Hocum, Jonah D; Battrell, Logan R; Maynard, Ryan; Adair, Jennifer E; Beard, Brian C; Rawlings, David J; Kiem, Hans-Peter; Miller, Daniel G; Trobridge, Grant D
2015-07-07
Analyzing the integration profile of retroviral vectors is a vital step in determining their potential genotoxic effects and developing safer vectors for therapeutic use. Identifying retroviral vector integration sites is also important for retroviral mutagenesis screens. We developed VISA, a vector integration site analysis server, to analyze next-generation sequencing data for retroviral vector integration sites. Sequence reads that contain a provirus are mapped to the human genome, sequence reads that cannot be localized to a unique location in the genome are filtered out, and then unique retroviral vector integration sites are determined based on the alignment scores of the remaining sequence reads. VISA offers a simple web interface to upload sequence files and results are returned in a concise tabular format to allow rapid analysis of retroviral vector integration sites.
VISMapper: ultra-fast exhaustive cartography of viral insertion sites for gene therapy.
Juanes, José M; Gallego, Asunción; Tárraga, Joaquín; Chaves, Felipe J; Marín-Garcia, Pablo; Medina, Ignacio; Arnau, Vicente; Dopazo, Joaquín
2017-09-20
The possibility of integrating viral vectors to become a persistent part of the host genome makes them a crucial element of clinical gene therapy. However, viral integration has associated risks, such as the unintentional activation of oncogenes that can result in cancer. Therefore, the analysis of integration sites of retroviral vectors is a crucial step in developing safer vectors for therapeutic use. Here we present VISMapper, a vector integration site analysis web server, to analyze next-generation sequencing data for retroviral vector integration sites. VISMapper can be found at: http://vismapper.babelomics.org . Because it uses novel mapping algorithms VISMapper is remarkably faster than previous available programs. It also provides a useful graphical interface to analyze the integration sites found in the genomic context.
Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Monse, Hella; Laufs, Stephanie; Kuate, Seraphin; Zeller, W. Jens; Fruehauf, Stefan; Überla, Klaus
2006-01-01
Preferential integration into transcriptionally active regions of genomes has been observed for retroviral vectors based on gamma-retroviruses and lentiviruses. However, differences in the integration site preferences were detected, which might be explained by differences in viral components of the preintegration complexes. Viral determinants of integration site preferences have not been defined. Therefore, integration sites of simian immunodeficiency virus (SIV)-based vectors produced in the absence of accessory genes or lacking promoter and enhancer elements were compared. Similar integration patterns for the different SIV vectors indicate that vif, vpr, vpx, nef, env, and promoter or enhancer elements are not required for preferential integration of SIV into transcriptionally active regions of genomes. PMID:16873270
Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration
De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.
2014-01-01
ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411
Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda
2017-06-17
The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .
Hong, Yang; Hondalus, Mary K
2008-10-01
Streptomyces PhiC31-based site-specific integration was used to transform the facultative intracellular pathogen Rhodococcus equi. The transformation efficiency of vectors incorporating the PhiC31 integrase and attP sites was comparable to that of replication plasmids using the same electroporation procedure. A single attB integration site was identified within an ORF encoding a pirin-like protein, which deviates slightly from the consensus sequence of Streptomyces attB sites. Vector integration was stably maintained in the R. equi chromosome for as many as 100 generations during unselected passage in vitro. In addition, integration does not appear to affect the replication of bacteria inside macrophages. Finally, this integration system was also used to successfully complement an R. equi mutant.
Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.
2010-01-01
Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052
Assessing the potential for AAV vector genotoxicity in a murine model
Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.
2011-01-01
Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988
Construction of a New Phage Integration Vector pFIV-Val for Use in Different Francisella Species
Tlapák, Hana; Köppen, Kristin; Rydzewski, Kerstin; Grunow, Roland; Heuner, Klaus
2018-01-01
We recently identified and described a putative prophage on the genomic island FhaGI-1 located within the genome of Francisella hispaniensis AS02-814 (F. tularensis subsp. novicida-like 3523). In this study, we constructed two variants of a Francisella phage integration vector, called pFIV1-Val and pFIV2-Val (Francisella Integration Vector-tRNAVal-specific), using the attL/R-sites and the site-specific integrase (FN3523_1033) of FhaGI-1, a chloramphenicol resistance cassette and a sacB gene for counter selection of transformants against the vector backbone. We inserted the respective sites and genes into vector pUC57-Kana to allow for propagation in Escherichia coli. The constructs generated a circular episomal form in E. coli which could be used to transform Francisella spp. where FIV-Val stably integrated site specifically into the tRNAVal gene of the genome, whereas pUC57-Kana is lost due to counter selection. Functionality of the new vector was demonstrated by the successfully complementation of a Francisella mutant strain. The vectors were stable in vitro and during host-cell infection without selective pressure. Thus, the vectors can be applied as a further genetic tool in Francisella research, expanding the present genetic tools by an integrative element. This new element is suitable to perform long-term experiments with different Francisella species. PMID:29594068
Construction of a New Phage Integration Vector pFIV-Val for Use in Different Francisella Species.
Tlapák, Hana; Köppen, Kristin; Rydzewski, Kerstin; Grunow, Roland; Heuner, Klaus
2018-01-01
We recently identified and described a putative prophage on the genomic island FhaGI-1 located within the genome of Francisella hispaniensis AS02-814 ( F. tularensis subsp. novicida -like 3523). In this study, we constructed two variants of a Francisella phage integration vector, called pFIV1-Val and pFIV2-Val ( Francisella Integration Vector-tRNA Val -specific), using the attL/R- sites and the site-specific integrase (FN3523_1033) of FhaGI-1, a chloramphenicol resistance cassette and a sacB gene for counter selection of transformants against the vector backbone. We inserted the respective sites and genes into vector pUC57-Kana to allow for propagation in Escherichia coli . The constructs generated a circular episomal form in E. coli which could be used to transform Francisella spp . where FIV-Val stably integrated site specifically into the tRNA Val gene of the genome, whereas pUC57-Kana is lost due to counter selection. Functionality of the new vector was demonstrated by the successfully complementation of a Francisella mutant strain. The vectors were stable in vitro and during host-cell infection without selective pressure. Thus, the vectors can be applied as a further genetic tool in Francisella research, expanding the present genetic tools by an integrative element. This new element is suitable to perform long-term experiments with different Francisella species.
Grandchamp, Nicolas; Altémir, Dorothée; Philippe, Stéphanie; Ursulet, Suzanna; Pilet, Héloïse; Serre, Marie-Claude; Lenain, Aude; Serguera, Che; Mallet, Jacques; Sarkis, Chamsy
2014-01-01
Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV) is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs) solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int) which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP) which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira
2012-01-06
Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less
Spinozzi, Giulio; Calabria, Andrea; Brasca, Stefano; Beretta, Stefano; Merelli, Ivan; Milanesi, Luciano; Montini, Eugenio
2017-11-25
Bioinformatics tools designed to identify lentiviral or retroviral vector insertion sites in the genome of host cells are used to address the safety and long-term efficacy of hematopoietic stem cell gene therapy applications and to study the clonal dynamics of hematopoietic reconstitution. The increasing number of gene therapy clinical trials combined with the increasing amount of Next Generation Sequencing data, aimed at identifying integration sites, require both highly accurate and efficient computational software able to correctly process "big data" in a reasonable computational time. Here we present VISPA2 (Vector Integration Site Parallel Analysis, version 2), the latest optimized computational pipeline for integration site identification and analysis with the following features: (1) the sequence analysis for the integration site processing is fully compliant with paired-end reads and includes a sequence quality filter before and after the alignment on the target genome; (2) an heuristic algorithm to reduce false positive integration sites at nucleotide level to reduce the impact of Polymerase Chain Reaction or trimming/alignment artifacts; (3) a classification and annotation module for integration sites; (4) a user friendly web interface as researcher front-end to perform integration site analyses without computational skills; (5) the time speedup of all steps through parallelization (Hadoop free). We tested VISPA2 performances using simulated and real datasets of lentiviral vector integration sites, previously obtained from patients enrolled in a hematopoietic stem cell gene therapy clinical trial and compared the results with other preexisting tools for integration site analysis. On the computational side, VISPA2 showed a > 6-fold speedup and improved precision and recall metrics (1 and 0.97 respectively) compared to previously developed computational pipelines. These performances indicate that VISPA2 is a fast, reliable and user-friendly tool for integration site analysis, which allows gene therapy integration data to be handled in a cost and time effective fashion. Moreover, the web access of VISPA2 ( http://openserver.itb.cnr.it/vispa/ ) ensures accessibility and ease of usage to researches of a complex analytical tool. We released the source code of VISPA2 in a public repository ( https://bitbucket.org/andreacalabria/vispa2 ).
New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.
Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel
2016-03-01
Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.
A novel, broad-range, CTXΦ-derived stable integrative expression vector for functional studies.
Das, Bhabatosh; Kumari, Reena; Pant, Archana; Sen Gupta, Sourav; Saxena, Shruti; Mehta, Ojasvi; Nair, Gopinath Balakrish
2014-12-01
CTXΦ, a filamentous vibriophage encoding cholera toxin, uses a unique strategy for its lysogeny. The single-stranded phage genome forms intramolecular base-pairing interactions between two inversely oriented XerC and XerD binding sites (XBS) and generates a functional phage attachment site, attP(+), for integration. The attP(+) structure is recognized by the host-encoded tyrosine recombinases XerC and XerD (XerCD), which enables irreversible integration of CTXΦ into the chromosome dimer resolution site (dif) of Vibrio cholerae. The dif site and the XerCD recombinases are widely conserved in bacteria. We took advantage of these conserved attributes to develop a broad-host-range integrative expression vector that could irreversibly integrate into the host chromosome using XerCD recombinases without altering the function of any known open reading frame (ORF). In this study, we engineered two different arabinose-inducible expression vectors, pBD62 and pBD66, using XBS of CTXΦ. pBD62 replicates conditionally and integrates efficiently into the dif of the bacterial chromosome by site-specific recombination using host-encoded XerCD recombinases. The expression level of the gene of interest could be controlled through the PBAD promoter by modulating the functions of the vector-encoded transcriptional factor AraC. We validated the irreversible integration of pBD62 into a wide range of pathogenic and nonpathogenic bacteria, such as V. cholerae, Vibrio fluvialis, Vibrio parahaemolyticus, Escherichia coli, Salmonella enterica, and Klebsiella pneumoniae. Gene expression from the PBAD promoter of integrated vectors was confirmed in V. cholerae using the well-studied reporter genes mCherry, eGFP, and lacZ. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Gene therapy using retrovirus vectors: vector development and biosafety at clinical trials.
Doi, Knayo; Takeuchi, Yasuhiro
2015-01-01
Retrovirus vectors (gammaretroviral and lentiviral vectors) have been considered as promising tools to transfer therapeutic genes into patient cells because they can permanently integrate into host cellular genome. To treat monogenic, inherited diseases, retroviral vectors have been used to add correct genes into patient cells. Conventional gammaretroviral vectors achieved successful results in clinical trials: treated patients had therapeutic gene expression in target cells and had improved symptoms of diseases. However, serious side-effects of leukemia occurred, caused by retroviral insertional mutagenesis (IM). These incidences stressed the importance of monitoring vector integration sites in patient cells as well as of re-consideration on safer vectors. More recently lentiviral vectors which can deliver genes into non-dividing cells started to be used in clinical trials including neurological disorders, showing their efficacy. Vector integration site analysis revealed that lentiviruses integrate less likely to near promoter regions of oncogenes than gammaretroviruses and no adverse events have been reported in lentiviral vector-mediated gene therapy clinical trials. Therefore lentiviral vectors have promises to be applied to a wide range of common diseases in near future. For example, T cells from cancer patients were transduced to express chimeric T cell receptors recognizing their tumour cells enhancing patients' anti-cancer immunity.
Dupont, L; Boizet-Bonhoure, B; Coddeville, M; Auvray, F; Ritzenthaler, P
1995-01-01
Temperate phage mv4 integrates its DNA into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus strains via site-specific recombination. Nucleotide sequencing of a 2.2-kb attP-containing phage fragment revealed the presence of four open reading frames. The larger open reading frame, close to the attP site, encoded a 427-amino-acid polypeptide with similarity in its C-terminal domain to site-specific recombinases of the integrase family. Comparison of the sequences of attP, bacterial attachment site attB, and host-phage junctions attL and attR identified a 17-bp common core sequence, where strand exchange occurs during recombination. Analysis of the attB sequence indicated that the core region overlaps the 3' end of a tRNA(Ser) gene. Phage mv4 DNA integration into the tRNA(Ser) gene preserved an intact tRNA(Ser) gene at the attL site. An integration vector based on the mv4 attP site and int gene was constructed. This vector transforms a heterologous host, L. plantarum, through site-specific integration into the tRNA(Ser) gene of the genome and will be useful for development of an efficient integration system for a number of additional bacterial species in which an identical tRNA gene is present. PMID:7836291
A novel Streptomyces spp. integration vector derived from the S. venezuelae phage, SV1.
Fayed, Bahgat; Younger, Ellen; Taylor, Gabrielle; Smith, Margaret C M
2014-05-30
Integrating vectors based on the int/attP loci of temperate phages are convenient and used widely, particularly for cloning genes in Streptomyces spp. We have constructed and tested a novel integrating vector based on g27, encoding integrase, and attP site from the phage, SV1. This plasmid, pBF3 integrates efficiently in S. coelicolor and S. lividans but surprisingly fails to generate stable integrants in S. venezuelae, the natural host for phage SV1. pBF3 promises to be a useful addition to the range of integrating vectors currently available for Streptomyces molecular genetics.
Han, Zongchao; Zhong, Li; Maina, Njeri; Hu, Zhongbo; Li, Xiaomiao; Chouthai, Nitin S; Bischof, Daniela; Weigel-Van Aken, Kirsten A; Slayton, William B; Yoder, Mervin C; Srivastava, Arun
2008-03-01
We previously reported that among single-stranded adeno-associated virus (ssAAV) vectors, serotypes 1 through 5, ssAAV1 is the most efficient in transducing murine hematopoietic stem cells (HSCs), but viral second-strand DNA synthesis remains a rate-limiting step. Subsequently, using double-stranded, self-complementary AAV (scAAV) vectors, serotypes 7 through 10, we observed that scAAV7 vectors also transduce murine HSCs efficiently. In the present study, we used scAAV1 and scAAV7 shuttle vectors to transduce HSCs in a murine bone marrow serial transplant model in vivo, which allowed examination of the AAV proviral integration pattern in the mouse genome, as well as recovery and nucleotide sequence analyses of AAV-HSC DNA junction fragments. The proviral genomes were stably integrated, and integration sites were localized to different mouse chromosomes. None of the integration sites was found to be in a transcribed gene, or near a cellular oncogene. None of the animals, monitored for up to 1 year, exhibited pathological abnormalities. Thus, AAV proviral integration-induced risk of oncogenesis was not found in our study, which provides functional confirmation of stable transduction of self-renewing multipotential HSCs by scAAV vectors as well as promise for the use of these vectors in the potential treatment of disorders of the hematopoietic system.
Bacteriophage-based vectors for site-specific insertion of DNA in the chromosome of Corynebacteria.
Oram, Mark; Woolston, Joelle E; Jacobson, Andrew D; Holmes, Randall K; Oram, Diana M
2007-04-15
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as beta. beta-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally encoded genes, is regulated by the DtxR protein in response to Fe(2+) levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the beta-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae DeltadtxR strain. Additionally, strains of beta-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for beta, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species.
Ehrhardt, Anja; Xu, Hui; Huang, Zan; Engler, Jeffrey A; Kay, Mark A
2005-05-01
In this study we performed a head-to-head comparison of the integrase phiC31 derived from a Streptomyces phage and the Sleeping Beauty (SB) transposase, a member of the TC1/mariner superfamily of transposable elements. Mouse liver was cotransfused with a vector containing our most robust human coagulation factor IX expression cassette and the appropriate recombinase recognition site and either a phiC31- or a SB transposase-expressing vector. To analyze transgene persistence and to prove somatic integration in vivo we induced cell cycling of mouse hepatocytes and found that the transgene expression levels dropped by only 16 to 21% and 56 to 66% in mice that received phiC31 and SB, respectively. Notably, no difference in the toxicity profile was detected in mice treated with either recombinase. Moreover we observed that with the integrase-mediated gene transfer, transgene expression levels were dependent on the remaining noncoding vector sequences, which also integrate into the host genome. Further analyses of a hot spot of integration after phiC31-mediated integration revealed small chromosomal deletions at the target site and that the recombination process was not dependent on the orientation in which the phiC31 recognition site attached to the pseudo-recognition sites in the host genome. Coupled together with ongoing improvements in both systems this study suggests that both nonviral vector systems will have important roles in achieving stable gene transfer in vivo.
Hüser, Daniela; Gogol-Döring, Andreas; Chen, Wei
2014-01-01
ABSTRACT Genome-wide analysis of adeno-associated virus (AAV) type 2 integration in HeLa cells has shown that wild-type AAV integrates at numerous genomic sites, including AAVS1 on chromosome 19q13.42. Multiple GAGY/C repeats, resembling consensus AAV Rep-binding sites are preferred, whereas rep-deficient AAV vectors (rAAV) regularly show a random integration profile. This study is the first study to analyze wild-type AAV integration in diploid human fibroblasts. Applying high-throughput third-generation PacBio-based DNA sequencing, integration profiles of wild-type AAV and rAAV are compared side by side. Bioinformatic analysis reveals that both wild-type AAV and rAAV prefer open chromatin regions. Although genomic features of AAV integration largely reproduce previous findings, the pattern of integration hot spots differs from that described in HeLa cells before. DNase-Seq data for human fibroblasts and for HeLa cells reveal variant chromatin accessibility at preferred AAV integration hot spots that correlates with variant hot spot preferences. DNase-Seq patterns of these sites in human tissues, including liver, muscle, heart, brain, skin, and embryonic stem cells further underline variant chromatin accessibility. In summary, AAV integration is dependent on cell-type-specific, variant chromatin accessibility leading to random integration profiles for rAAV, whereas wild-type AAV integration sites cluster near GAGY/C repeats. IMPORTANCE Adeno-associated virus type 2 (AAV) is assumed to establish latency by chromosomal integration of its DNA. This is the first genome-wide analysis of wild-type AAV2 integration in diploid human cells and the first to compare wild-type to recombinant AAV vector integration side by side under identical experimental conditions. Major determinants of wild-type AAV integration represent open chromatin regions with accessible consensus AAV Rep-binding sites. The variant chromatin accessibility of different human tissues or cell types will have impact on vector targeting to be considered during gene therapy. PMID:25031342
Bacteriophage-based Vectors for Site-specific Insertion of DNA in the Chromosome of Corynebacteria
Oram, Mark; Woolston, Joelle E.; Jacobson, Andrew D.; Holmes, Randall K.; Oram, Diana M.
2007-01-01
In Corynebacterium diphtheriae, diphtheria toxin is encoded by the tox gene of some temperate corynephages such as β. β-like corynephages are capable of inserting into the C. diphtheriae chromosome at two specific sites, attB1 and attB2. Transcription of the phage-encoded tox gene, and many chromosomally-encoded genes, is regulated by the DtxR protein in response to Fe2+ levels. Characterizing DtxR-dependent gene regulation is pivotal in understanding diphtheria pathogenesis and mechanisms of iron-dependent gene expression; although this has been hampered by a lack of molecular genetic tools in C. diphtheriae and related Coryneform species. To expand the systems for genetic manipulation of C. diphtheriae, we constructed plasmid vectors capable of integrating into the chromosome. These plasmids contain the β-encoded attP site and the DIP0182 integrase gene of C. diphtheriae NCTC13129. When these vectors were delivered to the cytoplasm of non-lysogenic C. diphtheriae, they integrated into either the attB1 or attB2 sites with comparable frequency. Lysogens were also transformed with these vectors, by virtue of the second attB site. An integrated vector carrying an intact dtxR gene complemented the mutant phenotypes of a C. diphtheriae ΔdtxR strain. Additionally, strains of β-susceptible C. ulcerans, and C. glutamicum, a species non-permissive for β, were each transformed with these vectors. This work significantly extends the tools available for targeted transformation of both pathogenic and non-pathogenic Corynebacterium species. PMID:17275217
Hüser, Daniela; Weger, Stefan; Heilbronn, Regine
2003-01-01
Adeno-associated virus type 2 (AAV-2) establishes latency by site-specific integration into a unique locus on human chromosome 19, called AAVS1. During the development of a sensitive real-time PCR assay for site-specific integration, AAV-AAVS1 junctions were reproducibly detected in highly purified AAV wild-type and recombinant AAV vector stocks. A series of controls documented that the junctions were packaged in AAV capsids and were newly generated during a single round of AAV production. Cloned junctions displayed variable AAV sequences fused to AAVS1. These data suggest that packaged junctions represent footprints of AAV integration during productive infection. Apparently, AAV latency established by site-specific integration and the helper virus-dependent, productive AAV cycle are more closely related than previously thought. PMID:12663794
Integration Site and Clonal Expansion in Human Chronic Retroviral Infection and Gene Therapy
Niederer, Heather A.; Bangham, Charles R. M.
2014-01-01
Retroviral vectors have been successfully used therapeutically to restore expression of genes in a range of single-gene diseases, including several primary immunodeficiency disorders. Although clinical trials have shown remarkable results, there have also been a number of severe adverse events involving malignant outgrowth of a transformed clonal population. This clonal expansion is influenced by the integration site profile of the viral integrase, the transgene expressed, and the effect of the viral promoters on the neighbouring host genome. Infection with the pathogenic human retrovirus HTLV-1 also causes clonal expansion of cells containing an integrated HTLV-1 provirus. Although the majority of HTLV-1-infected people remain asymptomatic, up to 5% develop an aggressive T cell malignancy. In this review we discuss recent findings on the role of the genomic integration site in determining the clonality and the potential for malignant transformation of cells carrying integrated HTLV-1 or gene therapy vectors, and how these results have contributed to the understanding of HTLV-1 pathogenesis and to improvements in gene therapy vector safety. PMID:25365582
Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel
2012-01-01
Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016
Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou
2013-04-01
An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.
AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.
Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A
2017-06-01
Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.
2012-01-01
Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697
Nafissi, Nafiseh; Slavcev, Roderick
2012-12-06
While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.
Field site selection: getting it right first time around
Malcolm, Colin A; El Sayed, Badria; Babiker, Ahmed; Girod, Romain; Fontenille, Didier; Knols, Bart GJ; Nugud, Abdel Hameed; Benedict, Mark Q
2009-01-01
The selection of suitable field sites for integrated control of Anopheles mosquitoes using the sterile insect technique (SIT) requires consideration of the full gamut of factors facing most proposed control strategies, but four criteria identify an ideal site: 1) a single malaria vector, 2) an unstructured, relatively low density target population, 3) isolation of the target population and 4) actual or potential malaria incidence. Such a site can exist in a diverse range of situations or can be created. Two contrasting SIT field sites are examined here: the desert-flanked Dongola Reach of the Nile River in Northern State, Sudan, where malaria is endemic, and the island of La Reunion, where autochthonous malaria is rare but risk is persistent. The single malaria-transmitting vector at both sites is Anopheles arabiensis. In Sudan, the target area is a narrow 500 km corridor stretching from the rocky terrain at the Fourth Cataract - just above the new Merowe Dam, to the northernmost edge of the species range, close to Egypt. Vector distribution and temporal changes in density depend on the Nile level, ambient temperature and human activities. On La Reunion, the An. arabiensis population is coastal, limited and divided into three areas by altitude and exposure to the trade winds on the east coast. Mosquito vectors for other diseases are an issue at both sites, but of primary importance on La Reunion due to the recent chikungunya epidemic. The similarities and differences between these two sites in terms of suitability are discussed in the context of area-wide integrated vector management incorporating the SIT. PMID:19917079
The LAM-PCR Method to Sequence LV Integration Sites.
Wang, Wei; Bartholomae, Cynthia C; Gabriel, Richard; Deichmann, Annette; Schmidt, Manfred
2016-01-01
Integrating viral gene transfer vectors are commonly used gene delivery tools in clinical gene therapy trials providing stable integration and continuous gene expression of the transgene in the treated host cell. However, integration of the reverse-transcribed vector DNA into the host genome is a potentially mutagenic event that may directly contribute to unwanted side effects. A comprehensive and accurate analysis of the integration site (IS) repertoire is indispensable to study clonality in transduced cells obtained from patients undergoing gene therapy and to identify potential in vivo selection of affected cell clones. To date, next-generation sequencing (NGS) of vector-genome junctions allows sophisticated studies on the integration repertoire in vitro and in vivo. We have explored the use of the Illumina MiSeq Personal Sequencer platform to sequence vector ISs amplified by non-restrictive linear amplification-mediated PCR (nrLAM-PCR) and LAM-PCR. MiSeq-based high-quality IS sequence retrieval is accomplished by the introduction of a double-barcode strategy that substantially minimizes the frequency of IS sequence collisions compared to the conventionally used single-barcode protocol. Here, we present an updated protocol of (nr)LAM-PCR for the analysis of lentiviral IS using a double-barcode system and followed by deep sequencing using the MiSeq device.
Analysis of the clonal repertoire of gene-corrected cells in gene therapy.
Paruzynski, Anna; Glimm, Hanno; Schmidt, Manfred; Kalle, Christof von
2012-01-01
Gene therapy-based clinical phase I/II studies using integrating retroviral vectors could successfully treat different monogenetic inherited diseases. However, with increased efficiency of this therapy, severe side effects occurred in various gene therapy trials. In all cases, integration of the vector close to or within a proto-oncogene contributed substantially to the development of the malignancies. Thus, the in-depth analysis of integration site patterns is of high importance to uncover potential clonal outgrowth and to assess the safety of gene transfer vectors and gene therapy protocols. The standard and nonrestrictive linear amplification-mediated PCR (nrLAM-PCR) in combination with high-throughput sequencing exhibits technologies that allow to comprehensively analyze the clonal repertoire of gene-corrected cells and to assess the safety of the used vector system at an early stage on the molecular level. It enables clarifying the biological consequences of the vector system on the fate of the transduced cell. Furthermore, the downstream performance of real-time PCR allows a quantitative estimation of the clonality of individual cells and their clonal progeny. Here, we present a guideline that should allow researchers to perform comprehensive integration site analysis in preclinical and clinical studies. Copyright © 2012 Elsevier Inc. All rights reserved.
Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko
2014-01-01
Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219
Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko
2014-01-01
Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.
Everson, Elizabeth M; Hocum, Jonah D; Trobridge, Grant D
2018-06-23
Previous studies have shown that foamy viral (FV) vectors are a promising alternative to gammaretroviral and lentiviral vectors and insulators can improve FV vector safety. However, in a previous analysis of insulator effects on FV vector safety, strong viral promoters were used to elicit genotoxic events. Here we developed and analyzed the efficacy and safety of a high-titer, clinically relevant FV vector driven by the housekeeping promoter elongation factor-1α and insulated with an enhancer blocking A1 insulator (FV-EGW-A1). Human CD34 + cord blood cells were exposed to an enhanced green fluorescent protein expressing vector, FV-EGW-A1, at a multiplicity of infection of 10 and then maintained in vitro or transplanted into immunodeficient mice. Flow cytometry was used to measure engraftment and marking in vivo. FV vector integration sites were analyzed to assess safety. FV-EGW-A1 resulted in high-marking, multi-lineage engraftment of human repopulating cells with no evidence of silencing. Engraftment was highly polyclonal with no clonal dominance and a promising safety profile based on integration site analysis. An FV vector with an elongation factor-1α promoter and an A1 insulator is a promising vector design for use in the clinic. This article is protected by copyright. All rights reserved.
Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning
2012-01-01
As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606
Zhang, Wenli; Muck-Hausl, Martin; Wang, Jichang; Sun, Chuanbo; Gebbing, Maren; Miskey, Csaba; Ivics, Zoltan; Izsvak, Zsuzsanna; Ehrhardt, Anja
2013-01-01
We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB) transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR) and linear amplification-mediated PCR (LAM-PCR). Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models. PMID:24124483
McAllister, Robert G; Liu, Jiahui; Woods, Matthew W; Tom, Sean K; Rupar, C Anthony; Barr, Stephen D
2014-01-01
The blood–brain barrier controls the passage of molecules from the blood into the central nervous system (CNS) and is a major challenge for treatment of neurological diseases. Metachromatic leukodystrophy is a neurodegenerative lysosomal storage disease caused by loss of arylsulfatase A (ARSA) activity. Gene therapy via intraventricular injection of a lentiviral vector is a potential approach to rapidly and permanently deliver therapeutic levels of ARSA to the CNS. We present the distribution of integration sites of a lentiviral vector encoding human ARSA (LV-ARSA) in murine brain choroid plexus and ependymal cells, administered via a single intracranial injection into the CNS. LV-ARSA did not exhibit a strong preference for integration in or near actively transcribed genes, but exhibited a strong preference for integration in or near satellite DNA. We identified several genomic hotspots for LV-ARSA integration and identified a consensus target site sequence characterized by two G-quadruplex-forming motifs flanking the integration site. In addition, our analysis identified several other non-B DNA motifs as new factors that potentially influence lentivirus integration, including human immunodeficiency virus type-1 in human cells. Together, our data demonstrate a clinically favorable integration site profile in the murine brain and identify non-B DNA as a potential new host factor that influences lentiviral integration in murine and human cells. PMID:25158091
Sequential cloning of chromosomes
Lacks, Sanford A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.
Molecular mechanisms of retroviral integration site selection
Kvaratskhelia, Mamuka; Sharma, Amit; Larue, Ross C.; Serrao, Erik; Engelman, Alan
2014-01-01
Retroviral replication proceeds through an obligate integrated DNA provirus, making retroviral vectors attractive vehicles for human gene-therapy. Though most of the host cell genome is available for integration, the process of integration site selection is not random. Retroviruses differ in their choice of chromatin-associated features and also prefer particular nucleotide sequences at the point of insertion. Lentiviruses including HIV-1 preferentially integrate within the bodies of active genes, whereas the prototypical gammaretrovirus Moloney murine leukemia virus (MoMLV) favors strong enhancers and active gene promoter regions. Integration is catalyzed by the viral integrase protein, and recent research has demonstrated that HIV-1 and MoMLV targeting preferences are in large part guided by integrase-interacting host factors (LEDGF/p75 for HIV-1 and BET proteins for MoMLV) that tether viral intasomes to chromatin. In each case, the selectivity of epigenetic marks on histones recognized by the protein tether helps to determine the integration distribution. In contrast, nucleotide preferences at integration sites seem to be governed by the ability for the integrase protein to locally bend the DNA duplex for pairwise insertion of the viral DNA ends. We discuss approaches to alter integration site selection that could potentially improve the safety of retroviral vectors in the clinic. PMID:25147212
2017-01-01
ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446
Sequential cloning of chromosomes
Lacks, S.A.
1995-07-18
A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.
Agaphonov, Michael O
2017-12-01
The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Gapinske, Michael; Tague, Nathan; Winter, Jackson; Underhill, Gregory H; Perez-Pinera, Pablo
2018-01-01
Gene editing technologies are revolutionizing fields such as biomedicine and biotechnology by providing a simple means to manipulate the genetic makeup of essentially any organism. Gene editing tools function by introducing double-stranded breaks at targeted sites within the genome, which the host cells repair preferentially by Non-Homologous End Joining. While the technologies to introduce double-stranded breaks have been extensively optimized, this progress has not been matched by the development of methods to integrate heterologous DNA at the target sites or techniques to detect and isolate cells that harbor the desired modification. We present here a technique for rapid introduction of vectors at target sites in the genome that enables efficient isolation of successfully edited cells.
Efficacy and site-specificity of adenoviral vector integration mediated by the phage φC31 integrase.
Robert, Marc-André; Zeng, Yue; Raymond, Benoît; Desfossé, Laurie; Mairey, Emilie; Tremblay, Jacques P; Massie, Bernard; Gilbert, Rénald
2012-12-01
Adenoviral vectors deleted of all their viral genes (helper-dependent [HD]) are efficient gene-transfer vehicles. Because transgene expression is rapidly lost in actively dividing cells, we investigated the feasibility of using phage φC31 integrase (φC31-Int) to integrate an HD carrying an attB site and the puromycin resistance gene into human cells (HeLa) and murine myoblasts (C2C12) by co-infection with a second HD-expressing φC31-Int. Because the HD genome is linear, we also investigated whether its circularization, through expression of Cre using a third HD, affects integration. Efficacy and specificity were determined by scoring the number of puromycin-resistant colonies and by sequencing integration sites. Unexpectedly, circularization of HD was unnecessary and it even reduced the integration efficacy. The maximum integration efficacy achieved was 0.5% in HeLa cells and 0.1% in C2C12 myoblasts. Up to 76% of the integration events occurred at pseudo attP sites and previously characterized hotspots were found. A small (two- to three-fold) increase in the number of γ-H2AX positive foci, accompanied by no noticeable change in γ-H2AX expression, indicated the low genotoxicity of φC31-Int. In conclusion, integration of HD mediated by φC31-Int is an attractive alternative to engineer cells, because it permits site-specific integration of large DNA fragments with low genotoxicity.
Characterization of Equine Infectious Anemia Virus Integration in the Horse Genome.
Liu, Qiang; Wang, Xue-Feng; Ma, Jian; He, Xi-Jun; Wang, Xiao-Jun; Zhou, Jian-Hua
2015-06-19
Human immunodeficiency virus (HIV)-1 has a unique integration profile in the human genome relative to murine and avian retroviruses. Equine infectious anemia virus (EIAV) is another well-studied lentivirus that can also be used as a promising retro-transfection vector, but its integration into its native host has not been characterized. In this study, we mapped 477 integration sites of the EIAV strain EIAVFDDV13 in fetal equine dermal (FED) cells during in vitro infection. Published integration sites of EIAV and HIV-1 in the human genome were also analyzed as references. Our results demonstrated that EIAVFDDV13 tended to integrate into genes and AT-rich regions, and it avoided integrating into transcription start sites (TSS), which is consistent with EIAV and HIV-1 integration in the human genome. Notably, the integration of EIAVFDDV13 favored long interspersed elements (LINEs) and DNA transposons in the horse genome, whereas the integration of HIV-1 favored short interspersed elements (SINEs) in the human genome. The chromosomal environment near LINEs or DNA transposons potentially influences viral transcription and may be related to the unique EIAV latency states in equids. The data on EIAV integration in its natural host will facilitate studies on lentiviral infection and lentivirus-based therapeutic vectors.
