenic strategies to confer resistance against viruses in rice plants

PubMed Central

Sasaya, Takahide; Nakazono-Nagaoka, Eiko; Saika, Hiroaki; Aoki, Hideyuki; Hiraguri, Akihiro; Netsu, Osamu; Uehara-Ichiki, Tamaki; Onuki, Masatoshi; Toki, Seichi; Saito, Koji; Yatou, Osamu

2014-01-01

Rice (Oryza sativa L.) is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. Many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA interference (RNAi), also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral “Achilles’ heel” gene to target for RNAi attack when engineering plants. PMID:24454308

Single-cell analysis of population context advances RNAi screening at multiple levels

PubMed Central

Snijder, Berend; Sacher, Raphael; Rämö, Pauli; Liberali, Prisca; Mench, Karin; Wolfrum, Nina; Burleigh, Laura; Scott, Cameron C; Verheije, Monique H; Mercer, Jason; Moese, Stefan; Heger, Thomas; Theusner, Kristina; Jurgeit, Andreas; Lamparter, David; Balistreri, Giuseppe; Schelhaas, Mario; De Haan, Cornelis A M; Marjomäki, Varpu; Hyypiä, Timo; Rottier, Peter J M; Sodeik, Beate; Marsh, Mark; Gruenberg, Jean; Amara, Ali; Greber, Urs; Helenius, Ari; Pelkmans, Lucas

2012-01-01

Isogenic cells in culture show strong variability, which arises from dynamic adaptations to the microenvironment of individual cells. Here we study the influence of the cell population context, which determines a single cell's microenvironment, in image-based RNAi screens. We developed a comprehensive computational approach that employs Bayesian and multivariate methods at the single-cell level. We applied these methods to 45 RNA interference screens of various sizes, including 7 druggable genome and 2 genome-wide screens, analysing 17 different mammalian virus infections and four related cell physiological processes. Analysing cell-based screens at this depth reveals widespread RNAi-induced changes in the population context of individual cells leading to indirect RNAi effects, as well as perturbations of cell-to-cell variability regulators. We find that accounting for indirect effects improves the consistency between siRNAs targeted against the same gene, and between replicate RNAi screens performed in different cell lines, in different labs, and with different siRNA libraries. In an era where large-scale RNAi screens are increasingly performed to reach a systems-level understanding of cellular processes, we show that this is often improved by analyses that account for and incorporate the single-cell microenvironment. PMID:22531119

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing.

PubMed

Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A

2013-08-01

Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Potential and development of inhaled RNAi therapeutics for the treatment of pulmonary tuberculosis.

PubMed

Man, Dede K W; Chow, Michael Y T; Casettari, Luca; Gonzalez-Juarrero, Mercedes; Lam, Jenny K W

2016-07-01

Tuberculosis (TB), caused by the infection of Mycobacterium tuberculosis (Mtb), continues to pose a serious threat to public health, and the situation is worsening with the rapid emergence of multidrug resistant (MDR) TB. Current TB regimens require long duration of treatment, and their toxic side effects often lead to poor adherence and low success rates. There is an urgent need for shorter and more effective treatment for TB. In recent years, RNA interference (RNAi) has become a powerful tool for studying gene function by silencing the target genes. The survival of Mtb in host macrophages involves the attenuation of the antimicrobial responses mounted by the host cells. RNAi technology has helped to improve our understanding of how these bacilli interferes with the bactericidal effect and host immunity during TB infection. It has been suggested that the host-directed intervention by modulation of host pathways can be employed as a novel and effective therapy against TB. This therapeutic approach could be achieved by RNAi, which holds enormous potential beyond a laboratory to the clinic. RNAi therapy targeting TB is being investigated for enhancing host antibacterial capacity or improving drug efficacy on drug resistance strains while minimizing the associated adverse effects. One of the key challenges of RNAi therapeutics arises from the delivery of the RNAi molecules into the target cells, and inhalation could serve as a direct administration route for the treatment of pulmonary TB in a non-invasive manner. However, there are still major obstacles that need to be overcome. This review focuses on the RNAi candidates that are currently explored for the treatment of TB and discusses the major barriers of pulmonary RNAi delivery. From this, we hope to stimulate further studies of local RNAi therapeutics for pulmonary TB treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Intrajugular Vein Delivery of AAV9-RNAi Prevents Neuropathological Changes and Weight Loss in Huntington's Disease Mice

PubMed Central

Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L

2014-01-01

Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Precision breeding for RNAi suppression of a major 4-coumarate:coenzyme A ligase gene improves cell wall saccharification from field grown sugarcane.

PubMed

Jung, Je Hyeong; Kannan, Baskaran; Dermawan, Hugo; Moxley, Geoffrey W; Altpeter, Fredy

2016-11-01

Sugarcane (Saccharum spp. hybrids) is a major feedstock for commercial bioethanol production. The recent integration of conversion technologies that utilize lignocellulosic sugarcane residues as well as sucrose from stem internodes has elevated bioethanol yields. RNAi suppression of lignin biosynthetic enzymes is a successful strategy to improve the saccharification of lignocellulosic biomass. 4-coumarate:coenzyme A ligase (4CL) is a key enzyme in the biosynthesis of phenylpropanoid metabolites, such as lignin and flavonoids. Identifying a major 4CL involved in lignin biosynthesis among multiple isoforms with functional divergence is key to manipulate lignin biosynthesis. In this study, two full length 4CL genes (Sh4CL1 and Sh4CL2) were isolated and characterized in sugarcane. Phylogenetic, expression and RNA interference (RNAi) analysis confirmed that Sh4CL1 is a major lignin biosynthetic gene. An intragenic precision breeding strategy may facilitate the regulatory approval of the genetically improved events and was used for RNAi suppression of Sh4CL1. Both, the RNAi inducing cassette and the expression cassette for the mutated ALS selection marker consisted entirely of DNA sequences from sugarcane or the sexually compatible species Sorghum bicolor. Field grown sugarcane with intragenic RNAi suppression of Sh4CL1 resulted in reduction of the total lignin content by up to 16.5 % along with altered monolignol ratios without reduction in biomass yield. Mature, field grown, intragenic sugarcane events displayed 52-76 % improved saccharification efficiency of lignocellulosic biomass compared to wild type (WT) controls. This demonstrates for the first time that an intragenic approach can add significant value to lignocellulosic feedstocks for biofuel and biochemical production.

New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing.

PubMed

Koch, Aline; Kogel, Karl-Heinz

2014-09-01

RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

Widespread spinal cord transduction by intrathecal injection of rAAV delivers efficacious RNAi therapy for amyotrophic lateral sclerosis.

PubMed

Wang, Hongyan; Yang, Bin; Qiu, Linghua; Yang, Chunxing; Kramer, Joshua; Su, Qin; Guo, Yansu; Brown, Robert H; Gao, Guangping; Xu, Zuoshang

2014-02-01

Amyotrophic lateral sclerosis (ALS) causes motor neuron degeneration and paralysis. No treatment can significantly slow or arrest the disease progression. Mutations in the SOD1 gene cause a subset of familial ALS by a gain of toxicity. In principle, these cases could be treated with RNAi that destroys the mutant mRNA, thereby abolishing the toxic protein. However, no system is available to efficiently deliver the RNAi therapy. Recombinant adenoassociated virus (rAAV) is a promising vehicle due to its long-lasting gene expression and low toxicity. However, ALS afflicts broad areas of the central nervous system (CNS). A lack of practical means to spread rAAV broadly has hindered its application in treatment of ALS. To overcome this barrier, we injected several rAAV serotypes into the cerebrospinal fluid. We found that some rAAV serotypes such as rAAVrh10 and rAAV9 transduced cells throughout the length of the spinal cord following a single intrathecal injection and in the broad forebrain following a single injection into the third ventricle. Furthermore, a single intrathecal injection of rAAVrh10 robustly transduced motor neurons throughout the spinal cord in a non-human primate. These results suggested a therapeutic potential of this vector for ALS. To test this, we injected a rAAVrh10 vector that expressed an artificial miRNA targeting SOD1 into the SOD1G93A mice. This treatment knocked down the mutant SOD1 expression and slowed the disease progression. Our results demonstrate the potential of rAAVs for delivering gene therapy to treat ALS and other diseases that afflict broad areas of the CNS.

Biodegradable charged polyester-based vectors (BCPVs) as an efficient non-viral transfection nanoagent for gene knockdown of the BCR-ABL hybrid oncogene in a human chronic myeloid leukemia cell line

NASA Astrophysics Data System (ADS)

Yang, Chengbin; Panwar, Nishtha; Wang, Yucheng; Zhang, Butian; Liu, Maixian; Toh, Huiting; Yoon, Ho Sup; Tjin, Swee Chuan; Chong, Peter Han Joo; Law, Wing-Cheung; Chen, Chih-Kuang; Yong, Ken-Tye

2016-04-01

First-line therapy of chronic myelogenous leukemia (CML) has always involved the use of BCR-ABL tyrosine-kinase inhibitors which is associated with an abnormal chromosome called Philadelphia chromosome. Although the overall survival rate has been improved by the current therapeutic regime, the presence of resistance has resulted in limited efficacy. In this study, an RNA interference (RNAi)-based therapeutic regime is proposed with the aim to knockdown the BCR-ABL hybrid oncogene using small interfering RNA (siRNA). The siRNA transfection rates have usually been limited due to the declining contact probability among polyplexes and the non-adherent nature of leukemic cells. Our work aims at addressing this limitation by using a biodegradable charged polyester-based vector (BCPV) as a nanocarrier for the delivery of BCR-ABL-specific siRNA to the suspension culture of a K562 CML cell line. BCR-ABL siRNAs were encapsulated in the BCPVs by electrostatic force. Cell internalization was facilitated by the BCPV and assessed by confocal microscopy and flow cytometry. The regulation of the BCR-ABL level in K562 cells as a result of RNAi was analyzed by real-time polymerase chain reaction (RT-PCR). We observed that BCPV was able to form stable nanoplexes with siRNA molecules, even in the presence of fetal bovine serum (FBS), and successfully assisted in vitro siRNA transfection in the non-adherent K562 cells. As a consequence of downregulation of BCR-ABL, BCPV-siRNA nanoplexes inhibited cell proliferation and promoted cell apoptosis. All results were compared with a commercial transfection reagent, Lipofectamine2000™, which served as a positive control. More importantly, this class of non-viral vector exhibits biodegradable features and negligible cytotoxicity, thus providing a versatile platform to deliver siRNA to non-adherent leukemia cells with high transfection efficiency by effectively overcoming extra- and intra-cellular barriers. Due to the excellent in vitro transfection results from BCPV-siRNA, a newly developed biodegradable transfection agent, BCPV, is being probed for transfection performance in an animal model.

MPEG-CS/Bmi-1RNAi Nanoparticles Synthesis and Its Targeted Inhibition Effect on CD133+ Laryngeal Stem Cells.

PubMed

Wei, Xudong; He, Jian; Wang, Jingyu; Wang, Wei

2018-03-01

Previous studies have confirmed that CD133+ cells in laryngeal tumor tissue have the characteristics of cancer stem cells. Bmi-1 gene expression is central to the tumorigenicity of CD133+ cells. In this study, we tried to develop a new siRNA carrier system using chitosan-methoxypolyethylene nanoparticles (CS-mPEG-NPs) that exhibit higher tumor-targeting ability and enhanced gene silencing efficacy in CD133+ tumor stem cells. It is hoped to block the self-renewal and kill the stem cells of laryngeal carcinoma. The mPEG-CS-Bmi-1RNAi-NPs were synthesized and their characters were checked. The changes in invasion ability and sensitivity to radiotherapy and chemotherapy of CD133+Hep-2 tumor cells were observed after Bmi-1 gene silencing. The mPEG-CS-Bmi-1RNAi-NPs synthesized in this experiment have a regular spherical form, a mean size of 139.70 ±6.40 nm, an encapsulation efficiency of 85.21 ± 1.94%, with drug loading capacity of 18.47 ± 1.83%, as well as low cytotoxicity, providing good protection to the loaded gene, strong resistance to nuclease degradation and high gene transfection efficiency. After Bmi-1 gene silencing, the invasion ability of CD133+ cells was weakened. Co-cultured with paclitaxel, the survival rates of CD133+Bmi-1RNAi cells were lower. After radiotherapy, the mean growth inhibition rate of CD133+/Bmi-1RNAi cells was significantly lower than CD133+ cells. In conclusion, the mPEG-CS nano-carrier is an ideal vector in gene therapy, while silencing the Bmi-1 gene can enhance the sensitivity of CD133+ tumor stem cells to chemoradiotherapy and abate their invasion ability.

La Crosse bunyavirus nonstructural protein NSs serves to suppress the type I interferon system of mammalian hosts.

PubMed

Blakqori, Gjon; Delhaye, Sophie; Habjan, Matthias; Blair, Carol D; Sánchez-Vargas, Irma; Olson, Ken E; Attarzadeh-Yazdi, Ghassem; Fragkoudis, Rennos; Kohl, Alain; Kalinke, Ulrich; Weiss, Siegfried; Michiels, Thomas; Staeheli, Peter; Weber, Friedemann

2007-05-01

La Crosse virus (LACV) is a mosquito-transmitted member of the Bunyaviridae family that causes severe encephalitis in children. For the LACV nonstructural protein NSs, previous overexpression studies with mammalian cells had suggested two different functions, namely induction of apoptosis and inhibition of RNA interference (RNAi). Here, we demonstrate that mosquito cells persistently infected with LACV do not undergo apoptosis and mount a specific RNAi response. Recombinant viruses that either express (rLACV) or lack (rLACVdelNSs) the NSs gene similarly persisted and were prone to the RNAi-mediated resistance to superinfection. Furthermore, in mosquito cells overexpressed LACV NSs was unable to inhibit RNAi against Semliki Forest virus. In mammalian cells, however, the rLACVdelNSs mutant virus strongly activated the antiviral type I interferon (IFN) system, whereas rLACV as well as overexpressed NSs suppressed IFN induction. Consequently, rLACVdelNSs was attenuated in IFN-competent mouse embryo fibroblasts and animals but not in systems lacking the type I IFN receptor. In situ analyses of mouse brains demonstrated that wild-type and mutant LACV mainly infect neuronal cells and that NSs is able to suppress IFN induction in the central nervous system. Thus, our data suggest little relevance of the NSs-induced apoptosis or RNAi inhibition for growth or pathogenesis of LACV in the mammalian host and indicate that NSs has no function in the insect vector. Since deletion of the viral NSs gene can be fully complemented by inactivation of the host's IFN system, we propose that the major biological function of NSs is suppression of the mammalian innate immune response.

Flowering-Related RING Protein 1 (FRRP1) Regulates Flowering Time and Yield Potential by Affecting Histone H2B Monoubiquitination in Rice (Oryza Sativa).

PubMed

Du, Yiwei; He, Wei; Deng, Changwang; Chen, Xi; Gou, Lanming; Zhu, Fugui; Guo, Wei; Zhang, Jianfu; Wang, Tao

2016-01-01

Flowering time is a critical trait for crops cultivated under various temperature/photoperiod conditions around the world. To understand better the flowering time of rice, we used the vector pTCK303 to produce several lines of RNAi knockdown transgenic rice and investigated their flowering times and other agronomic traits. Among them, the heading date of FRRP1-RNAi knockdown transgenic rice was 23-26 days earlier than that of wild-type plants. FRRP1 is a novel rice gene that encodes a C3HC4-type Really Interesting Novel Gene (RING) finger domain protein. In addition to the early flowering time, FRRP1-RNAi knockdown transgenic rice caused changes on an array of agronomic traits, including plant height, panicle length and grain length. We analyzed the expression of some key genes associated with the flowering time and other agronomic traits in the FRRP1-RNAi knockdown lines and compared with that in wild-type lines. The expression of Hd3a increased significantly, which was the key factor in the early flowering time. Further experiments showed that the level of histone H2B monoubiquitination (H2Bub1) was noticeably reduced in the FRRP1-RNAi knockdown transgenic rice lines compared with wild-type plants and MBP-FRRP1-F1 was capable of self-ubiquitination. The results indicate that Flowering Related RING Protein 1 (FRRP1) is involved in histone H2B monoubiquitination and suggest that FRRP1 functions as an E3 ligase in vivo and in vitro. In conclusion, FRRP1 probably regulates flowering time and yield potential in rice by affecting histone H2B monoubiquitination, which leads to changes in gene expression in multiple processes.

Flowering-Related RING Protein 1 (FRRP1) Regulates Flowering Time and Yield Potential by Affecting Histone H2B Monoubiquitination in Rice (Oryza Sativa)

PubMed Central

Deng, Changwang; Chen, Xi; Gou, Lanming; Zhu, Fugui; Guo, Wei; Zhang, Jianfu; Wang, Tao

2016-01-01

Flowering time is a critical trait for crops cultivated under various temperature/photoperiod conditions around the world. To understand better the flowering time of rice, we used the vector pTCK303 to produce several lines of RNAi knockdown transgenic rice and investigated their flowering times and other agronomic traits. Among them, the heading date of FRRP1-RNAi knockdown transgenic rice was 23–26 days earlier than that of wild-type plants. FRRP1 is a novel rice gene that encodes a C3HC4-type Really Interesting Novel Gene (RING) finger domain protein. In addition to the early flowering time, FRRP1-RNAi knockdown transgenic rice caused changes on an array of agronomic traits, including plant height, panicle length and grain length. We analyzed the expression of some key genes associated with the flowering time and other agronomic traits in the FRRP1-RNAi knockdown lines and compared with that in wild-type lines. The expression of Hd3a increased significantly, which was the key factor in the early flowering time. Further experiments showed that the level of histone H2B monoubiquitination (H2Bub1) was noticeably reduced in the FRRP1-RNAi knockdown transgenic rice lines compared with wild-type plants and MBP-FRRP1-F1 was capable of self-ubiquitination. The results indicate that Flowering Related RING Protein 1 (FRRP1) is involved in histone H2B monoubiquitination and suggest that FRRP1 functions as an E3 ligase in vivo and in vitro. In conclusion, FRRP1 probably regulates flowering time and yield potential in rice by affecting histone H2B monoubiquitination, which leads to changes in gene expression in multiple processes. PMID:26934377

Local alignment vectors reveal cancer cell-induced ECM fiber remodeling dynamics

PubMed Central

Lee, Byoungkoo; Konen, Jessica; Wilkinson, Scott; Marcus, Adam I.; Jiang, Yi

2017-01-01

Invasive cancer cells interact with the surrounding extracellular matrix (ECM), remodeling ECM fiber network structure by condensing, degrading, and aligning these fibers. We developed a novel local alignment vector analysis method to quantitatively measure collagen fiber alignment as a vector field using Circular Statistics. This method was applied to human non-small cell lung carcinoma (NSCLC) cell lines, embedded as spheroids in a collagen gel. Collagen remodeling was monitored using second harmonic generation imaging under normal conditions and when the LKB1-MARK1 pathway was disrupted through RNAi-based approaches. The results showed that inhibiting LKB1 or MARK1 in NSCLC increases the collagen fiber alignment and captures outward alignment vectors from the tumor spheroid, corresponding to high invasiveness of LKB1 mutant cancer cells. With time-lapse imaging of ECM micro-fiber morphology, the local alignment vector can measure the dynamic signature of invasive cancer cell activity and cell-migration-induced ECM and collagen remodeling and realigning dynamics. PMID:28045069

Developing an Alternanthera mosaic virus vector for efficient clonging of Whitefly cDNA RNAi to screen gene function

USDA-ARS?s Scientific Manuscript database

Alternanthera mosaic virus (AltMV; genus Potexvirus) is distinguished from the type member of the genus, Potato virus X by features of viral movement and variation within triple gene block protein 1 (TGB1). AltMV TGB1 variants TGB1L88 and TGB1P88 confer strong and weak silencing suppression, respect...

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

RNAi-mediated germline knockdown of FABP4 increases body weight but does not improve the deranged nutrient metabolism of diet-induced obese mice.

PubMed

Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A

2011-02-01

To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.

Analysis of Nuclear RNA Interference (RNAi) in Human Cells by Subcellular Fractionation and Argonaute Loading

PubMed Central

Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.

2014-01-01

RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

Knockdown of nuclease activity in the gut enhances RNAi efficiency in the Colorado potato beetle, Leptinotarsa decemlineata, but not in the desert locust, Schistocerca gregaria.

PubMed

Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef

2017-02-01

The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Altered lignin biosynthesis improves cellulosic bioethanol production in transgenic maize plants down-regulated for cinnamyl alcohol dehydrogenase.

PubMed

Fornalé, Silvia; Capellades, Montserrat; Encina, Antonio; Wang, Kan; Irar, Sami; Lapierre, Catherine; Ruel, Katia; Joseleau, Jean-Paul; Berenguer, Jordi; Puigdomènech, Pere; Rigau, Joan; Caparrós-Ruiz, David

2012-07-01

Cinnamyl alcohol dehydrogenase (CAD) is a key enzyme involved in the last step of monolignol biosynthesis. The effect of CAD down-regulation on lignin production was investigated through a transgenic approach in maize. Transgenic CAD-RNAi plants show a different degree of enzymatic reduction depending on the analyzed tissue and show alterations in cell wall composition. Cell walls of CAD-RNAi stems contain a lignin polymer with a slight reduction in the S-to-G ratio without affecting the total lignin content. In addition, these cell walls accumulate higher levels of cellulose and arabinoxylans. In contrast, cell walls of CAD-RNAi midribs present a reduction in the total lignin content and of cell wall polysaccharides. In vitro degradability assays showed that, although to a different extent, the changes induced by the repression of CAD activity produced midribs and stems more degradable than wild-type plants. CAD-RNAi plants grown in the field presented a wild-type phenotype and produced higher amounts of dry biomass. Cellulosic bioethanol assays revealed that CAD-RNAi biomass produced higher levels of ethanol compared to wild-type, making CAD a good target to improve both the nutritional and energetic values of maize lignocellulosic biomass.

RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

PubMed

Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

2017-01-01

Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea

PubMed Central

Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L.; Mukherjee, Sunil Kumar

2017-01-01

Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea. PMID:29077738

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

PubMed

Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

2015-01-01

We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed Central

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.

2016-01-01

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N

2016-02-26

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Overcoming diabetes-induced hyperglycemia through inhibition of hepatic phosphoenolpyruvate carboxykinase (GTP) with RNAi.

PubMed

Gómez-Valadés, Alicia G; Vidal-Alabró, Anna; Molas, Maria; Boada, Jordi; Bermúdez, Jordi; Bartrons, Ramon; Perales, José C

2006-02-01

Phosphoenolpyruvate carboxykinase (PEPCK; EC 4.1.1.32) is the rate-controlling enzyme in gluconeogenesis. In diabetic individuals, altered rates of gluconeogenesis are responsible for increased hepatic glucose output and sustained hyperglycemia. Liver-specific inhibition of PEPCK has not been assessed to date as a treatment for diabetes. We have designed a therapeutic, vector-based RNAi approach to induce posttranscriptional gene silencing of hepatic PEPCK using nonviral gene delivery. A transient reduction of PEPCK enzymatic activity (7.6 +/- 0.6 vs 9.7 +/- 1.1 mU/mg, P < 0.05) that correlated with decreased protein content of up to 50% was achieved using this strategy in diabetic mice. PEPCK partial silencing was sufficient to demonstrate lowered blood glucose (218 +/- 26 vs 364 +/- 33 mg/dl, P < 0.001) and improved glucose tolerance together with decreased circulating FFA (0.89 +/- 0.10 vs 1.44 +/- 0.11 mEq/dl, P < 0.001) and TAG (65 +/- 11 vs 102 +/- 16 mg/dl, P < 0.01), in the absence of liver steatosis or lactic acidosis. SREBP1c was down-regulated in PEPCK-silenced animals, suggesting a role for this pathway in the alterations of lipid metabolism. These data reinforce the significance of PEPCK in sustaining diabetes-induced hyperglycemia and validate liver-specific intervention at the level of PEPCK for diabetes gene therapy.

Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.

PubMed

Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A

2018-05-01

RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.

Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests

PubMed Central

Gillet, François-Xavier; Garcia, Rayssa A.; Macedo, Leonardo L. P.; Albuquerque, Erika V. S.; Silva, Maria C. M.; Grossi-de-Sa, Maria F.

2017-01-01

Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil (Anthonomus grandis), we showed that the chimeric protein PTD-DRBD (peptide transduction domain—dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests. PMID:28503153

Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests.

PubMed

Gillet, François-Xavier; Garcia, Rayssa A; Macedo, Leonardo L P; Albuquerque, Erika V S; Silva, Maria C M; Grossi-de-Sa, Maria F

2017-01-01

Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil ( Anthonomus grandis ), we showed that the chimeric protein PTD-DRBD (peptide transduction domain-dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests.

Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

PubMed

Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

2013-01-01

The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

Virus induced gene silencing (VIGS) for functional analysis of wheat genes involved in Zymoseptoria tritici susceptibility and resistance.

PubMed

Lee, Wing-Sham; Rudd, Jason J; Kanyuka, Kostya

2015-06-01

Virus-induced gene silencing (VIGS) has emerged as a powerful reverse genetic technology in plants supplementary to stable transgenic RNAi and, in certain species, as a viable alternative approach for gene functional analysis. The RNA virus Barley stripe mosaic virus (BSMV) was developed as a VIGS vector in the early 2000s and since then it has been used to study the function of wheat genes. Several variants of BSMV vectors are available, with some requiring in vitro transcription of infectious viral RNA, while others rely on in planta production of viral RNA from DNA-based vectors delivered to plant cells either by particle bombardment or Agrobacterium tumefaciens. We adapted the latest generation of binary BSMV VIGS vectors for the identification and study of wheat genes of interest involved in interactions with Zymoseptoria tritici and here present detailed and the most up-to-date protocols. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Glycogen and Glucose Metabolism Are Essential for Early Embryonic Development of the Red Flour Beetle Tribolium castaneum

PubMed Central

Fraga, Amanda; Ribeiro, Lupis; Lobato, Mariana; Santos, Vitória; Silva, José Roberto; Gomes, Helga; da Cunha Moraes, Jorge Luiz; de Souza Menezes, Jackson

2013-01-01

Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis) and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3) and hexokinase (HexA) genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi) of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen. PMID:23750237

Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.

Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana

DOE PAGES

Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...

2016-02-17

Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield

PubMed Central

Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

2017-01-01

RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3, a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA-HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing dsHaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera. Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls. PMID:28867769

Suppressing dengue-2 infection by chemical inhibition of Aedes aegypti host factors.

PubMed

Kang, Seokyoung; Shields, Alicia R; Jupatanakul, Natapong; Dimopoulos, George

2014-08-01

Dengue virus host factors (DENV HFs) that are essential for the completion of the infection cycle in the mosquito vector and vertebrate host represent potent targets for transmission blocking. Here we investigated whether known mammalian DENV HF inhibitors could influence virus infection in the arthropod vector A. aegypti. We evaluated the potency of bafilomycin (BAF; inhibitor of vacuolar H+-ATPase (vATPase)), mycophenolic acid (MPA; inhibitor of inosine-5'-monophosphate dehydrogenase (IMPDH)), castanospermine (CAS; inhibitor of glucosidase), and deoxynojirimycin (DNJ; inhibitor of glucosidase) in blocking DENV infection of the mosquito midgut, using various treatment methods that included direct injection, ingestion by sugar feeding or blood feeding, and silencing of target genes by RNA interference (RNAi). Injection of BAF (5 µM) and MPA (25 µM) prior to feeding on virus-infected blood inhibited DENV titers in the midgut at 7 days post-infection by 56% and 60%, and in the salivary gland at 14 days post-infection by 90% and 83%, respectively, while treatment of mosquitoes with CAS or DNJ did not affect susceptibility to the virus. Ingestion of BAF and MPA through a sugar meal or together with an infectious blood meal also resulted in various degrees of virus inhibition. RNAi-mediated silencing of several vATPase subunit genes and the IMPDH gene resulted in a reduced DENV infection, thereby indicating that BAF- and MPA-mediated virus inhibition in adult mosquitoes most likely occurred through the inhibition of these DENV HFs. The route and timing of BAF and MPA administration was essential, and treatment after exposure to the virus diminished the antiviral effect of these compounds. Here we provide proof-of-principle that chemical inhibition or RNAi-mediated depletion of the DENV HFs vATPase and IMPDH can be used to suppress DENV infection of adult A. aegypti mosquitoes, which may translate to a reduction in DENV transmission.

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.

PubMed

Gonzalez-Alegre, Pedro

2007-04-01

RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.

The effect of down regulation of calcineurin Aα by lentiviral vector-mediated RNAi on the biological behavior of small-cell lung cancer and its bone metastasis.

PubMed

Ma, Ning-Qiang; Liu, Li-Li; Min, Jie; Wang, Jun-Wei; Jiang, Wei-Feng; Liu, Yan; Feng, Yan-Guo; Su, Hai-Chuan; Feng, Ying-Ming; Zhang, He-Long

2011-12-01

Bone is the third most common site of cancer metastasis. Over 30 to 40% of lung cancers can develop skeletal metastasis and no effective curative therapy exists in clinic cases. Previously we screened the different expression of proteins between SBC-5 cells and SBC-3 cells by proteomic study methods (MALDI-TOF/TOF-MS) and found that calcineurin (hereafter referred as Cn) overexpresses in SBC-5 which has special priority in metastasis to bone in a multiple-organ metastasis mice model. However the roles of Cn in osteotropism of SCLC remain to be elucidated. At present study, we decrease CnAα expression in SBC-5 by lentiviral vector-mediated RNAi and found that down regulation of CnAα gene expression can decrease the proliferation and colony formation rate, impede the cell cycle progression, reduce the cell migration and invasion, and inhibit cells adhering to bone matrix, but not change the apoptosis rate of SBC-5 in vitro. In vivo down or up regulation of CnAα gene expression can only decrease or increase the bone metastasis rate, but not affect the metastasis rate to the visceral organs. Our research reveals that CnAα is closely related to the osteotropism metastasis of SCLC and a candidate tumor promotor gene for developing bone metastases.

Summary of bi-shRNA/GM-CSF augmented autologous tumor cell immunotherapy (FANG™) in advanced cancer of the liver.

PubMed

Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil

2014-01-01

Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Genome-wide identification and characterization of microRNAs differenytially expressed in fibers in a cotton phytochrome A1 RNAi line

USDA-ARS?s Scientific Manuscript database

Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...

RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

PubMed Central

Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

2016-01-01

Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

Adapting rice anther culture to gene transformation and RNA interference.

PubMed

Chen, Caiyan; Xiao, Han; Zhang, Wenli; Wang, Aiju; Xia, Zhihui; Li, Xiaobing; Zhai, Wenxue; Cheng, Zhukuan; Zhu, Lihuang

2006-10-01

Anther culture offers a rapid method of generating homozygous lines for breeding program and genetic analysis. To produce homozygous transgenic lines of rice (Oryza sativa L.) in one step, we developed an efficient protocol of anther-callus-based transformation mediated by Agrobacterium after optimizing several factors influencing efficient transformation, including callus induction and Agrobacterium density for co-cultivation. Using this protocol, we obtained 145 independent green transformants from five cultivars of japonica rice by transformation with a binary vector pCXK1301 bearing the rice gene, Xa21 for resistance to bacterial blight, of which 140 were further confirmed by PCR and Southern hybridization analysis, including haploids (32.1%), diploids (62.1%) and mixoploids (7.5%). Fifteen diploids were found to be doubled haploids, which accounted for 10.7% of the total positive lines. Finally, by including 28 from colchicine induced or spontaneous diploidization of haploids later after transformation, a total of 43 doubled haploids (30.7%) of Xa21 transgenic lines were obtained. We also generated two RNAi transgenic haploids of the rice OsMADS2 gene, a putative redundant gene of OsMADS4 based on their sequence similarity, to investigate its possible roles in rice flower development by this method. Flowers from the two OsMADS2 RNAi transgenic haploids displayed obvious homeotic alternations, in which lodicules were transformed into palea/lemma-like tissues, whereas identities of other floral organs were maintained. The phenotypic alternations were proved to result from specific transcriptional suppression of OsMADS2 gene by the introduced RNAi transgene. The results confirmed that OsMADS2 is involved in lodicule development of rice flower and functionally redundant with OsMADS4 gene. Our results demonstrated that rice anther culture could be adapted to gene transformation and RNAi analysis in rice.

Justification of Fuzzy Declustering Vector Quantization Modeling in Classification of Genotype-Image Phenotypes

NASA Astrophysics Data System (ADS)

Ng, Theam Foo; Pham, Tuan D.; Zhou, Xiaobo

2010-01-01

With the fast development of multi-dimensional data compression and pattern classification techniques, vector quantization (VQ) has become a system that allows large reduction of data storage and computational effort. One of the most recent VQ techniques that handle the poor estimation of vector centroids due to biased data from undersampling is to use fuzzy declustering-based vector quantization (FDVQ) technique. Therefore, in this paper, we are motivated to propose a justification of FDVQ based hidden Markov model (HMM) for investigating its effectiveness and efficiency in classification of genotype-image phenotypes. The performance evaluation and comparison of the recognition accuracy between a proposed FDVQ based HMM (FDVQ-HMM) and a well-known LBG (Linde, Buzo, Gray) vector quantization based HMM (LBG-HMM) will be carried out. The experimental results show that the performances of both FDVQ-HMM and LBG-HMM are almost similar. Finally, we have justified the competitiveness of FDVQ-HMM in classification of cellular phenotype image database by using hypotheses t-test. As a result, we have validated that the FDVQ algorithm is a robust and an efficient classification technique in the application of RNAi genome-wide screening image data.

Effect of down-regulation of voltage-gated sodium channel Nav1.7 on activation of astrocytes and microglia in DRG in rats with cancer pain.

PubMed

Pan, Jun; Lin, Xiang-Jin; Ling, Zhi-Heng; Cai, You-Zhi

2015-05-01

To evaluate the effect of down-regulation of Nav1.7 on the activation of astrocytes and microglia in DRG of rats with cancer pain, and explore the transmission of the nociceptive information. Lentiviral vector harboring RNAi sequence targeting the Nav1.7 gene was constructed, and Walker 256 breast cancer cell and morphine was injected to build the bone cancer pain model and morphine tolerance model in rats. Lentiviral vector was injected. Rats in each model were divided into 4 groups: model group, PBS group, vehicle group and LV-Nav1.7 group. The expression levels of GFAP and OX42 in dorsal root ganglia (DRG) were measured. After the animal model was built, the level of Nav1.7, GFAP and OX42 was improved obviously with the time prolonged, which was statistically significant (P<0.05). The expression level of GFAP and OX42 in the DRG in the LV-Nav1.7 group declined obviously compared to the model group, PBS group and vehicle group (P<0.05). Intrathecal injection of Navl.7 shRNA lentiviral vector can reduce the expression of Nav1.7 and inhibit the activation of astrocytes and microglia in DRG. The effort is also effective in morphine tolerance bone cancer pain model rats. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

Effective mRNA Inhibition in PANC-1 Cells in Vitro Mediated via an mPEG-SeSe-PEI Delivery System.