Characterization of Equine Infectious Anemia Virus Integration in the Horse Genome
Liu, Qiang; Wang, Xue-Feng; Ma, Jian; He, Xi-Jun; Wang, Xiao-Jun; Zhou, Jian-Hua
2015-01-01
Human immunodeficiency virus (HIV)-1 has a unique integration profile in the human genome relative to murine and avian retroviruses. Equine infectious anemia virus (EIAV) is another well-studied lentivirus that can also be used as a promising retro-transfection vector, but its integration into its native host has not been characterized. In this study, we mapped 477 integration sites of the EIAV strain EIAVFDDV13 in fetal equine dermal (FED) cells during in vitro infection. Published integration sites of EIAV and HIV-1 in the human genome were also analyzed as references. Our results demonstrated that EIAVFDDV13 tended to integrate into genes and AT-rich regions, and it avoided integrating into transcription start sites (TSS), which is consistent with EIAV and HIV-1 integration in the human genome. Notably, the integration of EIAVFDDV13 favored long interspersed elements (LINEs) and DNA transposons in the horse genome, whereas the integration of HIV-1 favored short interspersed elements (SINEs) in the human genome. The chromosomal environment near LINEs or DNA transposons potentially influences viral transcription and may be related to the unique EIAV latency states in equids. The data on EIAV integration in its natural host will facilitate studies on lentiviral infection and lentivirus-based therapeutic vectors. PMID:26102582
Gren, Tetiana; Ortseifen, Vera; Wibberg, Daniel; Schneiker-Bekel, Susanne; Bednarz, Hanna; Niehaus, Karsten; Zemke, Till; Persicke, Marcus; Pühler, Alfred; Kalinowski, Jörn
2016-08-20
The α-glucosidase inhibitor acarbose is used for treatment of diabetes mellitus type II, and is manufactured industrially with overproducing derivatives of Actinoplanes sp. SE50/110, reportedly obtained by conventional mutagenesis. Despite of high industrial significance, only limited information exists regarding acarbose metabolism, function and regulation of these processes, due to the absence of proper genetic engineering methods and tools developed for this strain. Here, a basic toolkit for genetic engineering of Actinoplanes sp. SE50/110 was developed, comprising a standardized protocol for a DNA transfer through Escherichia coli-Actinoplanes intergeneric conjugation and applied for the transfer of ϕC31, ϕBT1 and VWB actinophage-based integrative vectors. Integration sites, occurring once per genome for all vectors, were sequenced and characterized for the first time in Actinoplanes sp. SE50/110. Notably, in case of ϕC31 based vector pSET152, the integration site is highly conserved, while for ϕBT1 and the VWB based vectors pRT801 and pSOK804, respectively, no sequence similarities to those in other bacteria were detected. The studied plasmids were proven to be stable and neutral with respect to strain morphology and acarbose production, enabling future use for genetic manipulations of Actinoplanes sp. SE50/110. To further broaden the spectrum of available tools, a GUS reporter system, based on the pSET152 derived vector, was also established in Actinoplanes sp. SE50/110. Copyright © 2016 Elsevier B.V. All rights reserved.
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.
Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S
2009-07-01
Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.
Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka
2015-06-30
Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.
Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi
2016-07-01
Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F
2017-03-07
Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.
Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.
Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan
2008-11-01
Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-10-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-01-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624
Kardinal, C; Selmayr, M; Mocikat, R
1996-01-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
Konstantoulas, Constantine James; Indik, Stanislav
2014-04-30
Mouse mammary tumor virus (MMTV) is a complex, milk-born betaretrovirus, which preferentially infects dendritic cells (DC) in the gastrointestinal tract and then spreads to T and B lymphocytes and finally to the mammary gland. It is not clear how the prototypic betaretrovirus infects mucosal DCs and naïve lymphocytes as these cells are considered to be non-proliferative. Studies of MMTV biology have been hampered by the difficulty of obtaining sufficient virus/vector titers after transfection of a molecular clone in cultured cells. To surmount this barrier we developed a novel MMTV-based vector system with a split genome design containing potent posttranscriptional regulatory functions. Using this system, vector particles were produced to markedly greater titers (>1000-fold) than those obtained previously. The titers (>106 transduction units /ml) were comparable to those achieved with lentiviral or gammaretroviral vectors. Importantly, the vector transduced the enhanced green fluorescence protein gene into the chromosomes of non-dividing cells, such as cells arrested at the G2/M phase of the cell cycle and unstimulated hematopoietic progenitor cells, at an efficiency similar to that obtained with the HIV-1-based vector. In contrast to HIV-1, MMTV transductions were not affected by knocking down the expression of a factor involved in nuclear import of the HIV-1 pre-integration complexes, TNPO3. In contrast to HIV-1, the MMTV-based vector did not preferentially integrate in transcription units. Additionally, no preference for integration near transcription start sites, the regions preferentially targeted by gammaretroviral vectors, was observed. The vector derived from MMTV exhibits a random integration pattern. Overall, the betaretroviral vector system should facilitate molecular virology studies of the prototypic betaretrovirus as well as studies attempting to elucidate fundamental cellular processes such as nuclear import pathways. Random integration in cycling and non-cycling cells may be applicable in unbiased gene delivery.
Lentiviral Vector Induced Insertional Haploinsufficiency of Ebf1 Causes Murine Leukemia
Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute
2012-01-01
Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design. PMID:22472950
Genotoxicity of retroviral hematopoietic stem cell gene therapy
Trobridge, Grant D
2012-01-01
Introduction Retroviral vectors have been developed for hematopoietic stem cell (HSC) gene therapy and have successfully cured X-linked severe combined immunodeficiency (SCID-X1), adenosine deaminase deficiency (ADA-SCID), adrenoleukodystrophy, and Wiskott-Aldrich syndrome. However, in HSC gene therapy clinical trials, genotoxicity mediated by integrated vector proviruses has led to clonal expansion, and in some cases frank leukemia. Numerous studies have been performed to understand the molecular basis of vector-mediated genotoxicity with the aim of developing safer vectors and safer gene therapy protocols. These genotoxicity studies are critical to advancing HSC gene therapy. Areas covered This review provides an introduction to the mechanisms of retroviral vector genotoxicity. It also covers advances over the last 20 years in designing safer gene therapy vectors, and in integration site analysis in clinical trials and large animal models. Mechanisms of retroviral-mediated genotoxicity, and the risk factors that contribute to clonal expansion and leukemia in HSC gene therapy are introduced. Expert opinion Continued research on virus–host interactions and next-generation vectors should further improve the safety of future HSC gene therapy vectors and protocols. PMID:21375467
Browning, Diana L.; Collins, Casey P.; Hocum, Jonah D.; Leap, David J.; Rae, Dustin T.; Trobridge, Grant D.
2016-01-01
Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34+ cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy. PMID:26715244
Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.
Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James
2008-04-11
The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.
Vets, Sofie; De Rijck, Jan; Brendel, Christian; Grez, Manuel; Bushman, Frederic; Debyser, Zeger; Gijsbers, Rik
2013-01-01
Retrovirus-based vectors are commonly used as delivery vehicles to correct genetic diseases because of their ability to integrate new sequences stably. However, adverse events in which vector integration activates proto-oncogenes, leading to clonal expansion and leukemogenesis hamper their application. The host cell-encoded lens epithelium-derived growth factor (LEDGF/p75) binds lentiviral integrase and targets integration to active transcription units. We demonstrated earlier that replacing the LEDGF/p75 chromatin interaction domain with an alternative DNA-binding protein could retarget integration. Here, we show that transient expression of the chimeric protein using mRNA electroporation efficiently redirects lentiviral vector (LV) integration in wild-type (WT) cells. We then employed this technology in a model for X-linked chronic granulomatous disease (X-CGD) using myelomonocytic PLB-985 gp91−/− cells. Following electroporation with mRNA encoding the LEDGF-chimera, the cells were treated with a therapeutic lentivector encoding gp91phox. Integration site analysis revealed retargeted integration away from genes and towards heterochromatin-binding protein 1β (CBX1)-binding sites, in regions enriched in marks associated with gene silencing. Nevertheless, gp91phox expression was stable for at least 6 months after electroporation and NADPH-oxidase activity was restored to normal levels as determined by superoxide production. Together, these data provide proof-of-principle that transient expression of engineered LEDGF-chimera can retarget lentivector integration and rescues the disease phenotype in a cell model, opening perspectives for safer gene therapy. PMID:23462964
DNA transformations of Candida tropicalis with replicating and integrative vectors.
Sanglard, D; Fiechter, A
1992-12-01
The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.
Applications of lentiviral vectors in molecular imaging.
Chatterjee, Sushmita; De, Abhijit
2014-06-01
Molecular imaging provides the ability of simultaneous visual and quantitative estimation of long term gene expression directly from living organisms. To reveal the kinetics of gene expression by imaging method, often sustained expression of the transgene is required. Lentiviral vectors have been extensively used over last fifteen years for delivery of a transgene in a wide variety of cell types. Lentiviral vectors have the well known advantages such as sustained transgene delivery through stable integration into the host genome, the capability of infecting non-dividing and dividing cells, broad tissue tropism, a reasonably large carrying capacity for delivering therapeutic and reporter gene combinations. Additionally, they do not express viral proteins during transduction, have a potentially safe integration site profile, and a relatively easy system for vector manipulation and infective viral particle production. As a result, lentiviral vector mediated therapeutic and imaging reporter gene delivery to various target organs holds promise for the future treatment. In this review, we have conducted a brief survey of important lentiviral vector developments in diverse biomedical fields including reproductive biology.
Yang, V W; Marks, J A; Davis, B P; Jeffries, T W
1994-01-01
This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...
2008-01-01
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Vets, Sofie; De Rijck, Jan; Brendel, Christian; Grez, Manuel; Bushman, Frederic; Debyser, Zeger; Gijsbers, Rik
2013-03-05
Retrovirus-based vectors are commonly used as delivery vehicles to correct genetic diseases because of their ability to integrate new sequences stably. However, adverse events in which vector integration activates proto-oncogenes, leading to clonal expansion and leukemogenesis hamper their application. The host cell-encoded lens epithelium-derived growth factor (LEDGF/p75) binds lentiviral integrase and targets integration to active transcription units. We demonstrated earlier that replacing the LEDGF/p75 chromatin interaction domain with an alternative DNA-binding protein could retarget integration. Here, we show that transient expression of the chimeric protein using mRNA electroporation efficiently redirects lentiviral vector (LV) integration in wild-type (WT) cells. We then employed this technology in a model for X-linked chronic granulomatous disease (X-CGD) using myelomonocytic PLB-985 gp91(-/-) cells. Following electroporation with mRNA encoding the LEDGF-chimera, the cells were treated with a therapeutic lentivector encoding gp91(phox). Integration site analysis revealed retargeted integration away from genes and towards heterochromatin-binding protein 1β (CBX1)-binding sites, in regions enriched in marks associated with gene silencing. Nevertheless, gp91(phox) expression was stable for at least 6 months after electroporation and NADPH-oxidase activity was restored to normal levels as determined by superoxide production. Together, these data provide proof-of-principle that transient expression of engineered LEDGF-chimera can retarget lentivector integration and rescues the disease phenotype in a cell model, opening perspectives for safer gene therapy.Molecular Therapy - Nucleic Acids (2013) 2, e77; doi:10.1038/mtna.2013.4; published online 5 March 2013.
Vranckx, Lenard S.; Demeulemeester, Jonas; Debyser, Zeger
2016-01-01
The capacity to integrate transgenes into the host cell genome makes retroviral vectors an interesting tool for gene therapy. Although stable insertion resulted in successful correction of several monogenic disorders, it also accounts for insertional mutagenesis, a major setback in otherwise successful clinical gene therapy trials due to leukemia development in a subset of treated patients. Despite improvements in vector design, their use is still not risk-free. Lentiviral vector (LV) integration is directed into active transcription units by LEDGF/p75, a host-cell protein co-opted by the viral integrase. We engineered LEDGF/p75-based hybrid tethers in an effort to elicit a more random integration pattern to increase biosafety, and potentially reduce proto-oncogene activation. We therefore truncated LEDGF/p75 by deleting the N-terminal chromatin-reading PWWP-domain, and replaced this domain with alternative pan-chromatin binding peptides. Expression of these LEDGF-hybrids in LEDGF-depleted cells efficiently rescued LV transduction and resulted in LV integrations that distributed more randomly throughout the host-cell genome. In addition, when considering safe harbor criteria, LV integration sites for these LEDGF-hybrids distributed more safely compared to LEDGF/p75-mediated integration in wild-type cells. This approach should be broadly applicable to introduce therapeutic or suicide genes for cell therapy, such as patient-specific iPS cells. PMID:27788138
Vrljicak, Pavle; Tao, Shijie; Varshney, Gaurav K; Quach, Helen Ngoc Bao; Joshi, Adita; LaFave, Matthew C; Burgess, Shawn M; Sampath, Karuna
2016-04-07
DNA transposons and retroviruses are important transgenic tools for genome engineering. An important consideration affecting the choice of transgenic vector is their insertion site preferences. Previous large-scale analyses of Ds transposon integration sites in plants were done on the basis of reporter gene expression or germ-line transmission, making it difficult to discern vertebrate integration preferences. Here, we compare over 1300 Ds transposon integration sites in zebrafish with Tol2 transposon and retroviral integration sites. Genome-wide analysis shows that Ds integration sites in the presence or absence of marker selection are remarkably similar and distributed throughout the genome. No strict motif was found, but a preference for structural features in the target DNA associated with DNA flexibility (Twist, Tilt, Rise, Roll, Shift, and Slide) was observed. Remarkably, this feature is also found in transposon and retroviral integrations in maize and mouse cells. Our findings show that structural features influence the integration of heterologous DNA in genomes, and have implications for targeted genome engineering. Copyright © 2016 Vrljicak et al.
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
Lill, Georgia R.; Shaw, Kit; Carbonaro-Sarracino, Denise A.; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo
2017-01-01
Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase–deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2. These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34+ cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach. PMID:28351939
Cooper, Aaron R; Lill, Georgia R; Shaw, Kit; Carbonaro-Sarracino, Denise A; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo; Kohn, Donald B
2017-05-11
Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2 These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34 + cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach.
Rossi, Franca; Capodaglio, Alessandro; Dellaglio, Franco
2008-08-01
This report describes the vector-free engineering of Lactobacillus plantarum by chromosomal integration of an exogenous gene without inactivation of physiological traits. The integrative plasmid vector pP7B6 was derived from pGIP73 by replacing the cbh site, encoding the L. plantarum conjugated bile salt hydrolase, with the prophage fragment P7B6, from L. plantarum Lp80 (DSM 4229). Plasmid pP7B6NI was obtained by inserting the nisin immunity gene nisI of Lactococcus lactis subsp. lactis DSM 20729, preceded by the constitutive promoter P32 from the same strain, in a unique XbaI site of fragment P7B6 and was used to electrotransform L. plantarum Lp80. A food grade recombinant L. plantarum Lp80NI, with 480-fold higher immunity to nisin than the wild type, was derived by integration of pP7B6NI followed by the excision of pP7B6. Polymerase chain reaction tests demonstrated that the integration of nisI in the prophage region had occurred and that the erythromycin resistance marker from pP7B6 was lost. Fifteen among 31 L. plantarum strains tested hybridized with P7B6, indicating that the integration of pP7B6-derived vectors might occur in some other L. plantarum strains. This was experimentally confirmed by constructing the recombinant strain L. plantarum LZNI from the dairy isolate L. plantarum LZ (LMG 24600).
Preparation for a first-in-man lentivirus trial in patients with cystic fibrosis
Alton, Eric W F W; Beekman, Jeffery M; Boyd, A Christopher; Brand, June; Carlon, Marianne S; Connolly, Mary M; Chan, Mario; Conlon, Sinead; Davidson, Heather E; Davies, Jane C; Davies, Lee A; Dekkers, Johanna F; Doherty, Ann; Gea-Sorli, Sabrina; Gill, Deborah R; Griesenbach, Uta; Hasegawa, Mamoru; Higgins, Tracy E; Hironaka, Takashi; Hyndman, Laura; McLachlan, Gerry; Inoue, Makoto; Hyde, Stephen C; Innes, J Alastair; Maher, Toby M; Moran, Caroline; Meng, Cuixiang; Paul-Smith, Michael C; Pringle, Ian A; Pytel, Kamila M; Rodriguez-Martinez, Andrea; Schmidt, Alexander C; Stevenson, Barbara J; Sumner-Jones, Stephanie G; Toshner, Richard; Tsugumine, Shu; Wasowicz, Marguerite W; Zhu, Jie
2017-01-01
We have recently shown that non-viral gene therapy can stabilise the decline of lung function in patients with cystic fibrosis (CF). However, the effect was modest, and more potent gene transfer agents are still required. Fuson protein (F)/Hemagglutinin/Neuraminidase protein (HN)-pseudotyped lentiviral vectors are more efficient for lung gene transfer than non-viral vectors in preclinical models. In preparation for a first-in-man CF trial using the lentiviral vector, we have undertaken key translational preclinical studies. Regulatory-compliant vectors carrying a range of promoter/enhancer elements were assessed in mice and human air–liquid interface (ALI) cultures to select the lead candidate; cystic fibrosis transmembrane conductance receptor (CFTR) expression and function were assessed in CF models using this lead candidate vector. Toxicity was assessed and ‘benchmarked’ against the leading non-viral formulation recently used in a Phase IIb clinical trial. Integration site profiles were mapped and transduction efficiency determined to inform clinical trial dose-ranging. The impact of pre-existing and acquired immunity against the vector and vector stability in several clinically relevant delivery devices was assessed. A hybrid promoter hybrid cytosine guanine dinucleotide (CpG)- free CMV enhancer/elongation factor 1 alpha promoter (hCEF) consisting of the elongation factor 1α promoter and the cytomegalovirus enhancer was most efficacious in both murine lungs and human ALI cultures (both at least 2-log orders above background). The efficacy (at least 14% of airway cells transduced), toxicity and integration site profile supports further progression towards clinical trial and pre-existing and acquired immune responses do not interfere with vector efficacy. The lead rSIV.F/HN candidate expresses functional CFTR and the vector retains 90–100% transduction efficiency in clinically relevant delivery devices. The data support the progression of the F/HN-pseudotyped lentiviral vector into a first-in-man CF trial in 2017. PMID:27852956
Gonzalez-Murillo, Africa; Lozano, M. Luz; Montini, Eugenio; Bueren, Juan A.
2008-01-01
Recent studies of retroviral-mediated gene transfer have shown that retroviral integrations themselves may trigger nonmalignant clonal expansion of hematopoietic stem cells (HSCs) in transplant recipients. These observations suggested that previous conclusions of HSC dynamics based on gamma-retroviral gene marking should be confirmed with improved vectors having a more limited capacity to transactivate endogenous genes. Because of the low trans-activation activity of self-inactivating lentiviral vectors (LVs), we have investigated whether the LV marking of mouse HSCs induces a competitive repopulation advantage in recipients of serially transplants. As deduced from analyses conducted in primary and secondary recipients, we concluded that lentivirally transduced HSCs have no competitive repopulation advantages over untransduced HSCs. By linear amplification-mediated polymerase chain reaction (LAM-PCR) analysis, we characterized LV-targeted genes in HSC clones that engrafted up to quaternary recipients. Although 9 clones harbored integrations close to defined retroviral insertion sites, none was characterized as a common integration site, and none was present in HSC clones repopulating quaternary recipients. Taken together, our results show unaltered repopulation properties of HSCs transduced with LVs, and confirm early studies suggesting the natural capacity of a few HSC clones to generate a monoclonal or oligoclonal hematopoiesis in transplant recipients. PMID:18684860
Decade-Long Safety and Function of Retroviral-Modified Chimeric Antigen Receptor T-cells
Scholler, John; Brady, Troy L.; Binder-Scholl, Gwendolyn; Hwang, Wei-Ting; Plesa, Gabriela; Hege, Kristen M.; Vogel, Ashley N.; Kalos, Michael; Riley, James L.; Deeks, Steven G.; Mitsuyasu, Ronald T.; Bernstein, Wendy B.; Aronson, Naomi E.; Levine, Bruce L.; Bushman, Frederic D.; June, Carl H.
2015-01-01
The success of adoptive T cell gene transfer for treatment of cancer and HIV is predicated on generating a response that is both durable and safe. Here we report long term results from three clinical trials to evaluate gammaretroviral vector engineered T-cells for HIV. The vector encoded a chimeric antigen receptor (CAR) comprised of CD4 linked to the CD3-ζ signaling chain (CD4ζ). CAR T-cells were detected in 98% of samples tested for at least 11 years post-infusion at frequencies that exceed average T cell levels after most vaccine approaches. The CD4ζ transgene retained expression and function. There was no evidence of vector-induced immortalization of cells as integration site distributions showed no evidence of persistent clonal expansion or enrichment for integration sites near genes implicated in growth control or transformation. The CD4ζ T cells have stable levels of engraftment, with decay half-lives that exceed 16 years, in marked contrast to previous trials testing engineered T cells. These findings indicate that host immunosuppression prior to T cell transfer is not required in order to achieve long term persistence of gene-modified T cells. Further, our results emphasize the safety of T cells modified by retroviral gene transfer in clinical application, as measured in >500 patient years of follow up. Thus, previous safety issues with integrating viral vectors are hematopoietic stem cell or transgene intrinsic, and not a general feature of retroviral vectors. Engineered T cells are a promising form of synthetic biology for long term delivery of protein based therapeutics. These results provide a framework to guide the therapy of a wide spectrum of human diseases. PMID:22553251
Hashimoto, Ken; Zúniga, Concepción; Nakamura, Jiro; Hanada, Kyo
2015-03-24
Integration of disease-specific programmes into the primary health care (PHC) service has been attempted mostly in clinically oriented disease control such as HIV/AIDS and tuberculosis but rarely in vector control. Chagas disease is controlled principally by interventions against the triatomine vector. In Honduras, after successful reduction of household infestation by vertical approach, the Ministry of Health implemented community-based vector surveillance at the PHC services (health centres) to prevent the resurgence of infection. This paper retrospectively analyses the effects and process of integrating a Chagas disease vector surveillance system into health centres. We evaluated the effects of integration at six pilot sites in western Honduras during 2008-2011 on; surveillance performance; knowledge, attitude and practice in schoolchildren; reports of triatomine bug infestation and institutional response; and seroprevalence among children under 15 years of age. The process of integration of the surveillance system was analysed using the PRECEDE-PROCEED model for health programme planning. The model was employed to systematically determine influential and interactive factors which facilitated the integration process at different levels of the Ministry of Health and the community. Overall surveillance performance improved from 46 to 84 on a 100 point-scale. Schoolchildren's attitude (risk awareness) score significantly increased from 77 to 83 points. Seroprevalence declined from 3.4% to 0.4%. Health centres responded to the community bug reports by insecticide spraying. As key factors, the health centres had potential management capacity and influence over the inhabitants' behaviours and living environment directly and through community health volunteers. The National Chagas Programme played an essential role in facilitating changes with adequate distribution of responsibilities, participatory modelling, training and, evaluation and advocacy. We found that Chagas disease vector surveillance can be integrated into the PHC service. Health centres demonstrated capacity to manage vector surveillance and improve performance, children's awareness, vector report-response and seroprevalence, once tasks were simplified to be performed by trained non-specialists and distributed among the stakeholders. Health systems integration requires health workers to perform beyond their usual responsibilities and acquire management skills. Integration of vector control is feasible and can contribute to strengthening the preventive capacity of the PHC service.
Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P
2013-05-01
Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.
Sommerfeld, Johannes; Kroeger, Axel
2012-12-01
This article provides an overview of methods and cross-site insights of a 5-year research and capacity building initiative conducted between 2006 and 2011 in six countries of South Asia (India, Sri Lanka) and South-East Asia (Indonesia, Myanmar, Philippines, Thailand).The initiative managed an interdisciplinary investigation of ecological, biological, and social (i.e., eco-bio-social) dimensions of dengue in urban and peri-urban areas, and developed community-based interventions aimed at reducing dengue vector breeding and viral transmission. The multicountry study comprised interdisciplinary research groups from six leading Asian research institutions. The groups conducted a detailed situation analysis to identify and characterize local eco-bio-social conditions, and formed a community-of-practice for EcoHealth research where group partners disseminated results and collaboratively developed site-specific intervention tools for vector-borne diseases. In sites where water containers produced more than 70% of Aedes pupae, interventions ranged from mechanical lid covers for containers to biological control. Where small discarded containers presented the main problem, groups experimented with solid waste management, composting and recycling schemes. Many intervention tools were locally produced and all tools were implemented through community partnership strategies. All sites developed socially and culturally appropriate health education materials. The study also mobilised and empowered women's, students' and community groups and at several sites organized new volunteer groups for environmental health. The initiative's programmes showed significant impact on vector densities in some sites. Other sites showed varying effect - partially attributable to the 'contamination' of control groups - yet led to significant outcomes at the community level where local groups united around broad interests in environmental hygiene and sanitation. The programme's findings are relevant for defining efficient, effective and ecologically sound vector control interventions based on local evidence and in accordance with WHO's strategy for integrated vector management.
Sommerfeld, Johannes; Kroeger, Axel
2012-01-01
This article provides an overview of methods and cross-site insights of a 5-year research and capacity building initiative conducted between 2006 and 2011 in six countries of South Asia (India, Sri Lanka) and South-East Asia (Indonesia, Myanmar, Philippines, Thailand).The initiative managed an interdisciplinary investigation of ecological, biological, and social (i.e., eco-bio-social) dimensions of dengue in urban and peri-urban areas, and developed community-based interventions aimed at reducing dengue vector breeding and viral transmission. The multicountry study comprised interdisciplinary research groups from six leading Asian research institutions. The groups conducted a detailed situation analysis to identify and characterize local eco-bio-social conditions, and formed a community-of-practice for EcoHealth research where group partners disseminated results and collaboratively developed site-specific intervention tools for vector-borne diseases. In sites where water containers produced more than 70% of Aedes pupae, interventions ranged from mechanical lid covers for containers to biological control. Where small discarded containers presented the main problem, groups experimented with solid waste management, composting and recycling schemes. Many intervention tools were locally produced and all tools were implemented through community partnership strategies. All sites developed socially and culturally appropriate health education materials. The study also mobilised and empowered women’s, students’ and community groups and at several sites organized new volunteer groups for environmental health. The initiative’s programmes showed significant impact on vector densities in some sites. Other sites showed varying effect — partially attributable to the ‘contamination’ of control groups — yet led to significant outcomes at the community level where local groups united around broad interests in environmental hygiene and sanitation. The programme’s findings are relevant for defining efficient, effective and ecologically sound vector control interventions based on local evidence and in accordance with WHO’s strategy for integrated vector management. PMID:23318234
Li, Liqi; Luo, Qifa; Xiao, Weidong; Li, Jinhui; Zhou, Shiwen; Li, Yongsheng; Zheng, Xiaoqi; Yang, Hua
2017-02-01
Palmitoylation is the covalent attachment of lipids to amino acid residues in proteins. As an important form of protein posttranslational modification, it increases the hydrophobicity of proteins, which contributes to the protein transportation, organelle localization, and functions, therefore plays an important role in a variety of cell biological processes. Identification of palmitoylation sites is necessary for understanding protein-protein interaction, protein stability, and activity. Since conventional experimental techniques to determine palmitoylation sites in proteins are both labor intensive and costly, a fast and accurate computational approach to predict palmitoylation sites from protein sequences is in urgent need. In this study, a support vector machine (SVM)-based method was proposed through integrating PSI-BLAST profile, physicochemical properties, [Formula: see text]-mer amino acid compositions (AACs), and [Formula: see text]-mer pseudo AACs into the principal feature vector. A recursive feature selection scheme was subsequently implemented to single out the most discriminative features. Finally, an SVM method was implemented to predict palmitoylation sites in proteins based on the optimal features. The proposed method achieved an accuracy of 99.41% and Matthews Correlation Coefficient of 0.9773 for a benchmark dataset. The result indicates the efficiency and accuracy of our method in prediction of palmitoylation sites based on protein sequences.
Stone, Christopher M; Lindsay, Steve W; Chitnis, Nakul
2014-12-01
The opportunity to integrate vector management across multiple vector-borne diseases is particularly plausible for malaria and lymphatic filariasis (LF) control where both diseases are transmitted by the same vector. To date most examples of integrated control targeting these diseases have been unanticipated consequences of malaria vector control, rather than planned strategies that aim to maximize the efficacy and take the complex ecological and biological interactions between the two diseases into account. We developed a general model of malaria and LF transmission and derived expressions for the basic reproductive number (R0) for each disease. Transmission of both diseases was most sensitive to vector mortality and biting rate. Simulating different levels of coverage of long lasting-insecticidal nets (LLINs) and larval control confirms the effectiveness of these interventions for the control of both diseases. When LF was maintained near the critical density of mosquitoes, minor levels of vector control (8% coverage of LLINs or treatment of 20% of larval sites) were sufficient to eliminate the disease. Malaria had a far greater R0 and required a 90% population coverage of LLINs in order to eliminate it. When the mosquito density was doubled, 36% and 58% coverage of LLINs and larval control, respectively, were required for LF elimination; and malaria elimination was possible with a combined coverage of 78% of LLINs and larval control. Despite the low level of vector control required to eliminate LF, simulations suggest that prevalence of LF will decrease at a slower rate than malaria, even at high levels of coverage. If representative of field situations, integrated management should take into account not only how malaria control can facilitate filariasis elimination, but strike a balance between the high levels of coverage of (multiple) interventions required for malaria with the long duration predicted to be required for filariasis elimination.
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
NASA Astrophysics Data System (ADS)
Yu, Yuan; Tong, Qi; Li, Zhongxia; Tian, Jinhai; Wang, Yizhi; Su, Feng; Wang, Yongsheng; Liu, Jun; Zhang, Yong
2014-02-01
PhiC31 integrase-mediated gene delivery has been extensively used in gene therapy and animal transgenesis. However, random integration events are observed in phiC31-mediated integration in different types of mammalian cells; as a result, the efficiencies of pseudo attP site integration and evaluation of site-specific integration are compromised. To improve this system, we used an attB-TK fusion gene as a negative selection marker, thereby eliminating random integration during phiC31-mediated transfection. We also excised the selection system and plasmid bacterial backbone by using two other site-specific recombinases, Cre and Dre. Thus, we generated clean transgenic bovine fetal fibroblast cells free of selectable marker and plasmid bacterial backbone. These clean cells were used as donor nuclei for somatic cell nuclear transfer (SCNT), indicating a similar developmental competence of SCNT embryos to that of non-transgenic cells. Therefore, the present gene delivery system facilitated the development of gene therapy and agricultural biotechnology.
Bii, Victor M; Rae, Dustin T; Trobridge, Grant D
2015-11-24
Breast cancer (BC) is the second leading cause of malignancy among U.S. women. Metastasis results in a poor prognosis and increased mortality, but the molecular mechanisms by which metastatic tumors occur are not well understood. Identifying the genes that drive the metastatic process could provide targets for improved therapy and biomarkers to improve BC patient outcomes. Using a forward mutagenesis screen, BC cells mutagenized with a replication-incompetent gammaretroviral vector (γRV) were xenotransplanted into the mammary fat pad of immunodeficient mice. In this approach the vector provirus dysregulates nearby genes, providing a selective advantage to transduced cells to form metastases. Metastatic tumors were analyzed for proviral integration sites to identify nearby candidate metastasis genes. The γRV has a transgene cassette that allows for rescue in bacteria and rapid identification of vector integration sites. Using this approach, we identified the previously described metastasis gene WWTR1 (TAZ), and three other novel candidate metastasis genes including SHARPIN. SHARPIN was independently validated in vivo as a BC metastasis gene. Analysis of patient data showed that SHARPIN expression predicts metastasis-free survival after adjuvant therapy. Our approach has broad potential to identify genes involved in oncogenic processes for BC and other cancers. We show here it can identify both known (WWTR1) and novel (SHARPIN) BC metastasis genes.
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.
Auvray, F; Coddeville, M; Ritzenthaler, P; Dupont, L
1997-01-01
Bacteriophage mv4 is a temperate phage infecting Lactobacillus delbrueckii subsp. bulgaricus. During lysogenization, the phage integrates its genome into the host chromosome at the 3' end of a tRNA(Ser) gene through a site-specific recombination process (L. Dupont et al., J. Bacteriol., 177:586-595, 1995). A nonreplicative vector (pMC1) based on the mv4 integrative elements (attP site and integrase-coding int gene) is able to integrate into the chromosome of a wide range of bacterial hosts, including Lactobacillus plantarum, Lactobacillus casei (two strains), Lactococcus lactis subsp. cremoris, Enterococcus faecalis, and Streptococcus pneumoniae. Integrative recombination of pMC1 into the chromosomes of all of these species is dependent on the int gene product and occurs specifically at the pMC1 attP site. The isolation and sequencing of pMC1 integration sites from these bacteria showed that in lactobacilli, pMC1 integrated into the conserved tRNA(Ser) gene. In the other bacterial species where this tRNA gene is less or not conserved; secondary integration sites either in potential protein-coding regions or in intergenic DNA were used. A consensus sequence was deduced from the analysis of the different integration sites. The comparison of these sequences demonstrated the flexibility of the integrase for the bacterial integration site and suggested the importance of the trinucleotide CCT at the 5' end of the core in the strand exchange reaction. PMID:9068626
Heilbronner, Simon; Monk, Ian R; Foster, Timothy J
2013-11-01
Staphylococcus lugdunensis is a coagulase negative staphylococcus that is a commensal of man and an opportunistic pathogen. A site-specific integrative plasmid for the use in S. lugdunensis was constructed and validated. The integrase gene ccrB of bacteriophage ϕSL01 together with its attachment site was cloned into the thermosensitive plasmid pIMAY. The resulting plasmid pIPI03 integrated RecA-independently, site-specifically and irreversibly into the S. lugdunensis chromosome. Two IPTG-inducible antibiotic resistance determinants were cloned into pIPI03 and the derivatives were used to construct strains suitable for competitive growth experiments in both in vitro and in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.
Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma
2009-03-01
Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.
TreeVector: scalable, interactive, phylogenetic trees for the web.
Pethica, Ralph; Barker, Gary; Kovacs, Tim; Gough, Julian
2010-01-28
Phylogenetic trees are complex data forms that need to be graphically displayed to be human-readable. Traditional techniques of plotting phylogenetic trees focus on rendering a single static image, but increases in the production of biological data and large-scale analyses demand scalable, browsable, and interactive trees. We introduce TreeVector, a Scalable Vector Graphics-and Java-based method that allows trees to be integrated and viewed seamlessly in standard web browsers with no extra software required, and can be modified and linked using standard web technologies. There are now many bioinformatics servers and databases with a range of dynamic processes and updates to cope with the increasing volume of data. TreeVector is designed as a framework to integrate with these processes and produce user-customized phylogenies automatically. We also address the strengths of phylogenetic trees as part of a linked-in browsing process rather than an end graphic for print. TreeVector is fast and easy to use and is available to download precompiled, but is also open source. It can also be run from the web server listed below or the user's own web server. It has already been deployed on two recognized and widely used database Web sites.
Sites of Retroviral DNA Integration: From Basic Research to Clinical Applications
Serrao, Erik; Engelman, Alan N.
2016-01-01
One of the most crucial steps in the life cycle of a retrovirus is the integration of the viral DNA (vDNA) copy of the RNA genome into the genome of an infected host cell. Integration provides for efficient viral gene expression as well as for the segregation of the viral genomes to daughter cells upon cell division. Some integrated viruses are not well expressed, and cells latently infected with HIV-1 can resist the action of potent antiretroviral drugs and remain dormant for decades. Intensive research has been dedicated to understanding the catalytic mechanism of integration, as well as the viral and cellular determinants that influence integration site distribution throughout the host genome. In this review we summarize the evolution of techniques that have been used to recover and map retroviral integration sites, from the early days that first indicated that integration could occur in multiple cellular DNA locations, to current technologies that map upwards of millions of unique integration sites from single in vitro integration reactions or cell culture infections. We further review important insights gained from the use of such mapping techniques, including the monitoring of cell clonal expansion in patients treated with retrovirus-based gene therapy vectors, or AIDS patients on suppressive antiretroviral therapy (ART). These insights span from integrase (IN) enzyme sequence preferences within target DNA (tDNA) at the sites of integration, to the roles of host cellular proteins in mediating global integration distribution, to the potential relationship between genomic location of vDNA integration site and retroviral latency. PMID:26508664
Compass cues used by a nocturnal bull ant, Myrmecia midas.
Freas, Cody A; Narendra, Ajay; Cheng, Ken
2017-05-01
Ants use both terrestrial landmarks and celestial cues to navigate to and from their nest location. These cues persist even as light levels drop during the twilight/night. Here, we determined the compass cues used by a nocturnal bull ant, Myrmecia midas , in which the majority of individuals begin foraging during the evening twilight period. Myrmecia midas foragers with vectors of ≤5 m when displaced to unfamiliar locations did not follow the home vector, but instead showed random heading directions. Foragers with larger home vectors (≥10 m) oriented towards the fictive nest, indicating a possible increase in cue strength with vector length. When the ants were displaced locally to create a conflict between the home direction indicated by the path integrator and terrestrial landmarks, foragers oriented using landmark information exclusively and ignored any accumulated home vector regardless of vector length. When the visual landmarks at the local displacement site were blocked, foragers were unable to orient to the nest direction and their heading directions were randomly distributed. Myrmecia midas ants typically nest at the base of the tree and some individuals forage on the same tree. Foragers collected on the nest tree during evening twilight were unable to orient towards the nest after small lateral displacements away from the nest. This suggests the possibility of high tree fidelity and an inability to extrapolate landmark compass cues from information collected on the tree and at the nest site to close displacement sites. © 2017. Published by The Company of Biologists Ltd.
LEDGF/p75 interacts with mRNA splicing factors and targets HIV-1 integration to highly spliced genes
Singh, Parmit Kumar; Plumb, Matthew R.; Ferris, Andrea L.; Iben, James R.; Wu, Xiaolin; Fadel, Hind J.; Luke, Brian T.; Esnault, Caroline; Poeschla, Eric M.; Hughes, Stephen H.; Kvaratskhelia, Mamuka; Levin, Henry L.
2015-01-01
The host chromatin-binding factor LEDGF/p75 interacts with HIV-1 integrase and directs integration to active transcription units. To understand how LEDGF/p75 recognizes transcription units, we sequenced 1 million HIV-1 integration sites isolated from cultured HEK293T cells. Analysis of integration sites showed that cancer genes were preferentially targeted, raising concerns about using lentivirus vectors for gene therapy. Additional analysis led to the discovery that introns and alternative splicing contributed significantly to integration site selection. These correlations were independent of transcription levels, size of transcription units, and length of the introns. Multivariate analysis with five parameters previously found to predict integration sites showed that intron density is the strongest predictor of integration density in transcription units. Analysis of previously published HIV-1 integration site data showed that integration density in transcription units in mouse embryonic fibroblasts also correlated strongly with intron number, and this correlation was absent in cells lacking LEDGF. Affinity purification showed that LEDGF/p75 is associated with a number of splicing factors, and RNA sequencing (RNA-seq) analysis of HEK293T cells lacking LEDGF/p75 or the LEDGF/p75 integrase-binding domain (IBD) showed that LEDGF/p75 contributes to splicing patterns in half of the transcription units that have alternative isoforms. Thus, LEDGF/p75 interacts with splicing factors, contributes to exon choice, and directs HIV-1 integration to transcription units that are highly spliced. PMID:26545813
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-01-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population. PMID:9032306
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-03-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population.
Kemppainen, Minna J.; Pardo, Alejandro G.
2010-01-01
Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319
Modeling vector-borne disease risk in migratory animals under climate change.
Hall, Richard J; Brown, Leone M; Altizer, Sonia
2016-08-01
Recent theory suggests that animals that migrate to breed at higher latitudes may benefit from reduced pressure from natural enemies, including pathogens ("migratory escape"), and that migration itself weeds out infected individuals and lowers infection prevalence ("migratory culling"). The distribution and activity period of arthropod disease vectors in temperate regions is expected to respond rapidly to climate change, which could reduce the potential for migratory escape. However, climate change could have the opposite effect of reducing transmission if differential responses in the phenology and distribution of migrants and disease vectors reduce their overlap in space and time. Here we outline a simple modeling framework for exploring the influence of climate change on vector-borne disease dynamics in a migratory host. We investigate two scenarios under which pathogen transmission dynamics might be mediated by climate change: (1) vectors respond more rapidly than migrants to advancing phenology at temperate breeding sites, causing peak susceptible host density and vector emergence to diverge ("migratory mismatch") and (2) reduced migratory propensity allows increased nonbreeding survival of infected hosts and larger breeding-site epidemics (loss of migratory culling, here referred to as "sedentary amplification"). Our results highlight the need for continued surveillance of climate-induced changes to migratory behavior and vector activity to predict pathogen prevalence and its impacts on migratory animals. © The Author 2016. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.
Pinto, Filipe; Pacheco, Catarina C.; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C.; Urchueguía, Javier F.; Tamagnini, Paula
2015-01-01
The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. PMID:26490728
Analysis of the site-specific integration system of the Streptomyces aureofaciens phage μ1/6.
Farkašovská, Jarmila; Godány, Andrej
2012-03-01
The bacteriophage μ1/6 integrates its DNA into the chromosome of tetracycline producing strains of Streptomyces aureofaciens by a site-specific recombination process. A bioinformatic analysis of the μ1/6 genome revealed that orf5 encodes a putative integrase, a basic protein of 416 amino acids. The μ1/6 integrase was found to belong to the integrase family of site-specific tyrosine recombinases. The phage attachment site (attP) was localized downstream of the int gene. The attachment junctions (attL and attR) were determined, allowing identification of the bacterial attachment site (attB). All attachment sites shared a 46-bp common core sequence within which a site-specific recombination occurs. This core sequence comprises the 3' end of a putative tRNA(Thr) gene (anticodon TGT) which is completely restored in attL after integration of the phage into the host genome. An integration vector containing μ1/6 int-attP region was inserted stably into the S. aureofaciens B96, S. lividans TK24, and S. coelicolor A3. The μ1/6 integrase was shown to be functional in vivo in heterologous Escherichia coli without any other factors encoded by Streptomyces. In vitro recombination assay using purified μ1/6 integrase demonstrated its ability to catalyze integrative recombination in the presence of a crude extract of E. coli cells.
Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich
2005-12-01
Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Gold, Peter O.; Cowgill, Eric; Kreylos, Oliver; Gold, Ryan D.
2012-01-01
Three-dimensional (3D) slip vectors recorded by displaced landforms are difficult to constrain across complex fault zones, and the uncertainties associated with such measurements become increasingly challenging to assess as landforms degrade over time. We approach this problem from a remote sensing perspective by using terrestrial laser scanning (TLS) and 3D structural analysis. We have developed an integrated TLS data collection and point-based analysis workflow that incorporates accurate assessments of aleatoric and epistemic uncertainties using experimental surveys, Monte Carlo simulations, and iterative site reconstructions. Our scanning workflow and equipment requirements are optimized for single-operator surveying, and our data analysis process is largely completed using new point-based computing tools in an immersive 3D virtual reality environment. In a case study, we measured slip vector orientations at two sites along the rupture trace of the 1954 Dixie Valley earthquake (central Nevada, United States), yielding measurements that are the first direct constraints on the 3D slip vector for this event. These observations are consistent with a previous approximation of net extension direction for this event. We find that errors introduced by variables in our survey method result in <2.5 cm of variability in components of displacement, and are eclipsed by the 10–60 cm epistemic errors introduced by reconstructing the field sites to their pre-erosion geometries. Although the higher resolution TLS data sets enabled visualization and data interactivity critical for reconstructing the 3D slip vector and for assessing uncertainties, dense topographic constraints alone were not sufficient to significantly narrow the wide (<26°) range of allowable slip vector orientations that resulted from accounting for epistemic uncertainties.
MLV integration site selection is driven by strong enhancers and active promoters
LaFave, Matthew C.; Varshney, Gaurav K.; Gildea, Derek E.; Wolfsberg, Tyra G.; Baxevanis, Andreas D.; Burgess, Shawn M.
2014-01-01
Retroviruses integrate into the host genome in patterns specific to each virus. Understanding the causes of these patterns can provide insight into viral integration mechanisms, pathology and genome evolution, and is critical to the development of safe gene therapy vectors. We generated murine leukemia virus integrations in human HepG2 and K562 cells and subjected them to second-generation sequencing, using a DNA barcoding technique that allowed us to quantify independent integration events. We characterized >3 700 000 unique integration events in two ENCODE-characterized cell lines. We find that integrations were most highly enriched in a subset of strong enhancers and active promoters. In both cell types, approximately half the integrations were found in <2% of the genome, demonstrating genomic influences even narrower than previously believed. The integration pattern of murine leukemia virus appears to be largely driven by regions that have high enrichment for multiple marks of active chromatin; the combination of histone marks present was sufficient to explain why some strong enhancers were more prone to integration than others. The approach we used is applicable to analyzing the integration pattern of any exogenous element and could be a valuable preclinical screen to evaluate the safety of gene therapy vectors. PMID:24464997
Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés
2012-11-01
Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.
2012-01-01
Background Analysis is lacking on the management of vector control systems in disease-endemic countries with respect to the efficiency and sustainability of operations. Methods Three locations were selected, at the scale of province, municipality and barangay (i.e. village). Data on disease incidence, programme activities, and programme management were collected on-site through meetings and focus group discussions. Results Adaptation of disease control strategies to the epidemiological situation per barangay, through micro-stratification, brings gains in efficiency, but should be accompanied by further capacity building on local situational analysis for better selection and targeting of vector control interventions within the barangay. An integrated approach to vector control, aiming to improve the rational use of resources, was evident with a multi-disease strategy for detection and response, and by the use of combinations of vector control methods. Collaboration within the health sector was apparent from the involvement of barangay health workers, re-orientation of job descriptions and the creation of a disease surveillance unit. The engagement of barangay leaders and use of existing community structures helped mobilize local resources and voluntary services for vector control. In one location, local authorities and the community were involved in the planning, implementation and evaluation of malaria control, which triggered local programme ownership. Conclusions Strategies that contributed to an improved efficiency and sustainability of vector control operations were: micro-stratification, integration of vector control within the health sector, a multi-disease approach, involvement of local authorities, and empowerment of communities. Capacity building on situational analysis and vector surveillance should be addressed through national policy and guidelines. PMID:22873707
Hsu, Cary; Jones, Stephanie A.; Cohen, Cyrille J.; Zheng, Zhili; Kerstann, Keith; Zhou, Juhua; Robbins, Paul F.; Peng, Peter D.; Shen, Xinglei; Gomes, Theotonius J.; Dunbar, Cynthia E.; Munroe, David J.; Stewart, Claudia; Cornetta, Kenneth; Wangsa, Danny; Ried, Thomas; Rosenberg, Steven A.
2007-01-01
Malignancies arising from retrovirally transduced hematopoietic stem cells have been reported in animal models and human gene therapy trials. Whether mature lymphocytes are susceptible to insertional mutagenesis is unknown. We have characterized a primary human CD8+ T-cell clone, which exhibited logarithmic ex vivo growth in the absence of exogenous cytokine support for more than 1 year after transduction with a murine leukemia virus–based vector encoding the T-cell growth factor IL-15. Phenotypically, the clone was CD28−, CD45RA−, CD45RO+, and CD62L−, a profile consistent with effector memory T lymphocytes. After gene transfer with tumor-antigen–specific T-cell receptors, the clone secreted IFN-γ upon encountering tumor targets, providing further evidence that they derived from mature lymphocytes. Gene-expression analyses revealed no evidence of insertional activation of genes flanking the retroviral insertion sites. The clone exhibited constitutive telomerase activity, and the presence of autocrine loop was suggested by impaired cell proliferation following knockdown of IL-15Rα expression. The generation of this cell line suggests that nonphysiologic expression of IL-15 can result in the long-term in vitro growth of mature human T lymphocytes. The cytokine-independent growth of this line was a rare event that has not been observed in other IL-15 vector transduction experiments or with any other integrating vector system. It does not appear that the retroviral vector integration sites played a role in the continuous growth of this cell clone, but this remains under investigation. PMID:17353346
Rydzanicz, Katarzyna; Lonc, Elzbieta; Becker, Norbert
2009-01-01
Current strategy of Integrated Vector Management (IVM) comprises the general approach of environmentally friendly control measures. With regard to mosquitoes it includes first of all application of microbial insecticides based on Bacillus thuringiensis israelensis (Bti) and B. sphaericus (Bs) delta-endotoxins as well as the reduction of breeding habitats and natural enemy augmentation. It can be achieved thorough implementation of the interdisciplinary program, i. e., understanding of mosquito vector ecology, the appropriate vector-diseases (e. g., malariometric) measurements and training of local personnel responsible for mosquito abatement activities, as well as community involvement. Biocontrol methods as an alternative to chemical insecticides result from the sustainability development concept, growing awareness of environmental pollution and the development of insecticide-resistant strains of vector-mosquito populations in many parts of the world. Although sustainable trends are usually considered in terms of the monetary and training resources within countries, environmental concerns are actually more limiting factors for the duration of an otherwise successful vector control effort. In order to meet these new needs, increasing efforts have been made in search of and application of natural enemies, such as parasites, bacterial pathogens and predators which may control populations of insect vectors. The biological control agent based on the bacterial toxins Bti and Bs has been used in the Wrocław's University and Municipal Mosquito Control Programs since 1998. In West-Africa biocontrol appears to be an effective and safe tool to combat malaria in addition to bed-nets, residual indoor spraying and appropriate diagnosis and treatment of malaria parasites which are the major tools in the WHO Roll Back Malaria Program. IVM studies carried out 2005-2008 in Cotonou (Benin) as well those in Wrocław Irrigated Fields during the last years include the following major steps: 1. Mapping of all breeding sites in the project area and recording data in a geographical information system (GIS/relational database). All districts, streets and houses are numbered for quick reference during the operation; 2. Studying mosquito vector bionomics, migration and vectorial capacity in the project area, before, during and after the routine Bti treatments; 3. Assessment of the optimum for effective larvicide insecticide dosages at major breeding sites against the different target mosquito species; 4. Implementation of the microbial control agents in the integrated routine program. Adaptation of the application equipment to the local situation, training of the field staff, and routine treatments; 5. Conducting surveillance of vector-disease (e. g., malariometric) parameters in the control and experimental area before, during, and after the application of biocontrol agents.
Efficient disruption of Zebrafish genes using a Gal4-containing gene trap
2013-01-01
Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702
Chouaïbou, Mouhamadou S; Fodjo, Behi K; Fokou, Gilbert; Allassane, Ouattara F; Koudou, Benjamin G; David, Jean-Philippe; Antonio-Nkondjio, Christophe; Ranson, Hilary; Bonfoh, Bassirou
2016-08-24
Vector control can contribute to the development of resistance to insecticides in malaria vectors. As the swamps and wetlands used for some agricultural activities constitute productive breeding sites for many mosquito species, agricultural pest control may increase the selection pressure for insecticide resistance in mosquitoes. Understanding the use of agrochemicals by farmers is important to plan and initiate effective integrated pest and vector management interventions. A knowledge-attitude-practice study, using questionnaires, was undertaken with 102 rice farmers in Tiassalé and 106 vegetable farmers in Dabou (South Côte d'Ivoire) in order to generate information on pesticide usage. In addition, insecticide susceptibility bioassays were conducted using adult mosquitoes obtained from larvae collected within farms, and the persistence of agricultural pesticides in the farming environment, including sediment and mosquito breeding site water, was investigated by HPLC. Herbicides and insecticides appeared to be the most frequently used pesticides for both crops. Amino phosphonates (mostly glyphosate) represented the most used herbicides (45 % for rice up to 89 % for vegetables). Pyrethroids appeared to be the most used insecticides (accounting for 90 % of all the insecticide use reported). Approximately 75 % of respondents had not been to school and do not understand product labels. Only about 45 % of farmers respect the recommended pesticide dosage and about 10-15 % of pesticides used for rice and vegetable, respectively, are not recommended for these crops. As per WHO criteria, the mosquito local populations from the two localities were resistant to three of the four insecticides tested, as mortalities were less than 35 % for deltamethrin, DDT and bendiocarb. Higher susceptibility was observed for malathion, although the population was considered resistant in Dabou (80 % mortality) and susceptible in Tiassalé (98 % mortality). With the exception of glyphosate, residues from each of six chemicals tested for were detected in each of the sites visited in the two localities. The study describes the use of insecticides and herbicides on crops and highlights the importance of considering agriculture practices when attempting to manage resistance in malaria vectors. Inter-sectoral collaboration between agriculture and public health is required to develop efficient integrated pest and vector management interventions.
Herpes simplex virus type 1-derived recombinant and amplicon vectors.
Fraefel, Cornel; Marconi, Peggy; Epstein, Alberto L
2011-01-01
Herpes simplex virus type 1 (HSV-1) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153 kbp double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes (1) the two approaches most commonly used to prepare recombinant vectors through homologous recombination, either in eukaryotic cells or in bacteria, and (2) the two methodologies currently used to generate helper-free amplicon vectors, either using a bacterial artificial chromosome (BAC)-based approach or a Cre/loxP site-specific recombination strategy.
Stable long-term blood formation by stem cells in murine steady-state hematopoiesis.
Zavidij, Oksana; Ball, Claudia R; Herbst, Friederike; Oppel, Felix; Fessler, Sylvia; Schmidt, Manfred; von Kalle, Christof; Glimm, Hanno
2012-09-01
Hematopoietic stem cells (HSCs) generate all mature blood cells during the whole lifespan of an individual. However, the clonal contribution of individual HSC and progenitor cells in steady-state hematopoiesis is poorly understood. To investigate the activity of HSCs under steady-state conditions, murine HSC and progenitor cells were genetically marked in vivo by integrating lentiviral vectors (LVs) encoding green fluorescent protein (GFP). Hematopoietic contribution of individual marked clones was monitored by determination of lentiviral integration sites using highly sensitive linear amplification-mediated-polymerase chain reaction. A remarkably stable small proportion of hematopoietic cells expressed GFP in LV-injected animals for up to 24 months, indicating stable marking of murine steady-state hematopoiesis. Analysis of the lentiviral integration sites revealed that multiple hematopoietic clones with both myeloid and lymphoid differentiation potential contributed to long-term hematopoiesis. In contrast to intrafemoral vector injection, intravenous administration of LV preferentially targeted short-lived progenitor cells. Myelosuppressive treatment of mice prior to LV-injection did not affect the marking efficiency. Our study represents the first continuous analysis of clonal behavior of genetically marked hematopoietic cells in an unmanipulated system, providing evidence that multiple clones are simultaneously active in murine steady-state hematopoiesis. Copyright © 2012 AlphaMed Press.
NASA Astrophysics Data System (ADS)
Trawinski, P. R.; Mackay, D. S.
2009-03-01
The objective of this study is to quantify and model spatial dependence in mosquito vector populations and develop predictions for unsampled locations using geostatistics. Mosquito control program trap sites are often located too far apart to detect spatial dependence but the results show that integration of spatial data over time for Cx. pipiens-restuans and according to meteorological conditions for Ae. vexans enables spatial analysis of sparse sample data. This study shows that mosquito abundance is spatially correlated and that spatial dependence differs between Cx. pipiens-restuans and Ae. vexans mosquitoes.
Nuclease-free Adeno-Associated Virus-Mediated Il2rg Gene Editing in X-SCID Mice.
Hiramoto, Takafumi; Li, Li B; Funk, Sarah E; Hirata, Roli K; Russell, David W
2018-05-02
X-linked severe combined immunodeficiency (X-SCID) has been successfully treated by hematopoietic stem cell (HSC) transduction with retroviral vectors expressing the interleukin-2 receptor subunit gamma gene (IL2RG), but several patients developed malignancies due to vector integration near cellular oncogenes. This adverse side effect could in principle be avoided by accurate IL2RG gene editing with a vector that does not contain a functional promoter or IL2RG gene. Here, we show that adeno-associated virus (AAV) gene editing vectors can insert a partial Il2rg cDNA at the endogenous Il2rg locus in X-SCID murine bone marrow cells and that these ex vivo-edited cells repopulate transplant recipients and produce CD4 + and CD8 + T cells. Circulating, edited lymphocytes increased over time and appeared in secondary transplant recipients, demonstrating successful editing in long-term repopulating cells. Random vector integration events were nearly undetectable, and malignant transformation of the transplanted cells was not observed. Similar editing frequencies were observed in human hematopoietic cells. Our results demonstrate that therapeutically relevant HSC gene editing can be achieved by AAV vectors in the absence of site-specific nucleases and suggest that this may be a safe and effective therapy for hematopoietic diseases where in vivo selection can increase edited cell numbers. Copyright © 2018 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
A Multi-Index Integrated Change detection method for updating the National Land Cover Database
Jin, Suming; Yang, Limin; Xian, George Z.; Danielson, Patrick; Homer, Collin G.
2010-01-01
Land cover change is typically captured by comparing two or more dates of imagery and associating spectral change with true thematic change. A new change detection method, Multi-Index Integrated Change (MIIC), has been developed to capture a full range of land cover disturbance patterns for updating the National Land Cover Database (NLCD). Specific indices typically specialize in identifying only certain types of disturbances; for example, the Normalized Burn Ratio (NBR) has been widely used for monitoring fire disturbance. Recognizing the potential complementary nature of multiple indices, we integrated four indices into one model to more accurately detect true change between two NLCD time periods. The four indices are NBR, Normalized Difference Vegetation Index (NDVI), Change Vector (CV), and a newly developed index called the Relative Change Vector (RCV). The model is designed to provide both change location and change direction (e.g. biomass increase or biomass decrease). The integrated change model has been tested on five image pairs from different regions exhibiting a variety of disturbance types. Compared with a simple change vector method, MIIC can better capture the desired change without introducing additional commission errors. The model is particularly accurate at detecting forest disturbances, such as forest harvest, forest fire, and forest regeneration. Agreement between the initial change map areas derived from MIIC and the retained final land cover type change areas will be showcased from the pilot test sites.
Gonçalves, Juliana; Moreira, Elsa; Sequeira, Inês J.; Rodrigues, António S.; Rueff, José; Brás, Aldina
2016-01-01
Chromosomal fragile sites (FSs) are loci where gaps and breaks may occur and are preferential integration targets for some viruses, for example, Hepatitis B, Epstein-Barr virus, HPV16, HPV18, and MLV vectors. However, the integration of the human immunodeficiency virus (HIV) in Giemsa bands and in FSs is not yet completely clear. This study aimed to assess the integration preferences of HIV in FSs and in Giemsa bands using an in silico study. HIV integration positions from Jurkat cells were used and two nonparametric tests were applied to compare HIV integration in dark versus light bands and in FS versus non-FS (NFSs). The results show that light bands are preferential targets for integration of HIV-1 in Jurkat cells and also that it integrates with equal intensity in FSs and in NFSs. The data indicates that HIV displays different preferences for FSs compared to other viruses. The aim was to develop and apply an approach to predict the conditions and constraints of HIV insertion in the human genome which seems to adequately complement empirical data. PMID:27294106
Clément, Nathalie; Velu, Thierry; Brandenburger, Annick
2002-09-01
The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.
Would the control of invasive alien plants reduce malaria transmission? A review.
Stone, Christopher M; Witt, Arne B R; Walsh, Guillermo Cabrera; Foster, Woodbridge A; Murphy, Sean T
2018-02-01
Vector control has been the most effective preventive measure against malaria and other vector-borne diseases. However, due to concerns such as insecticide resistance and budget shortfalls, an integrated control approach will be required to ensure sustainable, long-term effectiveness. An integrated management strategy should entail some aspects of environmental management, relying on coordination between various scientific disciplines. Here, we review one such environmental control tactic: invasive alien plant management. This covers salient plant-mosquito interactions for both terrestrial and aquatic invasive plants and how these affect a vector's ability to transmit malaria. Invasive plants tend to have longer flowering durations, more vigorous growth, and their spread can result in an increase in biomass, particularly in areas where previously little vegetation existed. Some invasive alien plants provide shelter or resting sites for adult mosquitoes and are also attractive nectar-producing hosts, enhancing their vectorial capacity. We conclude that these plants may increase malaria transmission rates in certain environments, though many questions still need to be answered, to determine how often this conclusion holds. However, in the case of aquatic invasive plants, available evidence suggests that the management of these plants would contribute to malaria control. We also examine and review the opportunities for large-scale invasive alien plant management, including options for biological control. Finally, we highlight the research priorities that must be addressed in order to ensure that integrated vector and invasive alien plant management operate in a synergistic fashion.
Pinto, Filipe; Pacheco, Catarina C; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C; Urchueguía, Javier F; Tamagnini, Paula
2015-12-01
The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Killeen, G F; McKenzie, F E; Foy, B D; Schieffelin, C; Billingsley, P F; Beier, J C
2000-05-01
We have used a relatively simple but accurate model for predicting the impact of integrated transmission control on the malaria entomologic inoculation rate (EIR) at four endemic sites from across sub-Saharan Africa and the southwest Pacific. The simulated campaign incorporated modestly effective vaccine coverage, bed net use, and larval control. The results indicate that such campaigns would reduce EIRs at all four sites by 30- to 50-fold. Even without the vaccine, 15- to 25-fold reductions of EIR were predicted, implying that integrated control with a few modestly effective tools can meaningfully reduce malaria transmission in a range of endemic settings. The model accurately predicts the effects of bed nets and indoor spraying and demonstrates that they are the most effective tools available for reducing EIR. However, the impact of domestic adult vector control is amplified by measures for reducing the rate of emergence of vectors or the level of infectiousness of the human reservoir. We conclude that available tools, including currently neglected methods for larval control, can reduce malaria transmission intensity enough to alleviate mortality. Integrated control programs should be implemented to the fullest extent possible, even in areas of intense transmission, using simple models as decision-making tools. However, we also conclude that to eliminate malaria in many areas of intense transmission is beyond the scope of methods which developing nations can currently afford. New, cost-effective, practical tools are needed if malaria is ever to be eliminated from highly endemic areas.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065
Iyaloo, Diana P; Elahee, Khouaildi B; Bheecarry, Ambicadutt; Lees, Rosemary Susan
2014-04-01
Many novel approaches to controlling mosquito vectors through the release of sterile and mass reared males are being developed in the face of increasing insecticide resistance and other limitations of current methods. Before full scale release programmes can be undertaken there is a need for surveillance of the target population, and investigation of parameters such as dispersal and longevity of released, as compared to wild males through mark-release-recapture (MRR) and other experiments, before small scale pilot trials can be conducted. The nature of the sites used for this field work is crucial to ensure that a trial can feasibly collect sufficient and relevant information, given the available resources and practical limitations, and having secured the correct regulatory, community and ethical approvals and support. Mauritius is considering the inclusion of the sterile insect technique (SIT), for population reduction of Aedes albopictus, as a component of the Ministry of Health and Quality of Life's 'Operational Plan for Prevention and Control of Chikungunya and Dengue'. As part of an investigation into the feasibility of integrating the SIT into the Integrated Vector Management (IVM) scheme in Mauritius a pilot trial is planned. Two potential sites have been selected for this purpose, Pointe des Lascars and Panchvati, villages in the North East of the country, and population surveillance has commenced. This case study will here be used to explore the considerations which go into determining the most appropriate sites for mosquito field research. Although each situation is unique, and an ideal site may not be available, this discussion aims to help researchers to consider and balance the important factors and select field sites that will meet their needs. Copyright © 2013 International Atomic Energy Agency 2013. Published by Elsevier B.V. All rights reserved.
Data catalog for JPL Physical Oceanography Distributed Active Archive Center (PO.DAAC)
NASA Technical Reports Server (NTRS)
Digby, Susan
1995-01-01
The Physical Oceanography Distributed Active Archive Center (PO.DAAC) archive at the Jet Propulsion Laboratory contains satellite data sets and ancillary in-situ data for the ocean sciences and global-change research to facilitate multidisciplinary use of satellite ocean data. Geophysical parameters available from the archive include sea-surface height, surface-wind vector, surface-wind speed, surface-wind stress vector, sea-surface temperature, atmospheric liquid water, integrated water vapor, phytoplankton pigment concentration, heat flux, and in-situ data. PO.DAAC is an element of the Earth Observing System Data and Information System and is the United States distribution site for TOPEX/POSEIDON data and metadata.
Chromosomal integration of adenoviral vector DNA in vivo.
Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan
2010-10-01
So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.
Mechanisms of double-strand-break repair during gene targeting in mammalian cells.
Ng, P; Baker, M D
1999-01-01
In the present study, the mechanism of double-strand-break (DSB) repair during gene targeting at the chromosomal immunoglobulin mu-locus in a murine hybridoma was examined. The gene-targeting assay utilized specially designed insertion vectors genetically marked in the region of homology to the chromosomal mu-locus by six diagnostic restriction enzyme site markers. The restriction enzyme markers permitted the contribution of vector-borne and chromosomal mu-sequences in the recombinant product to be determined. The use of the insertion vectors in conjunction with a plating procedure in which individual integrative homologous recombination events were retained for analysis revealed several important features about the mammalian DSB repair process:The presence of the markers within the region of shared homology did not affect the efficiency of gene targeting.In the majority of recombinants, the vector-borne marker proximal to the DSB was absent, being replaced with the corresponding chromosomal restriction enzyme site. This result is consistent with either formation and repair of a vector-borne gap or an "end" bias in mismatch repair of heteroduplex DNA (hDNA) that favored the chromosomal sequence. Formation of hDNA was frequently associated with gene targeting and, in most cases, began approximately 645 bp from the DSB and could encompass a distance of at least 1469 bp.The hDNA was efficiently repaired prior to DNA replication.The repair of adjacent mismatches in hDNA occurred predominantly on the same strand, suggesting the involvement of a long-patch repair mechanism. PMID:10049929
Oter, Kerem; Gunay, Filiz; Tuzer, Erkut; Linton, Yvonne-Marie; Bellini, Romeo; Alten, Bulent
2013-10-01
Despite its confirmed establishment in neighboring Greece and Bulgaria, the presence of the Oriental invasive species Stegomyia albopicta (Skuse) (=Aedes albopictus) has never been confirmed in Turkey. Active surveillance for this container-breeding species was carried out using oviposition traps at 15 discrete sites in the towns of Ipsala (n=8 sites), Kesan (n=5) (Edirne District), and Malkara (n=2) (Tekirdag District) in the Thrace region of northwestern Turkey, from May 23 through November 10, 2011. Eggs collected were reared to the fourth larval instar and adult stages where possible to facilitate integrated morphological and molecular species identification. DNA barcodes (658 bp of the mitochondrial cytochrome c oxidase I [COI] gene) were compared with all four potentially invasive Stegomyia species: St. aegypti, St. albopicta, St. cretina, and St. japonica. Sequences generated for samples collected in Thrace Region were herein confirmed as St. albopicta, the first record of this vector species in Turkey. Eggs of St. albopicta were detected in two discrete localities: (1) In the grounds of a restaurant in Kesan (in week 36), and (2) in the customs area of the Turkish-Greek border at Ipsala (in weeks 32 and 38). Multiple detection of St. albopicta eggs indicates the possible establishment of the species in northwestern Turkey. Finding this important disease vector has implications for public health and requires the implementation of active vector monitoring programs and targeted vector suppression strategies to limit the spread of this invasive vector species in Turkey.
Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred
2015-01-01
Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.
NASA Astrophysics Data System (ADS)
Burdon, Daryl; Boyes, Suzanne J.; Elliott, Michael; Smyth, Katie; Atkins, Jonathan P.; Barnes, Richard A.; Wurzel, Rüdiger K.
2018-02-01
The management of marine resources is a complex process driven by the dynamics of the natural system and the influence of stakeholders including policy-makers. An integration of natural and social sciences research is required by policy-makers to better understand, and manage sustainably, natural changes and anthropogenic activities within particular marine systems. Given the uncertain development of activities in the marine environment, future scenarios assessments can be used to investigate whether marine policy measures are robust and sustainable. This paper develops an interdisciplinary framework, which incorporates future scenarios assessments, and identifies four main types of evaluation needed to integrate natural and social sciences research to support the integrated management of the marine environment: environmental policy and governance assessments; ecosystem services, indicators and valuation; modelling tools for management evaluations, and risk assessment and risk management. The importance of stakeholder engagement within each evaluation method is highlighted. The paper focuses on the transnational spatial marine management of the Dogger Bank, in the central North Sea, a site which is very important ecologically, economically and politically. Current management practices are reviewed, and research tools to support future management decisions are applied and discussed in relation to two main vectors of change affecting the Dogger Bank, namely commercial fisheries and offshore wind farm developments, and in relation to the need for nature conservation. The input of local knowledge through stakeholder engagement is highlighted as a necessary requirement to produce site-specific policy recommendations for the future management of the Dogger Bank. We present wider policy recommendations to integrate natural and social sciences in a global marine context.
Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja
2013-01-01
Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154
Barhoumi, Walid; Qualls, Whitney A.; Archer, Reginald; Fuller, Douglas O.; Chelbi, Ifhem; Cherni, Saifedine; Derbali, Mohamed; Arheart, Kristopher L.; Zhioua, Elyes; Beier, John C.
2015-01-01
The distribution expansion of important human visceral leishmaniasis (HVL) and sporadic cutaneous leishmaniasis (SCL) vector species, Phlebotomus perfiliewi and P. perniciosus, throughout central Tunisia is a major public health concern. This study was designed to investigate if the expansion of irrigation influences the abundance of sand fly species potentially involved in the transmission of HVL and SCL located in arid bioclimatic regions. Geographic and remote sensing approaches were used to predict the density of visceral leishmaniasis vectors in Tunisia. Entomological investigations were performed in the governorate of Sidi Bouzid, located in the arid bioclimatic region of Tunisia. In 2012, sand flies were collected by CDC light traps located at nine irrigated and nine non-irrigated sites to determine species abundance. Eight species in two genera were collected. Among sand flies of the subgenus Larroussius, P. perfiliewi was the only species collected significantly more in irrigated areas. Trap data were then used to develop Poisson regression models to map the apparent density of important sand fly species as a function of different environmental covariates including climate and vegetation density. The density of P. perfiliewi is predicted to be moderately high in the arid regions. These results highlight that the abundance of P. perfiliewi is associated with the development of irrigated areas and suggests that the expansion of this species will continue to more arid areas of the country as irrigation sites continue to be developed in the region. The continued increase in irrigated areas in the Middle East and North Africa region deserves attention, as it is associated with the spread of L. infantum vector P. perfiliewi. Integrated vector management strategies targeting irrigation structures to reduce sand fly vector populations should be evaluated in light of these findings. PMID:25447265
KILLEEN, GERRY F.; McKENZIE, F. ELLIS; FOY, BRIAN D.; SCHIEFFELIN, CATHERINE; BILLINGSLEY, PETER F.; BEIER, JOHN C.