PubMed

Zhang, Yuefeng; Yang, Bin; Liu, Yajie; Qin, Wenjie; Li, Chao; Wang, Lantian; Zheng, Wen; Wu, Yulian

2016-05-01

RNA interference (RNAi)-mediated gene therapy is a promising approach to cure various diseases. However, developing an effective, safe, specific RNAi delivery system remains a major challenge. In this study, a novel redox-responsive polyetherimide (PEI)-based nanovector, mPEG-SeSe-PEI, was developed and its efficacy evaluated. We prepared three mPEG-SeSe-PEI vector candidates for small interfering glyceraldehyde-3-phosphate dehydrogenase (siGADPH) and determined their physiochemical properties and transfection efficiency using flow cytometry and PEG11.6-SeSe-PEI polymer. We investigated the silencing efficacy of GADPH mRNA expression in PANC-1 cells and observed that PEG11.6-SeSe-PEI/siGADPH (N/P ratio=10) polyplexes possessed the appropriate size and zeta-potential and exhibited excellent in vitro gene silencing effects with the least cytotoxicity in PANC-1 cells. In conclusion, we present PEG11.6-SeSe-PEI as a potential therapeutic gene delivery system for small interfering RNA (siRNA).

Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

PubMed

Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

2014-03-01

Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

Viral Delivery of dsRNA for Control of Insect Agricultural Pests and Vectors of Human Disease: Prospects and Challenges

PubMed Central

Kolliopoulou, Anna; Taning, Clauvis N. T.; Smagghe, Guy; Swevers, Luc

2017-01-01

RNAi is applied as a new and safe method for pest control in agriculture but efficiency and specificity of delivery of dsRNA trigger remains a critical issue. Various agents have been proposed to augment dsRNA delivery, such as engineered micro-organisms and synthetic nanoparticles, but the use of viruses has received relatively little attention. Here we present a critical view of the potential of the use of recombinant viruses for efficient and specific delivery of dsRNA. First of all, it requires the availability of plasmid-based reverse genetics systems for virus production, of which an overview is presented. For RNA viruses, their application seems to be straightforward since dsRNA is produced as an intermediate molecule during viral replication, but DNA viruses also have potential through the production of RNA hairpins after transcription. However, application of recombinant virus for dsRNA delivery may not be straightforward in many cases, since viruses can encode RNAi suppressors, and virus-induced silencing effects can be determined by the properties of the encoded RNAi suppressor. An alternative is virus-like particles that retain the efficiency and specificity determinants of natural virions but have encapsidated non-replicating RNA. Finally, the use of viruses raises important safety issues which need to be addressed before application can proceed. PMID:28659820

Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens

DTIC Science & Technology

2011-10-01

vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

PubMed

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

[Improvement and the mechanism of cardiac function by knockdown of ADAM10 in adriamycin-induced cardiomyopathy rats].

PubMed

Li, Xiaoou; Xie, Lili; He, Bing; Huang, Wei

2018-01-01

Objective To study the role of a disintegrin and metalloproteinase10 (ADAM10) in shedding neural cadherin (N-cadherin) and develop an approach to interfere the process of ventricular remodeling in adriamycin-induced cardiomyopathy (ACM) rats. Methods In a rat model of ACM, the effects of intraperitoneal injection of the lentiviral RNAi vector of ADAM10 on the morphology of cardiomyocytes and contractile function were observed by HE staining and color Doppler echocardiography. The expressions of N-cadherin and C-terminal fragment 1 (CTF1) were detected by Western blotting and immunohistochemistry. Results In the in vivo experiment, a large amount of fluorescence was seen in the isolated primary cardiomyocytes, which indicated that the transfection in the rat model was successful. In the treatment group, the morphology of cardiomyocytes and function of the heart were evidently improved, N-cadherin protein expression was remarkably up-regulated and CTF1 protein was obviously down-regulated compared with the model group. Conclusion Knock-down of ADAM10 increases N-cadherin expression and decreases CTF1 expression, thus improves cardiac function in the rat model of ACM.

Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting

PubMed Central

De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.

2007-01-01

RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355

Engineering host-derived resistance against plant parasites through RNA interference: challenges and opportunities.

PubMed

Runo, Steven

2011-01-01

RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

RNAi-mediated resistance to viruses in genetically engineered plants.

PubMed

Ibrahim, Abdulrazak B; Aragão, Francisco J L

2015-01-01

RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.

MicroRNA-275 and its target Vitellogenin-2 are crucial in ovary development and blood digestion of Haemaphysalis longicornis.

PubMed

Hao, Jiawei; Luo, Jin; Chen, Ze; Ren, Qiaoyun; Guo, Jinxia; Liu, Xiaocui; Chen, Qiuyu; Wu, Feng; Wang, Zhen; Luo, Jianxun; Yin, Hong; Wang, Hui; Liu, Guangyuan

2017-05-22

The hard tick Haemaphysalis longicornis is widely distributed in eastern Asia, New Zealand and Australia and is considered the major vector of Theileria and Babesia, harmful parasites to humans and animals. Female ticks need successful blood meals to complete the life-cycle. Therefore, elucidation of the underlying molecular mechanisms of H. longicornis development and reproduction is considered important for developing control strategies against the tick and tick-borne pathogens. Luciferase assays were used to identify the targets of micro RNA miR-275 in vitro. RNAi of Vitellogenin (Vg) was used in phenotype rescue experiments of ticks with miR-275 inhibition, and these analyses were used to identify the authentic target of miR-275 in vivo. The expression of miR-275 in different tissues and developmental stages of ticks was assessed by real-time PCR. To elucidate the functions of miR-275 in female ticks, we injected a miR-275 antagomir into female ticks and observed the phenotypic changes. Statistical analyses were performed with GraphPad5 using Student's t-test. In this study, we identified Vg-2 as an authentic target of miR-275 both in vitro and in vivo by luciferase assays and phenotype rescue experiments. miR-275 plays the regulatory role in a tissue-specific manner and differentially in developmental stages. Silencing of miR-275 resulted in blood digestion problems, substantially impaired ovary development and significantly reduced egg mass (P < 0.0001). Furthermore, RNAi silencing of Vg-2 not only impacted the blood meal uptake (P < 0.05) but also the egg mass (P < 0.05). Significant rescue was observed in miR-275 knockout ticks when RNAi was applied to Vg-2. To our knowledge, this study is the first demonstration that miR-275 targets Vg-2 in H. longicornis and regulates the functions of blood digestion and ovary development. These findings improve the molecular understanding of tick development and reproduction.

Delivery of RNA interference therapeutics using polycation-based nanoparticles.

PubMed

Howard, Kenneth Alan

2009-07-25

RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

PubMed Central

Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

2016-01-01

ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate that knocking down the honey bee immune repressor-encoding nkd gene can suppress the reproduction of N. ceranae and improve the overall health of honey bees, which highlights the potential role of host-derived and RNAi-based therapeutics in controlling the infections in honey bees. The information obtained from this study will have positive implications for honey bee disease management practices. PMID:27613683

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

PubMed

Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

2016-11-15

Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate that knocking down the honey bee immune repressor-encoding nkd gene can suppress the reproduction of N. ceranae and improve the overall health of honey bees, which highlights the potential role of host-derived and RNAi-based therapeutics in controlling the infections in honey bees. The information obtained from this study will have positive implications for honey bee disease management practices. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

PubMed Central

Xie, Yuran; Merkel, Olivia M

2015-01-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

The Sheffield RNAi Screening Facility (SRSF): portfolio growth and technology development.

PubMed

Brown, Stephen

2014-05-01

The Sheffield RNAi Screening Facility (SRSF) (www.rnai.group.shef.ac.uk) was established in 2008 with Wellcome Trust and University of Sheffield funding, with the task to provide the first UK RNAi screening resource for academic groups interested in identifying genes required in a diverse range of biological processes using Drosophila cell culture. The SRSF has carried out a wide range of screens varying in sizes from bespoke small-scale libraries, targeting a few hundred genes, to high-throughput, genome-wide studies. The SRSF has grown and improved with a dedicated partnership of its academic customers based mainly in the UK. We are part of the UK Academics Functional Genomics Network, participating in organizing an annual meeting in London and are part of the University of Sheffield's D3N (www.d3n.org.uk), connecting academics, biotech and pharmaceutical companies with a multidisciplinary network in Drug Discovery and Development. Recently, the SRSF has been funded by the Yorkshire Cancer Research Fund to perform genome-wide RNAi screens using human cells as part of a core facility for regional Yorkshire Universities and screens are now underway. Overall the SRSF has carried out more than 40 screens from Drosophila and human cell culture experiments.

[Down-regulatory effect of Nucleostemin expression on signal molecule of PI3K/AKT/mTOR pathway in HL-60 cells].

PubMed

Jia, Yu; Wei, Yuan-Yu; Zhang, Fan; Li, Zhao-Bo; Liu, Shuai; Yue, Bao-Hong

2014-02-01

This study was purpose to explore the down-regulatory effect of nucleostemin (NS) expression on signal molecules of PI3K/AKT/mTOR pathway belonged to candidate ways of p53-independent signal pathway in the leukemia cells. The expression of NS was interfered by using recombinant lentivirus expression vector NS-RNAi-GV248 to transfect HL-60 cells of p53 deficiency. The expression of NS and signal molecules of PI3K/AKT/mTOR pathway were detected by using Real-time PCR. The results of showed that the HL-60 cells were transfected by recombinant lentivirus vector NS-RNAi-GV248 successfully and with transfection rate up to 80%. According to results of Real-time PCR detection, the inhibition rate of NS gene was 56.5% in HL-60 cells. And the expression levels of PI3K,AKT and GβL mRNA (0.491 ± 0.084,0.398 ± 0.164, 0.472 ± 0.097 respectively) were obviously down-regulated by silencing NS, and showed statistical difference (P < 0.05) in comparison with control (1.002 ± 0.171, 1.000 ± 0.411, 1.001 ± 0.206 respectively) . It is concluded that the changes of signal molecules of PI3K/AKT/mTOR pathway positively correlate with NS down-regulation, which provides evidence for confirming PI3K/AKT/mTOR signal pathway possible as a type of NS p53-independent pathway.

Small RNAs in plants: recent development and application for crop improvement

PubMed Central

Kamthan, Ayushi; Chaudhuri, Abira; Kamthan, Mohan; Datta, Asis

2015-01-01

The phenomenon of RNA interference (RNAi) which involves sequence-specific gene regulation by small non-coding RNAs, i.e., small interfering RNA (siRNA) and microRNA (miRNA) has emerged as one of most powerful approaches for crop improvement. RNAi based on siRNA is one of the widely used tools of reverse genetics which aid in revealing gene functions in many species. This technology has been extensively applied to alter the gene expression in plants with an aim to achieve desirable traits. RNAi has been used for enhancing the crop yield and productivity by manipulating the gene involved in biomass, grain yield and enhanced shelf life of fruits and vegetables. It has also been applied for developing resistance against various biotic (bacteria, fungi, viruses, nematodes, insects) and abiotic stresses (drought, salinity, cold, etc.). Nutritional improvements of crops have also been achieved by enriching the crops with essential amino acids, fatty acids, antioxidants and other nutrients beneficial for human health or by reducing allergens or anti-nutrients. microRNAs are key regulators of important plant processes like growth, development, and response to various stresses. In spite of similarity in size (20–24 nt), miRNA differ from siRNA in precursor structures, pathway of biogenesis, and modes of action. This review also highlights the miRNA based genetic modification technology where various miRNAs/artificial miRNAs and their targets can be utilized for improving several desirable plant traits. microRNA based strategies are much efficient than siRNA-based RNAi strategies due to its specificity and less undesirable off target effects. As per the FDA guidelines, small RNA (sRNA) based transgenics are much safer for consumption than those over-expressing proteins. This review thereby summarizes the emerging advances and achievement in the field of sRNAs and its application for crop improvement. PMID:25883599

Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway

PubMed Central

2012-01-01

Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893

Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

NASA Astrophysics Data System (ADS)

Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

2013-12-01

First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

ColE1-Plasmid Production in Escherichia coli: Mathematical Simulation and Experimental Validation.

PubMed

Freudenau, Inga; Lutter, Petra; Baier, Ruth; Schleef, Martin; Bednarz, Hanna; Lara, Alvaro R; Niehaus, Karsten

2015-01-01

Plasmids have become very important as pharmaceutical gene vectors in the fields of gene therapy and genetic vaccination in the past years. In this study, we present a dynamic model to simulate the ColE1-like plasmid replication control, once for a DH5α-strain carrying a low copy plasmid (DH5α-pSUP 201-3) and once for a DH5α-strain carrying a high copy plasmid (DH5α-pCMV-lacZ) by using ordinary differential equations and the MATLAB software. The model includes the plasmid replication control by two regulatory RNA molecules (RNAI and RNAII) as well as the replication control by uncharged tRNA molecules. To validate the model, experimental data like RNAI- and RNAII concentration, plasmid copy number (PCN), and growth rate for three different time points in the exponential phase were determined. Depending on the sampled time point, the measured RNAI- and RNAII concentrations for DH5α-pSUP 201-3 reside between 6 ± 0.7 and 34 ± 7 RNAI molecules per cell and 0.44 ± 0.1 and 3 ± 0.9 RNAII molecules per cell. The determined PCNs averaged between 46 ± 26 and 48 ± 30 plasmids per cell. The experimentally determined data for DH5α-pCMV-lacZ reside between 345 ± 203 and 1086 ± 298 RNAI molecules per cell and 22 ± 2 and 75 ± 10 RNAII molecules per cell with an averaged PCN of 1514 ± 1301 and 5806 ± 4828 depending on the measured time point. As the model was shown to be consistent with the experimentally determined data, measured at three different time points within the growth of the same strain, we performed predictive simulations concerning the effect of uncharged tRNA molecules on the ColE1-like plasmid replication control. The hypothesis is that these tRNA molecules would have an enhancing effect on the plasmid production. The in silico analysis predicts that uncharged tRNA molecules would indeed increase the plasmid DNA production.

The 5'-end heterogeneity of adenovirus virus-associated RNAI contributes to the asymmetric guide strand incorporation into the RNA-induced silencing complex.

PubMed

Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran

2009-11-01

Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.

Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.

PubMed

Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa

2008-02-01

RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABC(RNAi) mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABC(RNAi) gene class. Genetic complementation tests reveal functions for ABC(RNAi) transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABC(RNAi) proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABC(RNAi) mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABC(RNAi) gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABC(RNAi) transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity.

Multiple ferritins are vital to successful blood feeding and reproduction of the hard tick Haemaphysalis longicornis.

PubMed

Galay, Remil Linggatong; Aung, Kyaw Min; Umemiya-Shirafuji, Rika; Maeda, Hiroki; Matsuo, Tomohide; Kawaguchi, Hiroaki; Miyoshi, Noriaki; Suzuki, Hiroshi; Xuan, Xuenan; Mochizuki, Masami; Fujisaki, Kozo; Tanaka, Tetsuya

2013-05-15

Ticks are obligate hematophagous parasites and important vectors of diseases. The large amount of blood they consume contains great quantities of iron, an essential but also toxic element. The function of ferritin, an iron storage protein, and iron metabolism in ticks need to be further elucidated. Here, we investigated the function a newly identified secreted ferritin from the hard tick Haemaphysalis longicornis (HlFER2), together with the previously identified intracellular ferritin (HlFER1). Recombinant ferritins, expressed in Escherichia coli, were used for anti-serum preparation and were also assayed for iron-binding activity. RT-PCR and western blot analyses of different organs and developmental stages of the tick during blood feeding were performed. The localization of ferritins in different organs was demonstrated through an indirect immunofluorescent antibody test. RNA interference (RNAi) was performed to evaluate the importance of ferritin in blood feeding and reproduction of ticks. The midgut was also examined after RNAi using light and transmission electron microscopy. RT-PCR showed differences in gene expression in some organs and developmental stages. Interestingly, only HlFER2 was detected in the ovary during oviposition and in the egg despite the low mRNA transcript. RNAi induced a reduction in post-blood meal body weight, high mortality and decreased fecundity. The expression of vitellogenin genes was affected by silencing of ferritin. Abnormalities in digestive cells, including disrupted microvilli, and alteration of digestive activity were also observed. Taken altogether, our results show that the iron storage and protective functions of ferritin are crucial to successful blood feeding and reproduction of H. longicornis.

GenomeRNAi: a database for cell-based RNAi phenotypes.

PubMed

Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

2007-01-01

RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.

Towards the elements of successful insect RNAi.

PubMed

Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E

2013-12-01

RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.

The RNAi Inheritance Machinery of Caenorhabditis elegans.

PubMed

Spracklin, George; Fields, Brandon; Wan, Gang; Becker, Diveena; Wallig, Ashley; Shukla, Aditi; Kennedy, Scott

2017-07-01

Gene silencing mediated by dsRNA (RNAi) can persist for multiple generations in Caenorhabditis elegans (termed RNAi inheritance). Here we describe the results of a forward genetic screen in C. elegans that has identified six factors required for RNAi inheritance: GLH-1/VASA, PUP-1/CDE-1, MORC-1, SET-32, and two novel nematode-specific factors that we term here (heritable RNAi defective) HRDE-2 and HRDE-4 The new RNAi inheritance factors exhibit mortal germline (Mrt) phenotypes, which we show is likely caused by epigenetic deregulation in germ cells. We also show that HRDE-2 contributes to RNAi inheritance by facilitating the binding of small RNAs to the inheritance Argonaute (Ago) HRDE-1 Together, our results identify additional components of the RNAi inheritance machinery whose conservation provides insights into the molecular mechanism of RNAi inheritance, further our understanding of how the RNAi inheritance machinery promotes germline immortality, and show that HRDE-2 couples the inheritance Ago HRDE-1 with the small RNAs it needs to direct RNAi inheritance and germline immortality. Copyright © 2017 by the Genetics Society of America.

Transformation with TT8 and HB12 RNAi Constructs in Model Forage (Medicago sativa, Alfalfa) Affects Carbohydrate Structure and Metabolic Characteristics in Ruminant Livestock Systems.

PubMed

Li, Xinxin; Zhang, Yonggen; Hannoufa, Abdelali; Yu, Peiqiang

2015-11-04

Lignin, a phenylpropanoid polymer present in secondary cell walls, has a negative impact on feed digestibility. TT8 and HB12 genes were shown to have low expression levels in low-lignin tissues of alfalfa, but to date, there has been no study on the effect of down-regulation of these two genes in alfalfa on nutrient chemical profiles and availability in ruminant livestock systems. The objectives of this study were to investigate the effect of transformation of alfalfa with TT8 and HB12 RNAi constructs on carbohydrate (CHO) structure and CHO nutritive value in ruminant livestock systems. The results showed that transformation with TT8 and HB12 RNAi constructs reduced rumen, rapidly degraded CHO fractions (RDCA4, P = 0.06; RDCB1, P < 0.01) and totally degraded CHO fraction (TRDCHO, P = 0.08). Both HB12 and TT8 populations had significantly higher in vitro digestibility of neutral detergent fiber (NDF) at 30 h of incubation (ivNDF30) compared to the control (P < 0.01). The TT8 populations had highest ivDM30 and ivNDF240. Transformation of alfalfa with TT8 and HB12 RNAi constructs induced molecular structure changes. Different CHO functional groups had different sensitivities and different responses to the transformation. The CHO molecular structure changes induced by the transformation were associated with predicted CHO availability. Compared with HB12 RNAi, transformation with TT8 RNAi could improve forage quality by increasing the availability of both NDF and DM. Further study is needed on the relationship between the transformation-induced structure changes at a molecular level and nutrient utilization in ruminant livestock systems when lignification is much higher.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

GenomeRNAi: a database for cell-based RNAi phenotypes

PubMed Central

Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

2007-01-01

RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at PMID:17135194

Beyond insects: current status, achievements and future perspectives of RNAi in mite pests.

PubMed

Niu, Jinzhi; Shen, Guangmao; Christiaens, Olivier; Smagghe, Guy; He, Lin; Wang, Jinjun

2018-05-11

Mites comprise a group of key agricultural pests on a wide range of crops. They cause harm through feeding on the plant and transferring dangerous pathogens, and the rapid evolution of pesticide resistance in mites highlights the need for novel control methods. Currently, RNA interference (RNAi) shows a great potential for insect pest control. Here, we review the literature associated with RNAi in mite pests. We discuss different target genes and RNAi efficiency in various mite species, a promising Varroa control program through RNAi, the synergy of RNAi with plant defense mechanisms and microorganisms, and the current understandings of systemic movement of dsRNA. Based on this, we can conclude that there is a clear potential for an RNAi-based mite control application but further research on several aspects is needed, including: (i) the factors influencing the RNAi efficiency, (ii) the mechanism of environmental RNAi and cross-kingdom dsRNA trafficking, (iii) the mechanism of possible systemic and parental RNAi, and (iv) non-target effects, specifically in predatory mites, should be considered during the RNAi target selection. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Larval application of sodium channel homologous dsRNA restores pyrethroid insecticide susceptibility in a resistant adult mosquito population.

PubMed

Bona, Ana Caroline Dalla; Chitolina, Rodrigo Faitta; Fermino, Marise Lopes; de Castro Poncio, Lisiane; Weiss, Avital; Lima, José Bento Pereira; Paldi, Nitzan; Bernardes, Emerson Soares; Henen, Jonathan; Maori, Eyal

2016-07-14

Mosquitoes host and pass on to humans a variety of disease-causing pathogens such as infectious viruses and other parasitic microorganisms. The emergence and spread of insecticide resistance is threatening the effectiveness of current control measures for common mosquito vector borne diseases, such as malaria, dengue and Zika. Therefore, the emerging resistance to the widely used pyrethroid insecticides is an alarming problem for public health. Herein we demonstrated the use of RNA interference (RNAi) to increase susceptibility of adult mosquitoes to a widely used pyrethroid insecticide. Experiments were performed on a field-collected pyrethroid resistant strain of Ae. aegypti (Rio de Janeiro; RJ). Larvae from the resistant Ae. aegypti population were soaked with double-stranded RNAs (dsRNAs) that correspond either to voltage-gate sodium channel (VGSC), P-glycoprotein, or P450 detoxification genes and reared to adulthood. Adult mortality rates in the presence of various Deltamethrin pyrethroid concentrations were used to assess mosquito insecticide susceptibility. We characterized the RJ Ae. aegypti strain with regard to its level of resistance to a pyrethroid insecticide and found that it was approximately 6 times more resistant to Deltamethrin compared to the laboratory Rockefeller strain. The RJ strain displayed a higher frequency of Val1016Ile and Phe1534Cys substitutions of the VGSC gene. The resistant strain also displayed a higher basal expression level of VGSC compared to the Rockefeller strain. When dsRNA-treated mosquitoes were subjected to a standard pyrethroid contact bioassay, only dsRNA targeting VGSC increased the adult mortality of the pyrethroid resistant strain. The dsRNA treatment proved effective in increasing adult mosquito susceptibility over a range of pyrethroid concentrations and these results were associated with dsRNA-specific small interfering RNAs in treated adults, and the corresponding specific down regulation of VGSC gene expression level. Finally, we demonstrated that the efficiency of our approach was further improved by 'tiling' along the VGSC gene in order to identify the most potent dsRNA sequences. These results demonstrate that dsRNA applied to mosquito larvae retains its biological activity into adulthood. Thus, the RNAi system reported here could be a useful approach to control the widespread insecticide resistance in mosquitoes and other insect vectors of human diseases.

Optical imaging of RNAi-mediated silencing of cancer

NASA Astrophysics Data System (ADS)

Ochiya, Takahiro; Honma, Kimi; Takeshita, Fumitaka; Nagahara, Shunji

2008-02-01

RNAi has rapidly become a powerful tool for drug target discovery and validation in an in vitro culture system and, consequently, interest is rapidly growing for extension of its application to in vivo systems, such as animal disease models and human therapeutics. Cancer is one obvious application for RNAi therapeutics, because abnormal gene expression is thought to contribute to the pathogenesis and maintenance of the malignant phenotype of cancer and thereby many oncogenes and cell-signaling molecules present enticing drug target possibilities. RNAi, potent and specific, could silence tumor-related genes and would appear to be a rational approach to inhibit tumor growth. In subsequent in vivo studies, the appropriate cancer model must be developed for an evaluation of siRNA effects on tumors. How to evaluate the effect of siRNA in an in vivo therapeutic model is also important. Accelerating the analyses of these models and improving their predictive value through whole animal imaging methods, which provide cancer inhibition in real time and are sensitive to subtle changes, are crucial for rapid advancement of these approaches. Bioluminescent imaging is one of these optically based imaging methods that enable rapid in vivo analyses of a variety of cellular and molecular events with extreme sensitivity.

Zika virus alters the microRNA expression profile and elicits an RNAi response in Aedes aegypti mosquitoes

PubMed Central

Hart, Charles E.; Widen, Steven G.; Wood, Thomas G.; Thangamani, Saravanan; Asgari, Sassan

2017-01-01

Zika virus (ZIKV), a flavivirus transmitted primarily by Aedes aegypti, has recently spread globally in an unprecedented fashion, yet we have a poor understanding of host-microbe interactions in this system. To gain insights into the interplay between ZIKV and the mosquito, we sequenced the small RNA profiles in ZIKV-infected and non-infected Ae. aegypti mosquitoes at 2, 7 and 14 days post-infection. ZIKA induced an RNAi response in the mosquito with virus-derived short interfering RNAs and PIWI-interacting RNAs dramatically increased in abundance post-infection. Further, we found 17 host microRNAs (miRNAs) that were modulated by ZIKV infection at all time points. Strikingly, many of these regulated miRNAs have been reported to have their expression altered by dengue and West Nile viruses, while the response was divergent from that induced by the alphavirus Chikungunya virus in mosquitoes. This suggests that conserved miRNA responses occur within mosquitoes in response to flavivirus infection. This study expands our understanding of ZIKV-vector interactions and provides potential avenues to be further investigated to target ZIKV in the mosquito host. PMID:28715413

Development of an endogenous virus-free line of chickens susceptible to all subgroups of avian leukosis virus.

PubMed

Zhang, Huanmin; Bacon, Larry D; Fadly, Aly M

2008-09-01

Primary chicken embryo fibroblasts (CEF) from special specific pathogen-free chicken lines are used for detection of contamination of adult or embryonic tissues, meconium, or tissue culture fluids with avian leukosis viruses (ALV). The suitability and efficiency of such tests depend on the susceptibility of CEF to the various subgroups of exogenous as well as endogenous ALV. The ideal CEF for such tests should be not only susceptible to all retroviruses, but also free of endogenous viruses so that such tests are immune to any interference that may occur between the endogenous and the tested (exogenous) viruses. CEF and/or chickens free of endogenous viruses are also desirable for gene transfer studies using retroviral vectors, such as RNA interference (RNAi) experiments and transgenic work. The absence of ev genes in CEF or chickens can empower clean detection of successful RNAi construct delivery or gene transfer. CEF free of ev genes are also essential reagents routinely used in growing and detecting unknown retroviruses in varied viral assays. This report documents the development of a new line of chickens, 0.TVB*S1, that is free of endogenous viruses and susceptible to all subgroups of ALV identified in chickens.

Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

PubMed

Xie, Yuran; Merkel, Olivia M

2015-10-01

Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Progress Toward In Vivo Use of siRNAs-II

PubMed Central

Rettig, Garrett R; Behlke, Mark A

2012-01-01

RNA interference (RNAi) has been extensively employed for in vivo research since its use was first demonstrated in mammalian cells 10 years ago. Design rules have improved, and it is now routinely possible to obtain reagents that suppress expression of any gene desired. At the same time, increased understanding of the molecular basis of unwanted side effects has led to the development of chemical modification strategies that mitigate these concerns. Delivery remains the single greatest hurdle to widespread adoption of in vivo RNAi methods. However, exciting advances have been made and new delivery systems under development may help to overcome these barriers. This review discusses advances in RNAi biochemistry and biology that impact in vivo use and provides an overview of select publications that demonstrate interesting applications of these principles. Emphasis is placed on work with synthetic, small interfering RNAs (siRNAs) published since the first installment of this review which appeared in 2006. PMID:22186795

Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

PubMed

Abe, Hiroshi; Kimura, Yasuaki

2018-01-01

Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

PubMed Central

Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

2013-01-01

AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Therapeutic application of RNAi: is mRNA targeting finally ready for prime time?

PubMed Central

Grimm, Dirk; Kay, Mark A.

2007-01-01

With unprecedented speed, RNA interference (RNAi) has advanced from its basic discovery in lower organisms to becoming a powerful genetic tool and perhaps our single most promising biotherapeutic for a wide array of diseases. Numerous studies document RNAi efficacy in laboratory animals, and the first clinical trials are underway and thus far suggest that RNAi is safe to use in humans. Yet substantial hurdles have also surfaced and must be surmounted before therapeutic RNAi applications can become a standard therapy. Here we review the most critical roadblocks and concerns for clinical RNAi transition, delivery, and safety. We highlight emerging solutions and concurrently discuss novel therapeutic RNAi-based concepts. The current rapid advances create realistic optimism that the establishment of RNAi as a new and potent clinical modality in humans is near. PMID:18060021

Lentivirus-mediated RNA interference of vascular endothelial growth factor in monkey eyes with iris neovascularization.

PubMed

Yuan, Meng-Ke; Tao, Yong; Yu, Wen-Zhen; Kai, Wang; Jiang, Yan-Rong

2010-08-25

To explore the in vivo anti-angiogenesis effects resulting from lentivirus-mediated RNAi of vascular endothelial growth factor (VEGF) in monkeys with iris neovascularization (INV). Five specific recombinant lentiviral vectors for RNA interference, targeting Macaca mulatta VEGFA, were designed and the one with best knock down efficacy (LV-GFP-VEGFi1) in H1299 cells and RF/6A cells was selected by real-time PCR for in vivo use. A laser-induced retinal vein occlusion model was established in one eye of seven cynomolgus monkeys. In monkeys number 1, 3, and 5 (Group 1), the virus (1x10(8) particles) was intravitreally injected into the preretinal space of the animal's eye immediately after laser coagulation; and in monkeys number 2, 4, and 6 (Group 2), the virus (1x10(8) particles) was injected at 10 days after laser coagulation. In monkey number 7, a blank control injection was performed. In monkeys number 1 and 2, virus without RNAi sequence was used; in monkeys number 3 and 4, virus with nonspecific RNAi sequence was used; and in monkeys 5 and 6, LV-GFP-VEGFi1 was used. In monkey number 5, at 23 days after laser treatment, no obvious INV was observed, while fluorescein angiography of the iris revealed high fluorescence at the margin of pupil and point posterior synechiae. At 50 days after laser treatment, only a slight ectropion uvea was found. However, in the other eyes, obvious INV or hyphema was observed. The densities of new iridic vessels all significantly varied: between monkey number 5 and number 3 (36.01+/-4.49/mm(2) versus 48.68+/-9.30/mm(2), p=0.025), between monkey number 3 and monkey number 7 (48.68+/-9.30/mm(2) versus 74.38+/-9.23/mm(2), p=0.002), and between monkey number 5 and number 7 (36.01+/-4.49/mm(2) versus 74.38+/-9.23/mm(2), p<0.001). Lentivirus-mediated RNAi of VEGF may be a new strategy to treat iris neovascularization, while further studies are needed to investigate the long-term effect.

Development of small RNA delivery systems for lung cancer therapy.

PubMed

Fujita, Yu; Kuwano, Kazuyoshi; Ochiya, Takahiro

2015-03-06

RNA interference (RNAi) has emerged as a powerful tool for studying target identification and holds promise for the development of therapeutic gene silencing. Recent advances in RNAi delivery and target selection provide remarkable opportunities for translational medical research. The induction of RNAi relies on small silencing RNAs, which affect specific messenger RNA (mRNA) degradation. Two types of small RNA molecules, small interfering RNAs (siRNAs) and microRNAs (miRNAs), have a central function in RNAi technology. The success of RNAi-based therapeutic delivery may be dependent upon uncovering a delivery route, sophisticated delivery carriers, and nucleic acid modifications. Lung cancer is still the leading cause of cancer death worldwide, for which novel therapeutic strategies are critically needed. Recently, we have reported a novel platform (PnkRNA™ and nkRNA®) to promote naked RNAi approaches through inhalation without delivery vehicles in lung cancer xenograft models. We suggest that a new class of RNAi therapeutic agent and local drug delivery system could also offer a promising RNAi-based strategy for clinical applications in cancer therapy. In this article, we show recent strategies for an RNAi delivery system and suggest the possible clinical usefulness of RNAi-based therapeutics for lung cancer treatment.

RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smialowska, Agata, E-mail: smialowskaa@gmail.com; School of Life Sciences, Södertörn Högskola, Huddinge 141-89; Djupedal, Ingela

Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its rolemore » in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.« less

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

The Initiator Methionine tRNA Drives Secretion of Type II Collagen from Stromal Fibroblasts to Promote Tumor Growth and Angiogenesis

PubMed Central

Clarke, Cassie J.; Berg, Tracy J.; Birch, Joanna; Ennis, Darren; Mitchell, Louise; Cloix, Catherine; Campbell, Andrew; Sumpton, David; Nixon, Colin; Campbell, Kirsteen; Bridgeman, Victoria L.; Vermeulen, Peter B.; Foo, Shane; Kostaras, Eleftherios; Jones, J. Louise; Haywood, Linda; Pulleine, Ellie; Yin, Huabing; Strathdee, Douglas; Sansom, Owen; Blyth, Karen; McNeish, Iain; Zanivan, Sara; Reynolds, Andrew R.; Norman, Jim C.

2016-01-01

Summary Expression of the initiator methionine tRNA (tRNAiMet) is deregulated in cancer. Despite this fact, it is not currently known how tRNAiMet expression levels influence tumor progression. We have found that tRNAiMet expression is increased in carcinoma-associated fibroblasts, implicating deregulated expression of tRNAiMet in the tumor stroma as a possible contributor to tumor progression. To investigate how elevated stromal tRNAiMet contributes to tumor progression, we generated a mouse expressing additional copies of the tRNAiMet gene (2+tRNAiMet mouse). Growth and vascularization of subcutaneous tumor allografts was enhanced in 2+tRNAiMet mice compared with wild-type littermate controls. Extracellular matrix (ECM) deposited by fibroblasts from 2+tRNAiMet mice supported enhanced endothelial cell and fibroblast migration. SILAC mass spectrometry indicated that elevated expression of tRNAiMet significantly increased synthesis and secretion of certain types of collagen, in particular type II collagen. Suppression of type II collagen opposed the ability of tRNAiMet-overexpressing fibroblasts to deposit pro-migratory ECM. We used the prolyl hydroxylase inhibitor ethyl-3,4-dihydroxybenzoate (DHB) to determine whether collagen synthesis contributes to the tRNAiMet-driven pro-tumorigenic stroma in vivo. DHB had no effect on the growth of syngeneic allografts in wild-type mice but opposed the ability of 2+tRNAiMet mice to support increased angiogenesis and tumor growth. Finally, collagen II expression predicts poor prognosis in high-grade serous ovarian carcinoma. Taken together, these data indicate that increased tRNAiMet levels contribute to tumor progression by enhancing the ability of stromal fibroblasts to synthesize and secrete a type II collagen-rich ECM that supports endothelial cell migration and angiogenesis. PMID:26948875

The Initiator Methionine tRNA Drives Secretion of Type II Collagen from Stromal Fibroblasts to Promote Tumor Growth and Angiogenesis.