2008-01-01
We have used a relatively simple but accurate model for predicting the impact of integrated transmission control on the malaria entomologic inoculation rate (EIR) at four endemic sites from across sub-Saharan Africa and the southwest Pacific. The simulated campaign incorporated modestly effective vaccine coverage, bed net use, and larval control. The results indicate that such campaigns would reduce EIRs at all four sites by 30- to 50-fold. Even without the vaccine, 15- to 25-fold reductions of EIR were predicted, implying that integrated control with a few modestly effective tools can meaningfully reduce malaria transmission in a range of endemic settings. The model accurately predicts the effects of bed nets and indoor spraying and demonstrates that they are the most effective tools available for reducing EIR. However, the impact of domestic adult vector control is amplified by measures for reducing the rate of emergence of vectors or the level of infectiousness of the human reservoir. We conclude that available tools, including currently neglected methods for larval control, can reduce malaria transmission intensity enough to alleviate mortality. Integrated control programs should be implemented to the fullest extent possible, even in areas of intense transmission, using simple models as decision-making tools. However, we also conclude that to eliminate malaria in many areas of intense transmission is beyond the scope of methods which developing nations can currently afford. New, cost-effective, practical tools are needed if malaria is ever to be eliminated from highly endemic areas. PMID:11289662
Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S
2017-04-01
Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.
Mohien, Ceereena Ubaida; Colquhoun, David R.; Mathias, Derrick K.; Gibbons, John G.; Armistead, Jennifer S.; Rodriguez, Maria C.; Rodriguez, Mario Henry; Edwards, Nathan J.; Hartler, Jürgen; Thallinger, Gerhard G.; Graham, David R.; Martinez-Barnetche, Jesus; Rokas, Antonis; Dinglasan, Rhoel R.
2013-01-01
Malaria morbidity and mortality caused by both Plasmodium falciparum and Plasmodium vivax extend well beyond the African continent, and although P. vivax causes between 80 and 300 million severe cases each year, vivax transmission remains poorly understood. Plasmodium parasites are transmitted by Anopheles mosquitoes, and the critical site of interaction between parasite and host is at the mosquito's luminal midgut brush border. Although the genome of the “model” African P. falciparum vector, Anopheles gambiae, has been sequenced, evolutionary divergence limits its utility as a reference across anophelines, especially non-sequenced P. vivax vectors such as Anopheles albimanus. Clearly, technologies and platforms that bridge this substantial scientific gap are required in order to provide public health scientists with key transcriptomic and proteomic information that could spur the development of novel interventions to combat this disease. To our knowledge, no approaches have been published that address this issue. To bolster our understanding of P. vivax–An. albimanus midgut interactions, we developed an integrated bioinformatic-hybrid RNA-Seq-LC-MS/MS approach involving An. albimanus transcriptome (15,764 contigs) and luminal midgut subproteome (9,445 proteins) assembly, which, when used with our custom Diptera protein database (685,078 sequences), facilitated a comparative proteomic analysis of the midgut brush borders of two important malaria vectors, An. gambiae and An. albimanus. PMID:23082028
Ubaida Mohien, Ceereena; Colquhoun, David R; Mathias, Derrick K; Gibbons, John G; Armistead, Jennifer S; Rodriguez, Maria C; Rodriguez, Mario Henry; Edwards, Nathan J; Hartler, Jürgen; Thallinger, Gerhard G; Graham, David R; Martinez-Barnetche, Jesus; Rokas, Antonis; Dinglasan, Rhoel R
2013-01-01
Malaria morbidity and mortality caused by both Plasmodium falciparum and Plasmodium vivax extend well beyond the African continent, and although P. vivax causes between 80 and 300 million severe cases each year, vivax transmission remains poorly understood. Plasmodium parasites are transmitted by Anopheles mosquitoes, and the critical site of interaction between parasite and host is at the mosquito's luminal midgut brush border. Although the genome of the "model" African P. falciparum vector, Anopheles gambiae, has been sequenced, evolutionary divergence limits its utility as a reference across anophelines, especially non-sequenced P. vivax vectors such as Anopheles albimanus. Clearly, technologies and platforms that bridge this substantial scientific gap are required in order to provide public health scientists with key transcriptomic and proteomic information that could spur the development of novel interventions to combat this disease. To our knowledge, no approaches have been published that address this issue. To bolster our understanding of P. vivax-An. albimanus midgut interactions, we developed an integrated bioinformatic-hybrid RNA-Seq-LC-MS/MS approach involving An. albimanus transcriptome (15,764 contigs) and luminal midgut subproteome (9,445 proteins) assembly, which, when used with our custom Diptera protein database (685,078 sequences), facilitated a comparative proteomic analysis of the midgut brush borders of two important malaria vectors, An. gambiae and An. albimanus.
Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.
Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika
2013-01-01
Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.
Yan, Qing; Quan, Yuan; Sun, Huanhuan; Peng, Xinmiao; Zou, Zhengyun; Alcorn, Joseph L; Wetsel, Rick A; Wang, Dachun
2014-02-01
Human induced pluripotent stem cells (hiPSCs) have great therapeutic potential in repairing defective lung alveoli. However, genetic abnormalities caused by vector integrations and low efficiency in generating hiPSCs, as well as difficulty in obtaining transplantable hiPSC-derived cell types are still major obstacles. Here we report a novel strategy using a single nonviral site-specific targeting vector with a combination of Tet-On inducible gene expression system, Cre/lox P switching gene expression system, and alveolar epithelial type II cell (ATIIC)-specific Neomycin(R) transgene expression system. With this strategy, a single copy of all of the required transgenes can be specifically knocked into a site immediately downstream of β-2-microglobulin (B2M) gene locus at a high frequency, without causing B2M dysfunction. Thus, the expression of reprogramming factors, Oct4, Sox2, cMyc, and Klf4, can be precisely regulated for efficient reprogramming of somatic cells into random integration-free or genetic mutation-free hiPSCs. The exogenous reprogramming factor transgenes can be subsequently removed after reprogramming by transient expression of Cre recombinase, and the resulting random integration-free and exogenous reprogramming factor-free hiPSCs can be selectively differentiated into a homogenous population of ATIICs. In addition, we show that these hiPSC-derived ATIICs exhibit ultrastructural characteristics and biological functions of normal ATIICs. When transplanted into bleomycin-challenged mice lungs, hiPSC-derived ATIICs efficiently remain and re-epithelialize injured alveoli to restore pulmonary function, preventing lung fibrosis and increasing survival without tumorigenic side effect. This strategy allows for the first time efficient generation of patient-specific ATIICs for possible future clinical applications. © 2013 AlphaMed Press.
Yan, Qing; Quan, Yuan; Sun, Huanhuan; Peng, Xinmiao; Zou, Zhengyun; Alcorn, Joseph L.; Wetsel, Rick A.; Wang, Dachun
2013-01-01
Human induced pluripotent stem cells (hiPSCs) have great therapeutic potential in repairing defective lung alveoli. However, genetic abnormalities caused by vector-integrations and low efficiency in generating hiPSCs, as well as difficulty in obtaining transplantable hiPSC-derived cell types, are still major obstacles. Here we report a novel strategy using a single non-viral site-specific-targeting vector with a combination of Tet-On inducible gene expression system, Cre/lox P switching gene expression system, and alveolar epithelial type II cell (ATIIC)-specific NeomycinR trangene expression system. With this strategy, a single copy of all of the required transgenes can be specifically knocked into a site immediately downstream of beta-2-microglobulin (B2M) gene locus at a high frequency, without causing B2M dysfunction. Thus, the expression of reprogramming factors, Oct4, Sox2, cMyc and Klf4, can be precisely regulated for efficient reprogramming of somatic cells into random-integration-free or genetic mutation-free hiPSCs. The exogenous reprogramming factor transgenes can be subsequently removed after reprogramming by transient expression of Cre recombinase, and the resulting random-integration-free and exogenous reprogramming-factor-free hiPSCs can be selectively differentiated into a homogenous population of ATIICs. In addition, we show that these hiPSC-derived ATIICs exhibit ultra-structural characteristics and biological functions of normal ATIICs. When transplanted into bleomycin-challenged mice lungs, hiPSC-derived ATIICs efficiently remain and re-epithelialize injured alveoli to restore pulmonary function, preventing lung fibrosis and increasing survival without tumorigenic side effect. This strategy allows for the first time efficient generation of patient-specific ATIICs for possible future clinical applications. PMID:24123810
Li, Chun-Fang
2007-12-15
A unified description of free-space cylindrical vector beams is presented that is an integral transformation solution to the vector Helmholtz equation and the transversality condition. In the paraxial condition, this solution not only includes the known J(1) Bessel-Gaussian vector beam and the axisymmetric Laguerre-Gaussian vector beam that were obtained by solving the paraxial wave equations but also predicts two kinds of vector beam, called a modified Bessel-Gaussian vector beam.
2014-01-01
Background Mayotte, a small island in the Indian Ocean, has been affected for many years by vector-borne diseases. Malaria, Bancroftian filariasis, dengue, chikungunya and Rift Valley fever have circulated or still circulate on the island. They are all transmitted by Culicidae mosquitoes. To limit the impact of these diseases on human health, vector control has been implemented for more than 60 years on Mayotte. In this study, we assessed the resistance levels of four major vector species (Anopheles gambiae, Culex pipiens quinquefasciatus, Aedes aegypti and Aedes albopictus) to two types of insecticides: i) the locally currently-used insecticides (organophosphates, pyrethroids) and ii) alternative molecules that are promising for vector control and come from different insecticide families (bacterial toxins or insect growth regulators). When some resistance was found to one of these insecticides, we characterized the mechanisms involved. Methods Larval and adult bioassays were used to evaluate the level of resistance. When resistance was found, we tested for the presence of metabolic resistance through detoxifying enzyme activity assays, or for target-site mutations through molecular identification of known resistance alleles. Results Resistance to currently-used insecticides varied greatly between the four vector species. While no resistance to any insecticides was found in the two Aedes species, bioassays confirmed multiple resistance in Cx. p. quinquefasciatus (temephos: ~ 20 fold and deltamethrin: only 10% mortality after 24 hours). In An. gambiae, resistance was scarce: only a moderate resistance to temephos was found (~5 fold). This resistance appears to be due only to carboxyl-esterase overexpression and not to target modification. Finally, and comfortingly, none of the four species showed resistance to any of the new insecticides. Conclusions The low resistance observed in Mayotte’s main disease vectors is particularly interesting, because it leaves a range of tools useable by vector control services. Together with the relative isolation of the island (thus limited immigration of mosquitoes), it provides us with a unique place to implement an integrated vector management plan, including all the good practices learned from previous experiences. PMID:24984704
Pocquet, Nicolas; Darriet, Frédéric; Zumbo, Betty; Milesi, Pascal; Thiria, Julien; Bernard, Vincent; Toty, Céline; Labbé, Pierrick; Chandre, Fabrice
2014-07-01
Mayotte, a small island in the Indian Ocean, has been affected for many years by vector-borne diseases. Malaria, Bancroftian filariasis, dengue, chikungunya and Rift Valley fever have circulated or still circulate on the island. They are all transmitted by Culicidae mosquitoes. To limit the impact of these diseases on human health, vector control has been implemented for more than 60 years on Mayotte. In this study, we assessed the resistance levels of four major vector species (Anopheles gambiae, Culex pipiens quinquefasciatus, Aedes aegypti and Aedes albopictus) to two types of insecticides: i) the locally currently-used insecticides (organophosphates, pyrethroids) and ii) alternative molecules that are promising for vector control and come from different insecticide families (bacterial toxins or insect growth regulators). When some resistance was found to one of these insecticides, we characterized the mechanisms involved. Larval and adult bioassays were used to evaluate the level of resistance. When resistance was found, we tested for the presence of metabolic resistance through detoxifying enzyme activity assays, or for target-site mutations through molecular identification of known resistance alleles. Resistance to currently-used insecticides varied greatly between the four vector species. While no resistance to any insecticides was found in the two Aedes species, bioassays confirmed multiple resistance in Cx. p. quinquefasciatus (temephos: ~ 20 fold and deltamethrin: only 10% mortality after 24 hours). In An. gambiae, resistance was scarce: only a moderate resistance to temephos was found (~5 fold). This resistance appears to be due only to carboxyl-esterase overexpression and not to target modification. Finally, and comfortingly, none of the four species showed resistance to any of the new insecticides. The low resistance observed in Mayotte's main disease vectors is particularly interesting, because it leaves a range of tools useable by vector control services. Together with the relative isolation of the island (thus limited immigration of mosquitoes), it provides us with a unique place to implement an integrated vector management plan, including all the good practices learned from previous experiences.
NASA Astrophysics Data System (ADS)
Mukhopadhyay, Sabyasachi; Das, Nandan K.; Kurmi, Indrajit; Pradhan, Asima; Ghosh, Nirmalya; Panigrahi, Prasanta K.
2017-10-01
We report the application of a hidden Markov model (HMM) on multifractal tissue optical properties derived via the Born approximation-based inverse light scattering method for effective discrimination of precancerous human cervical tissue sites from the normal ones. Two global fractal parameters, generalized Hurst exponent and the corresponding singularity spectrum width, computed by multifractal detrended fluctuation analysis (MFDFA), are used here as potential biomarkers. We develop a methodology that makes use of these multifractal parameters by integrating with different statistical classifiers like the HMM and support vector machine (SVM). It is shown that the MFDFA-HMM integrated model achieves significantly better discrimination between normal and different grades of cancer as compared to the MFDFA-SVM integrated model.
Papanikolaou, Eleni; Paruzynski, Anna; Kasampalidis, Ioannis; Deichmann, Annette; Stamateris, Evangelos; Schmidt, Manfred; von Kalle, Christof; Anagnou, Nicholas P
2015-01-01
Gene therapy utilizing lentiviral-vectors (LVs) is postulated as a dynamic therapeutic alternative for monogenic diseases. However, retroviral gene transfer may cause insertional mutagenesis. Although, such risks had been originally estimated as extremely low, several reports of leukemias or clonal dominance, have led to a re-evaluation of the mechanisms operating in insertional mutagenesis. Therefore, unraveling the mechanism of retroviral integration is mandatory toward safer gene therapy applications. In the present study, we undertook an experimental approach which enabled direct correlation of the cell cycle stage of the target cell with the integration profile of LVs. CD34+ cells arrested at different stages of cell cycle, were transduced with a GFP-LV. LAM-PCR was employed for integration site detection, followed by microarray analysis to correlate transcribed genes with integration sites. The results indicate that ~10% of integration events occurred in actively transcribed genes and that the cell cycle stage of target cells affects integration pattern. Specifically, use of thymine promoted a safer profile, since it significantly reduced integration within cell cycle-related genes, while we observed increased possibility for integration into genes related to development, and decreased possibility for integration within cell cycle and cancer-related genes, when transduction occurs during mitosis. PMID:25523760
Fonseca, Dina M; Unlu, Isik; Crepeau, Taryn; Farajollahi, Ary; Healy, Sean P; Bartlett-Healy, Kristen; Strickman, Daniel; Gaugler, Randy; Hamilton, George; Kline, Daniel; Clark, Gary G
2013-12-01
Aedes (Stegomyia) albopictus (Skuse) is an important disease vector and biting nuisance. During the 2009 active season, six ∼1000-parcel sites were studied, three in urban and three in suburban areas of New Jersey, United States, to examine the efficacy of standard integrated urban mosquito control strategies applied area wide. Active source reduction, larviciding, adulticiding and public education (source reduction through education) were implemented in one site in each county, an education-only approach was developed in a second site and a third site was used as an untreated experimental control. Populations were surveyed weekly with BG-Sentinel traps and ovitraps. A substantial reduction in Ae. albopictus populations was achieved in urban sites, but only modest reductions in suburban sites. Education alone achieved significant reductions in urban adult Ae. albopictus. Egg catches echoed adult catches only in suburban sites. There are significant socioeconomic and climatic differences between urban and suburban sites that impact upon Ae. albopictus populations and the efficacy of the control methods tested. An integrated pest management approach can affect abundances, but labor-intensive, costly source reduction was not enough to maintain Ae. albopictus counts below a nuisance threshold. Nighttime adult population suppression using truck-mounted adulticides can be effective. Area-wide cost-effective strategies are necessary. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
A Neurocomputational Model of Goal-Directed Navigation in Insect-Inspired Artificial Agents
Goldschmidt, Dennis; Manoonpong, Poramate; Dasgupta, Sakyasingha
2017-01-01
Despite their small size, insect brains are able to produce robust and efficient navigation in complex environments. Specifically in social insects, such as ants and bees, these navigational capabilities are guided by orientation directing vectors generated by a process called path integration. During this process, they integrate compass and odometric cues to estimate their current location as a vector, called the home vector for guiding them back home on a straight path. They further acquire and retrieve path integration-based vector memories globally to the nest or based on visual landmarks. Although existing computational models reproduced similar behaviors, a neurocomputational model of vector navigation including the acquisition of vector representations has not been described before. Here we present a model of neural mechanisms in a modular closed-loop control—enabling vector navigation in artificial agents. The model consists of a path integration mechanism, reward-modulated global learning, random search, and action selection. The path integration mechanism integrates compass and odometric cues to compute a vectorial representation of the agent's current location as neural activity patterns in circular arrays. A reward-modulated learning rule enables the acquisition of vector memories by associating the local food reward with the path integration state. A motor output is computed based on the combination of vector memories and random exploration. In simulation, we show that the neural mechanisms enable robust homing and localization, even in the presence of external sensory noise. The proposed learning rules lead to goal-directed navigation and route formation performed under realistic conditions. Consequently, we provide a novel approach for vector learning and navigation in a simulated, situated agent linking behavioral observations to their possible underlying neural substrates. PMID:28446872
A Neurocomputational Model of Goal-Directed Navigation in Insect-Inspired Artificial Agents.
Goldschmidt, Dennis; Manoonpong, Poramate; Dasgupta, Sakyasingha
2017-01-01
Despite their small size, insect brains are able to produce robust and efficient navigation in complex environments. Specifically in social insects, such as ants and bees, these navigational capabilities are guided by orientation directing vectors generated by a process called path integration. During this process, they integrate compass and odometric cues to estimate their current location as a vector, called the home vector for guiding them back home on a straight path. They further acquire and retrieve path integration-based vector memories globally to the nest or based on visual landmarks. Although existing computational models reproduced similar behaviors, a neurocomputational model of vector navigation including the acquisition of vector representations has not been described before. Here we present a model of neural mechanisms in a modular closed-loop control-enabling vector navigation in artificial agents. The model consists of a path integration mechanism, reward-modulated global learning, random search, and action selection. The path integration mechanism integrates compass and odometric cues to compute a vectorial representation of the agent's current location as neural activity patterns in circular arrays. A reward-modulated learning rule enables the acquisition of vector memories by associating the local food reward with the path integration state. A motor output is computed based on the combination of vector memories and random exploration. In simulation, we show that the neural mechanisms enable robust homing and localization, even in the presence of external sensory noise. The proposed learning rules lead to goal-directed navigation and route formation performed under realistic conditions. Consequently, we provide a novel approach for vector learning and navigation in a simulated, situated agent linking behavioral observations to their possible underlying neural substrates.
Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression
Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A
2012-01-01
Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671
Foamy virus–mediated gene transfer to canine repopulating cells
Kiem, Hans-Peter; Allen, James; Trobridge, Grant; Olson, Erik; Keyser, Kirsten; Peterson, Laura; Russell, David W.
2007-01-01
Foamy virus (FV) vectors are particularly attractive gene-transfer vectors for stem-cell gene therapy because they form a stable transduction intermediate in quiescent cells and can efficiently transduce hematopoietic stem cells. Here, we studied the use of FV vectors to transduce long-term hematopoietic repopulating cells in the dog, a clinically relevant large animal model. Mobilized canine peripheral blood (PB) CD34+ cells were transduced with an enhanced green fluorescent protein (EGFP)–expressing FV vector in an 18-hour transduction protocol. All 3 dogs studied had rapid neutrophil engraftment to greater than 500/μL with a median of 10 days. Transgene expression was detected in all cell lineages (B cells, T cells, granulocytes, red blood cells, and platelets), indicating multilineage engraftment of transduced cells. Up to 19% of blood cells were EGFP+, and this was confirmed at the DNA level by real-time polymerase chain reaction (PCR) and Southern blot analysis. These transduction rates were higher than the best results we obtained previously with lentiviral vectors in a similar transduction protocol. Integration site analysis also demonstrated polyclonal repopulation and the transduction of multipotential hematopoietic repopulating cells. These data suggest that FV vectors should be useful for stem-cell gene therapy, particularly for applications in which short transduction protocols are critical. PMID:16968897
Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean
2014-01-15
Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.
Cellular and molecular mechanisms of HIV-1 integration targeting.
Engelman, Alan N; Singh, Parmit K
2018-07-01
Integration is central to HIV-1 replication and helps mold the reservoir of cells that persists in AIDS patients. HIV-1 interacts with specific cellular factors to target integration to interior regions of transcriptionally active genes within gene-dense regions of chromatin. The viral capsid interacts with several proteins that are additionally implicated in virus nuclear import, including cleavage and polyadenylation specificity factor 6, to suppress integration into heterochromatin. The viral integrase protein interacts with transcriptional co-activator lens epithelium-derived growth factor p75 to principally position integration within gene bodies. The integrase additionally senses target DNA distortion and nucleotide sequence to help fine-tune the specific phosphodiester bonds that are cleaved at integration sites. Research into virus-host interactions that underlie HIV-1 integration targeting has aided the development of a novel class of integrase inhibitors and may help to improve the safety of viral-based gene therapy vectors.
Luo, Yushuang; Kou, Xiaoxiao; Ding, Xuezhi; Hu, Shengbiao; Tang, Ying; Li, Wenping; Huang, Fan; Yang, Qi; Chen, Hanna; Xia, Liqiu
2012-02-01
To promote spinosad biosynthesis by improving the limited oxygen supply during high-density fermentation of Saccharopolyspora spinosa, the open reading frame of the Vitreoscilla hemoglobin gene was placed under the control of the promoter for the erythromycin resistance gene by splicing using overlapping extension PCR. This was cloned into the integrating vector pSET152, yielding the Vitreoscilla hemoglobin gene expression plasmid pSET152EVHB. This was then introduced into S. spinosa SP06081 by conjugal transfer, and integrated into the chromosome by site-specific recombination at the integration site ΦC31 on pSET152EVHB. The resultant conjugant, S. spinosa S078-1101, was genetically stable. The integration was further confirmed by PCR and Southern blotting analysis. A carbon monoxide differential spectrum assay showed that active Vitreoscilla hemoglobin was successfully expressed in S. spinosa S078-1101. Fermentation results revealed that expression of the Vitreoscilla hemoglobin gene significantly promoted spinosad biosynthesis under normal oxygen and moderately oxygen-limiting conditions (P<0.01). These findings demonstrate that integrating expression of the Vitreoscilla hemoglobin gene improves oxygen uptake and is an effective means for the genetic improvement of S. spinosa fermentation.
Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.
2008-01-01
Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809
NASA Technical Reports Server (NTRS)
Venkatakrishnan, P.; Hagyard, M. J.; Hathaway, D. H.
1988-01-01
A simple method of transforming vector magnetograms to heliographic coordinates is demonstrated. The merits of this transformation are illustrated using a vector magnetogram obtained with the MSFC vector magnetograph 80 minutes prior to a white light flare in active region AR 4474 on April 25, 1984. The original magnetogram shows strong magnetic shear along the neutral line at both the flare site and a nonflaring site. The transformation of the magnetogram to heliographic coordinates shows that the elimination of projection effects results in a much shorter length of the sheared region at the nonflaring site than what is inferred from the image plane vector magnetogram. The length of the sheared region at the flare site is relatively less affected by the transformation.
NASA Astrophysics Data System (ADS)
Husson, V. S.; Long, J. L.; Pearlman, M.
2001-12-01
By the end of 2000, 94% of ILRS stations had completed station and site information forms (i.e. site logs). These forms contain six types of information. These six categories include site identifiers, contact information, approximate coordinates, system configuration history, system ranging capabilities, and local survey ties. The ILRS Central Bureau, in conjunction with the ILRS Networks and Engineering Working Group, has developed procedures to quality control site log contents. Part of this verification entails data integrity checks of local site ties and is the primary focus of this paper. Local survey ties are critical to the combination of space geodetic network coordinate solutions (i.e. GPS, SLR, VLBI, DORIS) of the International Terrestrial Reference Frame (ITRF). Approximately 90% of active SLR sites are collocated with at least one other space geodetic technique. The process used to verify these SLR ties, at collocated sites, is identical to the approach used in ITRF2000. Local vectors (X, Y, Z) from each ILRS site log are differenced from its corresponding ITRF2000 position vectors (i.e. no transformations). These X, Y, and Z deltas are converted into North, East, and Up. Any deltas, in any component, larger than 5 millimeter is flagged for investigation. In the absence of ITRF2000 SLR positions, CSR positions were used. To further enhance this comparison and to fill gaps in information, local ties contained in site logs from the other space geodetic services (i.e. IGS, IVS, IDS) were used in addition to ITRF2000 ties. Case studies of two collocated sites (McDonald/Ft. Davis and Hartebeeshtoek) will be explored in-depth. Recommendations on how local site surveys should be conducted and how this information should be managed will also be presented.
Wu, Y; Ling, F; Hou, J; Guo, S; Wang, J; Gong, Z
2016-07-01
Vector-borne diseases are one of the world's major public health threats and annually responsible for 30-50% of deaths reported to the national notifiable disease system in China. To control vector-borne diseases, a unified, effective and economic surveillance system is urgently needed; all of the current surveillance systems in China waste resources and/or information. Here, we review some current surveillance systems and present a concept for an integrated surveillance system combining existing vector and vector-borne disease monitoring systems. The integrated surveillance system has been tested in pilot programmes in China and led to a 21·6% cost saving in rodent-borne disease surveillance. We share some experiences gained from these programmes.
Ruiz, Daniel; Cerón, Viviana; Molina, Adriana M.; Quiñónes, Martha L.; Jiménez, Mónica M.; Ahumada, Martha; Gutiérrez, Patricia; Osorio, Salua; Mantilla, Gilma; Connor, Stephen J.; Thomson, Madeleine C.
2014-01-01
As part of the Integrated National Adaptation Pilot project and the Integrated Surveillance and Control System, the Colombian National Institute of Health is working on the design and implementation of a Malaria Early Warning System framework, supported by seasonal climate forecasting capabilities, weather and environmental monitoring, and malaria statistical and dynamic models. In this report, we provide an overview of the local ecoepidemiologic settings where four malaria process-based mathematical models are currently being implemented at a municipal level. The description includes general characteristics, malaria situation (predominant type of infection, malaria-positive cases data, malaria incidence, and seasonality), entomologic conditions (primary and secondary vectors, mosquito densities, and feeding frequencies), climatic conditions (climatology and long-term trends), key drivers of epidemic outbreaks, and non-climatic factors (populations at risk, control campaigns, and socioeconomic conditions). Selected pilot sites exhibit different ecoepidemiologic settings that must be taken into account in the development of the integrated surveillance and control system. PMID:24891460
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes
Rai, Sudhir Kumar; Sangesland, Maya; Lee, Michael; Esnault, Caroline; Cui, Yujin; Chatterjee, Atreyi Ghatak
2017-01-01
Retroviruses and Long Terminal Repeat (LTR)-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs) encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements. PMID:29232693
Host factors that promote retrotransposon integration are similar in distantly related eukaryotes.
Rai, Sudhir Kumar; Sangesland, Maya; Lee, Michael; Esnault, Caroline; Cui, Yujin; Chatterjee, Atreyi Ghatak; Levin, Henry L
2017-12-01
Retroviruses and Long Terminal Repeat (LTR)-retrotransposons have distinct patterns of integration sites. The oncogenic potential of retrovirus-based vectors used in gene therapy is dependent on the selection of integration sites associated with promoters. The LTR-retrotransposon Tf1 of Schizosaccharomyces pombe is studied as a model for oncogenic retroviruses because it integrates into the promoters of stress response genes. Although integrases (INs) encoded by retroviruses and LTR-retrotransposons are responsible for catalyzing the insertion of cDNA into the host genome, it is thought that distinct host factors are required for the efficiency and specificity of integration. We tested this hypothesis with a genome-wide screen of host factors that promote Tf1 integration. By combining an assay for transposition with a genetic assay that measures cDNA recombination we could identify factors that contribute differentially to integration. We utilized this assay to test a collection of 3,004 S. pombe strains with single gene deletions. Using these screens and immunoblot measures of Tf1 proteins, we identified a total of 61 genes that promote integration. The candidate integration factors participate in a range of processes including nuclear transport, transcription, mRNA processing, vesicle transport, chromatin structure and DNA repair. Two candidates, Rhp18 and the NineTeen complex were tested in two-hybrid assays and were found to interact with Tf1 IN. Surprisingly, a number of pathways we identified were found previously to promote integration of the LTR-retrotransposons Ty1 and Ty3 in Saccharomyces cerevisiae, indicating the contribution of host factors to integration are common in distantly related organisms. The DNA repair factors are of particular interest because they may identify the pathways that repair the single stranded gaps flanking the sites of strand transfer following integration of LTR retroelements.
Foundation Mathematics for the Physical Sciences
NASA Astrophysics Data System (ADS)
Riley, K. F.; Hobson, M. P.
2011-03-01
1. Arithmetic and geometry; 2. Preliminary algebra; 3. Differential calculus; 4. Integral calculus; 5. Complex numbers and hyperbolic functions; 6. Series and limits; 7. Partial differentiation; 8. Multiple integrals; 9. Vector algebra; 10. Matrices and vector spaces; 11. Vector calculus; 12. Line, surface and volume integrals; 13. Laplace transforms; 14. Ordinary differential equations; 15. Elementary probability; Appendices; Index.
Student Solution Manual for Foundation Mathematics for the Physical Sciences
NASA Astrophysics Data System (ADS)
Riley, K. F.; Hobson, M. P.
2011-03-01
1. Arithmetic and geometry; 2. Preliminary algebra; 3. Differential calculus; 4. Integral calculus; 5. Complex numbers and hyperbolic functions; 6. Series and limits; 7. Partial differentiation; 8. Multiple integrals; 9. Vector algebra; 10. Matrices and vector spaces; 11. Vector calculus; 12. Line, surface and volume integrals; 13. Laplace transforms; 14. Ordinary differential equations; 15. Elementary probability; Appendix.
2013-06-28
of cuts that each fragment should be cut into so the fragments are no greater than a specific length threshold. Additionally, vector sequences and...restriction sites are attached to each fragment while ensuring the restriction sites are unique to each sequence. The vector sequences serve as hooks...for assembly into vector for cloning purposes, and also as primer binding domains for PCR ampl ification. The restriction sites are added to
Nmor, Jephtha C; Sunahara, Toshihiko; Goto, Kensuke; Futami, Kyoko; Sonye, George; Akweywa, Peter; Dida, Gabriel; Minakawa, Noboru
2013-01-16
Identification of malaria vector breeding sites can enhance control activities. Although associations between malaria vector breeding sites and topography are well recognized, practical models that predict breeding sites from topographic information are lacking. We used topographic variables derived from remotely sensed Digital Elevation Models (DEMs) to model the breeding sites of malaria vectors. We further compared the predictive strength of two different DEMs and evaluated the predictability of various habitat types inhabited by Anopheles larvae. Using GIS techniques, topographic variables were extracted from two DEMs: 1) Shuttle Radar Topography Mission 3 (SRTM3, 90-m resolution) and 2) the Advanced Spaceborne Thermal Emission Reflection Radiometer Global DEM (ASTER, 30-m resolution). We used data on breeding sites from an extensive field survey conducted on an island in western Kenya in 2006. Topographic variables were extracted for 826 breeding sites and for 4520 negative points that were randomly assigned. Logistic regression modelling was applied to characterize topographic features of the malaria vector breeding sites and predict their locations. Model accuracy was evaluated using the area under the receiver operating characteristics curve (AUC). All topographic variables derived from both DEMs were significantly correlated with breeding habitats except for the aspect of SRTM. The magnitude and direction of correlation for each variable were similar in the two DEMs. Multivariate models for SRTM and ASTER showed similar levels of fit indicated by Akaike information criterion (3959.3 and 3972.7, respectively), though the former was slightly better than the latter. The accuracy of prediction indicated by AUC was also similar in SRTM (0.758) and ASTER (0.755) in the training site. In the testing site, both SRTM and ASTER models showed higher AUC in the testing sites than in the training site (0.829 and 0.799, respectively). The predictability of habitat types varied. Drains, foot-prints, puddles and swamp habitat types were most predictable. Both SRTM and ASTER models had similar predictive potentials, which were sufficiently accurate to predict vector habitats. The free availability of these DEMs suggests that topographic predictive models could be widely used by vector control managers in Africa to complement malaria control strategies.
Pandey, Siddharth; Das, M K; Dhiman, Ramesh C
2016-01-01
The Ramgarh district of Jharkhand state, India is highly malarious owing to abundance of different malaria vector species, namely Anopheles culicifacies, An. fluviatilis and An. annularis. In spite of high prevalence of malaria vectors in Ramgarh, their larval ecology and climatic conditions affecting malaria dynamics have never been studied. Therefore, the objective of this study was to identify the diversity of potential breeding habitats and breeding preferences of anopheline vectors in the Ramgarh district. Anopheles immature collection was carried out at potential aquatic habitats in Ramgarh and Gola sites using the standard dipper on fortnightly basis from August 2012 to July 2013. The immatures were reared till adult emergence and further identified using standard keys. Temperature of outdoor and water bodies was recorded through temperature data loggers, and rainfall through standard rain gauges installed at each site. A total of 6495 immature specimens representing 17 Anopheles species including three malaria vectors, viz. An. culicifacies, An. fluviatilis and An. annularis were collected from 11 types of breeding habitats. The highly preferred breeding habitats of vector anophelines were river bed pools, rivulets, wells, ponds, river margins, ditches and irrigation channels. Larval abundance of vector species showed site-specific variation with temperature and rainfall patterns throughout the year. The Shannon-Weiner diversity index ranged from 0.19 to 1.94 at Ramgarh site and 0.16 to 1.76 at Gola site. The study revealed that malaria vector species have been adapted to breed in a wide range of water bodies. The regular monitoring of such specific vector breeding sites under changing ecological and environmental conditions will be useful in guiding larval control operations selectively for effective vector/ malaria control.