PubMed

Clarke, Cassie J; Berg, Tracy J; Birch, Joanna; Ennis, Darren; Mitchell, Louise; Cloix, Catherine; Campbell, Andrew; Sumpton, David; Nixon, Colin; Campbell, Kirsteen; Bridgeman, Victoria L; Vermeulen, Peter B; Foo, Shane; Kostaras, Eleftherios; Jones, J Louise; Haywood, Linda; Pulleine, Ellie; Yin, Huabing; Strathdee, Douglas; Sansom, Owen; Blyth, Karen; McNeish, Iain; Zanivan, Sara; Reynolds, Andrew R; Norman, Jim C

2016-03-21

Expression of the initiator methionine tRNA (tRNAi(Met)) is deregulated in cancer. Despite this fact, it is not currently known how tRNAi(Met) expression levels influence tumor progression. We have found that tRNAi(Met) expression is increased in carcinoma-associated fibroblasts, implicating deregulated expression of tRNAi(Met) in the tumor stroma as a possible contributor to tumor progression. To investigate how elevated stromal tRNAi(Met) contributes to tumor progression, we generated a mouse expressing additional copies of the tRNAi(Met) gene (2+tRNAi(Met) mouse). Growth and vascularization of subcutaneous tumor allografts was enhanced in 2+tRNAi(Met) mice compared with wild-type littermate controls. Extracellular matrix (ECM) deposited by fibroblasts from 2+tRNAi(Met) mice supported enhanced endothelial cell and fibroblast migration. SILAC mass spectrometry indicated that elevated expression of tRNAi(Met) significantly increased synthesis and secretion of certain types of collagen, in particular type II collagen. Suppression of type II collagen opposed the ability of tRNAi(Met)-overexpressing fibroblasts to deposit pro-migratory ECM. We used the prolyl hydroxylase inhibitor ethyl-3,4-dihydroxybenzoate (DHB) to determine whether collagen synthesis contributes to the tRNAi(Met)-driven pro-tumorigenic stroma in vivo. DHB had no effect on the growth of syngeneic allografts in wild-type mice but opposed the ability of 2+tRNAi(Met) mice to support increased angiogenesis and tumor growth. Finally, collagen II expression predicts poor prognosis in high-grade serous ovarian carcinoma. Taken together, these data indicate that increased tRNAi(Met) levels contribute to tumor progression by enhancing the ability of stromal fibroblasts to synthesize and secrete a type II collagen-rich ECM that supports endothelial cell migration and angiogenesis. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Emerging strategies for RNA interference (RNAi) applications in insects.

PubMed

Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

2015-01-01

RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

The FLIGHT Drosophila RNAi database

PubMed Central

Bursteinas, Borisas; Jain, Ekta; Gao, Qiong; Baum, Buzz; Zvelebil, Marketa

2010-01-01

FLIGHT (http://flight.icr.ac.uk/) is an online resource compiling data from high-throughput Drosophila in vivo and in vitro RNAi screens. FLIGHT includes details of RNAi reagents and their predicted off-target effects, alongside RNAi screen hits, scores and phenotypes, including images from high-content screens. The latest release of FLIGHT is designed to enable users to upload, analyze, integrate and share their own RNAi screens. Users can perform multiple normalizations, view quality control plots, detect and assign screen hits and compare hits from multiple screens using a variety of methods including hierarchical clustering. FLIGHT integrates RNAi screen data with microarray gene expression as well as genomic annotations and genetic/physical interaction datasets to provide a single interface for RNAi screen analysis and datamining in Drosophila. PMID:20855970

CXCR4 regulates growth of both primary and metastatic breast cancer.

PubMed

Smith, Matthew C P; Luker, Kathryn E; Garbow, Joel R; Prior, Julie L; Jackson, Erin; Piwnica-Worms, David; Luker, Gary D

2004-12-01

The chemokine receptor CXCR4 and its cognate ligand CXCL12 recently have been proposed to regulate the directional trafficking and invasion of breast cancer cells to sites of metastases. However, effects of CXCR4 on the growth of primary breast cancer tumors and established metastases and survival have not been determined. We used stable RNAi to reduce expression of CXCR4 in murine 4T1 cells, a highly metastatic mammary cancer cell line that is a model for stage IV human breast cancer. Using noninvasive bioluminescence and magnetic resonance imaging, we showed that knockdown of CXCR4 significantly limited the growth of orthotopically transplanted breast cancer cells. Mice in which parental 4T1 cells were implanted had progressively enlarging tumors that spontaneously metastasized, and these animals all died from metastatic disease. Remarkably, RNAi of CXCR4 prevented primary tumor formation in some mice, and all mice transplanted with CXCR RNAi cells survived without developing macroscopic metastases. To analyze effects of CXCR4 on metastases to the lung, an organ commonly affected by metastatic breast cancer, we injected tumor cells intravenously and monitored cell growth with bioluminescence imaging. Inhibiting CXCR4 with RNAi, or the specific antagonist AMD3100, substantially delayed the growth of 4T1 cells in the lung, although neither RNAi nor AMD3100 prolonged overall survival in mice with experimental lung metastases. These data indicate that CXCR4 is required to initiate proliferation and/or promote survival of breast cancer cells in vivo and suggest that CXCR4 inhibitors will improve treatment of patients with primary and metastatic breast cancer.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.

PubMed

Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar

2015-01-01

The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.

Cell wall composition and digestibility alterations in Brachypodium distachyon achieved through reduced expression of the UDP-arabinopyranose mutase

PubMed Central

Rancour, David M.; Hatfield, Ronald D.; Marita, Jane M.; Rohr, Nicholas A.; Schmitz, Robert J.

2015-01-01

Nucleotide-activated sugars are essential substrates for plant cell-wall carbohydrate-polymer biosynthesis. The most prevalent grass cell wall (CW) sugars are glucose (Glc), xylose (Xyl), and arabinose (Ara). These sugars are biosynthetically related via the UDP–sugar interconversion pathway. We sought to target and generate UDP–sugar interconversion pathway transgenic Brachypodium distachyon lines resulting in CW carbohydrate composition changes with improved digestibility and normal plant stature. Both RNAi-mediated gene-suppression and constitutive gene-expression approaches were performed. CWs from 336 T0 transgenic plants with normal appearance were screened for complete carbohydrate composition. RNAi mutants of BdRGP1, a UDP-arabinopyranose mutase, resulted in large alterations in CW carbohydrate composition with significant decreases in CW Ara content but with minimal change in plant stature. Five independent RNAi-RGP1 T1 plant lines were used for in-depth analysis of plant CWs. Real-time PCR analysis indicated that gene expression levels for BdRGP1, BdRGP2, and BdRGP3 were reduced in RNAi-RGP1 plants to 15–20% of controls. CW Ara content was reduced by 23–51% of control levels. No alterations in CW Xyl and Glc content were observed. Corresponding decreases in CW ferulic acid (FA) and ferulic acid-dimers (FA-dimers) were observed. Additionally, CW p-coumarates (pCA) were decreased. We demonstrate the CW pCA decrease corresponds to Ara-coupled pCA. Xylanase-mediated digestibility of RNAi-RGP1 Brachypodium CWs resulted in a near twofold increase of released total carbohydrate. However, cellulolytic hydrolysis of CW material was inhibited in leaves of RNAi-RGP1 mutants. Our results indicate that targeted manipulation of UDP–sugar biosynthesis can result in biomass with substantially altered compositions and highlights the complex effect CW composition has on digestibility. PMID:26136761

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

Considering RNAi experimental design in parasitic helminths.

PubMed

Dalzell, Johnathan J; Warnock, Neil D; McVeigh, Paul; Marks, Nikki J; Mousley, Angela; Atkinson, Louise; Maule, Aaron G

2012-04-01

Almost a decade has passed since the first report of RNA interference (RNAi) in a parasitic helminth. Whilst much progress has been made with RNAi informing gene function studies in disparate nematode and flatworm parasites, substantial and seemingly prohibitive difficulties have been encountered in some species, hindering progress. An appraisal of current practices, trends and ideals of RNAi experimental design in parasitic helminths is both timely and necessary for a number of reasons: firstly, the increasing availability of parasitic helminth genome/transcriptome resources means there is a growing need for gene function tools such as RNAi; secondly, fundamental differences and unique challenges exist for parasite species which do not apply to model organisms; thirdly, the inherent variation in experimental design, and reported difficulties with reproducibility undermine confidence. Ideally, RNAi studies of gene function should adopt standardised experimental design to aid reproducibility, interpretation and comparative analyses. Although the huge variations in parasite biology and experimental endpoints make RNAi experimental design standardization difficult or impractical, we must strive to validate RNAi experimentation in helminth parasites. To aid this process we identify multiple approaches to RNAi experimental validation and highlight those which we deem to be critical for gene function studies in helminth parasites.

A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae.

PubMed

Morris, Robert; Wilson, Leonie; Sturrock, Matthew; Warnock, Neil D; Carrizo, Daniel; Cox, Deborah; Maule, Aaron G; Dalzell, Johnathan J

2017-03-01

Entomopathogenic nematodes (EPNs) employ a sophisticated chemosensory apparatus to detect potential hosts. Understanding the molecular basis of relevant host-finding behaviours could facilitate improved EPN biocontrol approaches, and could lend insight to similar behaviours in economically important mammalian parasites. FMRFamide-like peptides are enriched and conserved across the Phylum Nematoda, and have been linked with motor and sensory function, including dispersal and aggregating behaviours in the free living nematode Caenorhabditis elegans. The RNA interference (RNAi) pathway of Steinernema carpocapsae was characterised in silico, and employed to knockdown the expression of the FMRFamide-like peptide 21 (GLGPRPLRFamide) gene (flp-21) in S. carpocapsae infective juveniles; a first instance of RNAi in this genus, and a first in an infective juvenile of any EPN species. Our data show that 5 mg/ml dsRNA and 50 mM serotonin triggers statistically significant flp-21 knockdown (-84%***) over a 48 h timecourse, which inhibits host-finding (chemosensory), dispersal, hyperactive nictation and jumping behaviours. However, whilst 1 mg/ml dsRNA and 50 mM serotonin also triggers statistically significant flp-21 knockdown (-51%**) over a 48 h timecourse, it does not trigger the null sensory phenotypes; statistically significant target knockdown can still lead to false negative results, necessitating appropriate experimental design. SPME GC-MS volatile profiles of two EPN hosts, Galleria mellonella and Tenebrio molitor reveal an array of shared and unique compounds; these differences had no impact on null flp-21 RNAi phenotypes for the behaviours assayed. Localisation of flp-21 / FLP-21 to paired anterior neurons by whole mount in situ hybridisation and immunocytochemistry corroborates the RNAi data, further suggesting a role in sensory modulation. These data can underpin efforts to study these behaviours in other economically important parasites, and could facilitate molecular approaches to EPN strain improvement for biocontrol.

The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo

PubMed Central

Meerbrey, Kristen L.; Hu, Guang; Kessler, Jessica D.; Roarty, Kevin; Fang, Justin E.; Herschkowitz, Jason I.; Burrows, Anna E.; Ciccia, Alberto; Sun, Tingting; Schmitt, Earlene M.; Bernardi, Ronald J.; Fu, Xiaoyong; Bland, Christopher S.; Cooper, Thomas A.; Schiff, Rachel; Rosen, Jeffrey M.; Westbrook, Thomas F.; Elledge, Stephen J.

2011-01-01

The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems. However, significant challenges still remain to fully exploit RNAi for mammalian genetics. For instance, genetic screens and in vivo studies could be broadly improved by methods that allow inducible and uniform gene expression control. To achieve this, we built the lentiviral pINDUCER series of expression vehicles for inducible RNAi in vivo. Using a multicistronic design, pINDUCER vehicles enable tracking of viral transduction and shRNA or cDNA induction in a broad spectrum of mammalian cell types in vivo. They achieve this uniform temporal, dose-dependent, and reversible control of gene expression across heterogenous cell populations via fluorescence-based quantification of reverse tet-transactivator expression. This feature allows isolation of cell populations that exhibit a potent, inducible target knockdown in vitro and in vivo that can be used in human xenotransplantation models to examine cancer drug targets. PMID:21307310

Current issues of RNAi therapeutics delivery and development.

PubMed

Haussecker, D

2014-12-10

12 years following the discovery of the RNAi mechanism in Man, a number of RNAi therapeutics development candidates have emerged with profiles suggesting that they could become drugs of significant medical importance for diseases like TTR amyloidosis, HBV, solid cancers, and hemophilia. Despite this robust progress, the perception of RNAi therapeutics has been on a roller-coaster ride driven not only by science, but also regulatory trends, the stock markets, and Big Pharma business development decisions [1]. This presentation provides an update on the current state of RNAi therapeutics development with a particular focus on what RNAi delivery can achieve today and key challenges to be overcome to expand therapeutic opportunities. The delivery of RNAi triggers to disease-relevant cell types clearly represents the rate-limiting factor in broadly expanding the applicability of RNAi therapeutics. Today, with at least 3 delivery options (lipid nanoparticles/LNPs, GalNAc-siRNA conjugates, Dynamic PolyConjugates/DPCs) for which profound gene knockdowns have been demonstrated in non-human primates and in the clinic, RNAi therapeutics should in principle be able to address most diseases related to gene expression in the liver. Given the central importance of the liver in systemic physiology, this already represents a significant therapeutic and commercial opportunity rivaling that of e.g. monoclonal antibodies. Beyond the liver, there is a reason to believe that current RNAi therapeutics technologies can address a number of solid tumors (e.g. LNPs), diseases of the eye (e.g. self-delivering RNAi triggers) as well as diseases involving the respiratory epithelium (e.g. aerosolized LNPs), certain phagocytic cells (LNPs), hematopoietic stem cells and their progeny (lentiviral DNA-directed RNAi), vascular endothelial cells (cationic lipoplexes), and certain cell types in the kidney (self-delivering RNAi triggers, DPCs; Table 1). Despite this success, there has been a sense that the applications of RNAi therapeutics are rather limited. This is largely based on the observation that the biodistribution of RNAi formulations is typically more limited compared to small molecules and oral administration is not possible with current technologies. Similarly, the utility of a given RNAi formulation is limited to a few cell types and tissues at most and a universal delivery strategy should remain elusive for the foreseeable future. Therefore, to further expand on the therapeutic utility and patient convenience of RNAi, it is important to overcome a number of delivery-related technical and scientific challenges which will be discussed in this presentation. For systemic applications, these include the necessity for extended blood circulation times, vascular escape (probably the most rewarding inquiry currently), tissue penetration, cellular uptake, and escape into the cytoplasm. In terms of safety, it is important that these formulations do not accumulate in the body, do not cause excessive off-targeting due to 'chemical stickiness' (often useful for purposes of biodistribution), and overcome the physical/biological barriers in a controlled manner. The time for realizing the therapeutic potential of RNAi has come. At the same time, it is important to lay the foundations for the next leg of value creation by overcoming the challenges of delivering RNAi to new cell types. Based on results from exploratory research, the renewed interest in RNAi therapeutics and capital infusion, there is a reason to be optimistic that this can be achieved. Copyright © 2014 Elsevier B.V. All rights reserved.

Dietary Blueberry and Bifidobacteria Attenuate Nonalcoholic Fatty Liver Disease in Rats by Affecting SIRT1-Mediated Signaling Pathway

PubMed Central

Ren, Tingting; Huang, Chao; Cheng, Mingliang

2014-01-01

NAFLD model rats were established and divided into NAFLD model (MG group), SIRT1 RNAi (SI group), blueberry juice (BJ group), blueberry juice + bifidobacteria (BJB group), blueberry juice + SIRT1 RNAi (BJSI group), and blueberry juice + bifidobacteria + SIRT1 RNAi groups (BJBSI group). A group with normal rats was a control group (CG). BJB group ameliorated NAFLD, which was better than BJ group (P < 0.05). The lipid accumulation was lower in CG, BJ, and BJB groups than that in MG, SI, BJSI, and BJBSI groups (P < 0.05). The levels of SIRT1 and PPAR-α were higher in CG, BJ, and BJB groups than those in MG, SI, BJSI, and BJBSI groups (P < 0.05). The levels of SREBP-1c were lower in CG, BJ, and BJB groups than those in MG, SI, BJSI, and BJBSI groups (P < 0.05). The biochemical indexes SOD, GSH, and HDL-c were improved from CG to BJB group (P < 0.05). Inversely, the levels of AST and ALT, TG, TC, LDL-c, and MDA were decreased from CG to BJB group (P < 0.05). These changes enhance antioxidative capability and biochemical index of rats. Blueberry juice and bifidobacteria improve NAFLD by activating SIRTI-mediating signaling pathway. PMID:25544867

Effects of HBV Genetic Variability on RNAi Strategies

PubMed Central

Panjaworayan, Nattanan; Brown, Chris M.

2011-01-01

RNAi strategies present promising antiviral strategies against HBV. RNAi strategies require base pairing between short RNAi effectors and targets in the HBV pregenome or other RNAs. Natural variation in HBV genotypes, quasispecies variation, or mutations selected by the RNAi strategy could potentially make these strategies less effective. However, current and proposed antiviral strategies against HBV are being, or could be, designed to avoid this. This would involve simultaneous targeting of multiple regions of the genome, or regions in which variation or mutation is not tolerated. RNAi strategies against single genotypes or against variable regions of the genome would need to have significant other advantages to be part of robust therapies. PMID:21760994

Molecular function of microtubule-associated protein 2 for filial imprinting in domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Katagiri, Sachiko; Aoki, Naoya; Iikubo, Eiji; Kitajima, Takaaki; Matsushima, Toshiya; Homma, Koichi J

2011-01-01

RNA interference (RNAi)-mediated gene-silencing can be a tool for elucidating the role of genes in the neural basis of behavioral plasticity. Previously, we reported that exogenous DNA could be successfully delivered into newly-hatched chick brains via electroporation. Here, we used this in vivo gene-transfer technique and showed that transfected microRNA vectors preferentially silence exogenous DNA expression in neuronal cells. Using this system, the up-regulation of microtubule-associated protein 2 (MAP2) accompanying filial imprinting was suppressed in vivo, which impaired the filial imprinting in chicks. In addition, the phosphorylation of MAP2 was found to increase in parallel with filial imprinting, and lithium chloride, an inhibitor of glycogen synthase kinase 3 (GSK3), was found to impair filial imprinting. Our results suggest that the regulation of MAP2 expression and its phosphorylation are required for filial imprinting and may modify microtubule stability, thereby leading to cytoskeletal reorganization during imprinting. This in vivo RNAi-mediated gene-silencing system will facilitate the analysis of gene function in the living chick brain and provides further clues regarding the molecular mechanisms underpinning avian learning. Copyright © 2010 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

PubMed Central

Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

2014-01-01

The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

FlyRNAi.org—the database of the Drosophila RNAi screening center and transgenic RNAi project: 2017 update

PubMed Central

Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2017-01-01

The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039

Targeting the undruggable: Advances and obstacles in current RNAi therapy

PubMed Central

Wu, Sherry Y.; Lopez-Berestein, Gabriel; Calin, George A.; Sood, Anil K.

2014-01-01

RNA interference (RNAi) therapeutics represents a rapidly emerging platform for personalized cancer treatment. Recent advances in delivery, target selection, and safety of RNAi cancer therapy provide unprecedented opportunities for clinical translation. Here, we discuss these advances and present strategies for making RNAi-based therapy a viable part of cancer management. PMID:24920658

False negative rates in Drosophila cell-based RNAi screens: a case study

PubMed Central

2011-01-01

Background High-throughput screening using RNAi is a powerful gene discovery method but is often complicated by false positive and false negative results. Whereas false positive results associated with RNAi reagents has been a matter of extensive study, the issue of false negatives has received less attention. Results We performed a meta-analysis of several genome-wide, cell-based Drosophila RNAi screens, together with a more focused RNAi screen, and conclude that the rate of false negative results is at least 8%. Further, we demonstrate how knowledge of the cell transcriptome can be used to resolve ambiguous results and how the number of false negative results can be reduced by using multiple, independently-tested RNAi reagents per gene. Conclusions RNAi reagents that target the same gene do not always yield consistent results due to false positives and weak or ineffective reagents. False positive results can be partially minimized by filtering with transcriptome data. RNAi libraries with multiple reagents per gene also reduce false positive and false negative outcomes when inconsistent results are disambiguated carefully. PMID:21251254

Analysis of RNA-Seq data reveals involvement of JAK/STAT signalling during leg regeneration in the cricket Gryllus bimaculatus.

PubMed

Bando, Tetsuya; Ishimaru, Yoshiyasu; Kida, Takuro; Hamada, Yoshimasa; Matsuoka, Yuji; Nakamura, Taro; Ohuchi, Hideyo; Noji, Sumihare; Mito, Taro

2013-03-01

In the cricket Gryllus bimaculatus, missing distal parts of the amputated leg are regenerated from the blastema, a population of dedifferentiated proliferating cells that forms at the distal tip of the leg stump. To identify molecules involved in blastema formation, comparative transcriptome analysis was performed between regenerating and normal unamputated legs. Components of JAK/STAT signalling were upregulated more than twofold in regenerating legs. To verify their involvement, Gryllus homologues of the interleukin receptor Domeless (Gb'dome), the Janus kinase Hopscotch (Gb'hop) and the transcription factor STAT (Gb'Stat) were cloned, and RNAi was performed against these genes. Gb'dome(RNAi), Gb'hop(RNAi) and Gb'Stat(RNAi) crickets showed defects in leg regeneration. Blastema expression of Gb'cyclinE was decreased in the Gb'Stat(RNAi) cricket compared with that in the control. Hyperproliferation of blastema cells caused by Gb'fat(RNAi) or Gb'warts(RNAi) was suppressed by RNAi against Gb'Stat. The results suggest that JAK/STAT signalling regulates blastema cell proliferation during leg regeneration.

RNAi Technology for Insect Management and Protection of Beneficial Insects from Diseases: Lessons, Challenges and Risk Assessments.

PubMed

Zotti, M J; Smagghe, G

2015-06-01

The time has passed for us to wonder whether RNA interference (RNAi) effectively controls pest insects or protects beneficial insects from diseases. The RNAi era in insect science began with studies of gene function and genetics that paved the way for the development of novel and highly specific approaches for the management of pest insects and, more recently, for the treatment and prevention of diseases in beneficial insects. The slight differences in components of RNAi pathways are sufficient to provide a high degree of variation in responsiveness among insects. The current framework to assess the negative effects of genetically modified (GM) plants on human health is adequate for RNAi-based GM plants. Because of the mode of action of RNAi and the lack of genomic data for most exposed non-target organisms, it becomes difficult to determine the environmental risks posed by RNAi-based technologies and the benefits provided for the protection of crops. A better understanding of the mechanisms that determine the variability in the sensitivity of insects would accelerate the worldwide release of commercial RNAi-based approaches.

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae

PubMed Central

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification.

PubMed

Zhang, Chi; Montgomery, Taiowa A; Fischer, Sylvia E J; Garcia, Susana M D A; Riedel, Christian G; Fahlgren, Noah; Sullivan, Christopher M; Carrington, James C; Ruvkun, Gary

2012-05-22

In nematodes, plants, and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary small interfering RNAs (siRNAs) and the target messenger RNA (mRNA) leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10, and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, and other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage but sensitive to high dosage of double-stranded RNAs. We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6, and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. Copyright © 2012 Elsevier Ltd. All rights reserved.

The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification

PubMed Central

Zhang, Chi; Montgomery, Taiowa A.; Fischer, Sylvia E. J.; Garcia, Susana M. D. A.; Riedel, Christian G.; Fahlgren, Noah; Sullivan, Christopher M.; Carrington, James C.; Ruvkun, Gary

2012-01-01

SUMMARY Background In nematodes, plants and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary siRNAs and the target mRNA leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. Results From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10 and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, as well as other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage, but sensitive to high dosage of double-stranded RNAs (dsRNAs). We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6 and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. Conclusions The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. PMID:22542102

Differential effects of RNAi treatments on field populations of the western corn rootworm.

PubMed

Chu, Chia-Ching; Sun, Weilin; Spencer, Joseph L; Pittendrigh, Barry R; Seufferheld, Manfredo J

2014-03-01

RNA interference (RNAi) mediated crop protection against insect pests is a technology that is greatly anticipated by the academic and industrial pest control communities. Prior to commercialization, factors influencing the potential for evolution of insect resistance to RNAi should be evaluated. While mutations in genes encoding the RNAi machinery or the sequences targeted for interference may serve as a prominent mechanism of resistance evolution, differential effects of RNAi on target pests may also facilitate such evolution. However, to date, little is known about how variation of field insect populations could influence the effectiveness of RNAi treatments. To approach this question, we evaluated the effects of RNAi treatments on adults of three western corn rootworm (WCR; Diabrotica virgifera virgifera LeConte) populations exhibiting different levels of gut cysteine protease activity, tolerance of soybean herbivory, and immune gene expression; two populations were collected from crop rotation-resistant (RR) problem areas and one from a location where RR was not observed (wild type; WT). Our results demonstrated that RNAi targeting DvRS5 (a highly expressed cysteine protease gene) reduced gut cysteine protease activity in all three WCR populations. However, the proportion of the cysteine protease activity that was inhibited varied across populations. When WCR adults were treated with double-stranded RNA of an immune gene att1, different changes in survival among WT and RR populations on soybean diets occurred. Notably, for both genes, the sequences targeted for RNAi were the same across all populations examined. These findings indicate that the effectiveness of RNAi treatments could vary among field populations depending on their physiological and genetic backgrounds and that the consistency of an RNAi trait's effectiveness on phenotypically different populations should be considered or tested prior to wide deployment. Also, genes that are potentially subjected to differential selection in the field should be avoided for RNAi-based pest control. Published by Elsevier Inc.

Photoinduced RNA interference.

PubMed

Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

2012-07-17

Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

PubMed

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis

PubMed Central

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests. PMID:29261729

Cathepsin B Cysteine Proteinase is Essential for the Development and Pathogenesis of the Plant Parasitic Nematode Radopholus similis

PubMed Central

Li, Yu; Wang, Ke; Xie, Hui; Wang, Dong-Wei; Xu, Chun-Ling; Huang, Xin; Wu, Wen-Jia; Li, Dan-Lei

2015-01-01

Radopholus similis is an important plant parasitic nematode which severely harms many crops. Cathepsin B is present in a wide variety of organisms, and plays an important role in many parasites. Understanding cathepsin B of R. similis would allow us to find new targets and approaches for its control. In this study, we found that Rs-cb-1 mRNA was expressed in esophageal glands, intestines and gonads of females, testes of males, juveniles and eggs in R. similis. Rs-cb-1 expression was the highest in females, followed by juveniles and eggs, and was the lowest in males. The maximal enzyme activity of Rs-CB-1 was detected at pH 6.0 and 40 °C. Silencing of Rs-cb-1 using in vitro RNAi (Soaking with dsRNA in vitro) not only significantly inhibited the development and hatching of R. similis, but also greatly reduced its pathogenicity. Using in planta RNAi, we confirmed that Rs-cb-1 expression in nematodes were significantly suppressed and the resistance to R. similis was significantly improved in T2 generation transgenic tobacco plants expressing Rs-cb-1 dsRNA. The genetic effects of in planta RNAi-induced gene silencing could be maintained in the absence of dsRNA for at least two generations before being lost, which was not the case for the effects induced by in vitro RNAi. Overall, our results first indicate that Rs-cb-1 plays key roles in the development, hatching and pathogenesis of R. similis, and that in planta RNAi is an effective tool in studying gene function and genetic engineering of plant resistance to migratory plant parasitic nematodes. PMID:26221074

Conditional RNAi: towards a silent gene therapy.

PubMed

Lee, Sang-Kyung; Kumar, Priti

2009-07-02

RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

Amides are excellent mimics of phosphate internucleoside linkages and are well tolerated in short interfering RNAs

PubMed Central

Mutisya, Daniel; Selvam, Chelliah; Lunstad, Benjamin D.; Pallan, Pradeep S.; Haas, Amanda; Leake, Devin; Egli, Martin; Rozners, Eriks

2014-01-01

RNA interference (RNAi) has become an important tool in functional genomics and has an intriguing therapeutic potential. However, the current design of short interfering RNAs (siRNAs) is not optimal for in vivo applications. Non-ionic phosphate backbone modifications may have the potential to improve the properties of siRNAs, but are little explored in RNAi technologies. Using X-ray crystallography and RNAi activity assays, the present study demonstrates that 3′-CH2-CO-NH-5′ amides are excellent replacements for phosphodiester internucleoside linkages in RNA. The crystal structure shows that amide-modified RNA forms a typical A-form duplex. The amide carbonyl group points into the major groove and assumes an orientation that is similar to the P–OP2 bond in the phosphate linkage. Amide linkages are well hydrated by tandem waters linking the carbonyl group and adjacent phosphate oxygens. Amides are tolerated at internal positions of both the guide and passenger strand of siRNAs and may increase the silencing activity when placed near the 5′-end of the passenger strand. As a result, an siRNA containing eight amide linkages is more active than the unmodified control. The results suggest that RNAi may tolerate even more extensive amide modification, which may be useful for optimization of siRNAs for in vivo applications. PMID:24813446

RNAi knockdown of rice SE5 gene is sensitive to the herbicide methyl viologen by the down-regulation of antioxidant defense.

PubMed

Xu, Sheng; Wang, Lijuan; Zhang, Bo; Han, Bin; Xie, Yanjie; Yang, Jie; Zhong, Weigong; Chen, Huiping; Wang, Ren; Wang, Ning; Cui, Weiti; Shen, Wenbiao

2012-09-01

Plant heme oxygenase (HO) catalyzes the oxygenation of heme to biliverdin, carbon monoxide (CO), and free iron (Fe(2+))-and Arabidopsis and rice (Oryza sativa) HOs are involved in light signaling. Here, we identified that the rice PHOTOPERIOD SENSITIVITY 5 (SE5) gene, which encoded a putative HO with high similarity to HO-1 from Arabidopsis (HY1), exhibited HO activity, and localized in the chloroplasts. Rice RNAi mutants silenced for SE5 were generated and displayed early flowering under long-day conditions, consistent with phenotypes of the null mutation in SE5 gene reported previously (se5 and s73). The herbicide methyl viologen (MV), which produces reactive oxygen species (ROS), was applied to determine whether SE5 regulates oxidative stress response. Compared with wild-type, SE5 RNAi transgenic plants aggravated seedling growth inhibition, chlorophyll loss and ROS overproduction, and decreased the transcripts of some representative antioxidative genes. By contrast, administration of exogenous CO partially rescued corresponding MV hypersensitivity in the SE5 RNAi plants. Alleviation of seed germination inhibition, chlorophyll loss and ROS overproduction, as well as the induction of antioxidant defense were further observed when SE5 or HY1 was overexpressed in transgenic Arabidopsis plants, indicating that SE5 may be useful for molecular breeding designed to improve plant tolerance to oxidative stress.

Bactrocera dorsalis male sterilization by targeted RNA interference of spermatogenesis: empowering sterile insect technique programs

PubMed Central

Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying

2016-01-01

RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174

RNAi assisted genome evolution unveils yeast mutants with improved xylose utilization.

PubMed

HamediRad, Mohammad; Lian, Jiazhang; Li, Hejun; Zhao, Huimin

2018-06-01

Xylose is a major component of lignocellulosic biomass, one of the most abundant feedstocks for biofuel production. Therefore, efficient and rapid conversion of xylose to ethanol is crucial in the viability of lignocellulosic biofuel plants. In this study, RNAi Assisted Genome Evolution (RAGE) was used to improve the xylose utilization rate in SR8, one of the most efficient publicly available xylose utilizing Saccharomyces cerevisiae strains. To identify gene targets for further improvement, we created a genome-scale library consisting of both genetic over-expression and down-regulation mutations in SR8. Followed by screening in media containing xylose as the sole carbon source, yeast mutants with 29% faster xylose utilization, and 45% higher ethanol productivity were obtained relative to the parent strain. Two known and two new effector genes were identified in these mutant strains. Notably, down-regulation of CDC11, an essential gene, resulted in faster xylose utilization, and this gene target cannot be identified in genetic knock-out screens. © 2018 Wiley Periodicals, Inc.

Low Immunogenic Endothelial Cells Maintain Morphological and Functional Properties Required for Vascular Tissue Engineering.

PubMed

Lau, Skadi; Eicke, Dorothee; Carvalho Oliveira, Marco; Wiegmann, Bettina; Schrimpf, Claudia; Haverich, Axel; Blasczyk, Rainer; Wilhelmi, Mathias; Figueiredo, Constança; Böer, Ulrike

2018-03-01

The limited availability of native vessels suitable for the application as hemodialysis shunts or bypass material demands new strategies in cardiovascular surgery. Tissue-engineered vascular grafts containing autologous cells are considered ideal vessel replacements due to the low risk of rejection. However, endothelial cells (EC), which are central components of natural blood vessels, are difficult to obtain from elderly patients of poor health. Umbilical cord blood represents a promising alternative source for EC, but their allogeneic origin corresponds with the risk of rejection after allotransplantation. To reduce this risk, the human leukocyte antigen class I (HLA I) complex was stably silenced by lentiviral vector-mediated RNA interference (RNAi) in EC from peripheral blood and umbilical cord blood and vein. EC from all three sources were transduced by 93.1% ± 4.8% and effectively, HLA I-silenced by up to 67% compared to nontransduced (NT) cells or transduced with a nonspecific short hairpin RNA, respectively. Silenced EC remained capable to express characteristic endothelial surface markers such as CD31 and vascular endothelial cadherin important for constructing a tight barrier, as well as von Willebrand factor and endothelial nitric oxide synthase important for blood coagulation and vessel tone regulation. Moreover, HLA I-silenced EC were still able to align under unidirectional flow, to take up acetylated low-density lipoprotein, and to form capillary-like tube structures in three-dimensional fibrin gels similar to NT cells. In particular, addition of adipose tissue-derived mesenchymal stem cells significantly improved tube formation capability of HLA I-silenced EC toward long and widely branched vascular networks necessary for prevascularizing vascular grafts. Thus, silencing HLA I by RNAi represents a promising technique to reduce the immunogenic potential of EC from three different sources without interfering with EC-specific morphological and functional properties required for vascular tissue engineering. This extends the spectrum of available cell sources from autologous to allogeneic sources, thereby accelerating the generation of tissue-engineered vascular grafts in acute clinical cases.

Delivery of RNAi Therapeutics to the Airways-From Bench to Bedside.