Berghofer, Y.; Klein, A.
1995-01-01
Methanococcus voltae, which contains four different gene groups that encode [NiFe]-hydrogenases, was transformed with integration vectors to achieve polar inactivation of two of the four hydrogenase operons that encode the selenium-free enzymes Vhc and Frc. Transformants which were selected by their acquired puromycin resistance showed site-specific insertions in either the vhc or frc operon by single crossover events. Southern hybridization revealed tandem integrations of whole vectors in the vhc operon, whereas only one vector copy was found in the frc operon. Northern (RNA) hybridizations showed a pac transcript of defined size, indicating strong termination in front of the hydrogenase genes downstream. In spite of the apparent abolition of expression of selenium-free hydrogenases through these polar insertions, they were not lethal to cells upon growth in selenium-deprived minimal medium, which we had previously shown to strongly induce transcription of the respective operons in M. voltae. Instead, like wild-type control cultures, transformants responded to selenium deprivation only with a reduction in growth rate. We conclude that loss of the potential to express a selenium-free hydrogenase can nevertheless be balanced by very small amounts of selenium hydrogenases under laboratory conditions in which the hydrogen supply is not likely to be a limiting growth factor. PMID:16535019
Closed-form integrator for the quaternion (euler angle) kinematics equations
NASA Technical Reports Server (NTRS)
Whitmore, Stephen A. (Inventor)
2000-01-01
The invention is embodied in a method of integrating kinematics equations for updating a set of vehicle attitude angles of a vehicle using 3-dimensional angular velocities of the vehicle, which includes computing an integrating factor matrix from quantities corresponding to the 3-dimensional angular velocities, computing a total integrated angular rate from the quantities corresponding to a 3-dimensional angular velocities, computing a state transition matrix as a sum of (a) a first complementary function of the total integrated angular rate and (b) the integrating factor matrix multiplied by a second complementary function of the total integrated angular rate, and updating the set of vehicle attitude angles using the state transition matrix. Preferably, the method further includes computing a quanternion vector from the quantities corresponding to the 3-dimensional angular velocities, in which case the updating of the set of vehicle attitude angles using the state transition matrix is carried out by (a) updating the quanternion vector by multiplying the quanternion vector by the state transition matrix to produce an updated quanternion vector and (b) computing an updated set of vehicle attitude angles from the updated quanternion vector. The first and second trigonometric functions are complementary, such as a sine and a cosine. The quantities corresponding to the 3-dimensional angular velocities include respective averages of the 3-dimensional angular velocities over plural time frames. The updating of the quanternion vector preserves the norm of the vector, whereby the updated set of vehicle attitude angles are virtually error-free.
Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.
Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo
2014-01-01
A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.
Lysine acetylation sites prediction using an ensemble of support vector machine classifiers.
Xu, Yan; Wang, Xiao-Bo; Ding, Jun; Wu, Ling-Yun; Deng, Nai-Yang
2010-05-07
Lysine acetylation is an essentially reversible and high regulated post-translational modification which regulates diverse protein properties. Experimental identification of acetylation sites is laborious and expensive. Hence, there is significant interest in the development of computational methods for reliable prediction of acetylation sites from amino acid sequences. In this paper we use an ensemble of support vector machine classifiers to perform this work. The experimentally determined acetylation lysine sites are extracted from Swiss-Prot database and scientific literatures. Experiment results show that an ensemble of support vector machine classifiers outperforms single support vector machine classifier and other computational methods such as PAIL and LysAcet on the problem of predicting acetylation lysine sites. The resulting method has been implemented in EnsemblePail, a web server for lysine acetylation sites prediction available at http://www.aporc.org/EnsemblePail/. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Wheel speed management control system for spacecraft
NASA Technical Reports Server (NTRS)
Goodzeit, Neil E. (Inventor); Linder, David M. (Inventor)
1991-01-01
A spacecraft attitude control system uses at least four reaction wheels. In order to minimize reaction wheel speed and therefore power, a wheel speed management system is provided. The management system monitors the wheel speeds and generates a wheel speed error vector. The error vector is integrated, and the error vector and its integral are combined to form a correction vector. The correction vector is summed with the attitude control torque command signals for driving the reaction wheels.
Padilla-Torres, Samael D.; Ferraz, Gonçalo; Luz, Sergio L. B.; Zamora-Perea, Elvira; Abad-Franch, Fernando
2013-01-01
Aedes aegypti and Ae. albopictus are the vectors of dengue, the most important arboviral disease of humans. To date, Aedes ecology studies have assumed that the vectors are truly absent from sites where they are not detected; since no perfect detection method exists, this assumption is questionable. Imperfect detection may bias estimates of key vector surveillance/control parameters, including site-occupancy (infestation) rates and control intervention effects. We used a modeling approach that explicitly accounts for imperfect detection and a 38-month, 55-site detection/non-detection dataset to quantify the effects of municipality/state control interventions on Aedes site-occupancy dynamics, considering meteorological and dwelling-level covariates. Ae. aegypti site-occupancy estimates (mean 0.91; range 0.79–0.97) were much higher than reported by routine surveillance based on ‘rapid larval surveys’ (0.03; 0.02–0.11) and moderately higher than directly ascertained with oviposition traps (0.68; 0.50–0.91). Regular control campaigns based on breeding-site elimination had no measurable effects on the probabilities of dwelling infestation by dengue vectors. Site-occupancy fluctuated seasonally, mainly due to the negative effects of high maximum (Ae. aegypti) and minimum (Ae. albopictus) summer temperatures (June-September). Rainfall and dwelling-level covariates were poor predictors of occupancy. The marked contrast between our estimates of adult vector presence and the results from ‘rapid larval surveys’ suggests, together with the lack of effect of local control campaigns on infestation, that many Aedes breeding sites were overlooked by vector control agents in our study setting. Better sampling strategies are urgently needed, particularly for the reliable assessment of infestation rates in the context of control program management. The approach we present here, combining oviposition traps and site-occupancy models, could greatly contribute to that crucial aim. PMID:23472194
Negre, Olivier; Bartholomae, Cynthia; Beuzard, Yves; Cavazzana, Marina; Christiansen, Lauryn; Courne, Céline; Deichmann, Annette; Denaro, Maria; de Dreuzy, Edouard; Finer, Mitchell; Fronza, Raffaele; Gillet-Legrand, Béatrix; Joubert, Christophe; Kutner, Robert; Leboulch, Philippe; Maouche, Leïla; Paulard, Anaïs; Pierciey, Francis J.; Rothe, Michael; Ryu, Byoung; Schmidt, Manfred; von Kalle, Christof; Payen, Emmanuel; Veres, Gabor
2015-01-01
A previously published clinical trial demonstrated the benefit of autologous CD34+ cells transduced with a self-inactivating lentiviral vector (HPV569) containing an engineered β-globin gene (βA-T87Q-globin) in a subject with β-thalassemia major. This vector has been modified to increase transduction efficacy without compromising safety. In vitro analyses indicated that the changes resulted in both increased vector titers (3 to 4 fold) and increased transduction efficacy (2 to 3 fold). An in vivo study in which 58 β-thalassemic mice were transplanted with vector- or mock-transduced syngenic bone marrow cells indicated sustained therapeutic efficacy. Secondary transplantations involving 108 recipients were performed to evaluate long-term safety. The six month study showed no hematological or biochemical toxicity. Integration site (IS) profile revealed an oligo/polyclonal hematopoietic reconstitution in the primary transplants and reduced clonality in secondary transplants. Tumor cells were detected in the secondary transplant mice in all treatment groups (including the control group), without statistical differences in the tumor incidence. Immunohistochemistry and quantitative PCR demonstrated that tumor cells were not derived from transduced donor cells. This comprehensive efficacy and safety data provided the basis for initiating two clinical trials with this second generation vector (BB305) in Europe and in the USA in patients with β-thalassemia major and sickle cell disease. PMID:25429463
Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2016-01-01
The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635
The Extinction of Dengue through Natural Vulnerability of Its Vectors
Williams, Craig R.; Bader, Christie A.; Kearney, Michael R.; Ritchie, Scott A.; Russell, Richard C.
2010-01-01
Background Dengue is the world's most important mosquito-borne viral illness. Successful future management of this disease requires an understanding of the population dynamics of the vector, especially in the context of changing climates. Our capacity to predict future dynamics is reflected in our ability to explain the significant historical changes in the distribution and abundance of the disease and its vector. Methodology/Principal Findings Here we combine daily weather records with simulation modelling techniques to explain vector (Aedes aegypti (L.)) persistence within its current and historic ranges in Australia. We show that, in regions where dengue presently occurs in Australia (the Wet Tropics region of Far North Queensland), conditions are persistently suitable for year-round adult Ae. aegypti activity and oviposition. In the historic range, however, the vector is vulnerable to periodic extinction due to the combined influence of adult activity constraints and stochastic loss of suitable oviposition sites. Conclusions/Significance These results, together with changes in water-storage behaviour by humans, can explain the observed historical range contraction of the disease vector. For these reasons, future eradication of dengue in wet tropical regions will be extremely difficult through classical mosquito control methods alone. However, control of Ae. aegypti in sub-tropical and temperate regions will be greatly facilitated by government policy regulating domestic water-storage. Exploitation of the natural vulnerabilities of dengue vectors (e.g., habitat specificity, climatic limitations) should be integrated with the emerging novel transgenic and symbiotic bacterial control techniques to develop future control and elimination strategies. PMID:21200424
phiGENOME: an integrative navigation throughout bacteriophage genomes.
Stano, Matej; Klucar, Lubos
2011-11-01
phiGENOME is a web-based genome browser generating dynamic and interactive graphical representation of phage genomes stored in the phiSITE, database of gene regulation in bacteriophages. phiGENOME is an integral part of the phiSITE web portal (http://www.phisite.org/phigenome) and it was optimised for visualisation of phage genomes with the emphasis on the gene regulatory elements. phiGENOME consists of three components: (i) genome map viewer built using Adobe Flash technology, providing dynamic and interactive graphical display of phage genomes; (ii) sequence browser based on precisely formatted HTML tags, providing detailed exploration of genome features on the sequence level and (iii) regulation illustrator, based on Scalable Vector Graphics (SVG) and designed for graphical representation of gene regulations. Bringing 542 complete genome sequences accompanied with their rich annotations and references, makes phiGENOME a unique information resource in the field of phage genomics. Copyright © 2011 Elsevier Inc. All rights reserved.
Krutzke, L; Prill, J M; Engler, T; Schmidt, C Q; Xu, Z; Byrnes, A P; Simmet, T; Kreppel, F
2016-08-10
The biodistribution of adenovirus type 5 (Ad5) vector particles is heavily influenced by interaction of the particles with plasma proteins, including coagulation factor X (FX), which binds specifically to the major Ad5 capsid protein hexon. FX mediates hepatocyte transduction by intravenously-injected Ad5 vectors and shields vector particles from neutralization by natural antibodies and complement. In mice, mutant Ad5 vectors that are ablated for FX-binding become detargeted from hepatocytes, which is desirable for certain applications, but unfortunately such FX-nonbinding vectors also become sensitive to neutralization by mouse plasma proteins. To improve the properties of Ad5 vectors for systemic delivery, we developed a strategy to replace the natural FX shield by a site-specific chemical polyethylene glycol shield. Coupling of polyethylene glycol to a specific site in hexon hypervariable region 1 yielded vector particles that were protected from neutralization by natural antibodies and complement although they were unable to bind FX. These vector particles evaded macrophages in vitro and showed significantly improved pharmacokinetics and hepatocyte transduction in vivo. Thus, site-specific shielding of Ad5 vectors with polyethylene glycol rendered vectors FX-independent and greatly improved their properties for systemic gene therapy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby
2014-01-01
Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635
Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan
2015-11-01
Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.
Lefschetz thimbles in fermionic effective models with repulsive vector-field
NASA Astrophysics Data System (ADS)
Mori, Yuto; Kashiwa, Kouji; Ohnishi, Akira
2018-06-01
We discuss two problems in complexified auxiliary fields in fermionic effective models, the auxiliary sign problem associated with the repulsive vector-field and the choice of the cut for the scalar field appearing from the logarithmic function. In the fermionic effective models with attractive scalar and repulsive vector-type interaction, the auxiliary scalar and vector fields appear in the path integral after the bosonization of fermion bilinears. When we make the path integral well-defined by the Wick rotation of the vector field, the oscillating Boltzmann weight appears in the partition function. This "auxiliary" sign problem can be solved by using the Lefschetz-thimble path-integral method, where the integration path is constructed in the complex plane. Another serious obstacle in the numerical construction of Lefschetz thimbles is caused by singular points and cuts induced by multivalued functions of the complexified scalar field in the momentum integration. We propose a new prescription which fixes gradient flow trajectories on the same Riemann sheet in the flow evolution by performing the momentum integration in the complex domain.
Modification and identification of a vector for making a large phage antibody library.
Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing
2007-11-20
The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.
Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D
2016-01-01
Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405
Fourier transform inequalities for phylogenetic trees.
Matsen, Frederick A
2009-01-01
Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.
Aslan, Hamide; Oliveira, Fabiano; Meneses, Claudio; Castrovinci, Philip; Gomes, Regis; Teixeira, Clarissa; Derenge, Candace A.; Orandle, Marlene; Gradoni, Luigi; Oliva, Gaetano; Fischer, Laurent; Valenzuela, Jesus G.; Kamhawi, Shaden
2016-01-01
Canine leishmaniasis (CanL) is a chronic fatal disease of dogs and a major source of human infection through propagation of parasites in vectors. Here, we infected 8 beagles through multiple experimental vector transmissions with Leishmania infantum–infected Lutzomyia longipalpis. CanL clinical signs varied, although live parasites were recovered from all dog spleens. Splenic parasite burdens correlated positively with Leishmania-specific interleukin 10 levels, negatively with Leishmania-specific interferon γ and interleukin 2 levels, and negatively with Leishmania skin test reactivity. A key finding was parasite persistence for 6 months in lesions observed at the bite sites in all dogs. These recrudesced following a second transmission performed at a distal site. Notably, sand flies efficiently acquired parasites after feeding on lesions at the primary bite site. In this study, controlled vector transmissions identify a potentially unappreciated role for skin at infectious bite sites in dogs with CanL, providing a new perspective regarding the mechanism of Leishmania transmissibility to vector sand flies. PMID:26768257
Homeologous plastid DNA transformation in tobacco is mediated by multiple recombination events.
Kavanagh, T A; Thanh, N D; Lao, N T; McGrath, N; Peter, S O; Horváth, E M; Dix, P J; Medgyesy, P
1999-01-01
Efficient plastid transformation has been achieved in Nicotiana tabacum using cloned plastid DNA of Solanum nigrum carrying mutations conferring spectinomycin and streptomycin resistance. The use of the incompletely homologous (homeologous) Solanum plastid DNA as donor resulted in a Nicotiana plastid transformation frequency comparable with that of other experiments where completely homologous plastid DNA was introduced. Physical mapping and nucleotide sequence analysis of the targeted plastid DNA region in the transformants demonstrated efficient site-specific integration of the 7.8-kb Solanum plastid DNA and the exclusion of the vector DNA. The integration of the cloned Solanum plastid DNA into the Nicotiana plastid genome involved multiple recombination events as revealed by the presence of discontinuous tracts of Solanum-specific sequences that were interspersed between Nicotiana-specific markers. Marked position effects resulted in very frequent cointegration of the nonselected peripheral donor markers located adjacent to the vector DNA. Data presented here on the efficiency and features of homeologous plastid DNA recombination are consistent with the existence of an active RecA-mediated, but a diminished mismatch, recombination/repair system in higher-plant plastids. PMID:10388829
NASA Astrophysics Data System (ADS)
Zellers, S.; Cowan, E. A.; Davies, M. H.
2014-12-01
Gulf of Alaska sediments contain distinct, low-diversity assemblages of benthic and planktic foraminifera, whose distribution is a function of food availability, water mass properties, ice proximity, transport/deposition, predation, and taphonomic processes. Spatial and temporal changes in diversity reflect these processes and provide insight into this margin's history. Two quantitative techniques are integrated to define and characterize benthic foraminferal biozones in Gulf of Alaska sediment core samples collected by the R/V Maurice Ewing in 2004 at shelf site EW0408-79JC (59.53° N, 141.76° W, 158 m depth), and slope site EW0408-85JC (59.56° N, 144.15° W, 682 m depth). Sediments date from the end of the most recent glaciation (diamict in 85JC) to the present (bioturbated, silty clay at both sites). We apply SHE analysis, a graphical, iterative technique, based on diversity trends in a plot of ln E vs. ln N, where E is species evenness and N is cumulative number of specimens. In each step, the plot is examined for the first change in slope between successive samples, representing a change in diversity. At this point a boundary is defined, samples before the break are removed, and the analysis is repeated until all samples are analyzed. Data are further analyzed using an unmixing algorithm known as polytopic vector analyses. This technique defines a small number of orthogonal end members that explain a majority of the variance, thus reducing data complexity and aiding interpretation. SHE-analysis of benthic foraminiferal data defines eighteen informal abundance biozones. Polytopic vector analyses indicate that the faunal assemblages reflect mixtures of up to seven distinct biofacies: outer neritic (2), upper bathyal (2), reduced oxygen (2), and inner neritic. Rapid changes in faunal diversity correspond with increased sedimentation rates, especially during the end of the most recent glaciation (17 to 16 ka). The same relationship occurs over the last 1000 years at the shelf site. Where the cores overlap in age, many more assemblage boundaries occur in the shelf core, suggesting a comparatively dynamic environment relative to the slope. The least amount of diversity change corresponds with the laminated intervals in 85JC, coincident with high productivity and development of anoxia during regional deglaciation.
Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette
1993-01-01
mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique
1989-07-01
the vector of the body force." lo., ,P /’P l> 16 __ __ _ __ ___P . 19 U In the first lecture we define the buoyancy force, develop a simplified...force and l’is a unit vector along the motion vector . Integrating Bernoulli’s law over a closed loop one gets: I also [ C by integrating along the...convection. It is conveiient to write these equations as evolution equations for a atate vector U(x, z, t) where x is the horizontal coordinate vector
Video data compression using artificial neural network differential vector quantization
NASA Technical Reports Server (NTRS)
Krishnamurthy, Ashok K.; Bibyk, Steven B.; Ahalt, Stanley C.
1991-01-01
An artificial neural network vector quantizer is developed for use in data compression applications such as Digital Video. Differential Vector Quantization is used to preserve edge features, and a new adaptive algorithm, known as Frequency-Sensitive Competitive Learning, is used to develop the vector quantizer codebook. To develop real time performance, a custom Very Large Scale Integration Application Specific Integrated Circuit (VLSI ASIC) is being developed to realize the associative memory functions needed in the vector quantization algorithm. By using vector quantization, the need for Huffman coding can be eliminated, resulting in superior performance against channel bit errors than methods that use variable length codes.
Ruiz, Daniel; Cerón, Viviana; Molina, Adriana M; Quiñónes, Martha L; Jiménez, Mónica M; Ahumada, Martha; Gutiérrez, Patricia; Osorio, Salua; Mantilla, Gilma; Connor, Stephen J; Thomson, Madeleine C
2014-07-01
As part of the Integrated National Adaptation Pilot project and the Integrated Surveillance and Control System, the Colombian National Institute of Health is working on the design and implementation of a Malaria Early Warning System framework, supported by seasonal climate forecasting capabilities, weather and environmental monitoring, and malaria statistical and dynamic models. In this report, we provide an overview of the local ecoepidemiologic settings where four malaria process-based mathematical models are currently being implemented at a municipal level. The description includes general characteristics, malaria situation (predominant type of infection, malaria-positive cases data, malaria incidence, and seasonality), entomologic conditions (primary and secondary vectors, mosquito densities, and feeding frequencies), climatic conditions (climatology and long-term trends), key drivers of epidemic outbreaks, and non-climatic factors (populations at risk, control campaigns, and socioeconomic conditions). Selected pilot sites exhibit different ecoepidemiologic settings that must be taken into account in the development of the integrated surveillance and control system. © The American Society of Tropical Medicine and Hygiene.
Adde, Antoine; Dusfour, Isabelle; Roux, Emmanuel; Girod, Romain; Briolant, Sébastien
2016-12-01
Little is known about the Anopheles species of the coastal areas of French Guiana, or their spatiotemporal distribution or environmental determinants. The present study aimed to (1) document the distribution of Anopheles fauna in the coastal area around Cayenne, and (2) investigate the use of remotely sensed land cover data as proxies of Anopheles presence. To characterise the Anopheles fauna, we combined the findings of two entomological surveys that were conducted during the period 2007-2009 and in 2014 at 37 sites. Satellite imagery data were processed to extract land cover variables potentially related to Anopheles ecology. Based on these data, a methodology was formed to estimate a statistical predictive model of the spatial-seasonal variations in the presence of Anopheles in the Cayenne region. Two Anopheles species, known as main malaria vectors in South America, were identified, including the more dominant An. aquasalis near town and rural sites, and An. darlingi only found in inland sites. Furthermore, a cross-validated model of An. aquasalis presence that integrated marsh and forest surface area was extrapolated to generate predictive maps. The present study supports the use of satellite imagery by health authorities for the surveillance of malaria vectors and planning of control strategies.
Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S
1996-07-15
Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.
NASA Technical Reports Server (NTRS)
Verber, C. M.; Kenan, R. P.; Hartman, N. F.; Chapman, C. M.
1980-01-01
A laboratory model of a 16 channel integrated optical data preprocessor was fabricated and tested in response to a need for a device to evaluate the outputs of a set of remote sensors. It does this by accepting the outputs of these sensors, in parallel, as the components of a multidimensional vector descriptive of the data and comparing this vector to one or more reference vectors which are used to classify the data set. The comparison is performed by taking the difference between the signal and reference vectors. The preprocessor is wholly integrated upon the surface of a LiNbO3 single crystal with the exceptions of the source and the detector. He-Ne laser light is coupled in and out of the waveguide by prism couplers. The integrated optical circuit consists of a titanium infused waveguide pattern, electrode structures and grating beam splitters. The waveguide and electrode patterns, by virtue of their complexity, make the vector subtraction device the most complex integrated optical structure fabricated to date.
Optimal distribution of integration time for intensity measurements in Stokes polarimetry.
Li, Xiaobo; Liu, Tiegen; Huang, Bingjing; Song, Zhanjie; Hu, Haofeng
2015-10-19
We consider the typical Stokes polarimetry system, which performs four intensity measurements to estimate a Stokes vector. We show that if the total integration time of intensity measurements is fixed, the variance of the Stokes vector estimator depends on the distribution of the integration time at four intensity measurements. Therefore, by optimizing the distribution of integration time, the variance of the Stokes vector estimator can be decreased. In this paper, we obtain the closed-form solution of the optimal distribution of integration time by employing Lagrange multiplier method. According to the theoretical analysis and real-world experiment, it is shown that the total variance of the Stokes vector estimator can be significantly decreased about 40% in the case discussed in this paper. The method proposed in this paper can effectively decrease the measurement variance and thus statistically improves the measurement accuracy of the polarimetric system.
Horizontal vectorization of electron repulsion integrals.
Pritchard, Benjamin P; Chow, Edmond
2016-10-30
We present an efficient implementation of the Obara-Saika algorithm for the computation of electron repulsion integrals that utilizes vector intrinsics to calculate several primitive integrals concurrently in a SIMD vector. Initial benchmarks display a 2-4 times speedup with AVX instructions over comparable scalar code, depending on the basis set. Speedup over scalar code is found to be sensitive to the level of contraction of the basis set, and is best for (lAlB|lClD) quartets when lD = 0 or lB=lD=0, which makes such a vectorization scheme particularly suitable for density fitting. The basic Obara-Saika algorithm, how it is vectorized, and the performance bottlenecks are analyzed and discussed. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.
Kowarz, Eric; Löscher, Denise; Marschalek, Rolf
2015-04-01
Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rochlin, I.; Ginsberg, H.S.; Campbell, S.R.
2009-01-01
Culex species were monitored at three proximate sites with historically different West Nile virus (WNV) activities. The site with human WNV transmission (epidemic) had the lowest abundance of the putative bridge vectors, Culex pipiens and Cx. salinarius. The site with horse cases but not human cases (epizootic) had the highest percent composition of Cx. salinarius, whereas the site with WNV-positive birds only (enzootic) had the highest Cx. pipiens abundance and percent composition. A total of 29 WNV-positive Culex pools were collected at the enzootic site, 17 at the epidemic site, and 14 at the epizootic site. Published models of human risk using Cx. pipiens and Cx. salinarius as the primary bridge vectors did not explain WNV activity at our sites. Other variables, such as additional vector species, environmental components, and socioeconomic factors, need to be examined to explain the observed patterns of WNV epidemic activity.
Integrated pest management and allocation of control efforts for vector-borne diseases
Ginsberg, H.S.
2001-01-01
Applications of various control methods were evaluated to determine how to integrate methods so as to minimize the number of human cases of vector-borne diseases. These diseases can be controlled by lowering the number of vector-human contacts (e.g., by pesticide applications or use of repellents), or by lowering the proportion of vectors infected with pathogens (e.g., by lowering or vaccinating reservoir host populations). Control methods should be combined in such a way as to most efficiently lower the probability of human encounter with an infected vector. Simulations using a simple probabilistic model of pathogen transmission suggest that the most efficient way to integrate different control methods is to combine methods that have the same effect (e.g., combine treatments that lower the vector population; or combine treatments that lower pathogen prevalence in vectors). Combining techniques that have different effects (e.g., a technique that lowers vector populations with a technique that lowers pathogen prevalence in vectors) will be less efficient than combining two techniques that both lower vector populations or combining two techniques that both lower pathogen prevalence, costs being the same. Costs of alternative control methods generally differ, so the efficiency of various combinations at lowering human contact with infected vectors should be estimated at available funding levels. Data should be collected from initial trials to improve the effects of subsequent interventions on the number of human cases.
Herzog, Roland W; Fields, Paul A; Arruda, Valder R; Brubaker, Jeff O; Armstrong, Elina; McClintock, Darryl; Bellinger, Dwight A; Couto, Linda B; Nichols, Timothy C; High, Katherine A
2002-07-20
Intramuscular injection of an adeno-associated virus (AAV) vector has resulted in vector dose-dependent, stable expression of canine factor IX (cF.IX) in hemophilia B dogs with an F.IX missense mutation (Herzog et al., Nat. Med. 1999;5:56-63). The use of a species-specific transgene allowed us to study risks and characteristics of antibody formation against the therapeutic transgene product. We analyzed seven dogs that had been injected at a single time point at multiple intramuscular sites with varying vector doses (dose per kilogram, dose per animal, dose per site). Comparison of individual animals suggests an increased likelihood of inhibitory anti-cF.IX (inhibitor) development with increased vector doses, with dose per site showing the strongest correlation with the risk of inhibitor formation. In six of seven animals, such immune responses were either absent or transient, and therefore did not prevent sustained systemic expression of cF.IX. Transient inhibitory/neutralizing anti-cF.IX responses occurred at vector doses of 2 x 10(12)/site, whereas a 6-fold higher dose resulted in a longer lasting, higher titer inhibitor. Anti-cF.IX was efficiently blocked in an eighth animal that was injected with a high vector dose per site, but in addition received transient immune suppression. Inhibitor formation was characterized by synthesis of two IgG subclasses and in vitro proliferation of lymphocytes to cF.IX antigen, indicating a helper T cell-dependent mechanism. Anti-cF.IX formation is likely influenced by the extent of local antigen presentation and may be avoided by limited vector doses or by transient immune modulation.
ERIC Educational Resources Information Center
Yaacob, Yuzita; Wester, Michael; Steinberg, Stanly
2010-01-01
This paper presents a prototype of a computer learning assistant ILMEV (Interactive Learning-Mathematica Enhanced Vector calculus) package with the purpose of helping students to understand the theory and applications of integration in vector calculus. The main problem for students using Mathematica is to convert a textbook description of a…
40 CFR 503.15 - Operational standards-pathogens and vector attraction reduction.
Code of Federal Regulations, 2011 CFR
2011-07-01
... vector attraction reduction. 503.15 Section 503.15 Protection of Environment ENVIRONMENTAL PROTECTION... § 503.15 Operational standards—pathogens and vector attraction reduction. (a) Pathogens—sewage sludge... reclamation site. (c) Vector attraction reduction—sewage sludge. (1) One of the vector attraction reduction...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elmore, Joshua R.; Furches, Anna; Wolff, Gara N.
Pseudomonas putida strains are highly robust bacteria known for their ability to efficiently utilize a variety of carbon sources, including aliphatic and aromatic hydrocarbons. Recently, P. putida has been engineered to valorize the lignin stream of a lignocellulosic biomass pretreatment process. Nonetheless, when compared to platform organisms such as Escherichia coli, the toolkit for engineering P. putida is underdeveloped. Heterologous gene expression in particular is problematic. Plasmid instability and copy number variance provide challenges for replicative plasmids, while use of homologous recombination for insertion of DNA into the chromosome is slow and laborious. Furthermore, heterologous expression efforts to date typicallymore » rely on overexpression of exogenous pathways using a handful of poorly characterized promoters. In order to improve the P. putida toolkit, we developed a rapid genome integration system using the site-specific recombinase from bacteriophage Bxb1 to enable rapid, high efficiency integration of DNA into the P. putida chromosome. We also developed a library of synthetic promoters with various UP elements, -35 sequences, and -10 sequences, as well as different ribosomal binding sites. We tested these promoters using a fluorescent reporter gene, mNeonGreen, to characterize the strength of each promoter, and identified UP-element-promoter-ribosomal binding sites combinations capable of driving a ~150-fold range of protein expression levels. One additional integrating vector was developed that confers more robust kanamycin resistance when integrated at single copy into the chromosome. This genome integration and reporter systems are extensible for testing other genetic parts, such as examining terminator strength, and will allow rapid integration of heterologous pathways for metabolic engineering.« less
Li, Shengwei; Gao, Xiaoping; Peng, Rui; Zhang, Sheng; Fu, Wei; Zou, Fangdong
A basic goal in the development of recombinant proteins is the generation of cell lines that express the desired protein stably over many generations. Here, we constructed engineered Chinese hamster ovary cell lines (CHO-S) with a pCHO-hVR1 vector that carried an extracellular domain of a VEGF receptor (VR) fusion gene. Forty-five clones with high hVR1 expression were selected for karyotype analysis. Using fluorescence in situ hybridization (FISH) and G-banding, we found that pCHO-hVR1 was integrated into three chromosomes, including chromosomes 1, Z3 and Z4. Four clones were selected to evaluate their productivity under non-fed, non-optimized shake flask conditions. The results showed that clones 1 and 2 with integration sites on chromosome 1 revealed high levels of hVR1 products (shake flask of approximately 800 mg/L), whereas clones 3 and 4 with integration sites on chromosomes Z3 or Z4 had lower levels of hVR1 products. Furthermore, clones 1 and 2 maintained their productivity stabilities over a continuous period of 80 generations, and clones 3 and 4 showed significant declines in their productivities in the presence of selection pressure. Finally, pCHO-hVR1 localized to the same region at chromosome 1q13, the telomere region of normal chromosome 1. In this study, these results demonstrate that the integration of exogenous hVR1 gene on chromosome 1, band q13, may create a high protein-producing CHO-S cell line, suggesting that chromosome 1q13 may contain a useful target site for the high expression of exogenous protein. This study shows that the integration into the target site of chromosome 1q13 may avoid the problems of random integration that cause gene silencing or also overcome position effects, facilitating exogenous gene expression in CHO-S cells.
Successful control of onchocerciasis vectors in San Vicente Pacaya, Guatemala, 1984-1989.
Ochoa, J O; Castro, J C; Barrios, V M; Juarez, E L; Tada, I
1997-07-01
Between 1984 and 1989, the onchocerciasis-vector control zone on the pilot area of San Vicente Pacaya, Guatemala, which had been subject to experimental control since 1979, was extended from 91.3 to 148.6 km2. Temephos was used as a larvicide against Simulium ochraceum s.l. the target species. As a new strategy, only breeding sites with water discharges of 0.1-10 litres/s were treated, every 2 weeks. This approach provided a substantial reduction in effort, number of treated sites, time and cost. To assess the effect of the temephos, nine sites were selected in which standardized collections of adult Simulium were made twice a month, by human bait. There was an obvious difference between the pre- and post-control mean densities of flies at each site. In the northern area, which includes the Lavaderos, Barretal, Colina and Rodeo sites, the biting density in 1979, before treatment, varied between 10 and 64 flies/man-hour (FMH). Four years later, this had been reduced to 0.1-3.2 FMH, and by the end of the present study, in 1989, the mean density was zero FMH. In the southern area, which lies south-east of Lavaderos (and includes Guachipilin, Ingerto, Pena Blanca and Sierra Morena), the density during the pre-control phase was 24 FMH at one of the two sites investigated at the time and 39.3 FMH at the other. It fell to 0.1-0.5 FMH after 5 years of control and to zero (three sites) or close to zero (< or = 0.5 FMH; one site) for the last 4 years of the present study. To assess the effect of vector control on onchocerciasis prevalence and incidence, 1280 residents from six endemic communities, out of 12,000 permanent inhabitants, were examined. In Santa Cruz, Patrocinio and Los Rios, the prevalence of skin microfilariae in the subjects from each community fell from 8.1%-37.8% during the pretreatment, base-line period to 0.0%-31.5% when the study foci were totally integrated into the vector-control operation following treatment. Incidence among children (aged < or = 9 years) varied from 0%-25% for the period 1982-1984 but, thereafter, not a single case appeared in four of the six study communities (Santa Cruz, Patrocinio, Los Rios and Berlin). Incidence in Guachipilin did not decline appreciably, probably because of human migration into the area from other onchocerciasis foci. The prevalence of nodules followed a similar trend to those of the prevalence and incidence of skin microfilariae, falling from 9.1%-45.0% pre-control to 1.8%-14.3% 10 years later.
Recombinase-Mediated Cassette Exchange Using Adenoviral Vectors.
Kolb, Andreas F; Knowles, Christopher; Pultinevicius, Patrikas; Harbottle, Jennifer A; Petrie, Linda; Robinson, Claire; Sorrell, David A
2017-01-01
Site-specific recombinases are important tools for the modification of mammalian genomes. In conjunction with viral vectors, they can be utilized to mediate site-specific gene insertions in animals and in cell lines which are difficult to transfect. Here we describe a method for the generation and analysis of an adenovirus vector supporting a recombinase-mediated cassette exchange reaction and discuss the advantages and limitations of this approach.