PubMed

Qiu, Yingshan; Lam, Jenny K W; Leung, Susan W S; Liang, Wanling

2016-09-20

RNA interference (RNAi) is a potent and specific post-transcriptional gene silencing process. Since its discovery, tremendous efforts have been made to translate RNAi technology into therapeutic applications for the treatment of different human diseases including respiratory diseases, by manipulating the expression of disease-associated gene(s). Similar to other nucleic acid-based therapeutics, the major hurdle of RNAi therapy is delivery. Pulmonary delivery is a promising approach of delivering RNAi therapeutics directly to the airways for treating local conditions and minimizing systemic side effects. It is a non-invasive route of administration that is generally well accepted by patients. However, pulmonary drug delivery is a challenge as the lungs pose a series of anatomical, physiological and immunological barriers to drug delivery. Understanding these barriers is essential for the development an effective RNA delivery system. In this review, the different barriers to pulmonary drug delivery are introduced. The potential of RNAi molecules as new class of therapeutics, and the latest preclinical and clinical studies of using RNAi therapeutics in different respiratory conditions are discussed in details. We hope this review can provide some useful insights for moving inhaled RNAi therapeutics from bench to bedside.

Stacking up CRISPR against RNAi for therapeutic gene inhibition.

PubMed

Haussecker, Dirk

2016-09-01

Both RNA interference (RNAi) and clustered regularly-interspaced short palindromic repeats (CRISPR) technologies allow for the sequence-specific inhibition of gene function and therefore have the potential to be used as therapeutic modalities. By judging the current public and scientific journal interest, it would seem that CRISPR, by enabling clean, durable knockouts, will dominate therapeutic gene inhibition, also at the expense of RNAi. This review aims to look behind prevailing sentiments and to more clearly define the likely scope of the therapeutic applications of the more recently developed CRISPR technology and its relative strengths and weaknesses with regards to RNAi. It is found that largely because of their broadly overlapping delivery constraints, while CRISPR presents formidable competition for DNA-directed RNAi strategies, its impact on RNAi therapeutics triggered by synthetic oligonucleotides will likely be more moderate. Instead, RNAi and genome editing, and in particular CRISPR, are poised to jointly promote a further shift toward sequence-targeted precision medicines. © 2016 Federation of European Biochemical Societies.

A RNA nanotechnology platform for a simultaneous two-in-one siRNA delivery and its application in synergistic RNAi therapy

PubMed Central

Jang, Mihue; Han, Hee Dong; Ahn, Hyung Jun

2016-01-01

Incorporating multiple copies of two RNAi molecules into a single nanostructure in a precisely controlled manner can provide an efficient delivery tool to regulate multiple gene pathways in the relation of mutual dependence. Here, we show a RNA nanotechnology platform for a two-in-one RNAi delivery system to contain polymeric two RNAi molecules within the same RNA nanoparticles, without the aid of polyelectrolyte condensation reagents. As our RNA nanoparticles lead to the simultaneous silencing of two targeted mRNAs, of which biological functions are highly interdependent, combination therapy for multi-drug resistance cancer cells, which was studied as a specific application of our two-in-one RNAi delivery system, demonstrates the efficient synergistic effects for cancer therapy. Therefore, this RNA nanoparticles approach has an efficient tool for a simultaneous co-delivery of RNAi molecules in the RNAi-based biomedical applications, and our current studies present an efficient strategy to overcome multi-drug resistance caused by malfunction of genes in chemotherapy. PMID:27562435

The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.

PubMed

Fassnacht, Christina; Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos; Stadler, Michael B; Ciosk, Rafal

2018-03-01

Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition.

The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans

PubMed Central

Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos

2018-01-01

Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition. PMID:29579041

RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella

PubMed Central

Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.

2004-01-01

Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231

An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

PubMed Central

Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

2013-01-01

RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

OfftargetFinder: a web tool for species-specific RNAi design.

PubMed

Good, R T; Varghese, T; Golz, J F; Russell, D A; Papanicolaou, A; Edwards, O; Robin, C

2016-04-15

RNA interference (RNAi) technology is being developed as a weapon for pest insect control. To maximize the specificity that such an approach affords we have developed a bioinformatic web tool that searches the ever-growing arthropod transcriptome databases so that pest-specific RNAi sequences can be identified. This will help technology developers finesse the design of RNAi sequences and suggests which non-target species should be assessed in the risk assessment process. http://rnai.specifly.org crobin@unimelb.edu.au. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

RNAi Screening in Spodoptera frugiperda.

PubMed

Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

2016-01-01

RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

Genome Enabled Discovery of Carbon Sequestration Genes in Poplar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filichkin, Sergei; Etherington, Elizabeth; Ma, Caiping

2007-02-22

The goals of the S.H. Strauss laboratory portion of 'Genome-enabled discovery of carbon sequestration genes in poplar' are (1) to explore the functions of candidate genes using Populus transformation by inserting genes provided by Oakridge National Laboratory (ORNL) and the University of Florida (UF) into poplar; (2) to expand the poplar transformation toolkit by developing transformation methods for important genotypes; and (3) to allow induced expression, and efficient gene suppression, in roots and other tissues. As part of the transformation improvement effort, OSU developed transformation protocols for Populus trichocarpa 'Nisqually-1' clone and an early flowering P. alba clone, 6K10. Completemore » descriptions of the transformation systems were published (Ma et. al. 2004, Meilan et. al 2004). Twenty-one 'Nisqually-1' and 622 6K10 transgenic plants were generated. To identify root predominant promoters, a set of three promoters were tested for their tissue-specific expression patterns in poplar and in Arabidopsis as a model system. A novel gene, ET304, was identified by analyzing a collection of poplar enhancer trap lines generated at OSU (Filichkin et. al 2006a, 2006b). Other promoters include the pGgMT1 root-predominant promoter from Casuarina glauca and the pAtPIN2 promoter from Arabidopsis root specific PIN2 gene. OSU tested two induction systems, alcohol- and estrogen-inducible, in multiple poplar transgenics. Ethanol proved to be the more efficient when tested in tissue culture and greenhouse conditions. Two estrogen-inducible systems were evaluated in transgenic Populus, neither of which functioned reliably in tissue culture conditions. GATEWAY-compatible plant binary vectors were designed to compare the silencing efficiency of homologous (direct) RNAi vs. heterologous (transitive) RNAi inverted repeats. A set of genes was targeted for post transcriptional silencing in the model Arabidopsis system; these include the floral meristem identity gene (APETALA1 or AP1), auxin response factor gene (ETTIN), the gene encoding transcriptional factor of WD40 family (TRANSPARENTTESTAGLABRA1 or TTG1), and the auxin efflux carrier (PIN-FORMED2 or PIN2) gene. More than 220 transgenic lines of the 1st, 2nd and 3rd generations were analyzed for RNAi suppression phenotypes (Filichkin et. al., manuscript submitted). A total of 108 constructs were supplied by ORNL, UF and OSU and used to generate over 1,881 PCR verified transgenic Populus and over 300 PCR verified transgenic Arabidopsis events. The Populus transgenics alone required Agrobacterium co-cultivations of 124.406 explants.« less

RNAi as a Routine Route Toward Breast Cancer Therapy

DTIC Science & Technology

2013-09-01

Award Number: W81XWH-08-1-0572 TITLE: RNAi as a Routine Route Toward Breast Cancer Therapy...To) 1 SEP 2012 - 31 AUG 2013 4. TITLE AND SUBTITLE RNAi as a Routine Route Toward Breast Cancer Therapy 5a. CONTRACT NUMBER...generation RNAi library and made that available to the breast cancer community. This resource has nearly 75,000 independent, sequence verified clones

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

Role of RNA Interference (RNAi) in Dengue Virus Replication and Identification of NS4B as an RNAi Suppressor

PubMed Central

Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan

2013-01-01

RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001

CDC-25.1 controls the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively regulating CDK-1 in Caenorhabditis elegans.

PubMed

Yoon, Sunghee; Kawasaki, Ichiro; Shim, Yhong-Hee

2012-04-01

In Caenorhabditis elegans, cdc-25.1 loss-of-function mutants display a lack of germline proliferation. We found that the proliferation defect of cdc-25.1 mutants was suppressed by wee-1.3 RNAi. Further, among the seven cdk and seven cyclin homologs examined, cdk-1 and cyb-3 RNAi treatment caused the most severe germline proliferation defects in an rrf-1 mutant background, which were similar to those of the cdc-25.1 mutants. In addition, while RNAi of cyd-1 and cye-1 caused significant germline proliferation defects, RNAi of cdk-2 and cdk-4 did not. Compared with the number of germ nuclei in wee-1.3(RNAi) worms, the number in wee-1.3(RNAi);cdk-1(RNAi) and wee-1.3(RNAi);cyb-3(RNAi) worms further decreased to the level of cdk-1(RNAi) and cyb-3(RNAi) worms, respectively, indicating that cdk-1 and cyb-3 are epistatic and function downstream of cdc-25.1 and wee-1.3 in the control of the cell cycle. BrdU labeling of adult worms showed that, while 100% of the wild-type germ nuclei in the mitotic region incorporated BrdU when labeled for more than 12 h at 20°C, a small fraction of the cdc-25.1 mutant germ nuclei failed to incorporate BrdU even when labeled for 68 h. These results indicate that CDC-25.1 is required for maintaining proper rate of germline mitotic cell cycle. We propose that CDC-25.1 regulates the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively controlling CDK-1, which forms a complex primarily with CYB-3, but also possibly with CYD-1 and CYE-1.

Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

PubMed Central

Foda, Bardees M.; Singh, Upinder

2015-01-01

RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

Improved nucleic acid descriptors for siRNA efficacy prediction.

PubMed

Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

2013-02-01

Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

Environmental RNAi in herbivorous insects.

PubMed

Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R

2015-05-01

Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

PubMed

Feretzaki, Marianna; Billmyre, R Blake; Clancey, Shelly Applen; Wang, Xuying; Heitman, Joseph

2016-03-01

RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein) and Qip1 (a homolog of N. crassa Qip) were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor) and Fzc28 (a transcription factor) are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

Gene silencing of Sugar-dependent 1 (JcSDP1), encoding a patatin-domain triacylglycerol lipase, enhances seed oil accumulation in Jatropha curcas

PubMed Central

2014-01-01

Background Triacylglycerols (TAGs) are the most abundant form of storage oil in plants. They consist of three fatty acid chains (usually C16 or C18) covalently linked to glycerol. SDP1 is a specific lipase for the first step of TAG catabolism in Arabidopsis seeds. Arabidopsis mutants deficient in SDP1 accumulate high levels of oils, probably due to blockage in TAG degradation. We applied this knowledge from the model plant, Arabidopsis thaliana, to engineer increased seed oil content in the biodiesel plant Jatropha curcas using RNA interference (RNAi) technology. Results As Jatropha is a biodiesel crop, any significant increase in its seed oil content would be an important agronomic trait. Using A. thaliana as a model plant, we found that a deficiency of SDP1 led to higher TAG accumulation and a larger number of oil bodies in seeds compared with wild type (Columbia-0; Col-0). We cloned Jatropha JcSDP1, and verified its function by complementation of the Arabidopsis sdp1-5 mutant. Taking advantage of the observation with Arabidopsis, we used RNAi technology to generate JcSDP1 deficiency in transgenic Jatropha. We found that Jatropha JcSDP1-RNAi plants accumulated 13 to 30% higher total seed storage lipid, along with a 7% compensatory decrease in protein content, compared with control (CK; 35S:GFP) plants. Free fatty acid (FFA) content in seeds was reduced from 27% in control plants to 8.5% in JcSDP1-RNAi plants. Conclusion Here, we showed that SDP1 deficiency enhances seed oil accumulation in Arabidopsis. Based on this result, we generated SDP1-deficient transgenic Jatropha plants using by RNAi technology with a native JcSDP1 promoter to silence endogenous JcSDP1 expression. Seeds of Jatropha JcSDP1-RNAi plants accumulated up to 30% higher total lipid and had reduced FFA content compared with control (CK; 35S:GFP) plants. Our strategy of improving an important agronomic trait of Jatropha can be extended to other oil crops to yield higher seed oil. PMID:24606605

Therapeutic gene targeting approaches for the treatment of dyslipidemias and atherosclerosis.

PubMed

Mäkinen, Petri I; Ylä-Herttuala, Seppo

2013-04-01

Despite improved therapies, cardiovascular diseases are the leading cause of morbidity and mortality worldwide. Therefore, new therapeutic approaches are still needed. In the gene therapy field, RNA interference (RNAi) and regulation of microRNAs (miRNAs) have gained a lot of attention in addition to traditional overexpression based strategies. Here, recent findings in therapeutic gene silencing and modulation of small RNA expression related to atherogenesis and dyslipidemia are summarized. Novel gene therapy approaches for the treatment of hyperlipidemia have been addressed. Antisense oligonucleotide and RNAi-based therapies against apolipoprotein B100 and proprotein convertase subtilisin/kexin type 9 have shown already efficacy in preclinical and clinical trials. In addition, several miRNAs dysregulated in atherosclerotic lesions and regulating cholesterol homeostasis have been found, which may represent novel targets for future therapies. New therapies for lowering lipid levels are now being tested in clinical trials, and both antisense oligonucleotide and RNAi-based therapies have shown promising results in lowering cholesterol levels. However, the modulation of inflammatory component in atherosclerosis by gene therapy and targeting of the effects to plaques are still difficult challenges.

shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

PubMed

Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

2016-12-01

RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

siRNAs and piRNAs Collaborate for Transposon Control in the Two-Spotted Spider Mite.

PubMed

Mondal, Mosharrof; Mansfield, Kody; Flynt, Alex

2018-04-20

RNAi has revolutionized genetic research, and is being commercialized as an insect pest control technology. Mechanisms exploited for this purpose are antiviral and therefore rapidly evolving. Ideally, RNAi will also be used for non-insect pests, however, differences in RNAi biology makes this uncertain. Tetranychus urticae (two-spotted spider mite) is a destructive non-insect pest, which has a proclivity to develop pesticide resistance. Here we provide a comprehensive study of the endogenous RNAi pathways of spider mites to inform design of exogenous RNAi triggers. This effort revealed unexpected roles for small RNAs and novel genome surveillance pathways. Spider mites have an expanded RNAi machinery relative to insects, encoding RNA dependent RNA polymerase (Rdrp) and extra Piwi-class effectors. Through analyzing T. urticae transcriptome data we explored small RNA biogenesis, and discovered five siRNA loci that appear central to genome surveillance. These RNAs are expressed in the gonad, which we hypothesize to trigger production of piRNAs for control of transposable elements (TEs). This work highlights the need to investigate endogenous RNAi biology as lessons from model organisms may not hold in other species, impacting development of an RNAi strategy. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

PubMed Central

Ladunga, Istvan

2007-01-01

Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

RNAi revised--target mRNA-dependent enhancement of gene silencing.

PubMed

Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias

2015-12-15

The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular mechanisms influencing efficiency of RNA interference in insects.

PubMed

Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

2018-06-21

RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Development of RNAi technology for targeted therapy--a track of siRNA based agents to RNAi therapeutics.

PubMed

Zhou, Yinjian; Zhang, Chunling; Liang, Wei

2014-11-10

RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.

Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

PubMed

Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

2017-01-01

Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can be applied to functional genomics analyses to facilitate, species-specific dsRNA-mediated control of other non-model hemipterans.

Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.

PubMed

Mongelli, Vanesa; Saleh, Maria-Carla

2016-09-29

Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.

Design and assembly of new non-viral RNAi delivery agents by microwave-assisted quaternization (MAQ) of tertiary amines

PubMed Central

Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.

2010-01-01

RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369

Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila

PubMed Central

Kurscheid, Sebastian; Lew-Tabor, Ala E; Rodriguez Valle, Manuel; Bruyeres, Anthea G; Doogan, Vivienne J; Munderloh, Ulrike G; Guerrero, Felix D; Barrero, Roberto A; Bellgard, Matthew I

2009-01-01

Background The Arthropods are a diverse group of organisms including Chelicerata (ticks, mites, spiders), Crustacea (crabs, shrimps), and Insecta (flies, mosquitoes, beetles, silkworm). The cattle tick, Rhipicephalus (Boophilus) microplus, is an economically significant ectoparasite of cattle affecting cattle industries world wide. With the availability of sequence reads from the first Chelicerate genome project (the Ixodes scapularis tick) and extensive R. microplus ESTs, we investigated evidence for putative RNAi proteins and studied RNA interference in tick cell cultures and adult female ticks targeting Drosophila homologues with known cell viability phenotype. Results We screened 13,643 R. microplus ESTs and I. scapularis genome reads to identify RNAi related proteins in ticks. Our analysis identified 31 RNAi proteins including a putative tick Dicer, RISC associated (Ago-2 and FMRp), RNA dependent RNA polymerase (EGO-1) and 23 homologues implicated in dsRNA uptake and processing. We selected 10 R. microplus ESTs with >80% similarity to D. melanogaster proteins associated with cell viability for RNAi functional screens in both BME26 R. microplus embryonic cells and female ticks in vivo. Only genes associated with proteasomes had an effect on cell viability in vitro. In vivo RNAi showed that 9 genes had significant effects either causing lethality or impairing egg laying. Conclusion We have identified key RNAi-related proteins in ticks and along with our loss-of-function studies support a functional RNAi pathway in R. microplus. Our preliminary studies indicate that tick RNAi pathways may differ from that of other Arthropods such as insects. PMID:19323841

Amides are excellent mimics of phosphate internucleoside linkages and are well tolerated in short interfering RNAs.

PubMed

Mutisya, Daniel; Selvam, Chelliah; Lunstad, Benjamin D; Pallan, Pradeep S; Haas, Amanda; Leake, Devin; Egli, Martin; Rozners, Eriks

2014-06-01

RNA interference (RNAi) has become an important tool in functional genomics and has an intriguing therapeutic potential. However, the current design of short interfering RNAs (siRNAs) is not optimal for in vivo applications. Non-ionic phosphate backbone modifications may have the potential to improve the properties of siRNAs, but are little explored in RNAi technologies. Using X-ray crystallography and RNAi activity assays, the present study demonstrates that 3'-CH2-CO-NH-5' amides are excellent replacements for phosphodiester internucleoside linkages in RNA. The crystal structure shows that amide-modified RNA forms a typical A-form duplex. The amide carbonyl group points into the major groove and assumes an orientation that is similar to the P-OP2 bond in the phosphate linkage. Amide linkages are well hydrated by tandem waters linking the carbonyl group and adjacent phosphate oxygens. Amides are tolerated at internal positions of both the guide and passenger strand of siRNAs and may increase the silencing activity when placed near the 5'-end of the passenger strand. As a result, an siRNA containing eight amide linkages is more active than the unmodified control. The results suggest that RNAi may tolerate even more extensive amide modification, which may be useful for optimization of siRNAs for in vivo applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Host-directed combinatorial RNAi improves inhibition of diverse strains of influenza A virus in human respiratory epithelial cells.

PubMed

Estrin, Michael A; Hussein, Islam T M; Puryear, Wendy B; Kuan, Anne C; Artim, Stephen C; Runstadler, Jonathan A

2018-01-01

Influenza A virus infections are important causes of morbidity and mortality worldwide, and currently available prevention and treatment methods are suboptimal. In recent years, genome-wide investigations have revealed numerous host factors that are required for influenza to successfully complete its life cycle. However, only a select, small number of influenza strains were evaluated using this platform, and there was considerable variation in the genes identified across different investigations. In an effort to develop a universally efficacious therapeutic strategy with limited potential for the emergence of resistance, this study was performed to investigate the effect of combinatorial RNA interference (RNAi) on inhibiting the replication of diverse influenza A virus subtypes and strains. Candidate genes were selected for targeting based on the results of multiple previous independent genome-wide studies. The effect of single and combinatorial RNAi on the replication of 12 diverse influenza A viruses, including three strains isolated from birds and one strain isolated from seals, was then evaluated in primary normal human bronchial epithelial cells. After excluding overly toxic siRNA, two siRNA combinations were identified that reduced mean viral replication by greater than 79 percent in all mammalian strains, and greater than 68 percent in all avian strains. Host-directed combinatorial RNAi effectively prevents growth of a broad range of influenza virus strains in vitro, and is a potential therapeutic candidate for further development and future in vivo studies.

EPA Registers Innovative Tool to Control Corn Rootworm

EPA Pesticide Factsheets

Ribonucleic acid interference (RNAi) based Plant Incorporated Protectant (PIP) technology is a new and innovative scientific tool utilized by U.S. growers. Learn more about RNAi technology and the 4 new products containing the RNAi based PIP called SMARTST

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae

PubMed Central

Morris, Robert; Wilson, Leonie; Warnock, Neil D.; Maule, Aaron G.

2017-01-01

Entomopathogenic nematodes (EPNs) employ a sophisticated chemosensory apparatus to detect potential hosts. Understanding the molecular basis of relevant host-finding behaviours could facilitate improved EPN biocontrol approaches, and could lend insight to similar behaviours in economically important mammalian parasites. FMRFamide-like peptides are enriched and conserved across the Phylum Nematoda, and have been linked with motor and sensory function, including dispersal and aggregating behaviours in the free living nematode Caenorhabditis elegans. The RNA interference (RNAi) pathway of Steinernema carpocapsae was characterised in silico, and employed to knockdown the expression of the FMRFamide-like peptide 21 (GLGPRPLRFamide) gene (flp-21) in S. carpocapsae infective juveniles; a first instance of RNAi in this genus, and a first in an infective juvenile of any EPN species. Our data show that 5 mg/ml dsRNA and 50 mM serotonin triggers statistically significant flp-21 knockdown (-84%***) over a 48 h timecourse, which inhibits host-finding (chemosensory), dispersal, hyperactive nictation and jumping behaviours. However, whilst 1 mg/ml dsRNA and 50 mM serotonin also triggers statistically significant flp-21 knockdown (-51%**) over a 48 h timecourse, it does not trigger the null sensory phenotypes; statistically significant target knockdown can still lead to false negative results, necessitating appropriate experimental design. SPME GC-MS volatile profiles of two EPN hosts, Galleria mellonella and Tenebrio molitor reveal an array of shared and unique compounds; these differences had no impact on null flp-21 RNAi phenotypes for the behaviours assayed. Localisation of flp-21 / FLP-21 to paired anterior neurons by whole mount in situ hybridisation and immunocytochemistry corroborates the RNAi data, further suggesting a role in sensory modulation. These data can underpin efforts to study these behaviours in other economically important parasites, and could facilitate molecular approaches to EPN strain improvement for biocontrol. PMID:28253355

Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer

PubMed Central

Azorsa, David O; Gonzales, Irma M; Basu, Gargi D; Choudhary, Ashish; Arora, Shilpi; Bisanz, Kristen M; Kiefer, Jeffrey A; Henderson, Meredith C; Trent, Jeffrey M; Von Hoff, Daniel D; Mousses, Spyro

2009-01-01

Background Pancreatic cancer retains a poor prognosis among the gastrointestinal cancers. It affects 230,000 individuals worldwide, has a very high mortality rate, and remains one of the most challenging malignancies to treat successfully. Treatment with gemcitabine, the most widely used chemotherapeutic against pancreatic cancer, is not curative and resistance may occur. Combinations of gemcitabine with other chemotherapeutic drugs or biological agents have resulted in limited improvement. Methods In order to improve gemcitabine response in pancreatic cancer cells, we utilized a synthetic lethal RNAi screen targeting 572 known kinases to identify genes that when silenced would sensitize pancreatic cancer cells to gemcitabine. Results Results from the RNAi screens identified several genes that, when silenced, potentiated the growth inhibitory effects of gemcitabine in pancreatic cancer cells. The greatest potentiation was shown by siRNA targeting checkpoint kinase 1 (CHK1). Validation of the screening results was performed in MIA PaCa-2 and BxPC3 pancreatic cancer cells by examining the dose response of gemcitabine treatment in the presence of either CHK1 or CHK2 siRNA. These results showed a three to ten-fold decrease in the EC50 for CHK1 siRNA-treated cells versus control siRNA-treated cells while treatment with CHK2 siRNA resulted in no change compared to controls. CHK1 was further targeted with specific small molecule inhibitors SB 218078 and PD 407824 in combination with gemcitabine. Results showed that treatment of MIA PaCa-2 cells with either of the CHK1 inhibitors SB 218078 or PD 407824 led to sensitization of the pancreatic cancer cells to gemcitabine. Conclusion These findings demonstrate the effectiveness of synthetic lethal RNAi screening as a tool for identifying sensitizing targets to chemotherapeutic agents. These results also indicate that CHK1 could serve as a putative therapeutic target for sensitizing pancreatic cancer cells to gemcitabine. PMID:19519883

RNA interference: ready to silence cancer?

PubMed

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Non-invasive delivery of dsGST is lethal to the sweet potato whitefly, Bemisia tabaci (G.) (Hemiptera: Aleyrodidae).

PubMed

Asokan, R; Rebijith, K B; Roopa, H K; Kumar, N K Krishna

2015-02-01

The sweet potato whitefly, Bemisia tabaci (G.) biotype B (Hemiptera: Aleyrodidae), is one of the most economically important pest, by being a dreaded vector of Geminiviruses, and also causes direct damage to the crops by sucking phloem sap. Glutathione S-transferase (GST) is a large family of multifunctional enzymes that play pivotal roles in the detoxification of secondary allelochemical produced by the host plants and in insecticide resistance, thus regulates insect growth and development. The objective of this study is to show the potential of RNA interference (RNAi) in the management of B. tabaci. RNAi is a sequence-specific gene silencing mechanism induced by double-stranded RNA (dsRNA) which holds tremendous potential in pest management. In this regard, we sequenced the GST from B. tabaci and synthesized approximately 500-bp dsRNA from the above and delivered through diet to B. tabaci. Real-time quantitative PCR (RT-qPCR) showed that continuous application of dsGST at 1.0, 0.5, and 0.25 μg/μl reduced mRNA expression levels for BtGST by 77.43, 64.86, and 52.95 % which resulted in mortality by 77, 59, and 40 %, respectively, after 72 h of application. Disruption of BtGST expression will enable the development of novel strategies in pest management and functional analysis of vital genes in B. tabaci.

Aedes aegypti ML and Niemann-Pick type C family members are agonists of dengue virus infection

PubMed Central

Jupatanakul, Natapong; Sim, Shuzhen; Dimopoulos, George

2014-01-01

Upon exposure to dengue virus, the Aedes aegypti mosquito vector mounts an anti-viral immune defense by activating the Toll, JAK/STAT, and RNAi pathways, thereby limiting infection. While these pathways and several other factors have been identified as dengue virus antagonists, our knowledge of factors that facilitate dengue virus infection is limited. Previous dengue virus infection-responsive transcriptome analyses have revealed an increased mRNA abundance of members of the myeloid differentiation 2-related lipid recognition protein (ML) and the Niemann Pick-type C1 (NPC1) families upon dengue virus infection. These genes encode lipid-binding proteins that have been shown to play a role in host-pathogen interactions in other organisms. RNAi-mediated gene silencing of a ML and a NPC1 gene family member in both laboratory strain and field-derived Ae. aegypti mosquitoes resulted in significantly elevated resistance to dengue virus in mosquito midguts, suggesting that these genes play roles as dengue virus agonists. In addition to their possible roles in virus cell entry and replication, gene expression analyses suggested that ML and NPC1 family members also facilitate viral infection by modulating the mosquito’s immune competence. Our study suggests that the dengue virus influences the expression of these genes to facilitate its infection of the mosquito host. PMID:24135719

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

PubMed

Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

2017-08-01

This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

RNAi-mediated silencing of MAP kinase signalling genes (Fmk1, Hog1, and Pbs2) in Fusarium oxysporum reduces pathogenesis on tomato plants.

PubMed

Pareek, Manish; Rajam, Manchikatla Venkat

2017-09-01

Fusarium oxysporum is a soil-borne plant fungal pathogen, and causes colossal losses in several crop plants including tomato. Effective control measures include the use of harmful fungicides and resistant cultivars, but these methods have shown limited success. Conventional methods to validate fungal pathogenic genes are labour intensive. Therefore, an alternative strategy is required to efficiently characterize unknown pathogenic genes. RNA interference (RNAi) has emerged as a potential tool to functionally characterize novel fungal pathogenic genes and also to control fungal diseases. Here, we report an efficient method to produce stable RNAi transformants of F. oxysporum using Agrobacterium-mediated transformation (AMT). We have transformed F. oxysporum spores using RNAi constructs of Fmk1, Hog1, and Pbs2 MAP kinase signalling genes. Fmk1 RNAi fungal transformants showed loss of surface hydrophobicity, reduced invasive growth on tomato fruits and hypo-virulence on tomato seedlings. Hog1 and Pbs2 RNAi transformants showed altered conidial size, and reduced invasive growth and pathogenesis. These results showed that AMT using RNAi constructs is an effective approach for dissecting the role of genes involved in pathogenesis in F. oxysporum and this could be extended for other fungal systems. The obtained knowledge can be easily translated for developing fungal resistant crops by RNAi. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design.

PubMed

Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy

2011-02-01

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.

The Nucleocapsid Protein of Coronaviruses Acts as a Viral Suppressor of RNA Silencing in Mammalian Cells.

PubMed

Cui, Lei; Wang, Haiying; Ji, Yanxi; Yang, Jie; Xu, Shan; Huang, Xingyu; Wang, Zidao; Qin, Lei; Tien, Po; Zhou, Xi; Guo, Deyin; Chen, Yu

2015-09-01

RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of medically important mammalian viruses including Severe acute respiratory syndrome coronavirus (SARS-CoV), and showed that the nucleocapsid protein (N protein) of coronaviruses suppresses RNAi triggered by either short hairpin RNAs or small interfering RNAs in mammalian cells. Mouse hepatitis virus (MHV) is closely related to SARS-CoV in the family Coronaviridae and was used as a coronavirus replication model. The replication of MHV increased when the N proteins were expressed in trans, while knockdown of Dicer1 or Ago2 transcripts facilitated the MHV replication in mammalian cells. These results support the hypothesis that RNAi is a part of the antiviral immunity responses in mammalian cells. IMPORTANCE RNAi has been well known to play important antiviral roles from plants to invertebrates. However, recent studies provided strong supports that RNAi is also involved in antiviral response in mammalian cells. An important indication for RNAi-mediated antiviral activity in mammals is the fact that a number of mammalian viruses encode potent suppressors of RNA silencing. Our results demonstrate that coronavirus N protein could function as a VSR through its double-stranded RNA binding activity. Mutational analysis of N protein allowed us to find out the critical residues for the VSR activity. Using the MHV-A59 as the coronavirus replication model, we showed that ectopic expression of SARS-CoV N protein could promote MHV replication in RNAi-active cells but not in RNAi-depleted cells. These results indicate that coronaviruses encode a VSR that functions in the replication cycle and provide further evidence to support that RNAi-mediated antiviral response exists in mammalian cells.

Establishment of a tissue-specific RNAi system in C. elegans.

PubMed

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

2007-10-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

Establishment of a tissue-specific RNAi system in C. elegans

PubMed Central

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

2011-01-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Towards the elements of successful insect Ribonucleic acid interference (RNAi)

USDA-ARS?s Scientific Manuscript database

Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

Biolistics-based gene silencing in plants using a modified particle inflow gun.

PubMed

Davies, Kevin M; Deroles, Simon C; Boase, Murray R; Hunter, Don A; Schwinn, Kathy E

2013-01-01

RNA interference (RNAi) is one of the most commonly used techniques for examining the function of genes of interest. In this chapter we present two examples of RNAi that use the particle inflow gun for delivery of the DNA constructs. In one example transient RNAi is used to show the function of an anthocyanin regulatory gene in flower petals. In the second example stably transformed cell cultures are produced with an RNAi construct that results in a change in the anthocyanin hydroxylation pattern.

RNAi Technique in Stem Cell Research: Current Status and Future Perspectives.

PubMed

Zou, Gang-Ming

2017-01-01

RNAi is a mechanism displayed by most eukaryotic cells to rid themselves of foreign double-strand RNA molecules. In the 18 years since the initial report, RNAi has now been demonstrated to function in mammalian cells to alter gene expression and has been used as a means for genetic discovery as well as a possible strategy for genetic correction and genetic therapy in cancer and other disease. The aim of this review is to provide a general overview of how RNAi suppresses gene expression and to examine some published RNAi approaches that have resulted in changes in stem cell function and suggest the possible clinical relevance of this work in cancer therapy through targeting cancer stem cells.

The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans

PubMed Central

Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hau; Florens, Laurence; Mak, Ho Yi

2012-01-01

The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans. PMID:22508728

The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans.

PubMed

Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi

2012-04-15

The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.

RNAi and retroviruses: are they in RISC?

PubMed

Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri

2013-02-01

RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.

Intelligent Interfaces for Mining Large-Scale RNAi-HCS Image Databases

PubMed Central

Lin, Chen; Mak, Wayne; Hong, Pengyu; Sepp, Katharine; Perrimon, Norbert

2010-01-01

Recently, High-content screening (HCS) has been combined with RNA interference (RNAi) to become an essential image-based high-throughput method for studying genes and biological networks through RNAi-induced cellular phenotype analyses. However, a genome-wide RNAi-HCS screen typically generates tens of thousands of images, most of which remain uncategorized due to the inadequacies of existing HCS image analysis tools. Until now, it still requires highly trained scientists to browse a prohibitively large RNAi-HCS image database and produce only a handful of qualitative results regarding cellular morphological phenotypes. For this reason we have developed intelligent interfaces to facilitate the application of the HCS technology in biomedical research. Our new interfaces empower biologists with computational power not only to effectively and efficiently explore large-scale RNAi-HCS image databases, but also to apply their knowledge and experience to interactive mining of cellular phenotypes using Content-Based Image Retrieval (CBIR) with Relevance Feedback (RF) techniques. PMID:21278820

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

First comparative transcriptomic analysis of wild adult male and female Lutzomyia longipalpis, vector of visceral leishmaniasis.

PubMed

McCarthy, Christina B; Santini, María Soledad; Pimenta, Paulo F P; Diambra, Luis A

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi).

First Comparative Transcriptomic Analysis of Wild Adult Male and Female Lutzomyia longipalpis, Vector of Visceral Leishmaniasis

PubMed Central

McCarthy, Christina B.; Santini, María Soledad; Pimenta, Paulo F. P.; Diambra, Luis A.

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi). PMID:23554910

Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target.

PubMed

Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor

2015-09-03

Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.

Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

PubMed

Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

2015-09-01

Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

RNAi control of aflatoxins in peanut plants, a multifactorial system

USDA-ARS?s Scientific Manuscript database

RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...

Transgene manipulation in zebrafish by using recombinases.

PubMed

Dong, Jie; Stuart, Gary W

2004-01-01

Although much remains to be done, our results to date suggest that efficient and precise genome engineering in zebrafish will be possible in the future by using Cre recombinase and SB transposase in combination with their respective target sites. In this study, we provide the first evidence that Cre recombinase can mediate effective site-specific deletion of transgenes in zebrafish. We found that the efficiency of target site utilization could approach 100%, independent of whether the target site was provided transiently by injection or stably within an integrated transgene. Microinjection of Cre mRNA appeared to be slightly more effective for this purpose than microinjection of Cre-expressing plasmid DNA. Our work has not yet progressed to the point where SB-mediated mobilization of our transgene constructs would be observed. However, a recent report has demonstrated that SB can enhance transgenesis rates sixfold over conventional methods by efficiently mediating multiple single-copy insertion of transgenes into the zebrafish genome (Davidson et al., 2003). Therefore, it seems likely that a combined system should eventually allow both SB-mediated transgene mobilization and Cre-mediated transgene modification. Our goal is to validate methods for the precise reengineering of the zebrafish genome by using a combination of Cre-loxP and SB transposon systems. These methods can be used to delete, replace, or mobilize large pieces of DNA or to modify the genome only when and where required by the investigator. For example, it should be possible to deliver particular RNAi genes to well-expressed chromosomal loci and then exchange them easily with alternative RNAi genes for the specific suppression of alternative targets. As a nonviral vector for gene therapy, the transposon component allows for the possibility of highly efficient integration, whereas the Cre-loxP component can target the integration and/or exchange of foreign DNA into specific sites within the genome. The specificity and efficiency of this system also make it ideal for applications in which precise genome modifications are required (e.g., stock improvement). Future work should establish whether alternative recombination systems (e.g., phiC31 integrase) can improve the utility of this system. After the fish system is fully established, it would be interesting to explore its application to genome engineering in other organisms.

RNAi mediated, stable resistance to Triticum mosaic virus in wheat

USDA-ARS?s Scientific Manuscript database

Triticum mosaic virus (TriMV), discovered in 2006, affects wheat production systems in the Great Plains of the United States. There are no available TriMV resistant commercial varieties. RNA interference (RNAi) was evaluated as an alternative strategy to generate resistance to TriMV. An RNAi pANDA...

Common ground: small RNA programming and chromatin modifications.

PubMed

Lejeune, Erwan; Allshire, Robin C

2011-06-01

Epigenetic mechanisms regulate genome structure and expression profiles in eukaryotes. RNA interference (RNAi) and other small RNA-based chromatin-modifying activities can act to reset the epigenetic landscape at defined chromatin domains. Centromeric heterochromatin assembly is a RNAi-dependent process in the fission yeast Schizosaccharomyces pombe, and provides a paradigm for detailed examination of such epigenetic processes. Here we review recent progress in understanding the mechanisms that underpin RNAi-mediated heterochromatin formation in S. pombe. We discuss recent analyses of the events that trigger RNAi and manipulations which uncouple RNAi and chromatin modification. Finally we provide an overview of similar molecular machineries across species where related small RNA pathways appear to drive the epigenetic reprogramming in germ cells and/or during early development in metazoans. Copyright © 2011 Elsevier Ltd. All rights reserved.

RNAi for functional genomics in plants.

PubMed

McGinnis, Karen M

2010-03-01

RNAi refers to several different types of gene silencing mediated by small, dsRNA molecules. Over the course of 20 years, the scientific understanding of RNAi has developed from the initial observation of unexpected expression patterns to a sophisticated understanding of a multi-faceted, evolutionarily conserved network of mechanisms that regulate gene expression in many organisms. It has also been developed as a genetic tool that can be exploited in a wide range of species. Because transgene-induced RNAi has been effective at silencing one or more genes in a wide range of plants, this technology also bears potential as a powerful functional genomics tool across the plant kingdom. Transgene-induced RNAi has indeed been shown to be an effective mechanism for silencing many genes in many organisms, but the results from multiple projects which attempted to exploit RNAi on a genome-wide scale suggest that there is a great deal of variation in the silencing efficacy between transgenic events, silencing targets and silencing-induced phenotype. The results from these projects indicate several important variables that should be considered in experimental design prior to the initiation of functional genomics efforts based on RNAi silencing. In recent years, alternative strategies have been developed for targeted gene silencing, and a combination of approaches may also enhance the use of targeted gene silencing for functional genomics.

Multimodality Imaging of RNA Interference

PubMed Central

Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

2013-01-01

The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

PubMed Central

Tomoyasu, Yoshinori

2014-01-01

The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

PubMed

Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

2017-02-01

RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules.

PubMed

Garcia-Martin, Juan Antonio; Dotu, Ivan; Clote, Peter

2015-07-01

Several algorithms for RNA inverse folding have been used to design synthetic riboswitches, ribozymes and thermoswitches, whose activity has been experimentally validated. The RNAiFold software is unique among approaches for inverse folding in that (exhaustive) constraint programming is used instead of heuristic methods. For that reason, RNAiFold can generate all sequences that fold into the target structure or determine that there is no solution. RNAiFold 2.0 is a complete overhaul of RNAiFold 1.0, rewritten from the now defunct COMET language to C++. The new code properly extends the capabilities of its predecessor by providing a user-friendly pipeline to design synthetic constructs having the functionality of given Rfam families. In addition, the new software supports amino acid constraints, even for proteins translated in different reading frames from overlapping coding sequences; moreover, structure compatibility/incompatibility constraints have been expanded. With these features, RNAiFold 2.0 allows the user to design single RNA molecules as well as hybridization complexes of two RNA molecules. the web server, source code and linux binaries are publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold2.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Combined lentiviral and RNAi technologies for the delivery and permanent silencing of the hsp25 gene.

PubMed

Kaur, Punit; Nagaraja, Ganachari M; Asea, Alexzander

2011-01-01

Elevated heat shock protein 27 (Hsp27) expression has been found in a number of tumors, including breast, prostate, gastric, uterine, ovarian, head and neck, and tumor arising from the nervous system and urinary system, and determined to be a predictor of poor clinical outcome. Although the mechanism of action of Hsp27 has been well documented, there are currently no available inhibitors of Hsp27 in clinical trials. RNA interference (RNAi) has the potential to offer more specificity and flexibility than traditional drugs to silence gene expression. Not surprisingly, RNAi has become a major focus for biotechnology and pharmaceutical companies, which are now in the early stages of developing RNAi therapeutics, mostly based on short interfering RNA (siRNAs), to target viral infection, cancer, hypercholesterolemia, cardiovascular disease, macular degeneration, and neurodegenerative diseases. However, the critical issues associated with RNAi as a therapeutic are delivery, specificity, and stability of the RNAi reagents. To date, the delivery is currently considered the biggest hurdle, as the introduction of siRNAs systemically into body fluids can result in their degradation, off-target effects, and immune detection. In this chapter, we discuss a method of combined lentiviral and RNAi-based technology for the delivery and permanent silencing of the hsp25 gene.

Biodegradable lipids enabling rapidly eliminated lipid nanoparticles for systemic delivery of RNAi therapeutics.

PubMed

Maier, Martin A; Jayaraman, Muthusamy; Matsuda, Shigeo; Liu, Ju; Barros, Scott; Querbes, William; Tam, Ying K; Ansell, Steven M; Kumar, Varun; Qin, June; Zhang, Xuemei; Wang, Qianfan; Panesar, Sue; Hutabarat, Renta; Carioto, Mary; Hettinger, Julia; Kandasamy, Pachamuthu; Butler, David; Rajeev, Kallanthottathil G; Pang, Bo; Charisse, Klaus; Fitzgerald, Kevin; Mui, Barbara L; Du, Xinyao; Cullis, Pieter; Madden, Thomas D; Hope, Michael J; Manoharan, Muthiah; Akinc, Akin

2013-08-01

In recent years, RNA interference (RNAi) therapeutics, most notably with lipid nanoparticle-based delivery systems, have advanced into human clinical trials. The results from these early clinical trials suggest that lipid nanoparticles (LNPs), and the novel ionizable lipids that comprise them, will be important materials in this emerging field of medicine. A persistent theme in the use of materials for biomedical applications has been the incorporation of biodegradability as a means to improve biocompatibility and/or to facilitate elimination. Therefore, the aim of this work was to further advance the LNP platform through the development of novel, next-generation lipids that combine the excellent potency of the most advanced lipids currently available with biodegradable functionality. As a representative example of this novel class of biodegradable lipids, the lipid evaluated in this work displays rapid elimination from plasma and tissues, substantially improved tolerability in preclinical studies, while maintaining in vivo potency on par with that of the most advanced lipids currently available.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).

PubMed

Asad, M

2006-01-01

The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.

Transgenic Suppression of AGAMOUS Genes in Apple Reduces Fertility and Increases Floral Attractiveness

PubMed Central

Klocko, Amy L.; Borejsza-Wysocka, Ewa; Brunner, Amy M.; Shevchenko, Olga; Aldwinckle, Herb; Strauss, Steven H.

2016-01-01

We investigated the ability of RNA interference (RNAi) directed against two co-orthologs of AGAMOUS (AG) from Malus domestica (domestic apple, MdAG) to reduce the risks of invasiveness and provide genetic containment of transgenes, while also promoting the attractiveness of flowers for ornamental usage. Suppression of two MdAG-like genes, MdMADS15 and MdMADS22, led to the production of trees with highly showy, polypetalous flowers. These “double-flowers” had strongly reduced expression of both MdAG-like genes. Members of the two other clades within in the MdAG subfamily showed mild to moderate differences in gene expression, or were unchanged, with the level of suppression approximately proportional to the level of sequence identity between the gene analyzed and the RNAi fragment. The double-flowers also exhibited reduced male and female fertility, had few viable pollen grains, a decreased number of stigmas, and produced few viable seeds after cross-pollination. Despite these floral alterations, RNAi-AG trees with double-flowers set full-sized fruit. Suppression or mutation of apple AG-like genes appears to be a promising method for combining genetic containment with improved floral attractiveness. PMID:27500731

Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae).

PubMed

Hunter, Wayne; Ellis, James; Vanengelsdorp, Dennis; Hayes, Jerry; Westervelt, Dave; Glick, Eitan; Williams, Michael; Sela, Ilan; Maori, Eyal; Pettis, Jeffery; Cox-Foster, Diana; Paldi, Nitzan

2010-12-23

The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsible for up to 30% of the world's food production through pollination of crops. Since fall 2006, honey bees in the U.S. have faced a serious population decline, due in part to a phenomenon called Colony Collapse Disorder (CCD), which is a disease syndrome that is likely caused by several factors. Data from an initial study in which investigators compared pathogens in honey bees affected by CCD suggested a putative role for Israeli Acute Paralysis Virus, IAPV. This is a single stranded RNA virus with no DNA stage placed taxonomically within the family Dicistroviridae. Although subsequent studies have failed to find IAPV in all CCD diagnosed colonies, IAPV has been shown to cause honey bee mortality. RNA interference technology (RNAi) has been used successfully to silence endogenous insect (including honey bee) genes both by injection and feeding. Moreover, RNAi was shown to prevent bees from succumbing to infection from IAPV under laboratory conditions. In the current study IAPV specific homologous dsRNA was used in the field, under natural beekeeping conditions in order to prevent mortality and improve the overall health of bees infected with IAPV. This controlled study included a total of 160 honey bee hives in two discrete climates, seasons and geographical locations (Florida and Pennsylvania). To our knowledge, this is the first successful large-scale real world use of RNAi for disease control.

RNA interference in a cestode reveals specific silencing of selected highly expressed gene transcripts.

PubMed

Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G

2010-04-01

Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for the first time, a functional RNAi pathway in a cestode and show that the robust knock-down of abundant gene transcripts is achievable using long dsRNAs following short exposure times. 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

PubMed

Wang, Leo L; Burdick, Jason A

2017-01-01

It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Human Virus-Derived Small RNAs Can Confer Antiviral Immunity in Mammals.

PubMed

Qiu, Yang; Xu, Yanpeng; Zhang, Yao; Zhou, Hui; Deng, Yong-Qiang; Li, Xiao-Feng; Miao, Meng; Zhang, Qiang; Zhong, Bo; Hu, Yuanyang; Zhang, Fu-Chun; Wu, Ligang; Qin, Cheng-Feng; Zhou, Xi

2017-06-20

RNA interference (RNAi) functions as a potent antiviral immunity in plants and invertebrates; however, whether RNAi plays antiviral roles in mammals remains unclear. Here, using human enterovirus 71 (HEV71) as a model, we showed HEV71 3A protein as an authentic viral suppressor of RNAi during viral infection. When the 3A-mediated RNAi suppression was impaired, the mutant HEV71 readily triggered the production of abundant HEV71-derived small RNAs with canonical siRNA properties in cells and mice. These virus-derived siRNAs were produced from viral dsRNA replicative intermediates in a Dicer-dependent manner and loaded into AGO, and they were fully active in degrading cognate viral RNAs. Recombinant HEV71 deficient in 3A-mediated RNAi suppression was significantly restricted in human somatic cells and mice, whereas Dicer deficiency rescued HEV71 infection independently of type I interferon response. Thus, RNAi can function as an antiviral immunity, which is induced and suppressed by a human virus, in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.

Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity

PubMed Central

Bayne, Elizabeth H.; White, Sharon A.; Kagansky, Alexander; Bijos, Dominika A.; Sanchez-Pulido, Luis; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Ponting, Chris P.; Rappsilber, Juri; Allshire, Robin C.

2010-01-01

Summary In fission yeast, RNAi directs heterochromatin formation at centromeres, telomeres, and the mating type locus. Noncoding RNAs transcribed from repeat elements generate siRNAs that are incorporated into the Argonaute-containing RITS complex and direct it to nascent homologous transcripts. This leads to recruitment of the CLRC complex, including the histone methyltransferase Clr4, promoting H3K9 methylation and heterochromatin formation. A key question is what mediates the recruitment of Clr4/CLRC to transcript-bound RITS. We have identified a LIM domain protein, Stc1, that is required for centromeric heterochromatin integrity. Our analyses show that Stc1 is specifically required to establish H3K9 methylation via RNAi, and interacts both with the RNAi effector Ago1, and with the chromatin-modifying CLRC complex. Moreover, tethering Stc1 to a euchromatic locus is sufficient to induce silencing and heterochromatin formation independently of RNAi. We conclude that Stc1 associates with RITS on centromeric transcripts and recruits CLRC, thereby coupling RNAi to chromatin modification. PMID:20211136

RNA interference-based therapeutics for inherited long QT syndrome.

PubMed

Li, Guoliang; Ma, Shuting; Sun, Chaofeng

2015-08-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

RNA interference-based therapeutics for inherited long QT syndrome

PubMed Central

LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

2015-01-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

PubMed

Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

2009-08-07

The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

The insect ecdysone receptor is a good potential target for RNAi-based pest control.

PubMed

Yu, Rong; Xu, Xinping; Liang, Yongkang; Tian, Honggang; Pan, Zhanqing; Jin, Shouheng; Wang, Na; Zhang, Wenqing

2014-01-01

RNA interference (RNAi) has great potential for use in insect pest control. However, some significant challenges must be overcome before RNAi-based pest control can become a reality. One challenge is the proper selection of a good target gene for RNAi. Here, we report that the insect ecdysone receptor (EcR) is a good potential target for RNAi-based pest control in the brown planthopper Nilaparvata lugens, a serious insect pest of rice plants. We demonstrated that the use of a 360 bp fragment (NlEcR-c) that is common between NlEcR-A and NlEcR-B for feeding RNAi experiments significantly decreased the relative mRNA expression levels of NlEcR compared with those in the dsGFP control. Feeding RNAi also resulted in a significant reduction in the number of offspring per pair of N. lugens. Consequently, a transgenic rice line expressing NlEcR dsRNA was constructed by Agrobacterium- mediated transformation. The results of qRT-PCR showed that the total copy number of the target gene in all transgenic rice lines was 2. Northern blot analysis showed that the small RNA of the hairpin dsNlEcR-c was successfully expressed in the transgenic rice lines. After newly hatched nymphs of N. lugens fed on the transgenic rice lines, effective RNAi was observed. The NlEcR expression levels in all lines examined were decreased significantly compared with the control. In all lines, the survival rate of the nymphs was nearly 90%, and the average number of offspring per pair in the treated groups was significantly less than that observed in the control, with a decrease of 44.18-66.27%. These findings support an RNAi-based pest control strategy and are also important for the management of rice insect pests.

Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

PubMed Central

van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

2014-01-01

The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates

PubMed Central

Palmer, William H.; Hadfield, Jarrod D.; Obbard, Darren J.

2018-01-01

Conflict between organisms can lead to a reciprocal adaptation that manifests as an increased evolutionary rate in genes mediating the conflict. This adaptive signature has been observed in RNA-interference (RNAi) pathway genes involved in the suppression of viruses and transposable elements in Drosophila melanogaster, suggesting that a subset of Drosophila RNAi genes may be locked in an arms race with these parasites. However, it is not known whether rapid evolution of RNAi genes is a general phenomenon across invertebrates, or which RNAi genes generally evolve adaptively. Here we use population genomic data from eight invertebrate species to infer rates of adaptive sequence evolution, and to test for past and ongoing selective sweeps in RNAi genes. We assess rates of adaptive protein evolution across species using a formal meta-analytic framework to combine data across species and by implementing a multispecies generalized linear mixed model of mutation counts. Across species, we find that RNAi genes display a greater rate of adaptive protein substitution than other genes, and that this is primarily mediated by positive selection acting on the genes most likely to defend against viruses and transposable elements. In contrast, evidence for recent selective sweeps is broadly spread across functional classes of RNAi genes and differs substantially among species. Finally, we identify genes that exhibit elevated adaptive evolution across the analyzed insect species, perhaps due to concurrent parasite-mediated arms races. PMID:29437826

Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

PubMed

Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

2018-02-01

RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

A status report on RNAi therapeutics

PubMed Central

2010-01-01

Fire and Mello initiated the current explosion of interest in RNA interference (RNAi) biology with their seminal work in Caenorhabditis elegans. These observations were closely followed by the demonstration of RNAi in Drosophila melanogaster. However, the full potential of these new discoveries only became clear when Tuschl and colleagues showed that 21-22 bp RNA duplexes with 3" overhangs, termed small interfering (si)RNAs, could reliably execute RNAi in a range of mammalian cells. Soon afterwards, it became clear that many different human cell types had endogenous machinery, the RNA-induced silencing complex (RISC), which could be harnessed to silence any gene in the genome. Beyond the availability of a novel way to dissect biology, an important target validation tool was now available. More importantly, two key properties of the RNAi pathway - sequence-mediated specificity and potency - suggested that RNAi might be the most important pharmacological advance since the advent of protein therapeutics. The implications were profound. One could now envisage selecting disease-associated targets at will and expect to suppress proteins that had remained intractable to inhibition by conventional methods, such as small molecules. This review attempts to summarize the current understanding on siRNA lead discovery, the delivery of RNAi therapeutics, typical in vivo pharmacological profiles, preclinical safety evaluation and an overview of the 14 programs that have already entered clinical practice. PMID:20615220

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Using RNAi in C. "elegans" to Demonstrate Gene Knockdown Phenotypes in the Undergraduate Biology Lab Setting

ERIC Educational Resources Information Center

Roy, Nicole M.

2013-01-01

RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…

"Caenorhabditis Elegans" as an Undergraduate Educational Tool for Teaching RNAi

ERIC Educational Resources Information Center

Andersen, Janet; Krichevsky, Alexander; Leheste, Joerg R.; Moloney, Daniel J.

2008-01-01

Discovery of RNA-mediated interference (RNAi) is widely recognized as one of the most significant molecular biology breakthroughs in the past 10 years. There is a need for science educators to develop teaching tools and laboratory activities that demonstrate the power of this new technology and help students to better understand the RNAi process.…

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

Autonomously folded α-helical lockers promote RNAi*

NASA Astrophysics Data System (ADS)

Guyader, Christian P. E.; Lamarre, Baptiste; de Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

2016-10-01

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

Autonomously folded α-helical lockers promote RNAi*

PubMed Central

Guyader, Christian P. E.; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

2016-01-01

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi. PMID:27721465

Autonomously folded α-helical lockers promote RNAi.

PubMed

Guyader, Christian P E; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E; Slater, Nigel K; Ryadnov, Maxim G

2016-10-10

RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

Reciprocal inhibition between intracellular antiviral signaling and the RNAi machinery in mammalian cells

PubMed Central

Seo, Gil Ju; Kincaid, Rodney P.; Phanaksri, Teva; Burke, James M.; Pare, Justin M.; Cox, Jennifer E.; Hsiang, Tien-Ying; Krug, Robert M.; Sullivan, Christopher S.

2013-01-01

SUMMARY RNA interference (RNAi) is an established antiviral defense mechanism in plants and invertebrates. Whether RNAi serves a similar function in mammalian cells remains unresolved. We find that in some cell types, mammalian RNAi activity is reduced shortly after viral infection via poly ADP-ribosylation of the RNA induced silencing complex (RISC), a core component of RNAi. Well-established antiviral signaling pathways, including RIG-I/MAVS and RNAseL, contribute to inhibition of RISC. In the absence of virus infection, microRNAs repress interferon-stimulated genes (ISGs) associated with cell death and proliferation, thus maintaining homeostasis. Upon detection of intracellular pathogen-associated molecular patterns, RISC activity decreases, contributing to increased expression of ISGs. Our results suggest that unlike in lower eukaryotes, mammalian RISC is not antiviral in some contexts, but rather, RISC has been co-opted to negatively regulate toxic host antiviral effectors via microRNAs. PMID:24075860

Soaking RNAi in Bombyx mori BmN4-SID1 Cells Arrests Cell Cycle Progression

PubMed Central

Mon, Hiroaki; Li, Zhiqing; Kobayashi, Isao; Tomita, Shuichiro; Lee, JaeMan; Sezutsu, Hideki; Tamura, Toshiki; Kusakabe, Takahiro

2013-01-01

RNA interference (RNAi) is an evolutionarily conserved mechanism for sequence-specific gene silencing. Previously, the BmN4-SID1 cell expressing Caenorhabditis ele gans SID-1 was established, in which soaking RNAi could induce effective gene silencing. To establish its utility, 6 cell cycle progression related cDNAs, CDK1, MYC, MYB, RNRS, CDT1, and GEMININ, were isolated from the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), and their expressions were further silenced by soaking RNAi in the BmN4-SID1 cells. The cell cycle progression analysis using flow cytometer demonstrated that the small amount of double stranded RNA was enough to arrest cell cycle progression at the specific cell phases. These data suggest that RNAi in the BmN4-SID1 cells can be used as a powerful tool for loss-of-function analysis of B. mori genes. PMID:24773378

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

PubMed Central

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Silencing heat shock protein 27 (HSP27) inhibits the proliferation and migration of vascular smooth muscle cells in vitro.

PubMed

Huang, Jie; Xie, Liang-di; Luo, Li; Zheng, Su-Li; Wang, Hua-Jun; Xu, Chang-Sheng

2014-05-01

The objective of this study was to examine the role of heat shock protein 27 (HSP27) in proliferation and migration of vascular smooth muscle cells (VSMCs). Three complementary DNA sequences targeting rat HSP27 gene were designed, synthesized, and subcloned into lentiviral vector. The interfering efficiency was detected by reverse transcriptase-polymerase chain reaction and Western blot. Methyl thiazolyl tetrazolium bromide assay was used for examining cell proliferation. F-actin polymerization was detected by FITC-Phalloidin staining using confocal microscopy. Modified Boyden chamber technique was used to assess VSMCs migration. The recombinant lentivirus containing RNAi targeting HSP27 gene significantly inhibited expression of HSP27 at both mRNA and protein levels. The interfering efficiencies of pNL-HSP27-EGFP-1, pNL-HSP27-EGFP-2, and pNL-HSP27-EGFP-3 were 71 %, 77 %, and 43 %, respectively. Reorganization of actin stimulated by PDGF-BB was markedly blocked by pretreatment with pNL-HSP27-EGFP-2. Proliferation and migration rates of VSMCs induced by PDGF-BB were inhibited by 30.8 % and 45.6 %, respectively, by pNL-HSP27-EGFP-2 (all P < 0.01). To conclude, these data indicate that HSP27 may regulate the proliferation, actin reorganization, and the migration of VSMCs. RNAi targeting at HSP27 may be a potential approach for inhibition of cell migration involved in pathogenesis of proliferative vascular diseases.

Monocyte-directed RNAi targeting CCR2 improves infarct healing in atherosclerosis-prone mice

PubMed Central

Majmudar, Maulik D.; Keliher, Edmund J.; Heidt, Timo; Leuschner, Florian; Truelove, Jessica; Sena, Brena F.; Gorbatov, Rostic; Iwamoto, Yoshiko; Dutta, Partha; Wojtkiewicz, Gregory; Courties, Gabriel; Sebas, Matt; Borodovsky, Anna; Fitzgerald, Kevin; Nolte, Marc W.; Dickneite, Gerhard; Chen, John W.; Anderson, Daniel G.; Swirski, Filip K.; Weissleder, Ralph; Nahrendorf, Matthias

2013-01-01

Background Exaggerated and prolonged inflammation after myocardial infarction (MI) accelerates left ventricular remodeling. Inflammatory pathways may present a therapeutic target to prevent post-MI heart failure. However, the appropriate magnitude and timing of interventions are largely unknown, in part because noninvasive monitoring tools are lacking. We here employed nanoparticle-facilitated silencing of CCR2, the chemokine receptor that governs inflammatory Ly-6Chigh monocyte subset traffic, to reduce infarct inflammation in apoE−/− mice after MI. We used dual target PET/MRI of transglutaminase factor XIII (FXIII) and myeloperoxidase (MPO) activity to monitor how monocyte subset-targeted RNAi altered infarct inflammation and healing. Methods and Results Flow cytometry, gene expression analysis and histology revealed reduced monocyte numbers and enhanced resolution of inflammation in infarcted hearts of apoE−/− mice that were treated with nanoparticle-encapsulated siRNA. To follow extracellular matrix crosslinking non-invasively, we developed a fluorine-18 labeled PET agent (18F-FXIII). Recruitment of MPO-rich inflammatory leukocytes was imaged using a molecular MRI sensor of MPO activity (MPO-Gd). PET/MRI detected anti-inflammatory effects of intravenous nanoparticle-facilitated siRNA therapy (75% decrease of MPO-Gd signal, p<0.05) while 18F-FXIII PET reflected unimpeded matrix crosslinking in the infarct. Silencing of CCR2 during the first week after MI improved ejection fraction on day 21 after MI from 29 to 35% (p<0.05). Conclusion CCR2 targeted RNAi reduced recruitment of Ly-6Chigh monocytes, attenuated infarct inflammation and curbed post-MI left ventricular remodeling. PMID:23616627

Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences

PubMed Central

Robert, Valérie J.P.; Sijen, Titia; van Wolfswinkel, Josien; Plasterk, Ronald H.A.

2005-01-01

Protection of genomes against invasion by repetitive sequences, such as transposons, viruses, and repetitive transgenes, involves strong and selective silencing of these sequences. During silencing of repetitive transgenes, a trans effect (“cosuppression”) occurs that results in silencing of cognate endogenous genes. Here we report RNA interference (RNAi) screens performed to catalog genes required for cosuppression in the Caenorhabditis elegans germline. We find factors with a putative role in chromatin remodeling and factors involved in RNAi. Together with molecular data also presented in this study, these results suggest that in C. elegans repetitive sequences trigger transcriptional gene silencing using RNAi and chromatin factors. PMID:15774721

Structurally flexible triethanolamine-core poly(amidoamine) dendrimers as effective nanovectors to deliver RNAi-based therapeutics.

PubMed

Liu, Xiaoxuan; Liu, Cheng; Catapano, Carlo V; Peng, Ling; Zhou, Jiehua; Rocchi, Palma

2014-01-01

RNAi-based nucleic acid molecules have attracted considerable attention as compelling therapeutics providing safe and competent delivery systems are available. Dendrimers are emerging as appealing nanocarriers for nucleic acid delivery thanks to their unique well-defined architecture and the resulting cooperativity and multivalency confined within a nanostructure. The present review offers a brief overview of the structurally flexible triethanolamine-core poly(amidoamine) (PAMAM) dendrimers developed in our group as nanovectors for the delivery of RNAi therapeutics. Their excellent activity for delivering different RNAi therapeutics in various disease models in vitro and in vivo will be highlighted here. © 2013.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

PubMed

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System

PubMed Central

Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096

Clathrin Heavy Chain Is Important for Viability, Oviposition, Embryogenesis and, Possibly, Systemic RNAi Response in the Predatory Mite Metaseiulus occidentalis

PubMed Central

Wu, Ke; Hoy, Marjorie A.

2014-01-01

Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis. PMID:25329675

Electric cell-substrate impedance sensing (ECIS) based real-time measurement of titer dependent cytotoxicity induced by adenoviral vectors in an IPI-2I cell culture model.

PubMed

Müller, Jakob; Thirion, Christian; Pfaffl, Michael W

2011-01-15

Recombinant viral vectors are widespread tools for transfer of genetic material in various modern biotechnological applications like for example RNA interference (RNAi). However, an accurate and reproducible titer assignment represents the basic step for most downstream applications regarding a precise multiplicity of infection (MOI) adjustment. As necessary scaffold for the studies described in this work we introduce a quantitative real-time PCR (qPCR) based approach for viral particle measurement. Still an implicated problem concerning physiological effects is that the appliance of viral vectors is often attended by toxic effects on the individual target. To determine the critical viral dose leading to cell death we developed an electric cell-substrate impedance sensing (ECIS) based assay. With ECIS technology the impedance change of a current flow through the cell culture medium in an array plate is measured in a non-invasive manner, visualizing effects like cell attachment, cell-cell contacts or proliferation. Here we describe the potential of this online measurement technique in an in vitro model using the porcine ileal epithelial cell line IPI-2I in combination with an adenoviral transfection vector (Ad5-derivate). This approach shows a clear dose-depending toxic effect, as the amount of applied virus highly correlates (p<0.001) with the level of cell death. Thus this assay offers the possibility to discriminate the minimal non-toxic dose of the individual transfection method. In addition this work suggests that the ECIS-device bears the feasibility to transfer this assay to multiple other cytotoxicological questions. Copyright © 2010 Elsevier B.V. All rights reserved.

A galactose-functionalized dendritic siRNA-nanovector to potentiate hepatitis C inhibition in liver cells

NASA Astrophysics Data System (ADS)

Lakshminarayanan, Abirami; Reddy, B. Uma; Raghav, Nallani; Ravi, Vijay Kumar; Kumar, Anuj; Maiti, Prabal K.; Sood, A. K.; Jayaraman, N.; Das, Saumitra

2015-10-01

A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector.A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector. Electronic supplementary information (ESI) available: Spectral data and experimental details. See DOI: 10.1039/c5nr02898a

Co-administration of liposomal l-OHP and PEGylated TS shRNA-lipoplex: A novel approach to enhance anti-tumor efficacy and reduce the immunogenic response to RNAi molecules.

PubMed

Alaaeldin, Eman; Abu Lila, Amr S; Ando, Hidenori; Fukushima, Masakazu; Huang, Cheng-Long; Wada, Hiromi; Sarhan, Hatem A; Khaled, Khaled A; Ishida, Tatsuhiro

2017-06-10

Many therapeutic strategies have been applied in efforts to conquer the development and/or progression of cancer. The combination of chemotherapy and an RNAi-based approach has proven to be an efficient anticancer therapy. However, the feasibility of such a therapeutic strategy has been substantially restricted either by the failure to achieve the efficient delivery of RNAi molecules to tumor tissue or by the immunostimulatory response triggered by RNAi molecules. In this study, therefore, we intended to investigate the efficacy of using liposomal oxaliplatin (liposomal l-OHP) to guarantee the efficient delivery of RNAi molecules, namely shRNA against thymidylate synthase (TS shRNA) complexed with cationic liposome (TS shRNA-lipoplex), to solid tumors, and to suppress the immunostimulatory effect of RNAi molecules, TS shRNA, following intravenous administration. Herein, we describe how liposomal l-OHP enhanced the intra-tumor accumulation of TS shRNA-lipoplex and significantly reduced the immunostimulatory response triggered by TS shRNA. Consequently, such enhanced accumulation of TS shRNA-lipoplex along with the cytotoxic effect of liposomal l-OHP led to a remarkable tumor growth suppression (compared to mono-therapy) following systemic administration. Our results, therefore, may have important implications for the provision of a safer and more applicable combination therapy of RNAi molecules and anti-cancer agents that can produce a more reliable anti-tumor effect. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogenetic Origin and Diversification of RNAi Pathway Genes in Insects.

PubMed

Dowling, Daniel; Pauli, Thomas; Donath, Alexander; Meusemann, Karen; Podsiadlowski, Lars; Petersen, Malte; Peters, Ralph S; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Niehuis, Oliver

2016-12-01

RNA interference (RNAi) refers to the set of molecular processes found in eukaryotic organisms in which small RNA molecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect Transcriptome Evolution) project as well as other resources such as i5K (5000 Insect Genome Project). Specifically, we traced the origin of the double stranded RNA binding protein R2D2 to the last common ancestor of winged insects (Pterygota), the loss of Sid-1/Tag-130 orthologs in Antliophora (fleas, flies and relatives, and scorpionflies in a broad sense), and confirm previous evidence for the splitting of the Argonaute proteins Aubergine and Piwi in Brachyceran flies (Diptera, Brachycera). Our study offers new reference points for future experimental research on RNAi-related pathway genes in insects. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

RNA Interference in Moths: Mechanisms, Applications, and Progress

PubMed Central

Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

2016-01-01

The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Antibody targeting facilitates effective intratumoral siRNA nanoparticle delivery to HER2-overexpressing cancer cells

PubMed Central

Palanca-Wessels, Maria C.; Booth, Garrett C.; Convertine, Anthony J.; Lundy, Brittany B.; Berguig, Geoffrey Y.; Press, Michael F.; Stayton, Patrick S.; Press, Oliver W.

2016-01-01

The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5′ RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5′ RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy. PMID:26840082

Antibody targeting facilitates effective intratumoral siRNA nanoparticle delivery to HER2-overexpressing cancer cells.

PubMed

Palanca-Wessels, Maria C; Booth, Garrett C; Convertine, Anthony J; Lundy, Brittany B; Berguig, Geoffrey Y; Press, Michael F; Stayton, Patrick S; Press, Oliver W

2016-02-23

The therapeutic potential of RNA interference (RNAi) has been limited by inefficient delivery of short interfering RNA (siRNA). Tumor-specific recognition can be effectively achieved by antibodies directed against highly expressed cancer cell surface receptors. We investigated the utility of linking an internalizing streptavidin-conjugated HER2 antibody to an endosome-disruptive biotinylated polymeric nanocarrier to improve the functional cytoplasmic delivery of siRNA in breast and ovarian cancer cells in vitro and in an intraperitoneal ovarian cancer xenograft model in vivo, yielding an 80% reduction of target mRNA and protein levels with sustained repression for at least 96 hours. RNAi-mediated site specific cleavage of target mRNA was demonstrated using the 5' RLM-RACE (RNA ligase mediated-rapid amplification of cDNA ends) assay. Mice bearing intraperitoneal human ovarian tumor xenografts demonstrated increased tumor accumulation of Cy5.5 fluorescently labeled siRNA and 70% target gene suppression after treatment with HER2 antibody-directed siRNA nanocarriers. Detection of the expected mRNA cleavage product by 5' RLM-RACE assay confirmed that suppression occurs via the expected RNAi pathway. Delivery of siRNA via antibody-directed endosomolytic nanoparticles may be a promising strategy for cancer therapy.

Characterization of small RNA populations in non-transgenic and aflatoxin-reducing-transformed peanut.