Methodology and software to detect viral integration site hot-spots
2011-01-01
Background Modern gene therapy methods have limited control over where a therapeutic viral vector inserts into the host genome. Vector integration can activate local gene expression, which can cause cancer if the vector inserts near an oncogene. Viral integration hot-spots or 'common insertion sites' (CIS) are scrutinized to evaluate and predict patient safety. CIS are typically defined by a minimum density of insertions (such as 2-4 within a 30-100 kb region), which unfortunately depends on the total number of observed VIS. This is problematic for comparing hot-spot distributions across data sets and patients, where the VIS numbers may vary. Results We develop two new methods for defining hot-spots that are relatively independent of data set size. Both methods operate on distributions of VIS across consecutive 1 Mb 'bins' of the genome. The first method 'z-threshold' tallies the number of VIS per bin, converts these counts to z-scores, and applies a threshold to define high density bins. The second method 'BCP' applies a Bayesian change-point model to the z-scores to define hot-spots. The novel hot-spot methods are compared with a conventional CIS method using simulated data sets and data sets from five published human studies, including the X-linked ALD (adrenoleukodystrophy), CGD (chronic granulomatous disease) and SCID-X1 (X-linked severe combined immunodeficiency) trials. The BCP analysis of the human X-linked ALD data for two patients separately (774 and 1627 VIS) and combined (2401 VIS) resulted in 5-6 hot-spots covering 0.17-0.251% of the genome and containing 5.56-7.74% of the total VIS. In comparison, the CIS analysis resulted in 12-110 hot-spots covering 0.018-0.246% of the genome and containing 5.81-22.7% of the VIS, corresponding to a greater number of hot-spots as the data set size increased. Our hot-spot methods enable one to evaluate the extent of VIS clustering, and formally compare data sets in terms of hot-spot overlap. Finally, we show that the BCP hot-spots from the repopulating samples coincide with greater gene and CpG island density than the median genome density. Conclusions The z-threshold and BCP methods are useful for comparing hot-spot patterns across data sets of disparate sizes. The methodology and software provided here should enable one to study hot-spot conservation across a variety of VIS data sets and evaluate vector safety for gene therapy trials. PMID:21914224
VectorBase: a home for invertebrate vectors of human pathogens
Lawson, Daniel; Arensburger, Peter; Atkinson, Peter; Besansky, Nora J.; Bruggner, Robert V.; Butler, Ryan; Campbell, Kathryn S.; Christophides, George K.; Christley, Scott; Dialynas, Emmanuel; Emmert, David; Hammond, Martin; Hill, Catherine A.; Kennedy, Ryan C.; Lobo, Neil F.; MacCallum, M. Robert; Madey, Greg; Megy, Karine; Redmond, Seth; Russo, Susan; Severson, David W.; Stinson, Eric O.; Topalis, Pantelis; Zdobnov, Evgeny M.; Birney, Ewan; Gelbart, William M.; Kafatos, Fotis C.; Louis, Christos; Collins, Frank H.
2007-01-01
VectorBase () is a web-accessible data repository for information about invertebrate vectors of human pathogens. VectorBase annotates and maintains vector genomes providing an integrated resource for the research community. Currently, VectorBase contains genome information for two organisms: Anopheles gambiae, a vector for the Plasmodium protozoan agent causing malaria, and Aedes aegypti, a vector for the flaviviral agents causing Yellow fever and Dengue fever. PMID:17145709
Genome Integration and Excision by a New Streptomyces Bacteriophage, ϕJoe
Haley, Joshua A.; Stark, W. Marshall
2016-01-01
ABSTRACT Bacteriophages are the source of many valuable tools for molecular biology and genetic manipulation. In Streptomyces, most DNA cloning vectors are based on serine integrase site-specific DNA recombination systems derived from phage. Because of their efficiency and simplicity, serine integrases are also used for diverse synthetic biology applications. Here, we present the genome of a new Streptomyces phage, ϕJoe, and investigate the conditions for integration and excision of the ϕJoe genome. ϕJoe belongs to the largest Streptomyces phage cluster (R4-like) and encodes a serine integrase. The attB site from Streptomyces venezuelae was used efficiently by an integrating plasmid, pCMF92, constructed using the ϕJoe int-attP locus. The attB site for ϕJoe integrase was occupied in several Streptomyces genomes, including that of S. coelicolor, by a mobile element that varies in gene content and size between host species. Serine integrases require a phage-encoded recombination directionality factor (RDF) to activate the excision reaction. The ϕJoe RDF was identified, and its function was confirmed in vivo. Both the integrase and RDF were active in in vitro recombination assays. The ϕJoe site-specific recombination system is likely to be an important addition to the synthetic biology and genome engineering toolbox. IMPORTANCE Streptomyces spp. are prolific producers of secondary metabolites, including many clinically useful antibiotics. Bacteriophage-derived integrases are important tools for genetic engineering, as they enable integration of heterologous DNA into the Streptomyces chromosome with ease and high efficiency. Recently, researchers have been applying phage integrases for a variety of applications in synthetic biology, including rapid assembly of novel combinations of genes, biosensors, and biocomputing. An important requirement for optimal experimental design and predictability when using integrases, however, is the need for multiple enzymes with different specificities for their integration sites. In order to provide a broad platform of integrases, we identified and validated the integrase from a newly isolated Streptomyces phage, ϕJoe. ϕJoe integrase is active in vitro and in vivo. The specific recognition site for integration is present in a wide range of different actinobacteria, including Streptomyces venezuelae, an emerging model bacterium in Streptomyces research. PMID:28003200
Searching for transcription factor binding sites in vector spaces
2012-01-01
Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338
NASA Astrophysics Data System (ADS)
Fukushima, Toshio
2017-06-01
Reviewed are recently developed methods of the numerical integration of the gravitational field of general two- or three-dimensional bodies with arbitrary shape and mass density distribution: (i) an axisymmetric infinitely-thin disc (Fukushima 2016a, MNRAS, 456, 3702), (ii) a general infinitely-thin plate (Fukushima 2016b, MNRAS, 459, 3825), (iii) a plane-symmetric and axisymmetric ring-like object (Fukushima 2016c, AJ, 152, 35), (iv) an axisymmetric thick disc (Fukushima 2016d, MNRAS, 462, 2138), and (v) a general three-dimensional body (Fukushima 2016e, MNRAS, 463, 1500). The key techniques employed are (a) the split quadrature method using the double exponential rule (Takahashi and Mori, 1973, Numer. Math., 21, 206), (b) the precise and fast computation of complete elliptic integrals (Fukushima 2015, J. Comp. Appl. Math., 282, 71), (c) Ridder's algorithm of numerical differentiaion (Ridder 1982, Adv. Eng. Softw., 4, 75), (d) the recursive computation of the zonal toroidal harmonics, and (e) the integration variable transformation to the local spherical polar coordinates. These devices succesfully regularize the Newton kernel in the integrands so as to provide accurate integral values. For example, the general 3D potential is regularly integrated as Φ (\\vec{x}) = - G \\int_0^∞ ( \\int_{-1}^1 ( \\int_0^{2π} ρ (\\vec{x}+\\vec{q}) dψ ) dγ ) q dq, where \\vec{q} = q (√{1-γ^2} cos ψ, √{1-γ^2} sin ψ, γ), is the relative position vector referred to \\vec{x}, the position vector at which the potential is evaluated. As a result, the new methods can compute the potential and acceleration vector very accurately. In fact, the axisymmetric integration reproduces the Miyamoto-Nagai potential with 14 correct digits. The developed methods are applied to the gravitational field study of galaxies and protoplanetary discs. Among them, the investigation on the rotation curve of M33 supports a disc-like structure of the dark matter with a double-power-law surface mass density distribution. Fortran 90 subroutines to execute these methods and their test programs and sample outputs are available from the author's WEB site: https://www.researchgate.net/profile/Toshio_Fukushima/
Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange
Hmelo, Laura R.; Borlee, Bradley R.; Almblad, Henrik; Love, Michelle E.; Randall, Trevor E.; Tseng, Boo Shan; Lin, Chuyang; Irie, Yasuhiko; Storek, Kelly M.; Yang, Jaeun Jane; Siehnel, Richard J.; Howell, P. Lynne; Singh, Pradeep K.; Tolker-Nielsen, Tim; Parsek, Matthew R.; Schweizer, Herbert P.; Harrison, Joe J.
2016-01-01
Allelic exchange is an efficient method of bacterial genome engineering. This protocol describes the use of this technique to make gene knockouts and knockins, as well as single nucleotide insertions, deletions and substitutions in Pseudomonas aeruginosa. Unlike other approaches to allelic exchange, this protocol does not require heterologous recombinases to insert or excise selective markers from the target chromosome. Rather, positive and negative selection are enabled solely by suicide vector-encoded functions and host cell proteins. Here, mutant alleles, which are flanked by regions of homology to the recipient chromosome, are synthesized in vitro and then cloned into allelic exchange vectors using standard procedures. These suicide vectors are then introduced into recipient cells by conjugation. Homologous recombination then results in antibiotic resistant single-crossover mutants in which the plasmid has integrated site-specifically into the chromosome. Subsequently, unmarked double-crossover mutants are isolated directly using sucrose-mediated counter-selection. This two-step process yields seamless mutations that are precise to a single base pair of DNA. The entire procedure requires ~2 weeks. PMID:26492139
Guilfoyle, Richard A.; Smith, Lloyd M.
1994-01-01
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.
Guilfoyle, R.A.; Smith, L.M.
1994-12-27
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.
Predictions of malaria vector distribution in Belize based on multispectral satellite data.
Roberts, D R; Paris, J F; Manguin, S; Harbach, R E; Woodruff, R; Rejmankova, E; Polanco, J; Wullschleger, B; Legters, L J
1996-03-01
Use of multispectral satellite data to predict arthropod-borne disease trouble spots is dependent on clear understandings of environmental factors that determine the presence of disease vectors. A blind test of remote sensing-based predictions for the spatial distribution of a malaria vector, Anopheles pseudopunctipennis, was conducted as a follow-up to two years of studies on vector-environmental relationships in Belize. Four of eight sites that were predicted to be high probability locations for presence of An. pseudopunctipennis were positive and all low probability sites (0 of 12) were negative. The absence of An. pseudopunctipennis at four high probability locations probably reflects the low densities that seem to characterize field populations of this species, i.e., the population densities were below the threshold of our sampling effort. Another important malaria vector, An. darlingi, was also present at all high probability sites and absent at all low probability sites. Anopheles darlingi, like An. pseudopunctipennis, is a riverine species. Prior to these collections at ecologically defined locations, this species was last detected in Belize in 1946.
Perturbation vectors to evaluate air quality using lichens and bromeliads: a Brazilian case study.
Monna, F; Marques, A N; Guillon, R; Losno, R; Couette, S; Navarro, N; Dongarra, G; Tamburo, E; Varrica, D; Chateau, C; Nepomuceno, F O
2017-10-17
Samples of one lichen species, Parmotrema crinitum, and one bromeliad species, Tillandsia usneoides, were collected in the state of Rio de Janeiro, Brazil, at four sites differently affected by anthropogenic pollution. The concentrations of aluminum, cadmium, copper, iron, lanthanum, lead, sulfur, titanium, zinc, and zirconium were determined by inductively coupled plasma-atomic emission spectroscopy. The environmental diagnosis was established by examining compositional changes via perturbation vectors, an underused family of methods designed to circumvent the problem of closure in any compositional dataset. The perturbation vectors between the reference site and the other three sites were similar for both species, although body concentration levels were different. At each site, perturbation vectors between lichens and bromeliads were approximately the same, whatever the local pollution level. It should thus be possible to combine these organisms, though physiologically different, for air quality surveys, after making all results comparable with appropriate correction. The use of perturbation vectors seems particularly suitable for assessing pollution level by biomonitoring, and for many frequently met situations in environmental geochemistry, where elemental ratios are more relevant than absolute concentrations.
Predictions of malaria vector distribution in Belize based on multispectral satellite data
NASA Technical Reports Server (NTRS)
Roberts, D. R.; Paris, J. F.; Manguin, S.; Harbach, R. E.; Woodruff, R.; Rejmankova, E.; Polanco, J.; Wullschleger, B.; Legters, L. J.
1996-01-01
Use of multispectral satellite data to predict arthropod-borne disease trouble spots is dependent on clear understandings of environmental factors that determine the presence of disease vectors. A blind test of remote sensing-based predictions for the spatial distribution of a malaria vector, Anopheles pseudopunctipennis, was conducted as a follow-up to two years of studies on vector-environmental relationships in Belize. Four of eight sites that were predicted to be high probability locations for presence of An. pseudopunctipennis were positive and all low probability sites (0 of 12) were negative. The absence of An. pseudopunctipennis at four high probability locations probably reflects the low densities that seem to characterize field populations of this species, i.e., the population densities were below the threshold of our sampling effort. Another important malaria vector, An. darlingi, was also present at all high probability sites and absent at all low probability sites. Anopheles darlingi, like An. pseudopunctipennis, is a riverine species. Prior to these collections at ecologically defined locations, this species was last detected in Belize in 1946.
A generalized nonlocal vector calculus
NASA Astrophysics Data System (ADS)
Alali, Bacim; Liu, Kuo; Gunzburger, Max
2015-10-01
A nonlocal vector calculus was introduced in Du et al. (Math Model Meth Appl Sci 23:493-540, 2013) that has proved useful for the analysis of the peridynamics model of nonlocal mechanics and nonlocal diffusion models. A formulation is developed that provides a more general setting for the nonlocal vector calculus that is independent of particular nonlocal models. It is shown that general nonlocal calculus operators are integral operators with specific integral kernels. General nonlocal calculus properties are developed, including nonlocal integration by parts formula and Green's identities. The nonlocal vector calculus introduced in Du et al. (Math Model Meth Appl Sci 23:493-540, 2013) is shown to be recoverable from the general formulation as a special example. This special nonlocal vector calculus is used to reformulate the peridynamics equation of motion in terms of the nonlocal gradient operator and its adjoint. A new example of nonlocal vector calculus operators is introduced, which shows the potential use of the general formulation for general nonlocal models.
Recombinant protein production from stable mammalian cell lines and pools.
Hacker, David L; Balasubramanian, Sowmya
2016-06-01
We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.
Resting and feeding preferences of Anopheles stephensi in an urban setting, perennial for malaria.
Thomas, Shalu; Ravishankaran, Sangamithra; Justin, N A Johnson Amala; Asokan, Aswin; Mathai, Manu Thomas; Valecha, Neena; Montgomery, Jacqui; Thomas, Matthew B; Eapen, Alex
2017-03-10
The Indian city of Chennai is endemic for malaria and the known local malaria vector is Anopheles stephensi. Plasmodium vivax is the predominant malaria parasite species, though Plasmodium falciparum is present at low levels. The urban ecotype of malaria prevails in Chennai with perennial transmission despite vector surveillance by the Urban Malaria Scheme (UMS) of the National Vector Borne Disease Control Programme (NVBDCP). Understanding the feeding and resting preferences, together with the transmission potential of adult vectors in the area is essential in effective planning and execution of improved vector control measures. A yearlong survey was carried out in cattle sheds and human dwellings to check the resting, feeding preferences and transmission potential of An. stephensi. The gonotrophic status, age structure, resting and host seeking preferences were studied. The infection rate in An. stephensi and Anopheles subpictus were analysed by circumsporozoite ELISA (CS-ELISA). Adult vectors were found more frequently and at higher densities in cattle sheds than human dwellings. The overall Human Blood Index (HBI) was 0.009 indicating the vectors to be strongly zoophilic. Among the vectors collected from human dwellings, 94.2% were from thatched structures and the remaining 5.8% from tiled and asbestos structures. 57.75% of the dissected vectors were nulliparous whereas, 35.83% were monoparous and the rest 6.42% biparous. Sporozoite positivity rate was 0.55% (4/720) and 1.92% (1/52) for An. stephensi collected from cattle sheds and human dwellings, respectively. One adult An. subpictus (1/155) was also found to be infected with P. falciparum. Control of the adult vector populations can be successful only by understanding the resting and feeding preferences. The present study indicates that adult vectors predominantly feed on cattle and cattle sheds are the preferred resting place, possibly due to easy availability of blood meal source and lack of any insecticide or repellent pressure. Hence targeting these resting sites with cost effective, socially acceptable intervention tools, together with effective larval source management to reduce vector breeding, could provide an improved integrated vector management strategy to help drive down malaria transmission and assist in India's plan to eliminate malaria by 2030.
Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B
2006-03-06
Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.
Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B
2006-01-01
Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-01-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439
Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.
Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C
1997-04-01
We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.
High-Throughput Sequencing Reveals Principles of Adeno-Associated Virus Serotype 2 Integration
Janovitz, Tyler; Klein, Isaac A.; Oliveira, Thiago; Mukherjee, Piali; Nussenzweig, Michel C.; Sadelain, Michel
2013-01-01
Viral integrations are important in human biology, yet genome-wide integration profiles have not been determined for many viruses. Adeno-associated virus (AAV) infects most of the human population and is a prevalent gene therapy vector. AAV integrates into the human genome with preference for a single locus, termed AAVS1. However, the genome-wide integration of AAV has not been defined, and the principles underlying this recombination remain unclear. Using a novel high-throughput approach, integrant capture sequencing, nearly 12 million AAV junctions were recovered from a human cell line, providing five orders of magnitude more data than were previously available. Forty-five percent of integrations occurred near AAVS1, and several thousand novel integration hotspots were identified computationally. Most of these occurred in genes, with dozens of hotspots targeting known oncogenes. Viral replication protein binding sites (RBS) and transcriptional activity were major factors favoring integration. In a first for eukaryotic viruses, the data reveal a unique asymmetric integration profile with distinctive directional orientation of viral genomes. These studies provide a new understanding of AAV integration biology through the use of unbiased high-throughput data acquisition and bioinformatics. PMID:23720718
Integrated vector management for malaria control
Beier, John C; Keating, Joseph; Githure, John I; Macdonald, Michael B; Impoinvil, Daniel E; Novak, Robert J
2008-01-01
Integrated vector management (IVM) is defined as "a rational decision-making process for the optimal use of resources for vector control" and includes five key elements: 1) evidence-based decision-making, 2) integrated approaches 3), collaboration within the health sector and with other sectors, 4) advocacy, social mobilization, and legislation, and 5) capacity-building. In 2004, the WHO adopted IVM globally for the control of all vector-borne diseases. Important recent progress has been made in developing and promoting IVM for national malaria control programmes in Africa at a time when successful malaria control programmes are scaling-up with insecticide-treated nets (ITN) and/or indoor residual spraying (IRS) coverage. While interventions using only ITNs and/or IRS successfully reduce transmission intensity and the burden of malaria in many situations, it is not clear if these interventions alone will achieve those critical low levels that result in malaria elimination. Despite the successful employment of comprehensive integrated malaria control programmes, further strengthening of vector control components through IVM is relevant, especially during the "end-game" where control is successful and further efforts are required to go from low transmission situations to sustained local and country-wide malaria elimination. To meet this need and to ensure sustainability of control efforts, malaria control programmes should strengthen their capacity to use data for decision-making with respect to evaluation of current vector control programmes, employment of additional vector control tools in conjunction with ITN/IRS tactics, case-detection and treatment strategies, and determine how much and what types of vector control and interdisciplinary input are required to achieve malaria elimination. Similarly, on a global scale, there is a need for continued research to identify and evaluate new tools for vector control that can be integrated with existing biomedical strategies within national malaria control programmes. This review provides an overview of how IVM programmes are being implemented, and provides recommendations for further development of IVM to meet the goals of national malaria control programmes in Africa. PMID:19091038
Sakkhachornphop, Supachai; Barbas, Carlos F; Keawvichit, Rassamee; Wongworapat, Kanlaya; Tayapiwatana, Chatchai
2012-09-01
Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine-adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future.
Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.
Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu
2017-06-14
Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.
STK Integrated Message Production List Editor (SIMPLE) for CEO Operations
NASA Technical Reports Server (NTRS)
Trenchard, Mike; Heydorn, James
2014-01-01
Late in fiscal year 2011, the Crew Earth Observations (CEO) team was tasked to upgrade and replace its mission planning and mission operations software systems, which were developed in the Space Shuttle era of the 1980s and 1990s. The impetuses for this change were the planned transition of all workstations to the Windows 7 64-bit operating system and the desire for more efficient and effective use of Satellite Tool Kit (STK) software required for reliable International Space Station (ISS) Earth location tracking. An additional requirement of this new system was the use of the same SQL database of CEO science sites from the SMMS, which was also being developed. STK Integrated Message Production List Editor (SIMPLE) is the essential, all-in-one tool now used by CEO staff to perform daily ISS mission planning to meet its requirement to acquire astronaut photography of specific sites on Earth. The sites are part of a managed, long-term database that has been defined and developed for scientific, educational, and public interest. SIMPLE's end product is a set of basic time and location data computed for an operator-selected set of targets that the ISS crew will be asked to photograph (photography is typically planned 12 to 36 hours out). The CEO operator uses SIMPLE to (a) specify a payload operations planning period; (b) acquire and validate the best available ephemeris data (vectors) for the ISS during the planning period; (c) ingest and display mission-specific site information from the CEO database; (d) identify and display potential current dynamic event targets as map features; (e) compute and display time and location information for each target; (f) screen and select targets based on known crew availability constraints, obliquity constraints, and real-time evaluated constraints to target visibility due to illumination (sun elevation) and atmospheric conditions (weather); and finally (g) incorporate basic, computed time and location information for each selected target into the daily CEO Target List product (message) for submission to ISS payload planning and integration teams for their review and approval prior to uplink. SIMPLE requires and uses the following resources: an ISS mission planning period Greenwich Mean Time start date/time and end date/time), the best available ISS mission ephemeris data (vectors) for that planning period, the STK software package configured for the ISS, and an ISS mission-specific subset of the CEO sites database. The primary advantages realized by the development and implementation of SIMPLE into the CEO payload operations support activity are a smooth transition to the Windows 7 operating system upon scheduled workstation refresh; streamlining of the input and verification of the current ISS ephemeris (vector data); seamless incorporation of selected contents of the SQL database of science sites; the ability to tag and display potential dynamic event opportunities on orbit track maps; simplification of the display and selection of encountered sites based on crew availability, illumination, obliquity, and weather constraints; the incorporation of high-quality mapping of the Earth with various satellite-based datasets for use in describing targets; and the ability to encapsulate and export the essential selected target elements in XML format for use by onboard Earth-location systems, such as Worldmap. SIMPLE is a carefully designed and crafted in-house software package that includes detailed help files for the user and meticulous internal documentation for future modifications. It was delivered in February 2012 for test and evaluation. Following acceptance, it was implemented for CEO mission operations support in May 2012.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravalli, Rajagopal N., E-mail: aravalli@umn.edu; Park, Chang W.; Steer, Clifford J., E-mail: steer001@umn.edu
The Sleeping Beauty transposon (SB-Tn) system is being used widely as a DNA vector for the delivery of therapeutic transgenes, as well as a tool for the insertional mutagenesis in animal models. In order to accurately assess the insertional potential and properties related to the integration of SB it is essential to determine the copy number of SB-Tn in the host genome. Recently developed SB100X transposase has demonstrated an integration rate that was much higher than the original SB10 and that of other versions of hyperactive SB transposases, such as HSB3 or HSB17. In this study, we have constructed amore » series of SB vectors carrying either a DsRed or a human β-globin transgene that was encompassed by cHS4 insulator elements, and containing the SB100X transposase gene outside the SB-Tn unit within the same vector in cis configuration. These SB-Tn constructs were introduced into the K-562 erythroid cell line, and their presence in the genomes of host cells was analyzed by Southern blot analysis using non-radioactive probes. Many copies of SB-Tn insertions were detected in host cells regardless of transgene sequences or the presence of cHS4 insulator elements. Interestingly, the size difference of 2.4 kb between insulated SB and non-insulated controls did not reflect the proportional difference in copy numbers of inserted SB-Tns. We then attempted methylation-sensitive Southern blots to assess the potential influence of cHS4 insulator elements on the epigenetic modification of SB-Tn. Our results indicated that SB100X was able to integrate at multiple sites with the number of SB-Tn copies larger than 6 kb in size. In addition, the non-radioactive Southern blot protocols developed here will be useful to detect integrated SB-Tn copies in any mammalian cell type.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Proper Conformal Killing Vectors in Kantowski-Sachs Metric
NASA Astrophysics Data System (ADS)
Hussain, Tahir; Farhan, Muhammad
2018-04-01
This paper deals with the existence of proper conformal Killing vectors (CKVs) in Kantowski-Sachs metric. Subject to some integrability conditions, the general form of vector filed generating CKVs and the conformal factor is presented. The integrability conditions are solved generally as well as in some particular cases to show that the non-conformally flat Kantowski-Sachs metric admits two proper CKVs, while it admits a 15-dimensional Lie algebra of CKVs in the case when it becomes conformally flat. The inheriting conformal Killing vectors (ICKVs), which map fluid lines conformally, are also investigated.
Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming.
Schmitt, Christopher E; Morales, Blanca M; Schmitz, Ellen M H; Hawkins, John S; Lizama, Carlos O; Zape, Joan P; Hsiao, Edward C; Zovein, Ann C
2017-06-05
Non-integrating episomal vectors have become an important tool for induced pluripotent stem cell reprogramming. The episomal vectors carrying the "Yamanaka reprogramming factors" (Oct4, Klf, Sox2, and L-Myc + Lin28) are critical tools for non-integrating reprogramming of cells to a pluripotent state. However, the reprogramming process remains highly stochastic, and is hampered by an inability to easily identify clones that carry the episomal vectors. We modified the original set of vectors to express spectrally separable fluorescent proteins to allow for enrichment of transfected cells. The vectors were then tested against the standard original vectors for reprogramming efficiency and for the ability to enrich for stoichiometric ratios of factors. The reengineered vectors allow for cell sorting based on reprogramming factor expression. We show that these vectors can assist in tracking episomal expression in individual cells and can select the reprogramming factor dosage. Together, these modified vectors are a useful tool for understanding the reprogramming process and improving induced pluripotent stem cell isolation efficiency.
NASA Technical Reports Server (NTRS)
1994-01-01
The Physical Oceanography Distributed Active Archive Center (PO.DAAC) archive at the Jet Propulsion Laboratory (JPL) includes satellite data sets for the ocean sciences and global-change research to facilitate multidisciplinary use of satellite ocean data. Parameters include sea-surface height, surface-wind vector, sea-surface temperature, atmospheric liquid water, and integrated water vapor. The JPL PO.DAAC is an element of the Earth Observing System Data and Information System (EOSDIS) and is the United States distribution site for Ocean Topography Experiment (TOPEX)/POSEIDON data and metadata.
Paaijmans, Krijn P; Imbahale, Susan S; Thomas, Matthew B; Takken, Willem
2010-07-09
The relationship between mosquito development and temperature is one of the keys to understanding the current and future dynamics and distribution of vector-borne diseases such as malaria. Many process-based models use mean air temperature to estimate larval development times, and hence adult vector densities and/or malaria risk. Water temperatures in three different-sized water pools, as well as the adjacent air temperature in lowland and highland sites in western Kenya were monitored. Both air and water temperatures were fed into a widely-applied temperature-dependent development model for Anopheles gambiae immatures, and subsequently their impact on predicted vector abundance was assessed. Mean water temperature in typical mosquito breeding sites was 4-6 degrees C higher than the mean temperature of the adjacent air, resulting in larval development rates, and hence population growth rates, that are much higher than predicted based on air temperature. On the other hand, due to the non-linearities in the relationship between temperature and larval development rate, together with a marginal buffering in the increase in water temperature compared with air temperature, the relative increases in larval development rates predicted due to climate change are substantially less. Existing models will tend to underestimate mosquito population growth under current conditions, and may overestimate relative increases in population growth under future climate change. These results highlight the need for better integration of biological and environmental information at the scale relevant to mosquito biology.
Wong, Gwendolyn K L; Jim, C Y
2016-12-15
Green roof, an increasingly common constituent of urban green infrastructure, can provide multiple ecosystem services and mitigate climate-change and urban-heat-island challenges. Its adoption has been beset by a longstanding preconception of attracting urban pests like mosquitoes. As more cities may become vulnerable to emerging and re-emerging mosquito-borne infectious diseases, the knowledge gap needs to be filled. This study gauges the habitat preference of vector mosquitoes for extensive green roofs vis-à-vis positive and negative control sites in an urban setting. Seven sites in a university campus were selected to represent three experimental treatments: green roofs (GR), ground-level blue-green spaces as positive controls (PC), and bare roofs as negative controls (NC). Mosquito-trapping devices were deployed for a year from March 2015 to 2016. Human-biting mosquito species known to transmit infectious diseases in the region were identified and recorded as target species. Generalized linear models evaluated the effects of site type, season, and weather on vector-mosquito abundance. Our model revealed site type as a significant predictor of vector mosquito abundance, with considerably more vector mosquitoes captured in PC than in GR and NC. Vector abundance was higher in NC than in GR, attributed to the occasional presence of water pools in depressions of roofing membrane after rainfall. Our data also demonstrated seasonal differences in abundance. Weather variables were evaluated to assess human-vector contact risks under different weather conditions. Culex quinquefasciatus, a competent vector of diseases including lymphatic filariasis and West Nile fever, could be the most adaptable species. Our analysis demonstrates that green roofs are not particularly preferred by local vector mosquitoes compared to bare roofs and other urban spaces in a humid subtropical setting. The findings call for a better understanding of vector ecology in diverse urban landscapes to improve disease control efficacy amidst surging urbanization and changing climate. Copyright © 2016 Elsevier B.V. All rights reserved.
Torina, Alessandra; Blanda, Valeria; Blanda, Marcellocalogero; Auteri, Michelangelo; La Russa, Francesco; Scimeca, Salvatore; D'Agostino, Rosalia; Disclafani, Rosaria; Villari, Sara; Currò, Vittoria; Caracappa, Santo
2018-02-27
Ticks (Acari: Ixodidae) are bloodsucking arthropods involved in pathogen transmission in animals and humans. Tick activity depends on various ecological factors such as vegetation, hosts, and temperature. The aim of this study was to analyse the spatial/temporal distribution of ticks in six sites within a peri-urban area of Palermo (Natural Reserve of Monte Pellegrino) and correlate it with field data using Geographical Information System (GIS) data. A total of 3092 ticks were gathered via dragging method from June 2012 to May 2014. The species collected were: Ixodes ventalloi (46.09%), Hyalomma lusitanicum (19.99%), Rhipicephalus sanguineus (17.34%), Rhipicephalus pusillus (16.11%), Haemaphisalis sulcata (0.36%), Dermacentor marginatus (0.10%), and Rhipicephalus turanicus (0.03%). GIS analysis revealed environmental characteristics of each site, and abundance of each tick species was analysed in relation to time (monthly trend) and space (site-specific abundance). A relevant presence of I. ventalloi in site 2 and H. lusitanicum in site 5 was observed, suggesting the possible exposure of animals and humans to tick-borne pathogens. Our study shows the importance of surveillance of ticks in peri-urban areas and the useful implementation of GIS analysis in vector ecology; studies on temporal and spatial distribution of ticks correlated to GIS-based ecological analysis represent an integrated strategy for decision support in public health.
Dissociable cognitive mechanisms underlying human path integration.
Wiener, Jan M; Berthoz, Alain; Wolbers, Thomas
2011-01-01
Path integration is a fundamental mechanism of spatial navigation. In non-human species, it is assumed to be an online process in which a homing vector is updated continuously during an outward journey. In contrast, human path integration has been conceptualized as a configural process in which travelers store working memory representations of path segments, with the computation of a homing vector only occurring when required. To resolve this apparent discrepancy, we tested whether humans can employ different path integration strategies in the same task. Using a triangle completion paradigm, participants were instructed either to continuously update the start position during locomotion (continuous strategy) or to remember the shape of the outbound path and to calculate home vectors on basis of this representation (configural strategy). While overall homing accuracy was superior in the configural condition, participants were quicker to respond during continuous updating, strongly suggesting that homing vectors were computed online. Corroborating these findings, we observed reliable differences in head orientation during the outbound path: when participants applied the continuous updating strategy, the head deviated significantly from straight ahead in direction of the start place, which can be interpreted as a continuous motor expression of the homing vector. Head orientation-a novel online measure for path integration-can thus inform about the underlying updating mechanism already during locomotion. In addition to demonstrating that humans can employ different cognitive strategies during path integration, our two-systems view helps to resolve recent controversies regarding the role of the medial temporal lobe in human path integration.
Chanda, Emmanuel; Ameneshewa, Birkinesh; Mihreteab, Selam; Berhane, Araia; Zehaie, Assefash; Ghebrat, Yohannes; Usman, Abdulmumini
2015-12-02
Contemporary malaria vector control relies on the use of insecticide-based, indoor residual spraying (IRS) and long-lasting insecticidal nets (LLINs). However, malaria-endemic countries, including Eritrea, have struggled to effectively deploy these tools due technical and operational challenges, including the selection of insecticide resistance in malaria vectors. This manuscript outlines the processes undertaken in consolidating strategic planning and operational frameworks for vector control to expedite malaria elimination in Eritrea. The effort to strengthen strategic frameworks for vector control in Eritrea was the 'case' for this study. The integrated vector management (IVM) strategy was developed in 2010 but was not well executed, resulting in a rise in malaria transmission, prompting a process to redefine and relaunch the IVM strategy with integration of other vector borne diseases (VBDs) as the focus. The information sources for this study included all available data and accessible archived documentary records on malaria vector control in Eritrea. Structured literature searches of published, peer-reviewed sources using online, scientific, bibliographic databases, Google Scholar, PubMed and WHO, and a combination of search terms were utilized to gather data. The literature was reviewed and adapted to the local context and translated into the consolidated strategic framework. In Eritrea, communities are grappling with the challenge of VBDs posing public health concerns, including malaria. The global fund financed the scale-up of IRS and LLIN programmes in 2014. Eritrea is transitioning towards malaria elimination and strategic frameworks for vector control have been consolidated by: developing an integrated vector management (IVM) strategy (2015-2019); updating IRS and larval source management (LSM) guidelines; developing training manuals for IRS and LSM; training of national staff in malaria entomology and vector control, including insecticide resistance monitoring techniques; initiating the global plan for insecticide resistance management; conducting needs' assessments and developing standard operating procedure for insectaries; developing a guidance document on malaria vector control based on eco-epidemiological strata, a vector surveillance plan and harmonized mapping, data collection and reporting tools. Eritrea has successfully consolidated strategic frameworks for vector control. Rational decision-making remains critical to ensure that the interventions are effective and their choice is evidence-based, and to optimize the use of resources for vector control. Implementation of effective IVM requires proper collaboration and coordination, consistent technical and financial capacity and support to offer greater benefits.