PubMed

Power, Imana L; Dang, Phat M; Sobolev, Victor S; Orner, Valerie A; Powell, Joseph L; Lamb, Marshall C; Arias, Renee S

2017-04-01

Aflatoxin contamination is a major constraint in food production worldwide. In peanut (Arachis hypogaea L.), these toxic and carcinogenic aflatoxins are mainly produced by Aspergillus flavus Link and A. parasiticus Speare. The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in peanut seed. In this study, we performed high-throughput sequencing of small RNA populations in a control line and in two transformed peanut lines that expressed an inverted repeat targeting five genes involved in the aflatoxin-biosynthesis pathway and that showed up to 100% less aflatoxin B 1 than the controls. The objective was to determine the putative involvement of the small RNA populations in aflatoxin reduction. In total, 41 known microRNA (miRNA) families and many novel miRNAs were identified. Among those, 89 known and 10 novel miRNAs were differentially expressed in the transformed lines. We furthermore found two small interfering RNAs derived from the inverted repeat, and 39 sRNAs that mapped without mismatches to the genome of A. flavus and were present only in the transformed lines. This information will increase our understanding of the effectiveness of RNAi and enable the possible improvement of the RNAi technology for the control of aflatoxins. Copyright © 2017 Elsevier B.V. All rights reserved.

RNAi-mediated resistance to whitefly (Bemisia tabaci) in genetically engineered lettuce (Lactuca sativa).

PubMed

Ibrahim, Abdulrazak B; Monteiro, Tatiane R; Cabral, Glaucia B; Aragão, Francisco J L

2017-10-01

RNA interference (RNAi)-based transgenic technologies have evolved as potent biochemical tools for silencing specific genes of plant pathogens and pests. The approach has been demonstrated to be useful in silencing genes in insect species. Here, we report on the successful construction of RNAi-based plasmid containing an interfering cassette designed to generate dsRNAs that target a novel v-ATPase transcript in whitefly (Bemisia tabaci), an important agricultural pest in tropical and sub-tropical regions. The presence of the transgene was confirmed in T 0 and T 1 generations of transgenic lettuce lines, segregating in a Mendelian fashion. Seven lines were infested with whiteflies and monitored over a period of 32 days. Analysis of mortality showed that within five days of feeding, insects on transgenic plants showed a mortality rate of 83.8-98.1%. In addition, a reduced number of eggs (95 fold less) was observed in flies feeding on transgenic lettuce plants than insects on control lines. Quantitative reverse transcription PCR showed decreased expression level of endogenous v-ATPase gene in whiteflies feeding on transgenic plants. This technology is a foundation for the production of whitefly-resistant commercial crops, improving agricultural sustainability and food security, reducing the use of more environmentally aggressive methods of pest control.

RNAi downregulation of three key lignin genes in sugarcane improves glucose release without reduction in sugar production

DOE PAGES

Bewg, William P.; Poovaiah, Charleson; Lan, Wu; ...

2016-12-20

Sugarcane is a subtropical crop that produces large amounts of biomass annually. It is a key agricultural crop in many countries for the production of sugar and other products. Residual bagasse following sucrose extraction is currently underutilized and it has potential as a carbohydrate source for the production of biofuels. As with all lignocellulosic crops, lignin acts as a barrier to accessing the polysaccharides, and as such, is the focus of transgenic efforts. In this study, we used RNAi to individually reduce the expression of three key genes in the lignin biosynthetic pathway in sugarcane. Furthermore, these genes, caffeoyl-CoA O-methyltransferasemore » ( CCoAOMT), ferulate 5-hydroxylase ( F5H) and caffeic acid O-methyltransferase ( COMT), impact lignin content and/or composition.« less

RNAi downregulation of three key lignin genes in sugarcane improves glucose release without reduction in sugar production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bewg, William P.; Poovaiah, Charleson; Lan, Wu

Sugarcane is a subtropical crop that produces large amounts of biomass annually. It is a key agricultural crop in many countries for the production of sugar and other products. Residual bagasse following sucrose extraction is currently underutilized and it has potential as a carbohydrate source for the production of biofuels. As with all lignocellulosic crops, lignin acts as a barrier to accessing the polysaccharides, and as such, is the focus of transgenic efforts. In this study, we used RNAi to individually reduce the expression of three key genes in the lignin biosynthetic pathway in sugarcane. Furthermore, these genes, caffeoyl-CoA O-methyltransferasemore » ( CCoAOMT), ferulate 5-hydroxylase ( F5H) and caffeic acid O-methyltransferase ( COMT), impact lignin content and/or composition.« less

RNAi functionalized scaffold for scarless skin regeneration

PubMed Central

Liu, Xing; Ma, Lie; Gao, Changyou

2013-01-01

Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756

Automated microscopy for high-content RNAi screening

PubMed Central

2010-01-01

Fluorescence microscopy is one of the most powerful tools to investigate complex cellular processes such as cell division, cell motility, or intracellular trafficking. The availability of RNA interference (RNAi) technology and automated microscopy has opened the possibility to perform cellular imaging in functional genomics and other large-scale applications. Although imaging often dramatically increases the content of a screening assay, it poses new challenges to achieve accurate quantitative annotation and therefore needs to be carefully adjusted to the specific needs of individual screening applications. In this review, we discuss principles of assay design, large-scale RNAi, microscope automation, and computational data analysis. We highlight strategies for imaging-based RNAi screening adapted to different library and assay designs. PMID:20176920

Effects of small interfering RNA inhibit Class I phosphoinositide 3-kinase on human gastric cancer cells

PubMed Central

Zhu, Bao-Song; Yu, Li-Yan; Zhao, Kui; Wu, Yong-You; Cheng, Xiao-Li; Wu, Yong; Zhong, Feng-Yun; Gong, Wei; Chen, Qiang; Xing, Chun-Gen

2013-01-01

AIM: To investigate the effects of small interfering RNA (siRNA)-mediated inhibition of Class I phosphoinositide 3-kinase (Class I PI3K) signal transduction on the proliferation, apoptosis, and autophagy of gastric cancer SGC7901 and MGC803 cells. METHODS: We constructed the recombinant replication adenovirus PI3K(I)-RNA interference (RNAi)-green fluorescent protein (GFP) and control adenovirus NC-RNAi-GFP, and infected it into human gastric cancer cells. MTT assay was used to determine the growth rate of the gastric cancer cells. Activation of autophagy was monitored with monodansylcadaverine (MDC) staining after adenovirus PI3K(I)-RNAi-GFP and control adenovirus NC-RNAi-GFP treatment. Immunofluorescence staining was used to detect the expression of microtubule-associated protein 1 light chain 3 (LC3). Mitochondrial membrane potential was measured using the fluorescent probe JC-1. The expression of autophagy was monitored with MDC, LC3 staining, and transmission electron microscopy. Western blotting was used to detect p53, Beclin-1, Bcl-2, and LC3 protein expression in the culture supernatant. RESULTS: The viability of gastric cancer cells was inhibited after siRNA targeting to the Class I PI3K blocked Class I PI3K signal pathway. MTT assays revealed that, after SGC7901 cancer cells were treated with adenovirus PI3K(I)-RNAi-GFP, the rate of inhibition reached 27.48% ± 2.71% at 24 h, 41.92% ± 2.02% at 48 h, and 50.85% ± 0.91% at 72 h. After MGC803 cancer cells were treated with adenovirus PI3K(I)-RNAi-GFP, the rate of inhibition reached 24.39% ± 0.93% at 24 h, 47.00% ± 0.87% at 48 h, and 70.30% ± 0.86% at 72 h (P < 0.05 compared to control group). It was determined that when 50 MOI, the transfection efficiency was 95% ± 2.4%. Adenovirus PI3K(I)-RNAi-GFP (50 MOI) induced mitochondrial dysfunction and activated cell apoptosis in SGC7901 cells, and the results described here prove that RNAi of Class I PI3K induced apoptosis in SGC7901 cells. The results showed that adenovirus PI3K(I)-RNAi-GFP transfection induced punctate distribution of LC3 immunoreactivity, indicating increased formation of autophagosomes. The results showed that the basal level of Beclin-1 and LC3 protein in SGC7901 cells was low. After incubating with adenovirus PI3K(I)-RNAi-GFP (50 MOI), Beclin-1, LC3, and p53 protein expression was significantly increased from 24 to 72 h. We also found that Bcl-2 protein expression down-regulated with the treatment of adenovirus PI3K(I)-RNAi-GFP (50 MOI). A number of isolated membranes, possibly derived from ribosome-free endoplasmic reticulum, were seen. These isolated membranes were elongated and curved to engulf a cytoplasmic fraction and organelles. We used transmission electron microscopy to identify ultrastructural changes in SGC7901 cells after adenovirus PI3K(I)-RNAi-GFP (50 MOI) treatment. Control cells showed a round shape and contained normal-looking organelles, nucleus, and chromatin, while adenovirus PI3K(I)-RNAi-GFP (50 MOI)-treated cells exhibited the typical signs of autophagy. CONCLUSION: After the Class I PI3K signaling pathway has been blocked by siRNA, the proliferation of cells was inhibited and the apoptosis of gastric cancer cells was enhanced. PMID:23555164

The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans.

PubMed

Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C

2002-06-28

Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

Drought response transcriptomes are altered in poplar with reduced tonoplast sucrose transporter expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xue, Liang-Jiao; Frost, Christopher J.; Tsai, Chung-Jui

Transgenic Populus tremula x alba (717-1B4) plants with reduced expression of a tonoplast sucrose efflux transporter, PtaSUT4, exhibit reduced shoot growth compared to wild type (WT) under sustained mild drought. The present study was undertaken to determine whether SUT4-RNAi directly or indirectly altered poplar predisposition and/or response to changes in soil water availability. While sucrose and hexose levels were constitutively elevated in shoot organs, expression responses to drought were most altered in the root tips of SUT4-RNAi plants. Prior to any drought treatment, constitutively elevated transcript levels of abscisic acid biosynthetic genes and bark/vegetative storage proteins suggested altered metabolism inmore » root tips of RNAi plants. Stronger drought-stimulation of stress-inducible genes encoding late-embryogenesis-abundant proteins in transgenic roots was consistent with increased vulnerability to soil drying. Transcript evidence suggested an RNAi effect on intercellular water trafficking by aquaporins in stem xylem during soil drying and recovery. Co-expression network analysis predicted altered integration of abscisic acid sensing/signaling with ethylene and jasmonate sensing/signaling in RNAi compared to WT roots. The overall conclusion is that steepened shoot-root sugar gradient in RNAi plants increased sensitivity of root tips to decreasing soil water availability.« less

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.

PubMed

Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F

2018-04-03

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Caenorhabditis elegans ABCRNAi Transporters Interact Genetically With rde-2 and mut-7

PubMed Central

Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa

2008-01-01

RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABCRNAi mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABCRNAi gene class. Genetic complementation tests reveal functions for ABCRNAi transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABCRNAi proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABCRNAi mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABCRNAi gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABCRNAi transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity. PMID:18245353

Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).

PubMed

Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash

2015-01-01

The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.

RNA interference: Applications and advances in insect toxicology and insect pest management.

PubMed

Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan

2015-05-01

Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.

Protein interaction network topology uncovers melanogenesis regulatory network components within functional genomics datasets.

PubMed

Ho, Hsiang; Milenković, Tijana; Memisević, Vesna; Aruri, Jayavani; Przulj, Natasa; Ganesan, Anand K

2010-06-15

RNA-mediated interference (RNAi)-based functional genomics is a systems-level approach to identify novel genes that control biological phenotypes. Existing computational approaches can identify individual genes from RNAi datasets that regulate a given biological process. However, currently available methods cannot identify which RNAi screen "hits" are novel components of well-characterized biological pathways known to regulate the interrogated phenotype. In this study, we describe a method to identify genes from RNAi datasets that are novel components of known biological pathways. We experimentally validate our approach in the context of a recently completed RNAi screen to identify novel regulators of melanogenesis. In this study, we utilize a PPI network topology-based approach to identify targets within our RNAi dataset that may be components of known melanogenesis regulatory pathways. Our computational approach identifies a set of screen targets that cluster topologically in a human PPI network with the known pigment regulator Endothelin receptor type B (EDNRB). Validation studies reveal that these genes impact pigment production and EDNRB signaling in pigmented melanoma cells (MNT-1) and normal melanocytes. We present an approach that identifies novel components of well-characterized biological pathways from functional genomics datasets that could not have been identified by existing statistical and computational approaches.

Protein interaction network topology uncovers melanogenesis regulatory network components within functional genomics datasets

PubMed Central

2010-01-01

Background RNA-mediated interference (RNAi)-based functional genomics is a systems-level approach to identify novel genes that control biological phenotypes. Existing computational approaches can identify individual genes from RNAi datasets that regulate a given biological process. However, currently available methods cannot identify which RNAi screen "hits" are novel components of well-characterized biological pathways known to regulate the interrogated phenotype. In this study, we describe a method to identify genes from RNAi datasets that are novel components of known biological pathways. We experimentally validate our approach in the context of a recently completed RNAi screen to identify novel regulators of melanogenesis. Results In this study, we utilize a PPI network topology-based approach to identify targets within our RNAi dataset that may be components of known melanogenesis regulatory pathways. Our computational approach identifies a set of screen targets that cluster topologically in a human PPI network with the known pigment regulator Endothelin receptor type B (EDNRB). Validation studies reveal that these genes impact pigment production and EDNRB signaling in pigmented melanoma cells (MNT-1) and normal melanocytes. Conclusions We present an approach that identifies novel components of well-characterized biological pathways from functional genomics datasets that could not have been identified by existing statistical and computational approaches. PMID:20550706

Key enzymes and proteins of crop insects as candidate for RNAi based gene silencing

PubMed Central

Kola, Vijaya Sudhakara Rao; Renuka, P.; Madhav, Maganti Sheshu; Mangrauthia, Satendra K.

2015-01-01

RNA interference (RNAi) is a mechanism of homology dependent gene silencing present in plants and animals. It operates through 21–24 nucleotides small RNAs which are processed through a set of core enzymatic machinery that involves Dicer and Argonaute proteins. In recent past, the technology has been well appreciated toward the control of plant pathogens and insects through suppression of key genes/proteins of infecting organisms. The genes encoding key enzymes/proteins with the great potential for developing an effective insect control by RNAi approach are actylcholinesterase, cytochrome P450 enzymes, amino peptidase N, allatostatin, allatotropin, tryptophan oxygenase, arginine kinase, vacuolar ATPase, chitin synthase, glutathione-S-transferase, catalase, trehalose phosphate synthase, vitellogenin, hydroxy-3-methylglutaryl coenzyme A reductase, and hormone receptor genes. Through various studies, it is demonstrated that RNAi is a reliable molecular tool which offers great promises in meeting the challenges imposed by crop insects with careful selection of key enzymes/proteins. Utilization of RNAi tool to target some of these key proteins of crop insects through various approaches is described here. The major challenges of RNAi based insect control such as identifying potential targets, delivery methods of silencing trigger, off target effects, and complexity of insect biology are very well illustrated. Further, required efforts to address these challenges are also discussed. PMID:25954206

Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans

PubMed Central

Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei

2016-01-01

RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA. PMID:27306325

Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.

PubMed

Imae, Rieko; Dejima, Katsufumi; Kage-Nakadai, Eriko; Arai, Hiroyuki; Mitani, Shohei

2016-06-16

RNA silencing signals in C. elegans spread among cells, leading to RNAi throughout the body. During systemic spread of RNAi, membrane trafficking is thought to play important roles. Here, we show that RNAi Spreading Defective-3 (rsd-3), which encodes a homolog of epsinR, a conserved ENTH (epsin N-terminal homology) domain protein, generally participates in cellular uptake of silencing RNA. RSD-3 is previously thought to be involved in systemic RNAi only in germ cells, but we isolated several deletion alleles of rsd-3, and found that these mutants are defective in the spread of silencing RNA not only into germ cells but also into somatic cells. RSD-3 is ubiquitously expressed, and intracellularly localized to the trans-Golgi network (TGN) and endosomes. Tissue-specific rescue experiments indicate that RSD-3 is required for importing silencing RNA into cells rather than exporting from cells. Structure/function analysis showed that the ENTH domain alone is sufficient, and membrane association of the ENTH domain is required, for RSD-3 function in systemic RNAi. Our results suggest that endomembrane trafficking through the TGN and endosomes generally plays an important role in cellular uptake of silencing RNA.

Drought response transcriptomes are altered in poplar with reduced tonoplast sucrose transporter expression

DOE PAGES

Xue, Liang-Jiao; Frost, Christopher J.; Tsai, Chung-Jui; ...

2016-09-19

Transgenic Populus tremula x alba (717-1B4) plants with reduced expression of a tonoplast sucrose efflux transporter, PtaSUT4, exhibit reduced shoot growth compared to wild type (WT) under sustained mild drought. The present study was undertaken to determine whether SUT4-RNAi directly or indirectly altered poplar predisposition and/or response to changes in soil water availability. While sucrose and hexose levels were constitutively elevated in shoot organs, expression responses to drought were most altered in the root tips of SUT4-RNAi plants. Prior to any drought treatment, constitutively elevated transcript levels of abscisic acid biosynthetic genes and bark/vegetative storage proteins suggested altered metabolism inmore » root tips of RNAi plants. Stronger drought-stimulation of stress-inducible genes encoding late-embryogenesis-abundant proteins in transgenic roots was consistent with increased vulnerability to soil drying. Transcript evidence suggested an RNAi effect on intercellular water trafficking by aquaporins in stem xylem during soil drying and recovery. Co-expression network analysis predicted altered integration of abscisic acid sensing/signaling with ethylene and jasmonate sensing/signaling in RNAi compared to WT roots. The overall conclusion is that steepened shoot-root sugar gradient in RNAi plants increased sensitivity of root tips to decreasing soil water availability.« less

Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

PubMed

Firnhaber, Christopher; Hammarlund, Marc

2013-11-01

Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

Expression of hsrω-RNAi transgene prior to heat shock specifically compromises accumulation of heat shock-induced Hsp70 in Drosophila melanogaster.

PubMed

Singh, Anand K; Lakhotia, Subhash C

2016-01-01

A delayed organismic lethality was reported in Drosophila following heat shock when developmentally active and stress-inducible noncoding hsrω-n transcripts were down-regulated during heat shock through hs-GAL4-driven expression of the hsrω-RNAi transgene, despite the characteristic elevation of all heat shock proteins (Hsp), including Hsp70. Here, we show that hsrω-RNAi transgene expression prior to heat shock singularly prevents accumulation of Hsp70 in all larval tissues without affecting transcriptional induction of hsp70 genes and stability of their transcripts. Absence of the stress-induced Hsp70 accumulation was not due to higher levels of Hsc70 in hsrω-RNAi transgene-expressing tissues. Inhibition of proteasomal activity during heat shock restored high levels of the induced Hsp70, suggesting very rapid degradation of the Hsp70 even during the stress when hsrω-RNAi transgene was expressed ahead of heat shock. Unexpectedly, while complete absence of hsrω transcripts in hsrω (66) homozygotes (hsrω-null) did not prevent high accumulation of heat shock-induced Hsp70, hsrω-RNAi transgene expression in hsrω-null background blocked Hsp70 accumulation. Nonspecific RNAi transgene expression did not affect Hsp70 induction. These observations reveal that, under certain conditions, the stress-induced Hsp70 can be selectively and rapidly targeted for proteasomal degradation even during heat shock. In the present case, the selective degradation of Hsp70 does not appear to be due to down-regulation of the hsrω-n transcripts per se; rather, this may be an indirect effect of the expression of hsrω-RNAi transgene whose RNA products may titrate away some RNA-binding proteins which may also be essential for stability of the induced Hsp70.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

PubMed

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Differential gene expression in tomato fruit and Colletotrichum gloeosporioides during colonization of the RNAi-SlPH tomato line with reduced fruit acidity and higher pH.

PubMed

Barad, Shiri; Sela, Noa; Dubey, Amit K; Kumar, Dilip; Luria, Neta; Ment, Dana; Cohen, Shahar; Schaffer, Arthur A; Prusky, Dov

2017-08-04

The destructive phytopathogen Colletotrichum gloeosporioides causes anthracnose disease in fruit. During host colonization, it secretes ammonia, which modulates environmental pH and regulates gene expression, contributing to pathogenicity. However, the effect of host pH environment on pathogen colonization has never been evaluated. Development of an isogenic tomato line with reduced expression of the gene for acidity, SlPH (Solyc10g074790.1.1), enabled this analysis. Total RNA from C. gloeosporioides colonizing wild-type (WT) and RNAi-SlPH tomato lines was sequenced and gene-expression patterns were compared. C. gloeosporioides inoculation of the RNAi-SlPH line with pH 5.96 compared to the WT line with pH 4.2 showed 30% higher colonization and reduced ammonia accumulation. Large-scale comparative transcriptome analysis of the colonized RNAi-SlPH and WT lines revealed their different mechanisms of colonization-pattern activation: whereas the WT tomato upregulated 13-LOX (lipoxygenase), jasmonic acid and glutamate biosynthesis pathways, it downregulated processes related to chlorogenic acid biosynthesis II, phenylpropanoid biosynthesis and hydroxycinnamic acid tyramine amide biosynthesis; the RNAi-SlPH line upregulated UDP-D-galacturonate biosynthesis I and free phenylpropanoid acid biosynthesis, but mainly downregulated pathways related to sugar metabolism, such as the glyoxylate cycle and L-arabinose degradation II. Comparison of C. gloeosporioides gene expression during colonization of the WT and RNAi-SlPH lines showed that the fungus upregulates ammonia and nitrogen transport and the gamma-aminobutyric acid metabolic process during colonization of the WT, while on the RNAi-SlPH tomato, it mainly upregulates the nitrate metabolic process. Modulation of tomato acidity and pH had significant phenotypic effects on C. gloeosporioides development. The fungus showed increased colonization on the neutral RNAi-SlPH fruit, and limited colonization on the WT acidic fruit. The change in environmental pH resulted in different defense responses for the two tomato lines. Interestingly, the WT line showed upregulation of jasmonate pathways and glutamate accumulation, supporting the reduced symptom development and increased ammonia accumulation, as the fungus might utilize glutamate to accumulate ammonia and increase environmental pH for better expression of pathogenicity factors. This was not found in the RNAi-SlPH line which downregulated sugar metabolism and upregulated the phenylpropanoid pathway, leading to host susceptibility.

Pathogen and Pest Responses Are Altered Due to RNAi-Mediated Knockdown of GLYCOALKALOID METABOLISM 4 in Solanum tuberosum.

PubMed

Paudel, Jamuna Risal; Davidson, Charlotte; Song, Jun; Maxim, Itkin; Aharoni, Asaph; Tai, Helen H

2017-11-01

Steroidal glycoalkaloids (SGAs) are major secondary metabolites constitutively produced in cultivated potato Solanum tuberosum, and α-solanine and α-chaconine are the most abundant SGAs. SGAs are toxic to humans at high levels but their role in plant protection against pests and pathogens is yet to be established. In this study, levels of SGAs in potato were reduced by RNA interference (RNAi)-mediated silencing of GLYCOALKALOID METABOLISM 4 (GAME4)-a gene encoding cytochrome P450, involved in an oxidation step in the conversion of cholesterol to SGA aglycones. Two GAME4 RNAi lines, T8 and T9, were used to investigate the effects of manipulation of the SGA biosynthetic pathway in potato. Growth and development of an insect pest, Colorado potato beetle (CPB), were affected in these lines. While no effect on CPB leaf consumption or weight gain was observed, early instar larval death and accelerated development of the insect was found while feeding on leaves of GAME4 RNAi lines. Modulation of SGA biosynthetic pathway in GAME4 RNAi plants was associated with a larger alteration to the metabolite profile, including increased levels of one or both the steroidal saponins or phytoecdysteroids, which could affect insect mortality as well as development time. Colonization by Verticillium dahliae on GAME4 RNAi plants was also tested. There were increased pathogen levels in the T8 GAME4 RNAi line but not in the T9. Metabolite differences between T8 and T9 were found and may have contributed to differences in V. dahliae infection. Drought responses created by osmotic stress were not affected by modulation of SGA biosynthetic pathway in potato.

Dietary Risk Assessment of v-ATPase A dsRNAs on Monarch Butterfly Larvae.

PubMed

Pan, Huipeng; Yang, Xiaowei; Bidne, Keith; Hellmich, Richard L; Siegfried, Blair D; Zhou, Xuguo

2017-01-01

By suppressing the expression of genes with essential biological functions, in planta RNAi can negatively affect the development and survival of target pests. As a part of a concerted effort to assess the risks of RNAi transgenic crops on non-target organisms, we developed an in vivo toxicity assay to examine the impacts of ingested dsRNAs incurred to the monarch butterfly, Danaus plexippus (L.), an iconic eco-indicator in North America. To create the worst case scenario, the full-length v-ATPase A cDNAs from the target pest, western corn rootworm, Diabrotica virgifera virgifera , and the non-target D. plexippus were respectively cloned. A 400 bp fragment with the highest sequence similarity between the two species was used as the template to synthesize dsRNAs for the subsequent dietary RNAi toxicity assay. Specifically, newly hatched neonates were provisioned with leaf disks surface-coated with v-ATPase A dsRNAs synthesized from D. v. virgifera and D. plexippus , respectively, a control dsRNA, β -glucoruronidase , from plants, and H 2 O. The endpoint measurements included gene expressions and life history traits. The 2283 bp D. plexippus v-ATPase A cDNA contains a 99 bp 5'-untranslated region, a 330 bp 3'-untranslated region, and an 1851 bp ORF encoding 617 amino acids. The temporal RNAi study did not detect any impact to D. plexippus v-ATPase A expression by the assay days and treatments. This was reflected in the phenotypic impacts of dietary RNAi, in which both survival rate and development time were not affected by the uptake of ingested dsRNAs. These combined results suggest that D. plexippus larvae are not susceptible to dietary RNAi, therefore, the impact of transgenic RNAi plants on this non-target organism is, likely, negligible.

Next-generation transgenic cotton: pyramiding RNAi and Bt counters insect resistance.

PubMed

Ni, Mi; Ma, Wei; Wang, Xiaofang; Gao, Meijing; Dai, Yan; Wei, Xiaoli; Zhang, Lei; Peng, Yonggang; Chen, Shuyuan; Ding, Lingyun; Tian, Yue; Li, Jie; Wang, Haiping; Wang, Xiaolin; Xu, Guowang; Guo, Wangzhen; Yang, Yihua; Wu, Yidong; Heuberger, Shannon; Tabashnik, Bruce E; Zhang, Tianzhen; Zhu, Zhen

2017-09-01

Transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are extensively cultivated worldwide. To counter rapidly increasing pest resistance to crops that produce single Bt toxins, transgenic plant 'pyramids' producing two or more Bt toxins that kill the same pest have been widely adopted. However, cross-resistance and antagonism between Bt toxins limit the sustainability of this approach. Here we describe development and testing of the first pyramids of cotton combining protection from a Bt toxin and RNA interference (RNAi). We developed two types of transgenic cotton plants producing double-stranded RNA (dsRNA) from the global lepidopteran pest Helicoverpa armigera designed to interfere with its metabolism of juvenile hormone (JH). We focused on suppression of JH acid methyltransferase (JHAMT), which is crucial for JH synthesis, and JH-binding protein (JHBP), which transports JH to organs. In 2015 and 2016, we tested larvae from a Bt-resistant strain and a related susceptible strain of H. armigera on seven types of cotton: two controls, Bt cotton, two types of RNAi cotton (targeting JHAMT or JHBP) and two pyramids (Bt cotton plus each type of RNAi). Both types of RNAi cotton were effective against Bt-resistant insects. Bt cotton and RNAi acted independently against the susceptible strain. In computer simulations of conditions in northern China, where millions of farmers grow Bt cotton as well as abundant non-transgenic host plants of H. armigera, pyramided cotton combining a Bt toxin and RNAi substantially delayed resistance relative to using Bt cotton alone. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces parasitic success.

PubMed

Sindhu, Anoop S; Maier, Tom R; Mitchum, Melissa G; Hussey, Richard S; Davis, Eric L; Baum, Thomas J

2009-01-01

Cyst nematodes are highly evolved sedentary plant endoparasites that use parasitism proteins injected through the stylet into host tissues to successfully parasitize plants. These secretory proteins likely are essential for parasitism as they are involved in a variety of parasitic events leading to the establishment of specialized feeding cells required by the nematode to obtain nourishment. With the advent of RNA interference (RNAi) technology and the demonstration of host-induced gene silencing in parasites, a new strategy to control pests and pathogens has become available, particularly in root-knot nematodes. Plant host-induced silencing of cyst nematode genes so far has had only limited success but similarly should disrupt the parasitic cycle and render the host plant resistant. Additional in planta RNAi data for cyst nematodes are being provided by targeting four parasitism genes through host-induced RNAi gene silencing in transgenic Arabidopsis thaliana, which is a host for the sugar beet cyst nematode Heterodera schachtii. Here it is reported that mRNA abundances of targeted nematode genes were specifically reduced in nematodes feeding on plants expressing corresponding RNAi constructs. Furthermore, this host-induced RNAi of all four nematode parasitism genes led to a reduction in the number of mature nematode females. Although no complete resistance was observed, the reduction of developing females ranged from 23% to 64% in different RNAi lines. These observations demonstrate the relevance of the targeted parasitism genes during the nematode life cycle and, potentially more importantly, suggest that a viable level of resistance in crop plants may be accomplished in the future using this technology against cyst nematodes.

Two distinct roles of the yorkie/yap gene during homeostasis in the planarian Dugesia japonica.

PubMed

Hwang, Byulnim; An, Yang; Agata, Kiyokazu; Umesono, Yoshihiko

2015-04-01

Adult planarians possess somatic pluripotent stem cells called neoblasts that give rise to all missing cell types during regeneration and homeostasis. Recent studies revealed that the Yorkie (Yki)/Yes-associated protein (YAP) transcriptional coactivator family plays an important role in the regulation of tissue growth during development and regeneration, and therefore we investigated the role of a planarian yki-related gene (termed Djyki) during regeneration and homeostasis of the freshwater planarian Dugesia japonica. We found that knockdown of the function of Djyki by RNA interference (RNAi) downregulated neoblast proliferation and caused regeneration defects after amputation. In addition, Djyki RNAi caused edema during homeostasis. These seemingly distinct defects induced by Djyki RNAi were rescued by simultaneous RNAi of a planarian mats-related gene (termed Djmats), suggesting an important role of Djmats in the negative regulation of Djyki, in accordance with the conservation of the functional relationship of these two genes during the course of evolution. Interestingly, Djyki RNAi did not prevent normal protonephridial structure, suggesting that Djyki RNAi induced the edema phenotype without affecting the excretory system. Further analyses revealed that increased expression of the D. japonica gene DjaquaporinA (DjaqpA), which belongs to a large gene family that encodes a water channel protein for the regulation of transcellular water flow, promoted the induction of edema, but not defects in neoblast dynamics, in Djyki(RNAi) animals. Thus, we conclude that Djyki plays two distinct roles in the regulation of active proliferation of stem cells and in osmotic water transport across the body surface in D. japonica. © 2015 The Authors Development, Growth & Differentiation published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Society of Developmental Biologists.

RNA Interference Knockdown of BRASSINOSTEROID INSENSITIVE1 in Maize Reveals Novel Functions for Brassinosteroid Signaling in Controlling Plant Architecture1[OPEN

PubMed Central

Kir, Gokhan; Ye, Huaxun; Nelissen, Hilde; Neelakandan, Anjanasree K.; Kusnandar, Andree S.; Luo, Anding; Inzé, Dirk; Sylvester, Anne W.; Yin, Yanhai; Becraft, Philip W.

2015-01-01

Brassinosteroids (BRs) are plant hormones involved in various growth and developmental processes. The BR signaling system is well established in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) but poorly understood in maize (Zea mays). BRASSINOSTEROID INSENSITIVE1 (BRI1) is a BR receptor, and database searches and additional genomic sequencing identified five maize homologs including duplicate copies of BRI1 itself. RNA interference (RNAi) using the extracellular coding region of a maize zmbri1 complementary DNA knocked down the expression of all five homologs. Decreased response to exogenously applied brassinolide and altered BR marker gene expression demonstrate that zmbri1-RNAi transgenic lines have compromised BR signaling. zmbri1-RNAi plants showed dwarf stature due to shortened internodes, with upper internodes most strongly affected. Leaves of zmbri1-RNAi plants are dark green, upright, and twisted, with decreased auricle formation. Kinematic analysis showed that decreased cell division and cell elongation both contributed to the shortened leaves. A BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1-yellow fluorescent protein (BES1-YFP) transgenic line was developed that showed BR-inducible BES1-YFP accumulation in the nucleus, which was decreased in zmbri1-RNAi. Expression of the BES1-YFP reporter was strong in the auricle region of developing leaves, suggesting that localized BR signaling is involved in promoting auricle development, consistent with the zmbri1-RNAi phenotype. The blade-sheath boundary disruption, shorter ligule, and disrupted auricle morphology of RNAi lines resemble KNOTTED1-LIKE HOMEOBOX (KNOX) mutants, consistent with a mechanistic connection between KNOX genes and BR signaling. PMID:26162429

Biotechnological uses of RNAi in plants: risk assessment considerations.

PubMed

Casacuberta, Josep M; Devos, Yann; du Jardin, Patrick; Ramon, Matthew; Vaucheret, Hervé; Nogué, Fabien

2015-03-01

RNAi offers opportunities to generate new traits in genetically modified (GM) plants. Instead of expressing novel proteins, RNAi-based GM plants reduce target gene expression. Silencing of off-target genes may trigger unintended effects, and identifying these genes would facilitate risk assessment. However, using bioinformatics alone is not reliable, due to the lack of genomic data and insufficient knowledge of mechanisms governing mRNA-small (s)RNA interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.

The next phase of life-sciences spaceflight research

PubMed Central

Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Higashitani, Atsushi

2011-01-01

Recently we demonstrated that the effectiveness of RNAi interference (RNAi) for inhibiting gene expression is maintained during spaceflight in the worm Caenorhabditis elegans and argued for the biomedical importance of this finding. We also successfully utilized green fluorescent protein (GFP)-tagged proteins to monitor changes in GPF localization during flight. Here we discuss potential applications of RNAi and GFP in spaceflight studies and the ramifications of these experiments for the future of space life-sciences research. PMID:22446523

Distinct RNAi Pathways in the Regulation of Physiology and Development in the Fungus Mucor circinelloides.

PubMed

Ruiz-Vázquez, Rosa M; Nicolás, Francisco E; Torres-Martínez, Santiago; Garre, Victoriano

2015-01-01

The basal fungus Mucor circinelloides has become, in recent years, a valuable model to study RNA-mediated gene silencing or RNA interference (RNAi). Serendipitously discovered in the late 1900s, the gene silencing in M. circinelloides is a landscape of consensus and dissents. Although similar to other classical fungal models in the basic design of the essential machinery that is responsible for silencing of gene expression, the existence of small RNA molecules of different sizes generated during this process and the presence of a mechanism that amplifies the silencing signal, give it a unique identity. In addition, M. circinelloides combines the components of RNAi machinery to carry out functions that not only limit themselves to the defense against foreign genetic material, but it uses some of these elements to regulate the expression of its own genes. Thus, different combinations of RNAi elements produce distinct classes of endogenous small RNAs (esRNAs) that regulate different physiological and developmental processes in response to environmental signals. The recent discovery of a new RNAi pathway involved in the specific degradation of endogenous mRNAs, using a novel RNase protein, adds one more element to the exciting puzzle of the gene silencing in M. circinelloides, in addition to providing hints about the evolutionary origin of the RNAi mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.

Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.

PubMed

Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin

2017-07-18

RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.

Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics

PubMed Central

Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin

2017-01-01

RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023

Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses

PubMed Central

Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.

2017-01-01

Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327

A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia

PubMed Central

Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric

2014-01-01

In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163

Silencing Prx1 and/or Prx5 sensitizes human esophageal cancer cells to ionizing radiation and increases apoptosis via intracellular ROS accumulation

PubMed Central

Gao, Mai-cang; Jia, Xiao-di; Wu, Qi-fei; Cheng, Yan; Chen, Fen-rong; Zhang, Jun

2011-01-01

Aim: To investigate whether down-regulation of peroxiredoxin 1 (Prx1) and/or peroxiredoxin 5 (Prx5) sensitizes human esophageal cancer cells to ionizing radiation (IR). Methods: Human esophageal carcinoma cell lines Eca-109 and TE-1 were used. Prx mRNA expression profiles in Eca-109 and TE-1 cells were determined using RT-PCR. Two highly expressed isoforms of Prxs, Prx1 and Prx5, were silenced by RNA interference (RNAi). Following IR, intracellular reactive oxygen species (ROS) and apoptosis were measured using flow cytometry, the activities of catalase, superoxide dismutase and glutathione peroxidase were measured, and the radiosensitizing effect of RNAi was observed. Tumor xenograft model was also used to examine the radiosensitizing effect of RNAi in vivo. Results: Down-regulation of Prx1 and/or Prx5 by RNAi does not alter the activities of catalase, superoxide dismutase and glutathione peroxidase, but made human tumor cells more sensitive to IR-induced apoptosis both in vitro and in vivo. When the two isoforms were decreased simultaneously, intracellular ROS and apoptosis significantly increased after IR. Conclusion: Silencing Prx1 and/or Prx5 by RNAi sensitizes human Eca-109 and TE-1 cells to IR, and the intracellular ROS accumulation may contribute to the radiosensitizing effect of the RNAi. PMID:21468086

RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

PubMed Central

Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

2006-01-01

Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines.

PubMed

Oliveira, Virgínia Carla; Bartasson, Lorrainy; de Castro, Maria Elita Batista; Corrêa, José Raimundo; Ribeiro, Bergmann Morais; Resende, Renato Oliveira

2011-01-01

The nonstructural protein (NSs) of the Tomato spotted wilt virus (TSWV) has been identified as an RNAi suppressor in plant cells. A recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) designated vAcNSs, containing the NSs gene under the control of the viral polyhedrin (polh) gene promoter, was constructed and the effects of NSs in permissive, semipermissive and nonpermissive insect cells to vAcNSs infection were evaluated. vAcNSs produced more budded virus when compared to wild type in semipermissive cells. Co-infection of vAcNSs with wild type baculoviruses clearly enhanced polyhedra production in all host cells. Confocal microscopy analysis showed that NSs accumulated in abundance in the cytoplasm of permissive and semipermissive cells. In contrast, high amounts of NSs were detected in the nuclei of nonpermissive cells. Co-infection of vAcNSs with a recombinant AcMNPV containing the enhanced green fluorescent protein (egfp) gene, significantly increased EGFP expression in semipermissive cells and in Anticarsia gemmatalis-hemocytes. Absence of small RNA molecules of egfp transcripts in this cell line and in a permissive cell line indicates the suppression of gene silencing activity. On the other hand, vAcNSs was not able to suppress RNAi in a nonpermissive cell line. Our data showed that NSs protein of TSWV facilitates baculovirus replication in different lepidopteran cell lines, and these results indicate that NSs could play a similar role during TSWV-infection in its thrips vector. Copyright © 2010 Elsevier B.V. All rights reserved.

Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA.

PubMed

Kocan, Katherine M; Manzano-Roman, Raúl; de la Fuente, José

2007-05-01

RNA interference (RNAi) has become the most powerful experimental tool for the study of gene function in ticks. Subolesin, initially called 4D8, was found to be protective against tick infestations when used as a vaccine and was shown to be highly conserved among ixodid tick species at the nucleotide and protein levels. RNAi caused systemic silencing of subolesin and demonstrated that this protein is involved in regulation of tick feeding, reproduction, and development. Recently, these results were extended to the one-host tick Rhipicephalus (Boophilus) microplus in which injection of dsRNA into replete females resulted in transovarial silencing of subolesin expression in eggs and larvae. Herein, we report transovarial silencing of subolesin by RNAi in the three-host ticks, Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis. Silencing of subolesin expression by RNAi in these tick species also affected subolesin expression in eggs and larvae. Transovarial RNAi appears to be a common mechanism in ixodid ticks and provides a simple method for the rapid characterization of tick genes involved in oviposition, embryogenesis, and larval development.

Small RNAs—The Secret Agents in the Plant-Pathogen Interactions

PubMed Central

Weiberg, Arne; Jin, Hailing

2015-01-01

Eukaryotic regulatory small RNAs (sRNAs) that induce RNA interference (RNAi) are involved in a plethora of biological processes, including host immunity and pathogen virulence. In plants, diverse classes of sRNAs contribute to the regulation of host innate immunity. These immune-regulatory sRNAs operate through distinct RNAi pathways that trigger transcriptional or post-transcriptional gene silencing. Similarly, many pathogen-derived sRNAs also regulate pathogen virulence. Remarkably, the influence of regulatory sRNAs is not limited to the individual organism in which they are generated. It can sometimes extend to interacting species from even different kingdoms. There they trigger gene silencing in the interacting organism, a phenomenon called cross-kingdom RNAi. This is exhibited in advanced pathogens and parasites that produce sRNAs to suppress host immunity. Conversely, in host-induced gene silencing (HIGS), diverse plants are engineered to trigger RNAi against pathogens and pests to confer host resistance. Cross-kingdom RNAi opens up a vastly unexplored area of research on mobile sRNAs in the battlefield between hosts and pathogens. PMID:26123395

RNAi-Dependent and Independent Control of LINE1 Accumulation and Mobility in Mouse Embryonic Stem Cells

PubMed Central

Ciaudo, Constance; Jay, Florence; Okamoto, Ikuhiro; Chen, Chong-Jian; Sarazin, Alexis; Servant, Nicolas; Barillot, Emmanuel; Heard, Edith; Voinnet, Olivier

2013-01-01

In most mouse tissues, long-interspersed elements-1 (L1s) are silenced via methylation of their 5′-untranslated regions (5′-UTR). A gradual loss-of-methylation in pre-implantation embryos coincides with L1 retrotransposition in blastocysts, generating potentially harmful mutations. Here, we show that Dicer- and Ago2-dependent RNAi restricts L1 accumulation and retrotransposition in undifferentiated mouse embryonic stem cells (mESCs), derived from blastocysts. RNAi correlates with production of Dicer-dependent 22-nt small RNAs mapping to overlapping sense/antisense transcripts produced from the L1 5′-UTR. However, RNA-surveillance pathways simultaneously degrade these transcripts and, consequently, confound the anti-L1 RNAi response. In Dicer−/− mESC complementation experiments involving ectopic Dicer expression, L1 silencing was rescued in cells in which microRNAs remained strongly depleted. Furthermore, these cells proliferated and differentiated normally, unlike their non-complemented counterparts. These results shed new light on L1 biology, uncover defensive, in addition to regulatory roles for RNAi, and raise questions on the differentiation defects of Dicer−/− mESCs. PMID:24244175

Efficacy of a Novel Class of RNA Interference Therapeutic Agents

PubMed Central

Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

2012-01-01

RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

Silencing of ATP11B by RNAi-Induced Changes in Neural Stem Cell Morphology.

PubMed

Wang, Jiao; Wang, Qian; Zhou, Fangfang; Wang, Dong; Wen, Tieqiao

2017-01-01

RNA interference (RNAi) technology is one of the main research tools in many studies of neural stem cells. This study describes effects of ATP11B on the morphology change of neural stem cells by using RNAi. ATP11B belongs to P4-ATPases family, which is preferential translocate phosphatidylserine of cell membrane. Although it exists in neural stem cells, its physiological function is poorly understood. By using RNAi technology to downregulate expression of ATP11B, we found distinct morphological changes in neural stem cells. More important, psiRNA-ATP11B-transfected cells displayed short neurite outgrowth compared to the control cells. These data strongly suggest that ATP11B plays a key role in the morphological change of neural stem cells.

Silencing of SlPL, which encodes a pectate lyase in tomato, confers enhanced fruit firmness, prolonged shelf-life and reduced susceptibility to grey mould.

PubMed

Yang, Lu; Huang, Wei; Xiong, Fangjie; Xian, Zhiqiang; Su, Deding; Ren, Maozhi; Li, Zhengguo

2017-12-01

Pectate lyase genes have been documented as excellent candidates for improvement of fruit firmness. However, implementation of pectate lyase in regulating fruit postharvest deterioration has not been fully explored. In this report, 22 individual pectate lyase genes in tomato were identified, and one pectate lyase gene SlPL (Solyc03g111690) showed dominant expression during fruit maturation. RNA interference of SlPL resulted in enhanced fruit firmness and changes in pericarp cells. More importantly, the SlPL-RNAi fruit demonstrated greater antirotting and pathogen-resisting ability. Compared to wild-type, SlPL-RNAi fruit had higher levels of cellulose and hemicellulose, whereas the level of water-soluble pectin was lower. Consistent with this, the activities of peroxidase, superoxide dismutase and catalase were higher in SlPL-RNAi fruit, and the malondialdehyde concentration was lower. RNA-Seq results showed large amounts of differentially expressed genes involved in hormone signalling, cell wall modification, oxidative stress and pathogen resistance. Collectively, these data demonstrate that pectate lyase plays an important role in both fruit softening and pathogen resistance. This may advance knowledge of postharvest fruit preservation in tomato and other fleshy fruit. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

In ovo electroporation of miRNA-based plasmids in the developing neural tube and assessment of phenotypes by DiI injection in open-book preparations.

PubMed

Wilson, Nicole H; Stoeckli, Esther T

2012-10-16

Commissural dI1 neurons have been extensively studied to elucidate the mechanisms underlying axon guidance during development(1,2). These neurons are located in the dorsal spinal cord and send their axons along stereotyped trajectories. Commissural axons initially project ventrally towards and then across the floorplate. After crossing the midline, these axons make a sharp rostral turn and project longitudinally towards the brain. Each of these steps is regulated by the coordinated activities of attractive and repulsive guidance cues. The correct interpretation of these cues is crucial to the guidance of axons along their demarcated pathway. Thus, the physiological contribution of a particular molecule to commissural axon guidance is ideally investigated in the context of the living embryo. Accordingly, gene knockdown in vivo must be precisely controlled in order to carefully distinguish axon guidance activities of genes that may play multiple roles during development. Here, we describe a method to knockdown gene expression in the chicken neural tube in a cell type-specific, traceable manner. We use novel plasmid vectors(3) harboring cell type-specific promoters/enhancers that drive the expression of a fluorescent protein marker, followed directly by a miR30-RNAi transcript(4) (located within the 3'-UTR of the cDNA encoding the fluorescent protein) (Figure 1). When electroporated into the developing neural tube, these vectors elicit efficient downregulation of gene expression and express bright fluorescent marker proteins to enable direct tracing of the cells experiencing knockdown(3). Mixing different RNAi vectors prior to electroporation allows the simultaneous knockdown of two or more genes in independent regions of the spinal cord. This permits complex cellular and molecular interactions to be examined during development, in a manner that is fast, simple, precise and inexpensive. In combination with DiI tracing of commissural axon trajectories in open-book preparations(5), this method is a useful tool for in vivo studies of the cellular and molecular mechanisms of commissural axon growth and guidance. In principle, any promoter/enhancer could be used, potentially making the technique more widely applicable for in vivo studies of gene function during development(6). This video first demonstrates how to handle and window eggs, the injection of DNA plasmids into the neural tube and the electroporation procedure. To investigate commissural axon guidance, the spinal cord is removed from the embryo as an open-book preparation, fixed, and injected with DiI to enable axon pathways to be traced. The spinal cord is mounted between coverslips and visualized using confocal microscopy.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

RNAi-based GM plants: food for thought for risk assessors.

PubMed

Ramon, Matthew; Devos, Yann; Lanzoni, Anna; Liu, Yi; Gomes, Ana; Gennaro, Andrea; Waigmann, Elisabeth

2014-12-01

RNA interference (RNAi) is an emerging technology that offers new opportunities for the generation of new traits in genetically modified (GM) plants. Potential risks associated with RNAi-based GM plants and issues specific to their risk assessment were discussed during an international scientific workshop (June 2014) organized by the European Food Safety Authority (EFSA). Selected key outcomes of the workshop are reported here. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Multi-walled carbon nanotube (MWCNT) synthesis, preparation, labeling, and functionalization.

PubMed

Kateb, Babak; Yamamoto, Vicky; Alizadeh, Darya; Zhang, Leying; Manohara, Harish M; Bronikowski, Michael J; Badie, Behnam

2010-01-01

Nanomedicine is a growing field with a great potential for introducing new generation of targeted and personalized drug. Amongst new generation of nano-vectors are carbon nanotubes (CNTs), which can be produced as single or multi-walled. Multi-walled carbon nanotubes (MWCNTs) can be fabricated as biocompatible nanostructures (cylindrical bulky tubes). These structures are currently under investigation for their application in nanomedicine as viable and safe nanovectors for gene and drug delivery. In this chapter, we will provide you with the necessary information to understand the synthesis of MWCNTs, functionalization, PKH26 labeling, RNAi, and DNA loading for in vitro experimentation and in vivo implantation of labeled MWCNT in mice as well as materials used in this experimentation. We used this technique to manipulate microglia as part of a novel application for the brain cancer immunotherapy. Our published data show this is a promising technique for labeling, and gene and drug delivery into microglia.

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Identification and Functional Characterization of a Tonoplast Dicarboxylate Transporter in Tomato (Solanum lycopersicum)

PubMed Central

Liu, Ruiling; Li, Boqiang; Qin, Guozheng; Zhang, Zhanquan; Tian, Shiping

2017-01-01

Acidity plays an important role in flavor and overall organoleptic quality of fruit and is mainly due to the presence of organic acids. Understanding the molecular basis of organic acid metabolism is thus of primary importance for fruit quality improvement. Here, we cloned a putative tonoplast dicarboxylate transporter gene (SlTDT) from tomato, and submitted it to the NCBI database (GenBank accession number: KC733165). SlTDT protein contained 13 putative transmembrane domains in silico analysis. Confocal microscopic study using green fluorescent fusion proteins revealed that SlTDT was localized on tonoplast. The expression patterns of SlTDT in tomato were analyzed by RT-qPCR. The results indicated that SlTDT expressed in leaves, roots, flowers and fruits at different ripening stages, suggesting SlTDT may be associated with the development of different tissues. To further explore the function of SlTDT, we constructed both overexpression and RNAi vectors and obtained transgenic tomato plants by agrobacterium-mediated method. Gas chromatography-mass spectrometer (GC-MS) analysis showed that overexpression of SlTDT significantly increased malate content, and reduced citrate content in tomato fruit. By contrast, repression of SlTDT in tomato reduced malate content of and increased citrate content. These results indicated that SlTDT played an important role in remobilization of malate and citrate in fruit vacuoles. PMID:28261242

Identification and Functional Characterization of a Tonoplast Dicarboxylate Transporter in Tomato (Solanum lycopersicum).

PubMed

Liu, Ruiling; Li, Boqiang; Qin, Guozheng; Zhang, Zhanquan; Tian, Shiping

2017-01-01

Acidity plays an important role in flavor and overall organoleptic quality of fruit and is mainly due to the presence of organic acids. Understanding the molecular basis of organic acid metabolism is thus of primary importance for fruit quality improvement. Here, we cloned a putative tonoplast dicarboxylate transporter gene ( SlTDT ) from tomato, and submitted it to the NCBI database (GenBank accession number: KC733165). SlTDT protein contained 13 putative transmembrane domains in silico analysis. Confocal microscopic study using green fluorescent fusion proteins revealed that SlTDT was localized on tonoplast. The expression patterns of SlTDT in tomato were analyzed by RT-qPCR. The results indicated that SlTDT expressed in leaves, roots, flowers and fruits at different ripening stages, suggesting SlTDT may be associated with the development of different tissues. To further explore the function of SlTDT , we constructed both overexpression and RNAi vectors and obtained transgenic tomato plants by agrobacterium-mediated method. Gas chromatography-mass spectrometer (GC-MS) analysis showed that overexpression of SlTDT significantly increased malate content, and reduced citrate content in tomato fruit. By contrast, repression of SlTDT in tomato reduced malate content of and increased citrate content. These results indicated that SlTDT played an important role in remobilization of malate and citrate in fruit vacuoles.

Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera.

PubMed

Wang, Lin; Tang, Nan; Gao, Xinlei; Guo, Dongyang; Chang, Zhaoxia; Fu, Yating; Akinyemi, Ibukun A; Wu, Qingfa

2016-11-02

Sogatella furcifera, the white-backed planthopper (WBPH), has become one of the most destructive pests in rice production owing to its plant sap-sucking behavior and efficient transmission of Southern rice black-streaked dwarf virus (SRBSDV) in a circulative, propagative and persistent manner. The dynamic and complex SRBSDV-WBPH-rice plant interaction is still poorly understood. In this study, based on a homology-based genome-wide analysis, 348 immune-related genes belonging to 28 families were identified in WBPH. A transcriptome analysis of non-viruliferous (NVF) and viruliferous groups with high viral titers (HVT) and median viral titers (MVT) revealed that feeding on SRBSDV-infected rice plants has a significant impact on gene expression, regardless of viral titers in insects. We identified 278 up-regulated and 406 down-regulated genes shared among the NVF, MVT, and HVT groups and detected significant down-regulation of primary metabolism-related genes and oxidoreductase. In viruliferous WBPH with viral titer-specific transcriptome changes, 1,906 and 1,467 genes exhibited strict monotonically increasing and decreasing expression, respectively. The RNAi pathway was the major antiviral response to increasing viral titers among diverse immune responses. These results clarify the responses of immune genes and the transcriptome of WBPH to SRBSDV and improve our knowledge of the functional relationship between pathogen, vector, and host.

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

Ribonucleic acid interference (RNAi) and control of citrus pests

USDA-ARS?s Scientific Manuscript database

Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...

RNAi therapeutics for brain cancer: current advancements in RNAi delivery strategies.

PubMed

Malhotra, Meenakshi; Toulouse, André; Godinho, Bruno M D C; Mc Carthy, David John; Cryan, John F; O'Driscoll, Caitriona M

2015-10-01

Malignant primary brain tumors are aggressive cancerous cells that invade the surrounding tissues of the central nervous system. The current treatment options for malignant brain tumors are limited due to the inability to cross the blood-brain barrier. The advancements in current research has identified and characterized certain molecular markers that are essential for tumor survival, progression, metastasis and angiogenesis. These molecular markers have served as therapeutic targets for the RNAi based therapies, which enable site-specific silencing of the gene responsible for tumor proliferation. However, to bring about therapeutic success, an efficient delivery carrier that can cross the blood-brain barrier and reach the targeted site is essential. The current review focuses on the potential of targeted, non-viral and viral particles containing RNAi therapeutic molecules as delivery strategies specifically for brain tumors.

RNAi of COL1A1 in mesenchymal progenitor cells.

PubMed

Millington-Ward, Sophia; McMahon, Helena P; Allen, Danny; Tuohy, Gearóid; Kiang, Anna-Sophia; Palfi, Arpad; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

2004-10-01

Given that mutant COL1A1 is known to cause Osteogenesis Imperfecta (OI), tools to modulate COL1A1 expression are likely to be of significant therapeutic value. In this context, we have evaluated RNA interference (RNAi) as a means to downregulate COL1A1 expression in Cos-7 cells and in human mesenchymal progenitor stem cells (MPCs), the latter cells giving rise to bone and therefore representing a target cell type for collagen-related disorders. In addition, allele-specificity, a key factor to the success of RNAi-based suppression, was explored with a view to developing a mutation-independent RNAi-based therapeutic for OI by targeting an intragenic SNP within transcripts derived from the COL1A1 gene. Preferential suppression of individual polymorphic alleles that differed by a single nucleotide was observed.

Analysis of Variability in HIV-1 Subtype A Strains in Russia Suggests a Combination of Deep Sequencing and Multitarget RNA Interference for Silencing of the Virus.

PubMed

Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A

2017-02-01

Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.

Leg regeneration is epigenetically regulated by histone H3K27 methylation in the cricket Gryllus bimaculatus.

PubMed

Hamada, Yoshimasa; Bando, Tetsuya; Nakamura, Taro; Ishimaru, Yoshiyasu; Mito, Taro; Noji, Sumihare; Tomioka, Kenji; Ohuchi, Hideyo

2015-09-01

Hemimetabolous insects such as the cricket Gryllus bimaculatus regenerate lost tissue parts using blastemal cells, a population of dedifferentiated proliferating cells. The expression of several factors that control epigenetic modification is upregulated in the blastema compared with differentiated tissue, suggesting that epigenetic changes in gene expression might control the differentiation status of blastema cells during regeneration. To clarify the molecular basis of epigenetic regulation during regeneration, we focused on the function of the Gryllus Enhancer of zeste [Gb'E(z)] and Ubiquitously transcribed tetratricopeptide repeat gene on the X chromosome (Gb'Utx) homologues, which regulate methylation and demethylation of histone H3 lysine 27 (H3K27), respectively. Methylated histone H3K27 in the regenerating leg was diminished by Gb'E(z)(RNAi) and was increased by Gb'Utx(RNAi). Regenerated Gb'E(z)(RNAi) cricket legs exhibited extra leg segment formation between the tibia and tarsus, and regenerated Gb'Utx(RNAi) cricket legs showed leg joint formation defects in the tarsus. In the Gb'E(z)(RNAi) regenerating leg, the Gb'dac expression domain expanded in the tarsus. By contrast, in the Gb'Utx(RNAi) regenerating leg, Gb'Egfr expression in the middle of the tarsus was diminished. These results suggest that regulation of the histone H3K27 methylation state is involved in the repatterning process during leg regeneration among cricket species via the epigenetic regulation of leg patterning gene expression. © 2015. Published by The Company of Biologists Ltd.

Dissecting the function of Cullin-RING ubiquitin ligase complex genes in planarian regeneration.

PubMed

Strand, Nicholas S; Allen, John M; Ghulam, Mahjoobah; Taylor, Matthew R; Munday, Roma K; Carrillo, Melissa; Movsesyan, Artem; Zayas, Ricardo M

2018-01-15

The ubiquitin system plays a role in nearly every aspect of eukaryotic cell biology. The enzymes responsible for transferring ubiquitin onto specific substrates are the E3 ubiquitin ligases, a large and diverse family of proteins, for which biological roles and target substrates remain largely undefined. Studies using model organisms indicate that ubiquitin signaling mediates key steps in developmental processes and tissue regeneration. Here, we used the freshwater planarian, Schmidtea mediterranea, to investigate the role of Cullin-RING ubiquitin ligase (CRL) complexes in stem cell regulation during regeneration. We identified six S. mediterranea cullin genes, and used RNAi to uncover roles for homologs of Cullin-1, -3 and -4 in planarian regeneration. The cullin-1 RNAi phenotype included defects in blastema formation, organ regeneration, lesions, and lysis. To further investigate the function of cullin-1-mediated cellular processes in planarians, we examined genes encoding the adaptor protein Skp1 and F-box substrate-recognition proteins that are predicted to partner with Cullin-1. RNAi against skp1 resulted in phenotypes similar to cullin-1 RNAi, and an RNAi screen of the F-box genes identified 19 genes that recapitulated aspects of cullin-1 RNAi, including ones that in mammals are involved in stem cell regulation and cancer biology. Our data provides evidence that CRLs play discrete roles in regenerative processes and provide a platform to investigate how CRLs regulate stem cells in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

A Perspective on the Future of High-Throughput RNAi Screening: Will CRISPR Cut Out the Competition or Can RNAi Help Guide the Way?

PubMed

Taylor, Jessica; Woodcock, Simon

2015-09-01

For more than a decade, RNA interference (RNAi) has brought about an entirely new approach to functional genomics screening. Enabling high-throughput loss-of-function (LOF) screens against the human genome, identifying new drug targets, and significantly advancing experimental biology, RNAi is a fast, flexible technology that is compatible with existing high-throughput systems and processes; however, the recent advent of clustered regularly interspaced palindromic repeats (CRISPR)-Cas, a powerful new precise genome-editing (PGE) technology, has opened up vast possibilities for functional genomics. CRISPR-Cas is novel in its simplicity: one piece of easily engineered guide RNA (gRNA) is used to target a gene sequence, and Cas9 expression is required in the cells. The targeted double-strand break introduced by the gRNA-Cas9 complex is highly effective at removing gene expression compared to RNAi. Together with the reduced cost and complexity of CRISPR-Cas, there is the realistic opportunity to use PGE to screen for phenotypic effects in a total gene knockout background. This review summarizes the exciting development of CRISPR-Cas as a high-throughput screening tool, comparing its future potential to that of well-established RNAi screening techniques, and highlighting future challenges and opportunities within these disciplines. We conclude that the two technologies actually complement rather than compete with each other, enabling greater understanding of the genome in relation to drug discovery. © 2015 Society for Laboratory Automation and Screening.

Silencing of OsGRX17 in rice improves drought stress tolerance by modulating ROS accumulation and stomatal closure

USDA-ARS?s Scientific Manuscript database

Glutaredoxins (GRXs) have emerged as key mediators in plant responses to environmental stimuli by modulating redox-dependent signaling pathways. Here, we report that RNAi-mediated suppression of the rice gene OsGRXS17, encoding a monothiol GRX with a CGFS-type active site motif, elevates H2O2 produc...

Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

PubMed Central

De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

2006-01-01

RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

Evolution of animal and plant dicers: early parallel duplications and recurrent adaptation of antiviral RNA binding in plants.

PubMed

Mukherjee, Krishanu; Campos, Henry; Kolaczkowski, Bryan

2013-03-01

RNA interference (RNAi) is a eukaryotic molecular system that serves two primary functions: 1) gene regulation and 2) protection against selfish elements such as viruses and transposable DNA. Although the biochemistry of RNAi has been detailed in model organisms, very little is known about the broad-scale patterns and forces that have shaped RNAi evolution. Here, we provide a comprehensive evolutionary analysis of the Dicer protein family, which carries out the initial RNA recognition and processing steps in the RNAi pathway. We show that Dicer genes duplicated and diversified independently in early animal and plant evolution, coincident with the origins of multicellularity. We identify a strong signature of long-term protein-coding adaptation that has continually reshaped the RNA-binding pocket of the plant Dicer responsible for antiviral immunity, suggesting an evolutionary arms race with viral factors. We also identify key changes in Dicer domain architecture and sequence leading to specialization in either gene-regulatory or protective functions in animal and plant paralogs. As a whole, these results reveal a dynamic picture in which the evolution of Dicer function has driven elaboration of parallel RNAi functional pathways in animals and plants.

RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

PubMed

Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

2017-01-01

Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.

PubMed

Smith, Ian; Greenside, Peyton G; Natoli, Ted; Lahr, David L; Wadden, David; Tirosh, Itay; Narayan, Rajiv; Root, David E; Golub, Todd R; Subramanian, Aravind; Doench, John G

2017-11-01

The application of RNA interference (RNAi) to mammalian cells has provided the means to perform phenotypic screens to determine the functions of genes. Although RNAi has revolutionized loss-of-function genetic experiments, it has been difficult to systematically assess the prevalence and consequences of off-target effects. The Connectivity Map (CMAP) represents an unprecedented resource to study the gene expression consequences of expressing short hairpin RNAs (shRNAs). Analysis of signatures for over 13,000 shRNAs applied in 9 cell lines revealed that microRNA (miRNA)-like off-target effects of RNAi are far stronger and more pervasive than generally appreciated. We show that mitigating off-target effects is feasible in these datasets via computational methodologies to produce a consensus gene signature (CGS). In addition, we compared RNAi technology to clustered regularly interspaced short palindromic repeat (CRISPR)-based knockout by analysis of 373 single guide RNAs (sgRNAs) in 6 cells lines and show that the on-target efficacies are comparable, but CRISPR technology is far less susceptible to systematic off-target effects. These results will help guide the proper use and analysis of loss-of-function reagents for the determination of gene function.

Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella

PubMed Central

Hameed, Muhammad Salman; Wang, Zhengbing; Yang, Guang

2018-01-01

Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella (PxAgo3) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella. PMID:29677157

Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella.

PubMed

Hameed, Muhammad Salman; Wang, Zhengbing; Vasseur, Liette; Yang, Guang

2018-04-20

Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella ( PxAgo3 ) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella .

RNA interference-mediated intrinsic antiviral immunity in invertebrates.

PubMed

Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

2013-01-01

In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

RNAiFold2T: Constraint Programming design of thermo-IRES switches.

PubMed

Garcia-Martin, Juan Antonio; Dotu, Ivan; Fernandez-Chamorro, Javier; Lozano, Gloria; Ramajo, Jorge; Martinez-Salas, Encarnacion; Clote, Peter

2016-06-15

RNA thermometers (RNATs) are cis-regulatory elements that change secondary structure upon temperature shift. Often involved in the regulation of heat shock, cold shock and virulence genes, RNATs constitute an interesting potential resource in synthetic biology, where engineered RNATs could prove to be useful tools in biosensors and conditional gene regulation. Solving the 2-temperature inverse folding problem is critical for RNAT engineering. Here we introduce RNAiFold2T, the first Constraint Programming (CP) and Large Neighborhood Search (LNS) algorithms to solve this problem. Benchmarking tests of RNAiFold2T against existent programs (adaptive walk and genetic algorithm) inverse folding show that our software generates two orders of magnitude more solutions, thus allowing ample exploration of the space of solutions. Subsequently, solutions can be prioritized by computing various measures, including probability of target structure in the ensemble, melting temperature, etc. Using this strategy, we rationally designed two thermosensor internal ribosome entry site (thermo-IRES) elements, whose normalized cap-independent translation efficiency is approximately 50% greater at 42 °C than 30 °C, when tested in reticulocyte lysates. Translation efficiency is lower than that of the wild-type IRES element, which on the other hand is fully resistant to temperature shift-up. This appears to be the first purely computational design of functional RNA thermoswitches, and certainly the first purely computational design of functional thermo-IRES elements. RNAiFold2T is publicly available as part of the new release RNAiFold3.0 at https://github.com/clotelab/RNAiFold and http://bioinformatics.bc.edu/clotelab/RNAiFold, which latter has a web server as well. The software is written in C ++ and uses OR-Tools CP search engine. clote@bc.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Lentivirus-mediated silencing of the PTC1 and PTC2 genes promotes recovery from spinal cord injury by activating the Hedgehog signaling pathway in a rat model.

PubMed

Zhang, Ya-Dong; Zhu, Zhong-Sheng; Zhang, Dong; Zhang, Zhen; Ma, Bin; Zhao, Shi-Chang; Xue, Feng

2017-12-15

This study aimed to investigate the effect of Patched-1 (PTC1) and PTC2 silencing in a rat model, on Hedgehog (Hh) pathway-mediated recovery from spinal cord injury (SCI). An analytical emphasis on the relationship between the sonic hedgehog (Shh) pathway and nerve regeneration was explored. A total of 126 rats were divided into normal, sham, SCI, negative control (NC), PTC1-RNAi, PTC2-RNAi and PTC1/PTC2-RNAi groups. The Basso, Beattie and Bresnahan (BBB) scale was employed to assess hind limb motor function. Quantitative real-time polymerase chain reaction and western blotting were performed to examine the mRNA and protein levels of PTC1, PTC2, Shh, glioma-associated oncogene homolog 1 (Gli-1), Smo and Nestin. Tissue morphology was analyzed using immunohistochemistry, and immunofluorescent staining was conducted to detect neurofilament protein 200 (NF-200) and glial fibrillary acidic protein (GFAP). The PTC1/PTC2-RNAi group displayed higher BBB scores than the SCI and NC groups. Shh, Gli-1, Smo and Nestin expression levels were elevated in the PTC1/PTC2-RNAi group. PTC1 and PTC2 mRNA and protein expression was lower in the PTC1/PTC2-RNAi group than in the normal, sham and SCI groups. Among the seven groups, the PTC1/PTC2-RNAi group had the largest positive area of NF-200 staining, whereas the SCI group exhibited a larger GFAP-positive area than both the normal and the sham groups. The Shh pathway may provide new insights into therapeutic indications and regenerative recovery tools for the treatment of SCI. Activation of the Hh signaling pathway by silencing PTC1 and PTC2 may reduce inflammation and may ultimately promote SCI recovery.

Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube

USDA-ARS?s Scientific Manuscript database

RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....

Biosafety research for non-target organism risk assessment of RNAi-based GE plants

PubMed Central

Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo

2015-01-01

RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

RDE-1 slicer activity is required only for passenger-strand cleavage during RNAi in Caenorhabditis elegans.

PubMed

Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F

2009-02-01

RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.

Recent advances in therapeutic recruitment of mammalian RNAi and bacterial CRISPR-Cas DNA interference pathways as emerging antiviral strategies.

PubMed

Chin, Wei-Xin; Ang, Swee Kim; Chu, Justin Jang Hann

2017-01-01

In invertebrate eukaryotes and prokaryotes, respectively, the RNAi and clustered regularly interspaced short palindromic repeats-CRISPR-associated (CRISPR-Cas) pathways are highly specific and efficient RNA and DNA interference systems, and are well characterised as potent antiviral systems. It has become possible to recruit or reconstitute these pathways in mammalian cells, where they can be directed against desired host or viral targets. The RNAi and CRISPR-Cas systems can therefore yield ideal antiviral therapeutics, capable of specific and efficient viral inhibition with minimal off-target effects, but development of such therapeutics can be slow. This review covers recent advances made towards developing RNAi or CRISPR-Cas strategies for clinical use. These studies address the delivery, toxicity or target design issues that typically plague the in vivo or clinical use of these technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix.

PubMed

Arakane, Y; Muthukrishnan, S; Kramer, K J; Specht, C A; Tomoyasu, Y; Lorenzen, M D; Kanost, M; Beeman, R W

2005-10-01

Functional analysis of the two chitin synthase genes, TcCHS1 and TcCHS2, in the red flour beetle, Tribolium castaneum, revealed unique and complementary roles for each gene. TcCHS1-specific RNA interference (RNAi) disrupted all three types of moult (larval-larval, larval-pupal and pupal-adult) and greatly reduced whole-body chitin content. Exon-specific RNAi showed that splice variant 8a of TcCHS1 was required for both the larval-pupal and pupal-adult moults, whereas splice variant 8b was required only for the latter. TcCHS2-specific RNAi had no effect on metamorphosis or on total body chitin content. However, RNAi-mediated down-regulation of TcCHS2, but not TcCHS1, led to cessation of feeding, a dramatic shrinkage in larval size and reduced chitin content in the midgut.