Vector tomography for reconstructing electric fields with non-zero divergence in bounded domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koulouri, Alexandra, E-mail: koulouri@uni-muenster.de; Department of Electrical and Electronic Engineering, Imperial College London, Exhibition Road, London SW7 2BT; Brookes, Mike
In vector tomography (VT), the aim is to reconstruct an unknown multi-dimensional vector field using line integral data. In the case of a 2-dimensional VT, two types of line integral data are usually required. These data correspond to integration of the parallel and perpendicular projection of the vector field along the integration lines and are called the longitudinal and transverse measurements, respectively. In most cases, however, the transverse measurements cannot be physically acquired. Therefore, the VT methods are typically used to reconstruct divergence-free (or source-free) velocity and flow fields that can be reconstructed solely from the longitudinal measurements. In thismore » paper, we show how vector fields with non-zero divergence in a bounded domain can also be reconstructed from the longitudinal measurements without the need of explicitly evaluating the transverse measurements. To the best of our knowledge, VT has not previously been used for this purpose. In particular, we study low-frequency, time-harmonic electric fields generated by dipole sources in convex bounded domains which arise, for example, in electroencephalography (EEG) source imaging. We explain in detail the theoretical background, the derivation of the electric field inverse problem and the numerical approximation of the line integrals. We show that fields with non-zero divergence can be reconstructed from the longitudinal measurements with the help of two sparsity constraints that are constructed from the transverse measurements and the vector Laplace operator. As a comparison to EEG source imaging, we note that VT does not require mathematical modeling of the sources. By numerical simulations, we show that the pattern of the electric field can be correctly estimated using VT and the location of the source activity can be determined accurately from the reconstructed magnitudes of the field. - Highlights: • Vector tomography is used to reconstruct electric fields generated by dipole sources. • Inverse solutions are based on longitudinal and transverse line integral measurements. • Transverse line integral measurements are used as a sparsity constraint. • Numerical procedure to approximate the line integrals is described in detail. • Patterns of the studied electric fields are correctly estimated.« less
Reducing vector-borne disease by empowering farmers in integrated vector management.
van den Berg, Henk; von Hildebrand, Alexander; Ragunathan, Vaithilingam; Das, Pradeep K
2007-07-01
Irrigated agriculture exposes rural people to health risks associated with vector-borne diseases and pesticides used in agriculture and for public health protection. Most developing countries lack collaboration between the agricultural and health sectors to jointly address these problems. We present an evaluation of a project that uses the "farmer field school" method to teach farmers how to manage vector-borne diseases and how to improve rice yields. Teaching farmers about these two concepts together is known as "integrated pest and vector management". An intersectoral project targeting rice irrigation systems in Sri Lanka. Project partners developed a new curriculum for the field school that included a component on vector-borne diseases. Rice farmers in intervention villages who graduated from the field school took vector-control actions as well as improving environmental sanitation and their personal protection measures against disease transmission. They also reduced their use of agricultural pesticides, especially insecticides. The intervention motivated and enabled rural people to take part in vector-management activities and to reduce several environmental health risks. There is scope for expanding the curriculum to include information on the harmful effects of pesticides on human health and to address other public health concerns. Benefits of this approach for community-based health programmes have not yet been optimally assessed. Also, the institutional basis of the integrated management approach needs to be broadened so that people from a wider range of organizations take part. A monitoring and evaluation system needs to be established to measure the performance of integrated management initiatives.
Ngufor, Corine; N'Guessan, Raphael; Fagbohoun, Josias; Subramaniam, Krishanthi; Odjo, Abibatou; Fongnikin, Augustin; Akogbeto, Martin; Weetman, David; Rowland, Mark
2015-11-18
Novel indoor residual spraying (IRS) and long-lasting insecticidal net (LLIN) products aimed at improving the control of pyrethroid-resistant malaria vectors have to be evaluated in Phase II semi-field experimental studies against highly pyrethroid-resistant mosquitoes. To better understand their performance it is necessary to fully characterize the species composition, resistance status and resistance mechanisms of the vector populations in the experimental hut sites. Bioassays were performed to assess phenotypic insecticide resistance in the malaria vector population at a newly constructed experimental hut site in Cové, a rice growing area in southern Benin, being used for WHOPES Phase II evaluation of newly developed LLIN and IRS products. The efficacy of standard WHOPES-approved pyrethroid LLIN and IRS products was also assessed in the experimental huts. Diagnostic genotyping techniques and microarray studies were performed to investigate the genetic basis of pyrethroid resistance in the Cové Anopheles gambiae population. The vector population at the Cové experimental hut site consisted of a mixture of Anopheles coluzzii and An. gambiae s.s. with the latter occurring at lower frequencies (23 %) and only in samples collected in the dry season. There was a high prevalence of resistance to pyrethroids and DDT (>90 % bioassay survival) with pyrethroid resistance intensity reaching 200-fold compared to the laboratory susceptible An. gambiae Kisumu strain. Standard WHOPES-approved pyrethroid IRS and LLIN products were ineffective in the experimental huts against this vector population (8-29 % mortality). The L1014F allele frequency was 89 %. CYP6P3, a cytochrome P450 validated as an efficient metabolizer of pyrethroids, was over-expressed. Characterizing pyrethroid resistance at Phase II field sites is crucial to the accurate interpretation of the performance of novel vector control products. The strong levels of pyrethroid resistance at the Cové experimental hut station make it a suitable site for Phase II experimental hut evaluations of novel vector control products, which aim for improved efficacy against pyrethroid-resistant malaria vectors to WHOPES standards. The resistance genes identified can be used as markers for further studies investigating the resistance management potential of novel mixture LLIN and IRS products tested at the site.
Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P
2006-08-01
Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.
Zheng, Weiyan; Wang, Yingjia; Chang, Tammy; Huang, He; Yee, Jiing-Kuan
2013-04-25
Retrovirus is frequently used in the genetic modification of mammalian cells and the establishment of induced pluripotent stem cells (iPSCs) via cell reprogramming. Vector-induced genotoxicity could induce profound effect on the physiology and function of these stem cells and their differentiated progeny. We analyzed retrovirus-induced genotoxicity in somatic cell Jurkat and two iPSC lines. In Jurkat cells, retrovirus frequently activated host gene expression and gene activation was not dependent on the distance between the integration site and the transcription start site of the host gene. In contrast, retrovirus frequently down-regulated host gene expression in iPSCs, possibly due to the action of chromatin silencing that spreads from the provirus to the nearby host gene promoter. Our data raises the issue that some of the phenotypic variability observed among iPSC clones derived from the same parental cell line may be caused by retrovirus-induced gene expression changes rather than by the reprogramming process itself. It also underscores the importance of characterizing retrovirus integration and carrying out risk assessment of iPSCs before they can be applied in basic research and clinics. Copyright © 2013 Elsevier B.V. All rights reserved.
A Data-Driven, Integrated Flare Model Based on Self-Organized Criticality
NASA Astrophysics Data System (ADS)
Dimitropoulou, M.; Isliker, H.; Vlahos, L.; Georgoulis, M.
2013-09-01
We interpret solar flares as events originating in solar active regions having reached the self-organized critical state, by alternatively using two versions of an "integrated flare model" - one static and one dynamic. In both versions the initial conditions are derived from observations aiming to investigate whether well-known scaling laws observed in the distribution functions of characteristic flare parameters are reproduced after the self-organized critical state has been reached. In the static model, we first apply a nonlinear force-free extrapolation that reconstructs the three-dimensional magnetic fields from two-dimensional vector magnetograms. We then locate magnetic discontinuities exceeding a threshold in the Laplacian of the magnetic field. These discontinuities are relaxed in local diffusion events, implemented in the form of cellular-automaton evolution rules. Subsequent loading and relaxation steps lead the system to self-organized criticality, after which the statistical properties of the simulated events are examined. In the dynamic version we deploy an enhanced driving mechanism, which utilizes the observed evolution of active regions, making use of sequential vector magnetograms. We first apply the static cellular automaton model to consecutive solar vector magnetograms until the self-organized critical state is reached. We then evolve the magnetic field inbetween these processed snapshots through spline interpolation, acting as a natural driver in the dynamic model. The identification of magnetically unstable sites as well as their relaxation follow the same rules as in the static model after each interpolation step. Subsequent interpolation/driving and relaxation steps cover all transitions until the end of the sequence. Physical requirements, such as the divergence-free condition for the magnetic field vector, are approximately satisfied in both versions of the model. We obtain robust power laws in the distribution functions of the modelled flaring events with scaling indices in good agreement with observations. We therefore conclude that well-known statistical properties of flares are reproduced after active regions reach self-organized criticality. The significant enhancement in both the static and the dynamic integrated flare models is that they initiate the simulation from observations, thus facilitating energy calculation in physical units. Especially in the dynamic version of the model, the driving of the system is based on observed, evolving vector magnetograms, allowing for the separation between MHD and kinetic timescales through the assignment of distinct MHD timestamps to each interpolation step.
Cancer gene discovery: exploiting insertional mutagenesis
Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio
2013-01-01
Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056
Human Induced Pluripotent Stem Cells Free of Vector and Transgene Sequences
Yu, Junying; Hu, Kejin; Smuga-Otto, Kim; Tian, Shulan; Stewart, Ron; Slukvin, Igor I.; Thomson, James A.
2009-01-01
Reprogramming differentiated human cells to induced pluripotent stem (iPS) cells has applications in basic biology, drug development, and transplantation. Human iPS cell derivation previously required vectors that integrate into the genome, which can create mutations and limit the utility of the cells in both research and clinical applications. Here we describe the derivation of human iPS cells using non-integrating episomal vectors. After removal of the episome, iPS cells completely free of vector and transgene sequences are derived that are similar to human embryonic stem (ES) cells in proliferative and developmental potential. These results demonstrate that reprogramming human somatic cells does not require genomic integration or the continued presence of exogenous reprogramming factors, and removes one obstacle to the clinical application of human iPS cells. PMID:19325077
Ayllón, Tania; Câmara, Daniel Cardoso Portela; Morone, Fernanda Cristina; Gonçalves, Larissa da Silva; Saito Monteiro de Barros, Fábio; Brasil, Patrícia; Carvalho, Marilia Sá; Honório, Nildimar Alves
2018-01-01
Aedes albopictus, originally considered as a secondary vector for arbovirus transmission, especially in areas where this species co-exist with Aedes aegypti, has been described in most regions of the world. Dispersion and domiciliation of Ae. albopictus in a complex of densely urbanized slums in Rio de Janeiro, Southeastern Brazil, was evidenced. In this study, we tested the hypotheses that 1) Ae. albopictus distribution in urban slums is negatively related to distance from vegetation, and 2) these vectors have taken on a domestic life style with a portion of the population feeding, ovipositing, and resting indoors. To do this, we developed an integrated surveillance proposal, aiming to detect the presence and abundance of Aedes mosquitoes. The study, based on a febrile syndrome surveillance system in a cohort of infants living in the slum complex, was performed on a weekly basis between February 2014 and April 2017. A total of 8,418 adult mosquitoes (3,052 Ae. aegypti, 44 Ae. albopictus, 16 Ae. scapularis, 4 Ae. fluviatilis and 5,302 Culex quinquefasciatus) were collected by direct aspiration and 46,047 Aedes spp. eggs were collected by oviposition traps. The Asian tiger mosquito, Ae. albopictus, was aspirated in its adult form (n = 44), and immature forms of this species (n = 12) were identified from the eggs collected by the ovitraps. In most collection sites, co-occurrence of Ae. aegypti and Ae. albopictus was observed. Key-sites, such as junkyards, thrift stores, factories, tire repair shops and garages, had the higher abundance of Ae. albopictus, followed by schools and households. We collected Ae. albopictus at up to 400 meters to the nearest vegetation cover. The log transformed (n+1) number of females Ae. albopictus captured at each collection point was inversely related to the distance to the nearest vegetation border. These results show that Ae. albopictus, a competent vector for important arboviruses and more commonly found in areas with higher vegetation coverage, is present and spread in neglected and densely urbanized areas, being collected at a long distance from the typical encounter areas for this species. Besides, as Ae. albopictus can easily move between sylvatic and urban environment, the entomological monitoring of Ae. albopictus should be an integral part of mosquito surveillance and control. Finally, key-sites, characterized by high human influx and presence of potential Aedes breeding sites, should be included in entomological monitoring.
Câmara, Daniel Cardoso Portela; Morone, Fernanda Cristina; Gonçalves, Larissa da Silva; Saito Monteiro de Barros, Fábio; Brasil, Patrícia; Carvalho, Marilia Sá; Honório, Nildimar Alves
2018-01-01
Aedes albopictus, originally considered as a secondary vector for arbovirus transmission, especially in areas where this species co-exist with Aedes aegypti, has been described in most regions of the world. Dispersion and domiciliation of Ae. albopictus in a complex of densely urbanized slums in Rio de Janeiro, Southeastern Brazil, was evidenced. In this study, we tested the hypotheses that 1) Ae. albopictus distribution in urban slums is negatively related to distance from vegetation, and 2) these vectors have taken on a domestic life style with a portion of the population feeding, ovipositing, and resting indoors. To do this, we developed an integrated surveillance proposal, aiming to detect the presence and abundance of Aedes mosquitoes. The study, based on a febrile syndrome surveillance system in a cohort of infants living in the slum complex, was performed on a weekly basis between February 2014 and April 2017. A total of 8,418 adult mosquitoes (3,052 Ae. aegypti, 44 Ae. albopictus, 16 Ae. scapularis, 4 Ae. fluviatilis and 5,302 Culex quinquefasciatus) were collected by direct aspiration and 46,047 Aedes spp. eggs were collected by oviposition traps. The Asian tiger mosquito, Ae. albopictus, was aspirated in its adult form (n = 44), and immature forms of this species (n = 12) were identified from the eggs collected by the ovitraps. In most collection sites, co-occurrence of Ae. aegypti and Ae. albopictus was observed. Key-sites, such as junkyards, thrift stores, factories, tire repair shops and garages, had the higher abundance of Ae. albopictus, followed by schools and households. We collected Ae. albopictus at up to 400 meters to the nearest vegetation cover. The log transformed (n+1) number of females Ae. albopictus captured at each collection point was inversely related to the distance to the nearest vegetation border. These results show that Ae. albopictus, a competent vector for important arboviruses and more commonly found in areas with higher vegetation coverage, is present and spread in neglected and densely urbanized areas, being collected at a long distance from the typical encounter areas for this species. Besides, as Ae. albopictus can easily move between sylvatic and urban environment, the entomological monitoring of Ae. albopictus should be an integral part of mosquito surveillance and control. Finally, key-sites, characterized by high human influx and presence of potential Aedes breeding sites, should be included in entomological monitoring. PMID:29684029
Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N
2012-10-01
The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.
Development of Next Generation Synthetic Biology Tools for Use in Streptomyces venezuelae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Phelan, Ryan M.; Sachs, Daniel; Petkiewicz, Shayne J.
Streptomyces have a rich history as producers of important natural products and this genus of bacteria has recently garnered attention for its potential applications in the broader context of synthetic biology. However, the dearth of genetic tools available to control and monitor protein production precludes rapid and predictable metabolic engineering that is possible in hosts such as Escherichia coli or Saccharomyces cerevisiae. In an effort to improve genetic tools for Streptomyces venezuelae, we developed a suite of standardized, orthogonal integration vectors and an improved method to monitor protein production in this host. These tools were applied to characterize heterologous promotersmore » and various attB chromosomal integration sites. A final study leveraged the characterized toolset to demonstrate its use in producing the biofuel precursor bisabolene using a chromosomally integrated expression system. In conclusion, these tools advance S. venezuelae to be a practical host for future metabolic engineering efforts.« less
Intershot Analysis of Flows in DIII-D
NASA Astrophysics Data System (ADS)
Meyer, W. H.; Allen, S. L.; Samuell, C. M.; Howard, J.
2016-10-01
Analysis of the DIII-D flow diagnostic data require demodulation of interference images, and inversion of the resultant line integrated emissivity and flow (phase) images. Four response matrices are pre-calculated: the emissivity line integral and the line integral of the scalar product of the lines-of-site with the orthogonal unit vectors of parallel flow. Equilibrium data determines the relative weight of the component matrices used in the final flow inversion matrix. Serial processing has been used for the lower divertor viewing flow camera 800x600 pixel image. The full cross section viewing camera will require parallel processing of the 2160x2560 pixel image. We will discuss using a Posix thread pool and a Tesla K40c GPU in the processing of this data. Prepared by LLNL under Contract DE-AC52-07NA27344. This material is based upon work supported by the U.S. DOE, Office of Science, Fusion Energy Sciences.
NASA Technical Reports Server (NTRS)
Westmoreland, Sally; Stow, Douglas A.
1992-01-01
A framework is proposed for analyzing ancillary data and developing procedures for incorporating ancillary data to aid interactive identification of land-use categories in land-use updates. The procedures were developed for use within an integrated image processsing/geographic information systems (GIS) that permits simultaneous display of digital image data with the vector land-use data to be updated. With such systems and procedures, automated techniques are integrated with visual-based manual interpretation to exploit the capabilities of both. The procedural framework developed was applied as part of a case study to update a portion of the land-use layer in a regional scale GIS. About 75 percent of the area in the study site that experienced a change in land use was correctly labeled into 19 categories using the combination of automated and visual interpretation procedures developed in the study.
40 CFR 258.22 - Disease vector control.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Disease vector control. 258.22 Section... MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.22 Disease vector control. (a) Owners or operators of all MSWLF units must prevent or control on-site populations of disease vectors using techniques...
40 CFR 258.22 - Disease vector control.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Disease vector control. 258.22 Section... MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.22 Disease vector control. (a) Owners or operators of all MSWLF units must prevent or control on-site populations of disease vectors using techniques...
40 CFR 258.22 - Disease vector control.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Disease vector control. 258.22 Section... MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.22 Disease vector control. (a) Owners or operators of all MSWLF units must prevent or control on-site populations of disease vectors using techniques...
40 CFR 258.22 - Disease vector control.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Disease vector control. 258.22 Section... MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.22 Disease vector control. (a) Owners or operators of all MSWLF units must prevent or control on-site populations of disease vectors using techniques...
40 CFR 258.22 - Disease vector control.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Disease vector control. 258.22 Section... MUNICIPAL SOLID WASTE LANDFILLS Operating Criteria § 258.22 Disease vector control. (a) Owners or operators of all MSWLF units must prevent or control on-site populations of disease vectors using techniques...
Visualizing Vector Fields Using Line Integral Convolution and Dye Advection
NASA Technical Reports Server (NTRS)
Shen, Han-Wei; Johnson, Christopher R.; Ma, Kwan-Liu
1996-01-01
We present local and global techniques to visualize three-dimensional vector field data. Using the Line Integral Convolution (LIC) method to image the global vector field, our new algorithm allows the user to introduce colored 'dye' into the vector field to highlight local flow features. A fast algorithm is proposed that quickly recomputes the dyed LIC images. In addition, we introduce volume rendering methods that can map the LIC texture on any contour surface and/or translucent region defined by additional scalar quantities, and can follow the advection of colored dye throughout the volume.
Parallel/Vector Integration Methods for Dynamical Astronomy
NASA Astrophysics Data System (ADS)
Fukushima, T.
Progress of parallel/vector computers has driven us to develop suitable numerical integrators utilizing their computational power to the full extent while being independent on the size of system to be integrated. Unfortunately, the parallel version of Runge-Kutta type integrators are known to be not so efficient. Recently we developed a parallel version of the extrapolation method (Ito and Fukushima 1997), which allows variable timesteps and still gives an acceleration factor of 3-4 for general problems. While the vector-mode usage of Picard-Chebyshev method (Fukushima 1997a, 1997b) will lead the acceleration factor of order of 1000 for smooth problems such as planetary/satellites orbit integration. The success of multiple-correction PECE mode of time-symmetric implicit Hermitian integrator (Kokubo 1998) seems to enlighten Milankar's so-called "pipelined predictor corrector method", which is expected to lead an acceleration factor of 3-4. We will review these directions and discuss future prospects.
Malaria vector populations across ecological zones in Guinea Conakry and Mali, West Africa.
Coulibaly, Boubacar; Kone, Raymond; Barry, Mamadou S; Emerson, Becky; Coulibaly, Mamadou B; Niare, Oumou; Beavogui, Abdoul H; Traore, Sekou F; Vernick, Kenneth D; Riehle, Michelle M
2016-04-08
Malaria remains a pervasive public health problem in sub-Saharan West Africa. Here mosquito vector populations were explored across four sites in Mali and the Republic of Guinea (Guinea Conakry). The study samples the major ecological zones of malaria-endemic regions in West Africa within a relatively small distance. Mosquito vectors were sampled from larval pools, adult indoor resting sites, and indoor and outdoor human-host seeking adults. Mosquitoes were collected at sites spanning 350 km that represented arid savannah, humid savannah, semi-forest and deep forest ecological zones, in areas where little was previously known about malaria vector populations. 1425 mosquito samples were analysed by molecular assays to determine species, genetic attributes, blood meal sources and Plasmodium infection status. Anopheles gambiae and Anopheles coluzzii were the major anophelines represented in all collections across the ecological zones, with A. coluzzii predominant in the arid savannah and A. gambiae in the more humid sites. The use of multiple collection methodologies across the sampling sites allows assessment of potential collection bias of the different methods. The L1014F kdr insecticide resistance mutation (kdr-w) is found at high frequency across all study sites. This mutation appears to have swept almost to fixation, from low frequencies 6 years earlier, despite the absence of widespread insecticide use for vector control. Rates of human feeding are very high across ecological zones, with only small fractions of animal derived blood meals in the arid and humid savannah. About 30 % of freshly blood-fed mosquitoes were positive for Plasmodium falciparum presence, while the rate of mosquitoes with established infections was an order of magnitude lower. The study represents detailed vector characterization from an understudied area in West Africa with endemic malaria transmission. The deep forest study site includes the epicenter of the 2014 Ebola virus epidemic. With new malaria control interventions planned in Guinea, these data provide a baseline measure and an opportunity to assess the outcome of future interventions.
A novel protocol for the production of recombinant LL-37 expressed as a thioredoxin fusion protein.
Li, Yifeng
2012-02-01
LL-37 is the only cathelicidin-derived antimicrobial peptide found in humans and it has a multifunctional role in host defense. The peptide has been shown to possess immunomodulatory functions in addition to antimicrobial activity. To provide sufficient material for biological and structural characterization of this important peptide, various systems were developed to produce recombinant LL-37 in Escherichia coli. In one previous approach, LL-37 coding sequence was cloned into vector pET-32a, allowing the peptide to be expressed as a thioredoxin fusion. The fusion protein contains two thrombin cleavage sites: a vector-encoded one that is 30-residue upstream of the insert and an engineered one that is immediately adjacent to LL-37. Cleavage at these two sites shall generate three fragments, one of which is the target peptide. However, when the fusion protein was treated with thrombin, cleavage only occurred at the remote upstream site. A plausible explanation is that the thrombin site adjacent to LL-37 is less accessible due to the peptide's aggregation tendency and cleavage at the remote site generates a fragment, which forms a large aggregate that buries the intended site. In this study, I deleted the vector-encoded thrombin site and S tag in pET-32a, and then inserted the coding sequence for LL-37 plus a thrombin site into the modified vector. Although removing the S tag did not change the oligomeric state of the fusion protein, deletion of the vector-encoded thrombin site allowed the fusion to be cleaved at the engineered site to release LL-37. The released peptide was separated from the carrier and cleavage enzyme by size-exclusion chromatography. This new approach enables a quick production of high quality active LL-37 with a decent amount. Copyright © 2011 Elsevier Inc. All rights reserved.
Integrating vector control across diseases.
Golding, Nick; Wilson, Anne L; Moyes, Catherine L; Cano, Jorge; Pigott, David M; Velayudhan, Raman; Brooker, Simon J; Smith, David L; Hay, Simon I; Lindsay, Steve W
2015-10-01
Vector-borne diseases cause a significant proportion of the overall burden of disease across the globe, accounting for over 10 % of the burden of infectious diseases. Despite the availability of effective interventions for many of these diseases, a lack of resources prevents their effective control. Many existing vector control interventions are known to be effective against multiple diseases, so combining vector control programmes to simultaneously tackle several diseases could offer more cost-effective and therefore sustainable disease reductions. The highly successful cross-disease integration of vaccine and mass drug administration programmes in low-resource settings acts a precedent for cross-disease vector control. Whilst deliberate implementation of vector control programmes across multiple diseases has yet to be trialled on a large scale, a number of examples of 'accidental' cross-disease vector control suggest the potential of such an approach. Combining contemporary high-resolution global maps of the major vector-borne pathogens enables us to quantify overlap in their distributions and to estimate the populations jointly at risk of multiple diseases. Such an analysis shows that over 80 % of the global population live in regions of the world at risk from one vector-borne disease, and more than half the world's population live in areas where at least two different vector-borne diseases pose a threat to health. Combining information on co-endemicity with an assessment of the overlap of vector control methods effective against these diseases allows us to highlight opportunities for such integration. Malaria, leishmaniasis, lymphatic filariasis, and dengue are prime candidates for combined vector control. All four of these diseases overlap considerably in their distributions and there is a growing body of evidence for the effectiveness of insecticide-treated nets, screens, and curtains for controlling all of their vectors. The real-world effectiveness of cross-disease vector control programmes can only be evaluated by large-scale trials, but there is clear evidence of the potential of such an approach to enable greater overall health benefit using the limited funds available.
Uchida, Naoya; Hargrove, Phillip W.; Lap, Coen J.; Evans, Molly E.; Phang, Oswald; Bonifacino, Aylin C.; Krouse, Allen E.; Metzger, Mark E.; Nguyen, Anh-Dao; Hsieh, Matthew M.; Wolfsberg, Tyra G.; Donahue, Robert E.; Persons, Derek A.; Tisdale, John F.
2012-01-01
Human immunodeficiency virus type 1 (HIV1) vectors poorly transduce rhesus hematopoietic cells due to species-specific restriction factors, including the tripartite motif-containing 5 isoformα (TRIM5α) which targets the HIV1 capsid. We previously developed a chimeric HIV1 (χHIV) vector system wherein the vector genome is packaged with the simian immunodeficiency virus (SIV) capsid for efficient transduction of both rhesus and human CD34+ cells. To evaluate whether χHIV vectors could efficiently transduce rhesus hematopoietic repopulating cells, we performed a competitive repopulation assay in rhesus macaques, in which half of the CD34+ cells were transduced with standard SIV vectors and the other half with χHIV vectors. As compared with SIV vectors, χHIV vectors achieved higher vector integration, and the transgene expression rates were two- to threefold higher in granulocytes and red blood cells and equivalent in lymphocytes and platelets for 2 years. A recipient of χHIV vector-only transduced cells reached up to 40% of transgene expression rates in granulocytes and lymphocytes and 20% in red blood cells. Similar to HIV1 and SIV vectors, χHIV vector frequently integrated into gene regions, especially into introns. In summary, our χHIV vector demonstrated efficient transduction for rhesus long-term repopulating cells, comparable with SIV vectors. This χHIV vector should allow preclinical testing of HIV1-based therapeutic vectors in large animal models. PMID:22871664
Mathematical Methods for Physics and Engineering Third Edition Paperback Set
NASA Astrophysics Data System (ADS)
Riley, Ken F.; Hobson, Mike P.; Bence, Stephen J.
2006-06-01
Prefaces; 1. Preliminary algebra; 2. Preliminary calculus; 3. Complex numbers and hyperbolic functions; 4. Series and limits; 5. Partial differentiation; 6. Multiple integrals; 7. Vector algebra; 8. Matrices and vector spaces; 9. Normal modes; 10. Vector calculus; 11. Line, surface and volume integrals; 12. Fourier series; 13. Integral transforms; 14. First-order ordinary differential equations; 15. Higher-order ordinary differential equations; 16. Series solutions of ordinary differential equations; 17. Eigenfunction methods for differential equations; 18. Special functions; 19. Quantum operators; 20. Partial differential equations: general and particular; 21. Partial differential equations: separation of variables; 22. Calculus of variations; 23. Integral equations; 24. Complex variables; 25. Application of complex variables; 26. Tensors; 27. Numerical methods; 28. Group theory; 29. Representation theory; 30. Probability; 31. Statistics; Index.
NASA Astrophysics Data System (ADS)
Lohe, M. A.
2018-06-01
We generalize the Watanabe–Strogatz (WS) transform, which acts on the Kuramoto model in d = 2 dimensions, to a higher-dimensional vector transform which operates on vector oscillator models of synchronization in any dimension , for the case of identical frequency matrices. These models have conserved quantities constructed from the cross ratios of inner products of the vector variables, which are invariant under the vector transform, and have trajectories which lie on the unit sphere S d‑1. Application of the vector transform leads to a partial integration of the equations of motion, leaving independent equations to be solved, for any number of nodes N. We discuss properties of complete synchronization and use the reduced equations to derive a stability condition for completely synchronized trajectories on S d‑1. We further generalize the vector transform to a mapping which acts in and in particular preserves the unit ball , and leaves invariant the cross ratios constructed from inner products of vectors in . This mapping can be used to partially integrate a system of vector oscillators with trajectories in , and for d = 2 leads to an extension of the Kuramoto system to a system of oscillators with time-dependent amplitudes and trajectories in the unit disk. We find an inequivalent generalization of the Möbius map which also preserves but leaves invariant a different set of cross ratios, this time constructed from the vector norms. This leads to a different extension of the Kuramoto model with trajectories in the complex plane that can be partially integrated by means of fractional linear transformations.
Chanda, Emmanuel; Govere, John M; Macdonald, Michael B; Lako, Richard L; Haque, Ubydul; Baba, Samson P; Mnzava, Abraham
2013-10-25
Integrated vector management (IVM) based vector control is encouraged by the World Health Organization (WHO). However, operational experience with the IVM strategy has mostly come from countries with relatively well-established health systems and with malaria control focused programmes. Little is known about deployment of IVM for combating multiple vector-borne diseases in post-emergency settings, where delivery structures are less developed or absent. This manuscript reports on the feasibility of operational IVM for combating vector-borne diseases in South Sudan. A methodical review of published and unpublished documents on vector-borne diseases for South Sudan was conducted via systematic literature search of online electronic databases, Google Scholar, PubMed and WHO, using a combination of search terms. Additional, non-peer reviewed literature was examined for information related to the subject. South Sudan is among the heartlands of vector-borne diseases in the world, characterized by enormous infrastructure, human and financial resource constraints and a weak health system against an increasing number of refugees, returnees and internally displaced people. The presence of a multiplicity of vector-borne diseases in this post-conflict situation presents a unique opportunity to explore the potential of a rational IVM strategy for multiple disease control and optimize limited resource utilization, while maximizing the benefits and providing a model for countries in a similar situation. The potential of integrating vector-borne disease control is enormous in South Sudan. However, strengthened coordination, intersectoral collaboration and institutional and technical capacity for entomological monitoring and evaluation, including enforcement of appropriate legislation are crucial.
Integrated vector management: a critical strategy for combating vector-borne diseases in South Sudan
2013-01-01
Background Integrated vector management (IVM) based vector control is encouraged by the World Health Organization (WHO). However, operational experience with the IVM strategy has mostly come from countries with relatively well-established health systems and with malaria control focused programmes. Little is known about deployment of IVM for combating multiple vector-borne diseases in post-emergency settings, where delivery structures are less developed or absent. This manuscript reports on the feasibility of operational IVM for combating vector-borne diseases in South Sudan. Case description A methodical review of published and unpublished documents on vector-borne diseases for South Sudan was conducted via systematic literature search of online electronic databases, Google Scholar, PubMed and WHO, using a combination of search terms. Additional, non-peer reviewed literature was examined for information related to the subject. Discussion South Sudan is among the heartlands of vector-borne diseases in the world, characterized by enormous infrastructure, human and financial resource constraints and a weak health system against an increasing number of refugees, returnees and internally displaced people. The presence of a multiplicity of vector-borne diseases in this post-conflict situation presents a unique opportunity to explore the potential of a rational IVM strategy for multiple disease control and optimize limited resource utilization, while maximizing the benefits and providing a model for countries in a similar situation. Conclusion The potential of integrating vector-borne disease control is enormous in South Sudan. However, strengthened coordination, intersectoral collaboration and institutional and technical capacity for entomological monitoring and evaluation, including enforcement of appropriate legislation are crucial. PMID:24156749
Naval Medical Research and Development News. Volume 7, Issue 10
2015-10-01
SR) product against adult Aedes aegypti the primary vector for DENV. The goal of this project is to obtain evidence that SRs lessen contact between...multi-site project designated to test the SR against the dengue vector Aedes aegypti. Four other sites will evaluate its impact against malarial
The geometric approach to sets of ordinary differential equations and Hamiltonian dynamics
NASA Technical Reports Server (NTRS)
Estabrook, F. B.; Wahlquist, H. D.
1975-01-01
The calculus of differential forms is used to discuss the local integration theory of a general set of autonomous first order ordinary differential equations. Geometrically, such a set is a vector field V in the space of dependent variables. Integration consists of seeking associated geometric structures invariant along V: scalar fields, forms, vectors, and integrals over subspaces. It is shown that to any field V can be associated a Hamiltonian structure of forms if, when dealing with an odd number of dependent variables, an arbitrary equation of constraint is also added. Families of integral invariants are an immediate consequence. Poisson brackets are isomorphic to Lie products of associated CT-generating vector fields. Hamilton's variational principle follows from the fact that the maximal regular integral manifolds of a closed set of forms must include the characteristics of the set.
Integrated optic vector-matrix multiplier
Watts, Michael R [Albuquerque, NM
2011-09-27
A vector-matrix multiplier is disclosed which uses N different wavelengths of light that are modulated with amplitudes representing elements of an N.times.1 vector and combined to form an input wavelength-division multiplexed (WDM) light stream. The input WDM light stream is split into N streamlets from which each wavelength of the light is individually coupled out and modulated for a second time using an input signal representing elements of an M.times.N matrix, and is then coupled into an output waveguide for each streamlet to form an output WDM light stream which is detected to generate a product of the vector and matrix. The vector-matrix multiplier can be formed as an integrated optical circuit using either waveguide amplitude modulators or ring resonator amplitude modulators.
NASA Astrophysics Data System (ADS)
Hutsalyuk, A.; Liashyk, A.; Pakuliak, S. Z.; Ragoucy, E.; Slavnov, N. A.
2016-11-01
We study the scalar products of Bethe vectors in integrable models solvable by the nested algebraic Bethe ansatz and possessing {gl}(2| 1) symmetry. Using explicit formulas of the monodromy matrix entries’ multiple actions onto Bethe vectors we obtain a representation for the scalar product in the most general case. This explicit representation appears to be a sum over partitions of the Bethe parameters. It can be used for the analysis of scalar products involving on-shell Bethe vectors. As a by-product, we obtain a determinant representation for the scalar products of generic Bethe vectors in integrable models with {gl}(1| 1) symmetry. Dedicated to the memory of Petr Petrovich Kulish.
Expanding integrated vector management to promote healthy environments
Lizzi, Karina M.; Qualls, Whitney A.; Brown, Scott C.; Beier, John C.