In vivo RNAi in the Drosophila Follicular Epithelium: Analysis of Stem Cell Maintenance, Proliferation, and Differentiation.

PubMed

Riechmann, Veit

2017-01-01

In vivo RNAi in Drosophila facilitates simple and rapid analysis of gene functions in a cell- or tissue-specific manner. The versatility of the UAS-GAL4 system allows to control exactly where and when during development the function of a gene is depleted. The epithelium of the ovary is a particularly good model to study in a living animal how stem cells are maintained and how their descendants proliferate and differentiate. Here I provide basic information about the publicly available reagents for in vivo RNAi, and I describe how the oogenesis system can be applied to analyze stem cells and epithelial development at a histological level. Moreover, I give helpful hints to optimize the use of the UAS-GAL4 system for RNAi induction in the follicular epithelium. Finally, I provide detailed step-by-step protocols for ovary dissection, antibody stainings, and ovary mounting for microscopic analysis.

Downregulation of GAUT12 in Populus deltoides by RNA silencing results in reduced recalcitrance, increased growth and reduced xylan and pectin in a woody biofuel feedstock

DOE PAGES

Biswal, Ajaya K.; Hao, Zhangying; Pattathil, Sivakumar; ...

2015-03-12

The inherent recalcitrance of woody bioenergy feedstocks is a major challenge for their use as a source of second-generation biofuel. Secondary cell walls that constitute the majority of hardwood biomass are rich in cellulose, xylan, and lignin. The interactions among these polymers prevent facile accessibility and deconstruction by enzymes and chemicals. Plant biomass that can with minimal pretreatment be degraded into sugars is required to produce renewable biofuels in a cost-effective manner. The following are the results: GAUT12/IRX8 is a putative glycosyltransferase proposed to be involved in secondary cell wall glucuronoxylan and/or pectin biosynthesis based on concomitant reductions of bothmore » xylan and the pectin homogalacturonan (HG) in Arabidopsis irx8 mutants. Two GAUT12 homologs exist in Populus trichocarpa, PtGAUT12.1 and PtGAUT12.2. Knockdown expression of both genes simultaneously has been shown to reduce xylan content in Populus wood. We tested the proposition that RNA interference (RNAi) downregulation of GAUT12.1 alone would lead to increased sugar release in Populus wood, that is, reduced recalcitrance, based on the hypothesis that GAUT12 synthesizes a wall structure required for deposition of xylan and that cell walls with less xylan and/or modified cell wall architecture would have reduced recalcitrance. Using an RNAi approach, we generated 11 Populus deltoides transgenic lines with 50 to 67% reduced PdGAUT12.1 transcript expression compared to wild type (WT) and vector controls. Ten of the eleven RNAi lines yielded 4 to 8% greater glucose release upon enzymatic saccharification than the controls. The PdGAUT12.1 knockdown (PdGAUT12.1-KD) lines also displayed 12 to 52% and 12 to 44% increased plant height and radial stem diameter, respectively, compared to the controls. Knockdown of PdGAUT12.1 resulted in a 25 to 47% reduction in galacturonic acid and 17 to 30% reduction in xylose without affecting total lignin content, revealing that in Populus wood as in Arabidopsis, GAUT12 affects both pectin and xylan formation. Finally, analyses of the sugars present in sequential cell wall extracts revealed a reduction of glucuronoxylan and pectic HG and rhamnogalacturonan in extracts from PdGAUT12.1-KD lines.« less

Small RNA Regulators of Plant-Hemipteran Interactions: Micromanagers with Versatile Roles

PubMed Central

Sattar, Sampurna; Thompson, Gary A.

2016-01-01

Non-coding small RNAs (sRNAs) in plants have important roles in regulating biological processes, including development, reproduction, and stress responses. Recent research indicates significant roles for sRNA-mediated gene silencing during plant-hemipteran interactions that involve all three of these biological processes. Plant responses to hemipteran feeding are determined by changes in the host transcriptome that appear to be fine-tuned by sRNAs. The role of sRNA in plant defense responses is complex. Different forms of sRNAs, with specific modes of action, regulate changes in the host transcriptome primarily through post-transcriptional gene silencing and occasionally through translational repression. Plant genetic resistance against hemipterans provides a model to explore the regulatory roles of sRNAs in plant defense. Aphid-induced sRNA expression in resistance genotypes delivers a new paradigm in understanding the regulation of R gene-mediated resistance in host plants. Unique sRNA profiles, including changes in sRNA biogenesis and expression can also provide insights into susceptibility to insect herbivores. Activation of phytohormone-mediated defense responses against insect herbivory is another hallmark of this interaction, and recent studies have shown that regulation of phytohormone signaling is under the control of sRNAs. Hemipterans feeding on resistant plants also show changes in insect sRNA profiles, possibly influencing insect development and reproduction. Changes in insect traits such as fecundity, host range, and resistance to insecticides are impacted by sRNAs and can directly contribute to the success of certain insect biotypes. In addition to causing direct damage to the host plant, hemipteran insects are often vectors of viral pathogens. Insect anti-viral RNAi machinery is activated to limit virus accumulation, suggesting a role in insect immunity. Virus-derived long sRNAs strongly resemble insect piRNAs, leading to the speculation that the piRNA pathway is induced in response to viral infection. Evidence for robust insect RNAi machinery in several hemipteran species is of immense interest and is being actively pursued as a possible tool for insect control. RNAi-induced gene silencing following uptake of exogenous dsRNA was successfully demonstrated in several hemipterans and the presence of sid-1 like genes support the concept of a systemic response in some species. PMID:27625654

The reference transcriptome of the adult female biting midge (Culicoides sonorensis) and differential gene expression profiling during teneral, blood, and sucrose feeding conditions.

PubMed

Nayduch, Dana; Lee, Matthew B; Saski, Christopher A

2014-01-01

Unlike other important vectors such as mosquitoes and sandflies, genetic and genomic tools for Culicoides biting midges are lacking, despite the fact that they vector a large number of arboviruses and other pathogens impacting humans and domestic animals world-wide. In North America, female Culicoides sonorensis midges are important vectors of bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV), orbiviruses that cause significant disease in livestock and wildlife. Libraries of tissue-specific transcripts expressed in response to feeding and oral orbivirus challenge in C. sonorensis have previously been reported, but extensive genome-wide expression profiling in the midge has not. Here, we successfully used deep sequencing technologies to construct the first adult female C. sonorensis reference transcriptome, and utilized genome-wide expression profiling to elucidate the genetic response to blood and sucrose feeding over time. The adult female midge unigene consists of 19,041 genes, of which less than 7% are differentially expressed during the course of a sucrose meal, while up to 52% of the genes respond significantly in blood-fed midges, indicating hematophagy induces complex physiological processes. Many genes that were differentially expressed during blood feeding were associated with digestion (e.g. proteases, lipases), hematophagy (e.g., salivary proteins), and vitellogenesis, revealing many major metabolic and biological factors underlying these critical processes. Additionally, key genes in the vitellogenesis pathway were identified, which provides the first glimpse into the molecular basis of anautogeny for C. sonorensis. This is the first extensive transcriptome for this genus, which will serve as a framework for future expression studies, RNAi, and provide a rich dataset contributing to the ultimate goal of informing a reference genome assembly and annotation. Moreover, this study will serve as a foundation for subsequent studies of genome-wide expression analyses during early orbivirus infection and dissecting the molecular mechanisms behind vector competence in midges.

Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

PubMed Central

Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

2013-01-01

Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

PubMed

Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

2016-12-05

Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

Suppression of Chloroplastic Alkenal/One Oxidoreductase Represses the Carbon Catabolic Pathway in Arabidopsis Leaves during Night1[OPEN

PubMed Central

Ifuku, Kentaro; Ikeda, Ken-ichi; Inoue, Kanako Ikeda; Park, Pyoyun; Tamoi, Masahiro; Inoue, Hironori; Sakamoto, Katsuhiko; Saito, Ryota

2016-01-01

Lipid-derived reactive carbonyl species (RCS) possess electrophilic moieties and cause oxidative stress by reacting with cellular components. Arabidopsis (Arabidopsis thaliana) has a chloroplast-localized alkenal/one oxidoreductase (AtAOR) for the detoxification of lipid-derived RCS, especially α,β-unsaturated carbonyls. In this study, we aimed to evaluate the physiological importance of AtAOR and analyzed AtAOR (aor) mutants, including a transfer DNA knockout, aor (T-DNA), and RNA interference knockdown, aor (RNAi), lines. We found that both aor mutants showed smaller plant sizes than wild-type plants when they were grown under day/night cycle conditions. To elucidate the cause of the aor mutant phenotype, we analyzed the photosynthetic rate and the respiration rate by gas-exchange analysis. Subsequently, we found that both wild-type and aor (RNAi) plants showed similar CO2 assimilation rates; however, the respiration rate was lower in aor (RNAi) than in wild-type plants. Furthermore, we revealed that phosphoenolpyruvate carboxylase activity decreased and starch degradation during the night was suppressed in aor (RNAi). In contrast, the phenotype of aor (RNAi) was rescued when aor (RNAi) plants were grown under constant light conditions. These results indicate that the smaller plant sizes observed in aor mutants grown under day/night cycle conditions were attributable to the decrease in carbon utilization during the night. Here, we propose that the detoxification of lipid-derived RCS by AtAOR in chloroplasts contributes to the protection of dark respiration and supports plant growth during the night. PMID:26884484

Suppression of Chloroplastic Alkenal/One Oxidoreductase Represses the Carbon Catabolic Pathway in Arabidopsis Leaves during Night.

PubMed

Takagi, Daisuke; Ifuku, Kentaro; Ikeda, Ken-Ichi; Inoue, Kanako Ikeda; Park, Pyoyun; Tamoi, Masahiro; Inoue, Hironori; Sakamoto, Katsuhiko; Saito, Ryota; Miyake, Chikahiro

2016-04-01

Lipid-derived reactive carbonyl species (RCS) possess electrophilic moieties and cause oxidative stress by reacting with cellular components. Arabidopsis (Arabidopsis thaliana) has a chloroplast-localized alkenal/one oxidoreductase (AtAOR) for the detoxification of lipid-derived RCS, especially α,β-unsaturated carbonyls. In this study, we aimed to evaluate the physiological importance of AtAOR and analyzed AtAOR (aor) mutants, including a transfer DNA knockout, aor (T-DNA), and RNA interference knockdown, aor (RNAi), lines. We found that both aor mutants showed smaller plant sizes than wild-type plants when they were grown under day/night cycle conditions. To elucidate the cause of the aor mutant phenotype, we analyzed the photosynthetic rate and the respiration rate by gas-exchange analysis. Subsequently, we found that both wild-type and aor (RNAi) plants showed similar CO2 assimilation rates; however, the respiration rate was lower in aor (RNAi) than in wild-type plants. Furthermore, we revealed that phosphoenolpyruvate carboxylase activity decreased and starch degradation during the night was suppressed in aor (RNAi). In contrast, the phenotype of aor (RNAi) was rescued when aor (RNAi) plants were grown under constant light conditions. These results indicate that the smaller plant sizes observed in aor mutants grown under day/night cycle conditions were attributable to the decrease in carbon utilization during the night. Here, we propose that the detoxification of lipid-derived RCS by AtAOR in chloroplasts contributes to the protection of dark respiration and supports plant growth during the night. © 2016 American Society of Plant Biologists. All Rights Reserved.

Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

PubMed

Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

2015-10-08

Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and addressed the safety concerns of the marker genes in transgenic plants on the environments.

Selection of Reference Genes for RT-qPCR Analysis in Coccinella septempunctata to Assess Un-intended Effects of RNAi Transgenic Plants.

PubMed

Yang, Chunxiao; Preisser, Evan L; Zhang, Hongjun; Liu, Yong; Dai, Liangying; Pan, Huipeng; Zhou, Xuguo

2016-01-01

The development of genetically engineered plants that employ RNA interference (RNAi) to suppress invertebrate pests opens up new avenues for insect control. While this biotechnology shows tremendous promise, the potential for both non-target and off-target impacts, which likely manifest via altered mRNA expression in the exposed organisms, remains a major concern. One powerful tool for the analysis of these un-intended effects is reverse transcriptase-quantitative polymerase chain reaction, a technique for quantifying gene expression using a suite of reference genes for normalization. The seven-spotted ladybeetle Coccinella septempunctata , a commonly used predator in both classical and augmentative biological controls, is a model surrogate species used in the environmental risk assessment (ERA) of plant incorporated protectants (PIPs). Here, we assessed the suitability of eight reference gene candidates for the normalization and analysis of C. septempunctata v-ATPase A gene expression under both biotic and abiotic conditions. Five computational tools with distinct algorisms, geNorm, Normfinder, BestKeeper , the Δ C t method, and RefFinder , were used to evaluate the stability of these candidates. As a result, unique sets of reference genes were recommended, respectively, for experiments involving different developmental stages, tissues, and ingested dsRNAs. By providing a foundation for standardized RT-qPCR analysis in C. septempunctata , our work improves the accuracy and replicability of the ERA of PIPs involving RNAi transgenic plants.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

PubMed Central

2014-01-01

Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

Adenovirus Delivered Short Hairpin RNA Targeting a Conserved Site in the 5′ Non-Translated Region Inhibits All Four Serotypes of Dengue Viruses

PubMed Central

Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam

2012-01-01

Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.

PubMed

Kennedy, Lisa M; Grishok, Alla

2014-05-01

Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning.

Neuronal Migration Is Regulated by Endogenous RNAi and Chromatin-Binding Factor ZFP-1/AF10 in Caenorhabditis elegans

PubMed Central

Kennedy, Lisa M.; Grishok, Alla

2014-01-01

Endogenous short RNAs and the conserved plant homeodomain (PHD) zinc-finger protein ZFP-1/AF10 regulate overlapping sets of genes in Caenorhabditis elegans, which suggests that they control common biological pathways. We have shown recently that the RNAi factor RDE-4 and ZFP-1 negatively modulate transcription of the insulin/PI3 signaling-dependent kinase PDK-1 to promote C. elegans fitness. Moreover, we have demonstrated that the insulin/IGF-1-PI3K-signaling pathway regulates the activity of the DAF-16/FOXO transcription factor in the hypodermis to nonautonomously promote the anterior migrations of the hermaphrodite-specific neurons (HSNs) during embryogenesis of C. elegans. In this study, we implicate the PHD-containing isoform of ZFP-1 and endogenous RNAi in the regulation of HSN migration. ZFP-1 affects HSN migration in part through its negative effect on pdk-1 transcription and modulation of downstream DAF-16 activity. We also identify a novel role for ZFP-1 and RNAi pathway components, including RDE-4, in the regulation of HSN migration in parallel with DAF-16. Therefore, the coordinated activities of DAF-16, ZFP-1, and endogenous RNAi contribute to gene regulation during development to ensure proper neuronal positioning. PMID:24558261

The impact of HIV-1 genetic diversity on the efficacy of a combinatorial RNAi-based gene therapy.

PubMed

Herrera-Carrillo, E; Berkhout, B

2015-06-01

A hurdle for human immunodeficiency virus (HIV-1) therapy is the genomic diversity of circulating viruses and the possibility that drug-resistant virus variants are selected. Although RNA interference (RNAi) is a powerful tool to stably inhibit HIV-1 replication by the expression of antiviral short hairpin RNAs (shRNAs) in transduced T cells, this approach is also vulnerable to pre-existing genetic variation and the development of viral resistance through mutation. To prevent viral escape, we proposed to combine multiple shRNAs against important regions of the HIV-1 RNA genome, which should ideally be conserved in all HIV-1 subtypes. The vulnerability of RNAi therapy to viral escape has been studied for a single subtype B strain, but it is unclear whether the antiviral shRNAs can inhibit diverse virus isolates and subtypes, including drug-resistant variants that could be present in treated patients. To determine the breadth of the RNAi gene therapy approach, we studied the susceptibility of HIV-1 subtypes A-E and drug-resistant variants. In addition, we monitored the evolution of HIV-1 escape variants. We demonstrate that the combinatorial RNAi therapy is highly effective against most isolates, supporting the future testing of this gene therapy in appropriate in vivo models.

RNAi-mediated resistance against Cotton leaf curl disease in elite Indian cotton (Gossypium hirsutum) cultivar Narasimha.

PubMed

Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A

2016-08-01

Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.

Analysis of energetically biased transcripts of viruses and transposable elements

PubMed Central

Secolin, Rodrigo; Pascoal, Vinícius D’Ávila Bitencourt; Lopes-Cendes, Iscia; Pereira, Tiago Campos

2012-01-01

RNA interference (RNAi) is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs) are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC) in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC). Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs. PMID:23271949

Logic integration of mRNA signals by an RNAi-based molecular computer.

PubMed

Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

2010-05-01

Synthetic in vivo molecular 'computers' could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that 'transduce' mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi 'computational' module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting.

Logic integration of mRNA signals by an RNAi-based molecular computer

PubMed Central

Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

2010-01-01

Synthetic in vivo molecular ‘computers’ could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that ‘transduce’ mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi ‘computational’ module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting. PMID:20194121

iScreen: Image-Based High-Content RNAi Screening Analysis Tools.

PubMed

Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua

2015-09-01

High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.

RNAi Experiments in D. melanogaster: Solutions to the Overlooked Problem of Off-Targets Shared by Independent dsRNAs

PubMed Central

Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.

2010-01-01

Background RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or Caenorhabditis elegans, often large dsRNAs are used. One of the drawbacks of RNAi technology is that unwanted gene products with sequence similarity to the gene of interest can be down regulated too. To verify the outcome of an RNAi experiment and to avoid these unwanted off-target effects, an additional non-overlapping dsRNA can be used to down-regulate the same gene. However it has never been tested whether this approach is sufficient to reduce the risk of off-targets. Methodology We created a novel tool to analyse the occurance of off-target effects in Drosophila and we analyzed 99 randomly chosen genes. Principal Findings Here we show that nearly all genes contain non-overlapping internal sequences that do show overlap in a common off-target gene. Conclusion Based on our in silico findings, off-target effects should not be ignored and our presented on-line tool enables the identification of two RNA interference constructs, free of overlapping off-targets, from any gene of interest. PMID:20957038

The Caenorhabditis elegans rsd-2 and rsd-6 genes are required for chromosome functions during exposure to unfavorable environments.

PubMed

Han, Wang; Sundaram, Prema; Kenjale, Himanshu; Grantham, James; Timmons, Lisa

2008-04-01

In Caenorhabditis elegans, exogenous dsRNA can elicit systemic RNAi, a process that requires the function of many genes. Considering that the activities of many of these genes are also required for normal development, it is surprising that exposure to high concentrations of dsRNA does not elicit adverse consequences to animals. Here, we report inducible phenotypes in attenuated C. elegans strains reared in environments that include nonspecific dsRNA and elevated temperature. Under these conditions, chromosome integrity is compromised in RNAi-defective strains harboring mutations in rsd-2 or rsd-6. Specifically, rsd-2 mutants display defects in transposon silencing, while meiotic chromosome disjunction is affected in rsd-6 mutants. RSD-2 proteins localize to multiple cellular compartments, including the nucleolus and cytoplasmic compartments that, in part, are congruent with calreticulin and HAF-6. We considered that the RNAi defects in rsd-2 mutants might have relevance to membrane-associated functions; however, endomembrane compartmentalization and endocytosis/exocytosis markers in rsd-2 and rsd-6 mutants appear normal. The mutants also possess environmentally sensitive defects in cell-autonomous RNAi elicited from transgene-delivered dsRNAs. Thus, the ultimate functions of rsd-2 and rsd-6 in systemic RNAi are remarkably complex and environmentally responsive.

RNAiFold: a web server for RNA inverse folding and molecular design.

PubMed

Garcia-Martin, Juan Antonio; Clote, Peter; Dotu, Ivan

2013-07-01

Synthetic biology and nanotechnology are poised to make revolutionary contributions to the 21st century. In this article, we describe a new web server to support in silico RNA molecular design. Given an input target RNA secondary structure, together with optional constraints, such as requiring GC-content to lie within a certain range, requiring the number of strong (GC), weak (AU) and wobble (GU) base pairs to lie in a certain range, the RNAiFold web server determines one or more RNA sequences, whose minimum free-energy secondary structure is the target structure. RNAiFold provides access to two servers: RNA-CPdesign, which applies constraint programming, and RNA-LNSdesign, which applies the large neighborhood search heuristic; hence, it is suitable for larger input structures. Both servers can also solve the RNA inverse hybridization problem, i.e. given a representation of the desired hybridization structure, RNAiFold returns two sequences, whose minimum free-energy hybridization is the input target structure. The web server is publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold, which provides access to two specialized servers: RNA-CPdesign and RNA-LNSdesign. Source code for the underlying algorithms, implemented in COMET and supported on linux, can be downloaded at the server website.

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

New technology and resources for cryptococcal research

PubMed Central

Zhang, Nannan; Park, Yoon-Dong; Williamson, Peter R.

2014-01-01

Rapid advances in molecular biology and genome sequencing have enabled the generation of new technology and resources for cryptococcal research. RNAi-mediated specific gene knock down has become routine and more efficient by utilizing modified shRNA plasmids and convergent promoter RNAi constructs. This system was recently applied in a high-throughput screen to identify genes involved in host-pathogen interactions. Gene deletion efficiencies have also been improved by increasing rates of homologous recombination through a number of approaches, including a combination of double-joint PCR with split-marker transformation, the use of dominant selectable markers and the introduction of Cre-Loxp systems into Cryptococcus. Moreover, visualization of cryptococcal proteins has become more facile using fusions with codon-optimized fluorescent tags, such as green or red fluorescent proteins or, mCherry. Using recent genome-wide analytical tools, new transcriptional factors and regulatory proteins have been identified in novel virulence-related signaling pathways by employing microarray analysis, RNA-sequencing and proteomic analysis. PMID:25460849

Targeting Prostate Cancer with Multifunctional Nanoparticles

DTIC Science & Technology

2015-10-01

duplexes using Lipofectamine RNAiMAX (Invitrogen) as well as the appropriate controls including vehicle, non-targeting siRNA (siSC5) (negative...independent claudin-3 and claudin-4 siRNA duplexes using Lipofectamine RNAiMAX (Invitrogen). For these experiments we also included the appropriate

RNAi at work: Targeting invertebrate pests and beneficial organisms' diseases

USDA-ARS?s Scientific Manuscript database

Invertebrates present two types of large scale RNAi application opportunities: pest control and beneficial insect health. The former involves the introduction of sustainable applications to keep pest populations low, and the latter represents the challenge of keeping beneficial organisms healthy. RN...

Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid

USDA-ARS?s Scientific Manuscript database

Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....

Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy

PubMed Central

Miele, Evelina; Spinelli, Gian Paolo; Miele, Ermanno; Di Fabrizio, Enzo; Ferretti, Elisabetta; Tomao, Silverio; Gulino, Alberto

2012-01-01

During recent decades there have been remarkable advances and profound changes in cancer therapy. Many therapeutic strategies learned at the bench, including monoclonal antibodies and small molecule inhibitors, have been used at the bedside, leading to important successes. One of the most important advances in biology has been the discovery that small interfering RNA (siRNA) is able to regulate the expression of genes, by a phenomenon known as RNA interference (RNAi). RNAi is one of the most rapidly growing fields of research in biology and therapeutics. Much research effort has gone into the application of this new discovery in the treatment of various diseases, including cancer. However, even though these molecules may have potential and strong utility, some limitations make their clinical application difficult, including delivery problems, side effects due to off-target actions, disturbance of physiological functions of the cellular machinery involved in gene silencing, and induction of the innate immune response. Many researchers have attempted to overcome these limitations and to improve the safety of potential RNAi-based therapeutics. Nanoparticles, which are nanostructured entities with tunable size, shape, and surface, as well as biological behavior, provide an ideal opportunity to modify current treatment regimens in a substantial way. These nanoparticles could be designed to surmount one or more of the barriers encountered by siRNA. Nanoparticle drug formulations afford the chance to improve drug bioavailability, exploiting superior tissue permeability, payload protection, and the “stealth” features of these entities. The main aims of this review are: to explain the siRNA mechanism with regard to potential applications in siRNA-based cancer therapy; to discuss the possible usefulness of nanoparticle-based delivery of certain molecules for overcoming present therapeutic limitations; to review the ongoing relevant clinical research with its pitfalls and promises; and to evaluate critically future perspectives and challenges in siRNA-based cancer therapy. PMID:22915840

Complete In Vitro Life Cycle of Trypanosoma congolense: Development of Genetic Tools

PubMed Central

Plazolles, Nicolas; Baltz, Théo

2010-01-01

Background Animal African trypanosomosis, a disease mainly caused by the protozoan parasite Trypanosoma congolense, is a major constraint to livestock productivity and has a significant impact in the developing countries of Africa. RNA interference (RNAi) has been used to study gene function and identify drug and vaccine targets in a variety of organisms including trypanosomes. However, trypanosome RNAi studies have mainly been conducted in T. brucei, as a model for human infection, largely ignoring livestock parasites of economical importance such as T. congolense, which displays different pathogenesis profiles. The whole T. congolense life cycle can be completed in vitro, but this attractive model displayed important limitations: (i) genetic tools were currently limited to insect forms and production of modified infectious BSF through differentiation was never achieved, (ii) in vitro differentiation techniques lasted several months, (iii) absence of long-term bloodstream forms (BSF) in vitro culture prevented genomic analyses. Methodology/Principal Findings We optimized culture conditions for each developmental stage and secured the differentiation steps. Specifically, we devised a medium adapted for the strenuous development of stable long-term BSF culture. Using Amaxa nucleofection technology, we greatly improved the transfection rate of the insect form and designed an inducible transgene expression system using the IL3000 reference strain. We tested it by expression of reporter genes and through RNAi. Subsequently, we achieved the complete in vitro life cycle with dramatically shortened time requirements for various wild type and transgenic strains. Finally, we established the use of modified strains for experimental infections and underlined a host adaptation phase requirement. Conclusions/Significance We devised an improved T. congolense model, which offers the opportunity to perform functional genomics analyses throughout the whole life cycle. It represents a very useful tool to understand pathogenesis mechanisms and to study potential therapeutic targets either in vitro or in vivo using a mouse model. PMID:20209144

Ovary ecdysteroidogenic hormone requires a receptor tyrosine kinase to activate egg formation in the mosquito Aedes aegypti

PubMed Central

Vogel, Kevin J.; Brown, Mark R.; Strand, Michael R.

2015-01-01

Mosquitoes are major disease vectors because most species must feed on blood from a vertebrate host to produce eggs. Blood feeding by the vector mosquito Aedes aegypti triggers the release of two neurohormones, ovary ecdysteroidogenic hormone (OEH) and insulin-like peptides (ILPs), which activate multiple processes required for egg formation. ILPs function by binding to the insulin receptor, which activates downstream components in the canonical insulin signaling pathway. OEH in contrast belongs to a neuropeptide family called neuroparsins, whose receptor is unknown. Here we demonstrate that a previously orphanized receptor tyrosine kinase (RTK) from A. aegypti encoded by the gene AAEL001915 is an OEH receptor. Phylogenetic studies indicated that the protein encoded by this gene, designated AAEL001915, belongs to a clade of RTKs related to the insulin receptor, which are distinguished by an extracellular Venus flytrap module. Knockdown of AAEL001915 by RNAi disabled OEH-mediated egg formation in A. aegypti. AAEL001915 was primarily detected in the mosquito ovary in association with follicular epithelial cells. Both monomeric and dimeric AAEL001915 were detected in mosquito ovaries and transfected Drosophila S2 cells. Functional assays further indicated that OEH bound to dimeric AAEL001915, which resulted in downstream phosphorylation of Ak strain transforming factor (Akt). We hypothesize that orthologs of AAEL001915 in other insects are neuroparsin receptors. PMID:25848040

Ovary ecdysteroidogenic hormone requires a receptor tyrosine kinase to activate egg formation in the mosquito Aedes aegypti.

PubMed

Vogel, Kevin J; Brown, Mark R; Strand, Michael R

2015-04-21

Mosquitoes are major disease vectors because most species must feed on blood from a vertebrate host to produce eggs. Blood feeding by the vector mosquito Aedes aegypti triggers the release of two neurohormones, ovary ecdysteroidogenic hormone (OEH) and insulin-like peptides (ILPs), which activate multiple processes required for egg formation. ILPs function by binding to the insulin receptor, which activates downstream components in the canonical insulin signaling pathway. OEH in contrast belongs to a neuropeptide family called neuroparsins, whose receptor is unknown. Here we demonstrate that a previously orphanized receptor tyrosine kinase (RTK) from A. aegypti encoded by the gene AAEL001915 is an OEH receptor. Phylogenetic studies indicated that the protein encoded by this gene, designated AAEL001915, belongs to a clade of RTKs related to the insulin receptor, which are distinguished by an extracellular Venus flytrap module. Knockdown of AAEL001915 by RNAi disabled OEH-mediated egg formation in A. aegypti. AAEL001915 was primarily detected in the mosquito ovary in association with follicular epithelial cells. Both monomeric and dimeric AAEL001915 were detected in mosquito ovaries and transfected Drosophila S2 cells. Functional assays further indicated that OEH bound to dimeric AAEL001915, which resulted in downstream phosphorylation of Ak strain transforming factor (Akt). We hypothesize that orthologs of AAEL001915 in other insects are neuroparsin receptors.

RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

PubMed Central

van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

2018-01-01

To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

PubMed

Rotenberg, D; Whitfield, A E

2010-08-01

Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

RNA Interference Directed against the Transglutaminase Gene Triggers Dysbiosis of Gut Microbiota in Drosophila*

PubMed Central

Sekihara, Sanae; Shibata, Toshio; Hyakkendani, Mai; Kawabata, Shun-ichiro

2016-01-01

We recently reported that transglutaminase (TG) suppresses immune deficiency pathway-controlled antimicrobial peptides (IMD-AMPs), thereby conferring immune tolerance to gut microbes, and that RNAi of the TG gene in flies decreases the lifespan compared with non-TG-RNAi flies. Here, analysis of the bacterial composition of the Drosophila gut by next-generation sequencing revealed that gut microbiota comprising one dominant genus of Acetobacter in non-TG-RNAi flies was shifted to that comprising two dominant genera of Acetobacter and Providencia in TG-RNAi flies. Four bacterial strains, including Acetobacter persici SK1 and Acetobacter indonesiensis SK2, Lactobacillus pentosus SK3, and Providencia rettgeri SK4, were isolated from the midgut of TG-RNAi flies. SK1 exhibited the highest resistance to the IMD-AMPs Cecropin A1 and Diptericin among the isolated bacteria. In contrast, SK4 exhibited considerably lower resistance against Cecropin A1, whereas SK4 exhibited high resistance to hypochlorous acid. The resistance of strains SK1–4 against IMD-AMPs in in vitro assays could not explain the shift of the microbiota in the gut of TG-RNAi flies. The lifespan was reduced in gnotobiotic flies that ingested both SK4 and SK1, concomitant with the production of reactive oxygen species and apoptosis in the midgut, whereas the survival rate was not altered in gnotobiotic flies that mono-ingested either SK4 or SK1. Interestingly, significant amounts of reactive oxygen species were detected in the midgut of gnotobiotic flies that ingested SK4 and SK2, concomitant with no significant apoptosis in the midgut. In gnotobiotic flies that co-ingested SK4 and SK1, an additional unknown factor(s) may be required to cause midgut apoptosis. PMID:27760824

The tonoplast-localized sucrose transporter in Populus (PtaSUT4) regulates whole-plant water relations, responses to water stress, and photosynthesis.

PubMed

Frost, Christopher J; Nyamdari, Batbayar; Tsai, Chung-Jui; Harding, Scott A

2012-01-01

The Populus sucrose (Suc) transporter 4 (PtaSUT4), like its orthologs in other plant taxa, is tonoplast localized and thought to mediate Suc export from the vacuole into the cytosol. In source leaves of Populus, SUT4 is the predominantly expressed gene family member, with transcript levels several times higher than those of plasma membrane SUTs. A hypothesis is advanced that SUT4-mediated tonoplast sucrose fluxes contribute to the regulation of osmotic gradients between cellular compartments, with the potential to mediate both sink provisioning and drought tolerance in Populus. Here, we describe the effects of PtaSUT4-RNA interference (RNAi) on sucrose levels and raffinose family oligosaccharides (RFO) induction, photosynthesis, and water uptake, retention and loss during acute and chronic drought stresses. Under normal water-replete growing conditions, SUT4-RNAi plants had generally higher shoot water contents than wild-type plants. In response to soil drying during a short-term, acute drought, RNAi plants exhibited reduced rates of water uptake and delayed wilting relative to wild-type plants. SUT4-RNAi plants had larger leaf areas and lower photosynthesis rates than wild-type plants under well-watered, but not under chronic water-limiting conditions. Moreover, the magnitude of shoot water content, height growth, and photosynthesis responses to contrasting soil moisture regimes was greater in RNAi than wild-type plants. The concentrations of stress-responsive RFOs increased in wild-type plants but were unaffected in SUT4-RNAi plants under chronically dry conditions. We discuss a model in which the subcellular compartmentalization of sucrose mediated by PtaSUT4 is regulated in response to both sink demand and plant water status in Populus.

The role of co-opted ESCRT proteins and lipid factors in protection of tombusviral double-stranded RNA replication intermediate against reconstituted RNAi in yeast

PubMed Central

Nagy, Peter D.

2017-01-01

Reconstituted antiviral defense pathway in surrogate host yeast is used as an intracellular probe to further our understanding of virus-host interactions and the role of co-opted host factors in formation of membrane-bound viral replicase complexes in protection of the viral RNA against ribonucleases. The inhibitory effect of the RNA interference (RNAi) machinery of S. castellii, which only consists of the two-component DCR1 and AGO1 genes, was measured against tomato bushy stunt virus (TBSV) in wild type and mutant yeasts. We show that deletion of the co-opted ESCRT-I (endosomal sorting complexes required for transport I) or ESCRT-III factors makes TBSV replication more sensitive to the RNAi machinery in yeast. Moreover, the lack of these pro-viral cellular factors in cell-free extracts (CFEs) used for in vitro assembly of the TBSV replicase results in destruction of dsRNA replication intermediate by a ribonuclease at the 60 min time point when the CFE from wt yeast has provided protection for dsRNA. In addition, we demonstrate that co-opted oxysterol-binding proteins and membrane contact sites, which are involved in enrichment of sterols within the tombusvirus replication compartment, are required for protection of viral dsRNA. We also show that phosphatidylethanolamine level influences the formation of RNAi-resistant replication compartment. In the absence of peroxisomes in pex3Δ yeast, TBSV subverts the ER membranes, which provide as good protection for TBSV dsRNA against RNAi or ribonucleases as the peroxisomal membranes in wt yeast. Altogether, these results demonstrate that co-opted protein factors and usurped lipids are exploited by tombusviruses to build protective subcellular environment against the RNAi machinery and possibly other cellular ribonucleases. PMID:28759634

High throughput RNAi assay optimization using adherent cell cytometry.

PubMed

Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W

2011-04-25

siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.

High throughput RNAi assay optimization using adherent cell cytometry

PubMed Central

2011-01-01

Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450

Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

PubMed

Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

2018-05-01

Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.