2014-01-01
Integrated Vector Management (IVM) strategies are intended to protect communities from pathogen transmission by arthropods. These strategies target multiple vectors and different ecological and socioeconomic settings, but the aggregate benefits of IVM are limited by the narrow focus of its approach; IVM strategies only aim to control arthropod vectors. We argue that IVM should encompass environmental modifications at early stages, for instance, infrastructural development and sanitation services, to regulate not only vectors but also nuisance-biting arthropods. An additional focus on nuisance-biting arthropods will improve public health, quality of life, and minimize social disparity issues fostered by pests. Optimally, IVM could incorporate environmental awareness and promotion of control methods in order to proactively reduce threats of serious pest situations. PMID:25028090
Optimal cue integration in ants.
Wystrach, Antoine; Mangan, Michael; Webb, Barbara
2015-10-07
In situations with redundant or competing sensory information, humans have been shown to perform cue integration, weighting different cues according to their certainty in a quantifiably optimal manner. Ants have been shown to merge the directional information available from their path integration (PI) and visual memory, but as yet it is not clear that they do so in a way that reflects the relative certainty of the cues. In this study, we manipulate the variance of the PI home vector by allowing ants (Cataglyphis velox) to run different distances and testing their directional choice when the PI vector direction is put in competition with visual memory. Ants show progressively stronger weighting of their PI direction as PI length increases. The weighting is quantitatively predicted by modelling the expected directional variance of home vectors of different lengths and assuming optimal cue integration. However, a subsequent experiment suggests ants may not actually compute an internal estimate of the PI certainty, but are using the PI home vector length as a proxy. © 2015 The Author(s).
Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.
2017-01-01
Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506
Siapati, Elena K; Bigger, Brian W; Miskin, James; Chipchase, Daniel; Parsley, Kathryn L; Mitrophanous, Kyriacos; Themis, Mike; Thrasher, Adrian J; Bonnet, Dominique
2005-09-01
The use of lentiviral vectors for gene transfer into hematopoietic stem cells has raised considerable interest as these vectors can permanently integrate their genome into quiescent cells. Vectors based on alternative lentiviruses would theoretically be safer than HIV-1-based vectors and could also be used in HIV-positive patients, minimizing the risk of generating replication-competent virus. Here we report the use of third-generation equine infectious anemia virus (EIAV)- and HIV-1-based vectors with minimal viral sequences and absence of accessory proteins. We have compared their efficiency in transducing mouse and human hematopoietic stem cells both in vitro and in vivo to that of a previously documented second-generation HIV-1 vector. The third-generation EIAV- and HIV-based vectors gave comparable levels of transduction and transgene expression in both mouse and human NOD/SCID repopulating cells but were less efficient than the second-generation HIV-1 vector in human HSCs. For the EIAV vector this is possibly a reflection of the lower protein expression levels achieved in human cells, as vector copy number analysis revealed that this vector exhibited a trend to integrate equally efficiently compared to the third-generation HIV-1 vector in both mouse and human HSCs. Interestingly, the presence or absence of Tat in viral preparations did not influence the transduction efficiency of HIV-1 vectors in human HSCs.
Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim Neto, Modesto Leite
2015-09-04
Aedes aegypti is a vector of international concern because it can transmit to humans three important arboviral diseases: yellow fever, dengue and chikungunya. Epidemics that are repeated year after year in a variety of urban centers indicate that there are control failures, allowing the vector to continue expanding. To identify the most effective vector control strategies and the factors that contributed to the success or failure of each strategy, we carried out a systematic review with meta-analysis of articles published in 12 databases, from 1974 to the month of December 2013. We evaluated the association between the use of whatever chemical substance, mechanical agent, biological or integrated actions against A. aegypti and the control of the vector, as measured by 10 indicators. We found 2,791 articles, but after careful selection, only 26 studies remained for analysis related to control interventions implemented in 15 countries, with 5 biological, 5 chemical, 3 mechanical and 13 integrated strategies. The comparison among all of them, indicated that the control of A. aegypti is significantly associated with the type of strategy used, and that integrated interventions consist of the most effective method for controlling A. aegypti. The most effective control method was the integrated approach, considering the influence of eco-bio-social determinants in the virus-vector-man epidemiological chain, and community involvement, starting with community empowerment as active agents of vector control.
A Study on Aircraft Engine Control Systems for Integrated Flight and Propulsion Control
NASA Astrophysics Data System (ADS)
Yamane, Hideaki; Matsunaga, Yasushi; Kusakawa, Takeshi; Yasui, Hisako
The Integrated Flight and Propulsion Control (IFPC) for a highly maneuverable aircraft and a fighter-class engine with pitch/yaw thrust vectoring is described. Of the two IFPC functions the aircraft maneuver control utilizes the thrust vectoring based on aerodynamic control surfaces/thrust vectoring control allocation specified by the Integrated Control Unit (ICU) of a FADEC (Full Authority Digital Electronic Control) system. On the other hand in the Performance Seeking Control (PSC) the ICU identifies engine's various characteristic changes, optimizes manipulated variables and finally adjusts engine control parameters in cooperation with the Engine Control Unit (ECU). It is shown by hardware-in-the-loop simulation that the thrust vectoring can enhance aircraft maneuverability/agility and that the PSC can improve engine performance parameters such as SFC (specific fuel consumption), thrust and gas temperature.
Student Solution Manual for Essential Mathematical Methods for the Physical Sciences
NASA Astrophysics Data System (ADS)
Riley, K. F.; Hobson, M. P.
2011-02-01
1. Matrices and vector spaces; 2. Vector calculus; 3. Line, surface and volume integrals; 4. Fourier series; 5. Integral transforms; 6. Higher-order ODEs; 7. Series solutions of ODEs; 8. Eigenfunction methods; 9. Special functions; 10. Partial differential equations; 11. Solution methods for PDEs; 12. Calculus of variations; 13. Integral equations; 14. Complex variables; 15. Applications of complex variables; 16. Probability; 17. Statistics.
Essential Mathematical Methods for the Physical Sciences
NASA Astrophysics Data System (ADS)
Riley, K. F.; Hobson, M. P.
2011-02-01
1. Matrices and vector spaces; 2. Vector calculus; 3. Line, surface and volume integrals; 4. Fourier series; 5. Integral transforms; 6. Higher-order ODEs; 7. Series solutions of ODEs; 8. Eigenfunction methods; 9. Special functions; 10. Partial differential equations; 11. Solution methods for PDEs; 12. Calculus of variations; 13. Integral equations; 14. Complex variables; 15. Applications of complex variables; 16. Probability; 17. Statistics; Appendices; Index.
USDA-ARS?s Scientific Manuscript database
Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...
An integrated ecosystem approach for sustainable prevention and control of dengue in Central Havana.
Bonet, Mariano; Spiegel, Jerry M; Ibarra, Ana Maria; Kouri, Gustavo; Pintre, Alfredo; Yassi, Annalee
2007-01-01
The authors developed and evaluated a comprehensive participatory ecosystem health approach for preventing the transmission of dengue, the most prevalent vector-borne disease in Cuba and the Latin America-Caribbean region. The integrated surveillance system central to this initiative encompassed three main subsystems (environmental; entomological; clinical-epidemiologic), relying on extensive community involvement. The study was conducted in Central Havana, Cuba. Indicators from each subsystem were selected and mapped using a GIS procedure providing instant visualization by city block in the municipality. To elucidate the factors affecting control and prevention efforts, perceived needs and risks, as well as knowledge, attitudes, and behaviors related to dengue, were assessed. Specific factors associated with the presence of mosquito breeding sites and risks of dengue were examined in a case-control study.
Sakkhachornphop, Supachai; Barbas, Carlos F.; Keawvichit, Rassamee; Wongworapat, Kanlaya
2012-01-01
Abstract Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine–adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future. PMID:22429108
Cruz, Tess Boley
2009-01-01
This Vector paper (IV of V on monitoring the tobacco use epidemic) presents the data sources and methods that can be used to monitor tobacco marketing and makes recommendations for creating a national surveillance system. In 2002, the Vector Work Group of the National Tobacco Monitoring, Research and Evaluation Workshop identified priority indicators of tobacco marketing: tobacco brand pricing strategies, retail environment advertising and promotional allowances, gray market or smuggling activities, lobbying, direct mail marketing, tobacco brand placements in films, Internet promotions, and sponsorship at bars and events. This paper reviews and identifies data sources and gaps for these priority indicators and for 12 other indicators of interest. There are 38 commercial data sites and Internet sources, as well as individual research efforts that address the priority indicators. These sources are not integrated, often costly, and limited in standardization. Tobacco marketing could be more effectively monitored with the development of a national research network. Surveillance of the tobacco industry's methods to push tobacco and pull consumers can help the public health community identify new markets and campaigns, justify and tailor effective tobacco control strategies, and evaluate existing counter-marketing efforts.
Genome Integration and Excision by a New Streptomyces Bacteriophage, ϕJoe.
Fogg, Paul C M; Haley, Joshua A; Stark, W Marshall; Smith, Margaret C M
2017-03-01
Bacteriophages are the source of many valuable tools for molecular biology and genetic manipulation. In Streptomyces , most DNA cloning vectors are based on serine integrase site-specific DNA recombination systems derived from phage. Because of their efficiency and simplicity, serine integrases are also used for diverse synthetic biology applications. Here, we present the genome of a new Streptomyces phage, ϕJoe, and investigate the conditions for integration and excision of the ϕJoe genome. ϕJoe belongs to the largest Streptomyces phage cluster (R4-like) and encodes a serine integrase. The attB site from Streptomyces venezuelae was used efficiently by an integrating plasmid, pCMF92, constructed using the ϕJoe int-attP locus. The attB site for ϕJoe integrase was occupied in several Streptomyces genomes, including that of S. coelicolor , by a mobile element that varies in gene content and size between host species. Serine integrases require a phage-encoded recombination directionality factor (RDF) to activate the excision reaction. The ϕJoe RDF was identified, and its function was confirmed in vivo Both the integrase and RDF were active in in vitro recombination assays. The ϕJoe site-specific recombination system is likely to be an important addition to the synthetic biology and genome engineering toolbox. IMPORTANCE Streptomyces spp. are prolific producers of secondary metabolites, including many clinically useful antibiotics. Bacteriophage-derived integrases are important tools for genetic engineering, as they enable integration of heterologous DNA into the Streptomyces chromosome with ease and high efficiency. Recently, researchers have been applying phage integrases for a variety of applications in synthetic biology, including rapid assembly of novel combinations of genes, biosensors, and biocomputing. An important requirement for optimal experimental design and predictability when using integrases, however, is the need for multiple enzymes with different specificities for their integration sites. In order to provide a broad platform of integrases, we identified and validated the integrase from a newly isolated Streptomyces phage, ϕJoe. ϕJoe integrase is active in vitro and in vivo The specific recognition site for integration is present in a wide range of different actinobacteria, including Streptomyces venezuelae , an emerging model bacterium in Streptomyces research. Copyright © 2017 Fogg et al.
Urbinati, Fabrizia; Wherley, Jennifer; Geiger, Sabine; Fernandez, Beatriz Campo; Kaufman, Michael L; Cooper, Aaron; Romero, Zulema; Marchioni, Filippo; Reeves, Lilith; Read, Elizabeth; Nowicki, Barbara; Grassman, Elke; Viswanathan, Shivkumar; Wang, Xiaoyan; Hollis, Roger P; Kohn, Donald B
2017-09-01
Gene therapy by autologous hematopoietic stem cell transplantation (HSCT) represents a new approach to treat sickle cell disease (SCD). Optimization of the manufacture, characterization and testing of the transduced hematopoietic stem cell final cell product (FCP), as well as an in depth in vivo toxicology study, are critical for advancing this approach to clinical trials. Data are shown to evaluate and establish the feasibility of isolating, transducing with the Lenti/β AS3 -FB vector and cryopreserving CD34 + cells from human bone marrow (BM) at clinical scale. In vitro and in vivo characterization of the FCP was performed, showing that all the release criteria were successfully met. In vivo toxicology studies were conducted to evaluate potential toxicity of the Lenti/β AS3 -FB LV in the context of a murine BM transplant. Primary and secondary transplantation did not reveal any toxicity from the lentiviral vector. Additionally, vector integration site analysis of murine and human BM cells did not show any clonal skewing caused by insertion of the Lenti/β AS3 -FB vector in cells from primary and secondary transplanted mice. We present here a complete protocol, thoroughly optimized to manufacture, characterize and establish safety of a FCP for gene therapy of SCD. Copyright © 2017 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Humbert, Olivier; Chan, Frieda; Rajawat, Yogendra S.; Torgerson, Troy R.; Burtner, Christopher R.; Hubbard, Nicholas W.; Humphrys, Daniel; Norgaard, Zachary K.; O’Donnell, Patricia; Adair, Jennifer E.; Trobridge, Grant D.; Scharenberg, Andrew M.; Felsburg, Peter J.; Rawlings, David J.
2018-01-01
Hematopoietic stem-cell gene therapy is a promising treatment of X-linked severe combined immunodeficiency disease (SCID-X1), but currently, it requires recipient conditioning, extensive cell manipulation, and sophisticated facilities. With these limitations in mind, we explored a simpler therapeutic approach to SCID-X1 treatment by direct IV administration of foamy virus (FV) vectors in the canine model. FV vectors were used because they have a favorable integration site profile and are resistant to serum inactivation. Here, we show improved efficacy of our in vivo gene therapy platform by mobilization with granulocyte colony-stimulating factor (G-CSF) and AMD3100 before injection of an optimized FV vector incorporating the human phosphoglycerate kinase enhancerless promoter. G-CSF/AMD3100 mobilization before FV vector delivery accelerated kinetics of CD3+ lymphocyte recovery, promoted thymopoiesis, and increased immune clonal diversity. Gene-corrected T lymphocytes exhibited a normal CD4:CD8 ratio and a broad T-cell receptor repertoire and showed restored γC-dependent signaling function. Treated animals showed normal primary and secondary antibody responses to bacteriophage immunization and evidence for immunoglobulin class switching. These results demonstrate safety and efficacy of an accessible, portable, and translatable platform with no conditioning regimen for the treatment of SCID-X1 and other genetic diseases. PMID:29720491
Design and cloning strategies for constructing shRNA expression vectors
McIntyre, Glen J; Fanning, Gregory C
2006-01-01
Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676
Insulated piggyBac vectors for insect transgenesis
Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J
2006-01-01
Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846
A geo-coded inventory of anophelines in the Afrotropical Region south of the Sahara: 1898-2016.
Kyalo, David; Amratia, Punam; Mundia, Clara W; Mbogo, Charles M; Coetzee, Maureen; Snow, Robert W
2017-01-01
Background : Understanding the distribution of anopheline vectors of malaria is an important prelude to the design of national malaria control and elimination programmes. A single, geo-coded continental inventory of anophelines using all available published and unpublished data has not been undertaken since the 1960s. Methods : We have searched African, European and World Health Organization archives to identify unpublished reports on anopheline surveys in 48 sub-Saharan Africa countries. This search was supplemented by identification of reports that formed part of post-graduate theses, conference abstracts, regional insecticide resistance databases and more traditional bibliographic searches of peer-reviewed literature. Finally, a check was made against two recent repositories of dominant malaria vector species locations ( circa 2,500). Each report was used to extract information on the survey dates, village locations (geo-coded to provide a longitude and latitude), sampling methods, species identification methods and all anopheline species found present during the survey. Survey records were collapsed to a single site over time. Results : The search strategy took years and resulted in 13,331 unique, geo-coded survey locations of anopheline vector occurrence between 1898 and 2016. A total of 12,204 (92%) sites reported the presence of 10 dominant vector species/sibling species; 4,473 (37%) of these sites were sampled since 2005. 4,442 (33%) sites reported at least one of 13 possible secondary vector species; 1,107 (25%) of these sites were sampled since 2005. Distributions of dominant and secondary vectors conform to previous descriptions of the ecological ranges of these vectors. Conclusion : We have assembled the largest ever geo-coded database of anophelines in Africa, representing a legacy dataset for future updating and identification of knowledge gaps at national levels. The geo-coded database is available on Harvard Dataverse as a reference source for African national malaria control programmes planning their future control and elimination strategies.
A geo-coded inventory of anophelines in the Afrotropical Region south of the Sahara: 1898-2016
Kyalo, David; Amratia, Punam; Mundia, Clara W.; Mbogo, Charles M.; Coetzee, Maureen; Snow, Robert W.
2017-01-01
Background: Understanding the distribution of anopheline vectors of malaria is an important prelude to the design of national malaria control and elimination programmes. A single, geo-coded continental inventory of anophelines using all available published and unpublished data has not been undertaken since the 1960s. Methods: We have searched African, European and World Health Organization archives to identify unpublished reports on anopheline surveys in 48 sub-Saharan Africa countries. This search was supplemented by identification of reports that formed part of post-graduate theses, conference abstracts, regional insecticide resistance databases and more traditional bibliographic searches of peer-reviewed literature. Finally, a check was made against two recent repositories of dominant malaria vector species locations ( circa 2,500). Each report was used to extract information on the survey dates, village locations (geo-coded to provide a longitude and latitude), sampling methods, species identification methods and all anopheline species found present during the survey. Survey records were collapsed to a single site over time. Results: The search strategy took years and resulted in 13,331 unique, geo-coded survey locations of anopheline vector occurrence between 1898 and 2016. A total of 12,204 (92%) sites reported the presence of 10 dominant vector species/sibling species; 4,473 (37%) of these sites were sampled since 2005. 4,442 (33%) sites reported at least one of 13 possible secondary vector species; 1,107 (25%) of these sites were sampled since 2005. Distributions of dominant and secondary vectors conform to previous descriptions of the ecological ranges of these vectors. Conclusion: We have assembled the largest ever geo-coded database of anophelines in Africa, representing a legacy dataset for future updating and identification of knowledge gaps at national levels. The geo-coded database is available on Harvard Dataverse as a reference source for African national malaria control programmes planning their future control and elimination strategies. PMID:28884158
Surveillance of malaria vector population density and biting behaviour in western Kenya.
Ototo, Ednah N; Mbugi, Jenard P; Wanjala, Christine L; Zhou, Guofa; Githeko, Andrew K; Yan, Guiyun
2015-06-17
Malaria is a great public health burden and Africa suffers the largest share of malaria-attributed deaths. Despite control efforts targeting indoor malaria transmission, such as insecticide-treated bed nets (ITNs) and deployment of indoor residual spraying, transmission of the parasite in western Kenya is still maintained. This study was carried out to determine the impact of ITNs on indoor vector densities and biting behaviour in western Kenya. Indoor collection of adult mosquitoes was done monthly in six study sites in western Kenya using pyrethrum spray collections from 2012 to 2014. The rotator trap collections were done in July-August in 2013 and May-June in 2014. Mosquitoes were collected every 2 h between 18.00 and 08.00 h. Human behaviour study was conducted via questionnaire surveys. Species within Anopheles gambiae complex was differentiated by PCR and sporozoite infectivity was determined by ELISA. Species distribution was determined and bed net coverage in the study sites was recorded. During the study a total of 5,469 mosquito vectors were collected from both PSC and Rotator traps comprising 3,181 (58.2%) Anopheles gambiae and 2,288 (41.8%) Anopheles funestus. Compared to all the study sites, Rae had the highest density of An. gambiae with a mean of 1.2 (P<0.001) while Kombewa had the highest density of An. funestus with a mean of 1.08 (P<0.001). Marani had the lowest density of vectors with 0.06 An. gambiae and 0.17 An. funestus (P<0.001). Among the 700 PCR confirmed An. gambiae s.l. individuals, An. gambiae s.s. accounted for 49% and An. arabiensis 51%. Over 50% of the study population stayed outdoors between 18.00 and 20.00 and 06.00 and 08.00 which was the time when highest densities of blood fed vectors were collected. Anopheles gambie s.s. was the main malaria parasite vector in the highland sites and An. arabiensis in the lowland sites. Bed net ownership in 2012 averaged 87% across the study sites. This study suggests that mass distribution of ITNs has had a significant impact on vector densities, species distribution and sporozoite rate. However, shift of biting time poses significant threats to the current malaria vector control strategies which heavily rely on indoor controls.
Haider, Najmul; Cuellar, Ana Carolina; Kjær, Lene Jung; Sørensen, Jens Havskov; Bødker, Rene
2018-03-05
Microclimatic temperatures provide better estimates of vector-borne disease transmission parameters than standard meteorological temperatures, as the microclimate represent the actual temperatures to which the vectors are exposed. The objectives of this study were to quantify farm-level geographic variations and temporal patterns in the extrinsic incubation period (EIP) of Schmallenberg virus transmitted by Culicoides in Denmark through generation of microclimatic temperatures surrounding all Danish cattle farms. We calculated the hourly microclimatic temperatures at potential vector-resting sites within a 500 m radius of 22,004 Danish cattle farms for the months April to November from 2000 to 2016. We then modeled the daily EIP of Schmallenberg virus at each farm, assuming vectors choose resting sites either randomly or based on temperatures (warmest or coolest available) every hour. The results of the model output are presented as 17-year averages. The difference between the warmest and coolest microhabitats at the same farm was on average 3.7 °C (5th and 95th percentiles: 1.0 °C to 7.8 °C). The mean EIP of Schmallenberg virus (5th and 95th percentiles) for all cattle farms during spring, summer, and autumn was: 23 (18-33), 14 (12-18) and 51 (48-55) days, respectively, assuming Culicoides select resting sites randomly. These estimated EIP values were considerably shorter than those estimated using standard meteorological temperatures obtained from a numerical weather prediction model for the same periods: 43 (39-52), 21 (17-24) and 57 (55-58) days, respectively. When assuming that vectors actively select the coolest resting sites at a farm, the EIP was 2.3 (range: 1.1 to 4.1) times longer compared to that of the warmest sites at the same farm. We estimated a wide range of EIP in different microclimatic habitats surrounding Danish cattle farms, stressing the importance of identifying the specific resting sites of vectors when modeling vector-borne disease transmission. We found a large variation in the EIP among different farms, suggesting disease transmission may vary substantially between regions, even within a small country. Our findings could be useful for designing risk-based surveillance, and in the control and prevention of emerging and re-emerging vector-borne diseases.
(abstract) Satellite Physical Oceanography Data Available From an EOSDIS Archive
NASA Technical Reports Server (NTRS)
Digby, Susan A.; Collins, Donald J.
1996-01-01
The Physical Oceanography Distributed Active Archive Center (PO.DAAC) at the Jet Propulsion Laboratory archives and distributes data as part of the Earth Observing System Data and Information System (EOSDIS). Products available from JPL are largely satellite derived and include sea-surface height, surface-wind speed and vectors, integrated water vapor, atmospheric liquid water, sea-surface temperature, heat flux, and in-situ data as it pertains to satellite data. Much of the data is global and spans fourteen years.There is email access, a WWW site, product catalogs, and FTP capabilities. Data is free of charge.
Student Solution Manual for Mathematical Methods for Physics and Engineering Third Edition
NASA Astrophysics Data System (ADS)
Riley, K. F.; Hobson, M. P.
2006-03-01
Preface; 1. Preliminary algebra; 2. Preliminary calculus; 3. Complex numbers and hyperbolic functions; 4. Series and limits; 5. Partial differentiation; 6. Multiple integrals; 7. Vector algebra; 8. Matrices and vector spaces; 9. Normal modes; 10. Vector calculus; 11. Line, surface and volume integrals; 12. Fourier series; 13. Integral transforms; 14. First-order ordinary differential equations; 15. Higher-order ordinary differential equations; 16. Series solutions of ordinary differential equations; 17. Eigenfunction methods for differential equations; 18. Special functions; 19. Quantum operators; 20. Partial differential equations: general and particular; 21. Partial differential equations: separation of variables; 22. Calculus of variations; 23. Integral equations; 24. Complex variables; 25. Application of complex variables; 26. Tensors; 27. Numerical methods; 28. Group theory; 29. Representation theory; 30. Probability; 31. Statistics.
USDA-ARS?s Scientific Manuscript database
The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...
Harnessing Integrated Vector Management for Enhanced Disease Prevention.
Chanda, Emmanuel; Ameneshewa, Birkinesh; Bagayoko, Magaran; Govere, John M; Macdonald, Michael B
2017-01-01
The increasing global threat of emerging and re-emerging vector-borne diseases (VBDs) poses a serious health problem. The World Health Organization (WHO) recommends integrated vector management (IVM) strategy for combating VBD transmission. An IVM approach requires entomological knowledge, technical and infrastructure capacity, and systems facilitating stakeholder collaboration. In sub-Saharan Africa, successful operational IVM experience comes from relatively few countries. This article provides an update on the extent to which IVM is official national policy, the degree of IVM implementation, the level of compliance with WHO guidelines, and concordance in the understanding of IVM, and it assesses the operational impact of IVM. The future outlook encompasses rational and sustainable use of effective vector control tools and inherent improved return for investment for disease vector control. Copyright © 2016 Elsevier Ltd. All rights reserved.
Torina, Alessandra; Blanda, Marcellocalogero; Auteri, Michelangelo; La Russa, Francesco; Scimeca, Salvatore; D’Agostino, Rosalia; Disclafani, Rosaria; Currò, Vittoria; Caracappa, Santo
2018-01-01
Ticks (Acari: Ixodidae) are bloodsucking arthropods involved in pathogen transmission in animals and humans. Tick activity depends on various ecological factors such as vegetation, hosts, and temperature. The aim of this study was to analyse the spatial/temporal distribution of ticks in six sites within a peri-urban area of Palermo (Natural Reserve of Monte Pellegrino) and correlate it with field data using Geographical Information System (GIS) data. A total of 3092 ticks were gathered via dragging method from June 2012 to May 2014. The species collected were: Ixodes ventalloi (46.09%), Hyalomma lusitanicum (19.99%), Rhipicephalus sanguineus (17.34%), Rhipicephalus pusillus (16.11%), Haemaphisalis sulcata (0.36%), Dermacentor marginatus (0.10%), and Rhipicephalus turanicus (0.03%). GIS analysis revealed environmental characteristics of each site, and abundance of each tick species was analysed in relation to time (monthly trend) and space (site-specific abundance). A relevant presence of I. ventalloi in site 2 and H. lusitanicum in site 5 was observed, suggesting the possible exposure of animals and humans to tick-borne pathogens. Our study shows the importance of surveillance of ticks in peri-urban areas and the useful implementation of GIS analysis in vector ecology; studies on temporal and spatial distribution of ticks correlated to GIS-based ecological analysis represent an integrated strategy for decision support in public health. PMID:29495440
Polarization-analyzing circuit on InP for integrated Stokes vector receiver.
Ghosh, Samir; Kawabata, Yuto; Tanemura, Takuo; Nakano, Yoshiaki
2017-05-29
Stokes vector modulation and direct detection (SVM/DD) has immense potentiality to reduce the cost burden for the next-generation short-reach optical communication networks. In this paper, we propose and demonstrate an InGaAsP/InP waveguide-based polarization-analyzing circuit for an integrated Stokes vector (SV) receiver. By transforming the input state-of-polarization (SOP) and projecting its SV onto three different vectors on the Poincare sphere, we show that the actual SOP can be retrieved by simple calculation. We also reveal that this projection matrix has a flexibility and its deviation due to device imperfectness can be calibrated to a certain degree, so that the proposed device would be fundamentally robust against fabrication errors. A proof-of-concept photonic integrated circuit (PIC) is fabricated on InP by using half-ridge waveguides to successfully demonstrate detection of different SOPs scattered on the Poincare sphere.
Zohdy, Sarah; Derfus, Kristin; Headrick, Emily G; Andrianjafy, Mbolatiana Tovo; Wright, Patricia C; Gillespie, Thomas R
2016-02-24
Deforestation and land-use change have the potential to alter human exposure to malaria. A large percentage of Madagascar's original forest cover has been lost to slash-and-burn agriculture, and malaria is one of the top causes of mortality on the island. In this study, the influence of land-use on the distribution of Plasmodium vectors and concomitant Plasmodium infection in humans and mosquito vectors was examined in the southeastern rainforests of Madagascar. From June to August 2013, health assessments were conducted on individuals living in sixty randomly selected households in six villages bordering Ranomafana National Park. Humans were screened for malaria using species-specific rapid diagnostic tests (RDTs), and surveyed about insecticide-treated bed net (ITN) usage. Concurrently, mosquitoes were captured in villages and associated forest and agricultural sites. All captured female Anopheline mosquitoes were screened for Plasmodium spp. using a circumsporozoite enzyme-linked immunosorbent assay (csELISA). Anopheles spp. dominated the mosquito communities of agricultural and village land-use sites, accounting for 41.4 and 31.4 % of mosquitoes captured respectively, whereas Anopheles spp. accounted for only 1.6 % of mosquitoes captured from forest sites. Interestingly, most Anopheles spp. (67.7 %) were captured in agricultural sites in close proximity to animal pens, and 90.8 % of Anopheles mosquitoes captured in agricultural sites were known vectors of malaria. Three Anopheline mosquitoes (0.7 %) were positive for malaria (Plasmodium vivax-210) and all positive mosquitoes were collected from agricultural or village land-use sites. Ten humans (3.7 %) tested were positive for P. falciparum, and 23.3 % of those surveyed reported never sleeping under ITNs. This study presents the first report of malaria surveillance in humans and the environment in southeastern Madagascar. These findings suggest that even during the winter, malaria species are present in both humans and mosquitoes; with P. falciparum found in humans, and evidence of P. vivax-210 in mosquito vectors. The presence of P. vivax in resident vectors, but not humans may relate to the high incidence of humans lacking the Duffy protein. The majority of mosquito vectors were found in agricultural land-use sites, in particular near livestock pens. These findings have the potential to inform and improve targeted malaria control and prevention strategies in the region.
West Nile virus surveillance in Europe: moving towards an integrated animal-human-vector approach
Gossner, Céline M; Marrama, Laurence; Carson, Marianne; Allerberger, Franz; Calistri, Paolo; Dilaveris, Dimitrios; Lecollinet, Sylvie; Morgan, Dilys; Nowotny, Norbert; Paty, Marie-Claire; Pervanidou, Danai; Rizzo, Caterina; Roberts, Helen; Schmoll, Friedrich; Van Bortel, Wim; Gervelmeyer, Andrea
2017-01-01
This article uses the experience of five European countries to review the integrated approaches (human, animal and vector) for surveillance and monitoring of West Nile virus (WNV) at national and European levels. The epidemiological situation of West Nile fever in Europe is heterogeneous. No model of surveillance and monitoring fits all, hence this article merely encourages countries to implement the integrated approach that meets their needs. Integration of surveillance and monitoring activities conducted by the public health authorities, the animal health authorities and the authorities in charge of vector surveillance and control should improve efficiency and save resources by implementing targeted measures. The creation of a formal interagency working group is identified as a crucial step towards integration. Blood safety is a key incentive for public health authorities to allocate sufficient resources for WNV surveillance, while the facts that an effective vaccine is available for horses and that most infected animals remain asymptomatic make the disease a lesser priority for animal health authorities. The examples described here can support other European countries wishing to strengthen their WNV surveillance or preparedness, and also serve as a model for surveillance and monitoring of other (vector-borne) zoonotic infections. PMID:28494844
Mitsakakis, Konstantinos; Hin, Sebastian; Müller, Pie; Wipf, Nadja; Thomsen, Edward; Coleman, Michael; Zengerle, Roland; Vontas, John; Mavridis, Konstantinos
2018-02-03
Monitoring malaria prevalence in humans, as well as vector populations, for the presence of Plasmodium , is an integral component of effective malaria control, and eventually, elimination. In the field of human diagnostics, a major challenge is the ability to define, precisely, the causative agent of fever, thereby differentiating among several candidate (also non-malaria) febrile diseases. This requires genetic-based pathogen identification and multiplexed analysis, which, in combination, are hardly provided by the current gold standard diagnostic tools. In the field of vectors, an essential component of control programs is the detection of Plasmodium species within its mosquito vectors, particularly in the salivary glands, where the infective sporozoites reside. In addition, the identification of species composition and insecticide resistance alleles within vector populations is a primary task in routine monitoring activities, aiming to support control efforts. In this context, the use of converging diagnostics is highly desirable for providing comprehensive information, including differential fever diagnosis in humans, and mosquito species composition, infection status, and resistance to insecticides of vectors. Nevertheless, the two fields of human diagnostics and vector control are rarely combined, both at the diagnostic and at the data management end, resulting in fragmented data and mis- or non-communication between various stakeholders. To this direction, molecular technologies, their integration in automated platforms, and the co-assessment of data from multiple diagnostic sources through information and communication technologies are possible pathways towards a unified human vector approach.
Mitsakakis, Konstantinos; Hin, Sebastian; Wipf, Nadja; Coleman, Michael; Zengerle, Roland; Vontas, John; Mavridis, Konstantinos
2018-01-01
Monitoring malaria prevalence in humans, as well as vector populations, for the presence of Plasmodium, is an integral component of effective malaria control, and eventually, elimination. In the field of human diagnostics, a major challenge is the ability to define, precisely, the causative agent of fever, thereby differentiating among several candidate (also non-malaria) febrile diseases. This requires genetic-based pathogen identification and multiplexed analysis, which, in combination, are hardly provided by the current gold standard diagnostic tools. In the field of vectors, an essential component of control programs is the detection of Plasmodium species within its mosquito vectors, particularly in the salivary glands, where the infective sporozoites reside. In addition, the identification of species composition and insecticide resistance alleles within vector populations is a primary task in routine monitoring activities, aiming to support control efforts. In this context, the use of converging diagnostics is highly desirable for providing comprehensive information, including differential fever diagnosis in humans, and mosquito species composition, infection status, and resistance to insecticides of vectors. Nevertheless, the two fields of human diagnostics and vector control are rarely combined, both at the diagnostic and at the data management end, resulting in fragmented data and mis- or non-communication between various stakeholders. To this direction, molecular technologies, their integration in automated platforms, and the co-assessment of data from multiple diagnostic sources through information and communication technologies are possible pathways towards a unified human vector approach. PMID:29401670
Accumulation of the Cyclobutane Thymine Dimer in Defined Sequences of Free and Nucleosomal DNA
2013-08-01
cyclobutane dimer in a single-stranded vector , Proc. Natl. Acad. Sci. U. S. A., 1988, 85, 8141–8145. 11 C. A. Smith, M. Wang, N. Jiang, L. Che, X. Zhao and...J.-S. Taylor, Mutation spectra of M13 vectors containing site-specific cis–syn, trans–syn-I, (6-4), and Dewar pyrimi- done photoproducts of thymidylyl...Bypass of a site-specific cis–syn thymine dimer in a SV40 vector during in vitro replication by HeLa and XPV cell-free extracts, Biochemistry, 1998
A transposase strategy for creating libraries of circularly permuted proteins.
Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J
2012-05-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.
A transposase strategy for creating libraries of circularly permuted proteins
Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.
2012-01-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko
2008-05-09
Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-{beta}-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 daysmore » after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells.« less
Miyamoto, Kazutaka; Akiyama, Mizuha; Tamura, Fumiya; Isomi, Mari; Yamakawa, Hiroyuki; Sadahiro, Taketaro; Muraoka, Naoto; Kojima, Hidenori; Haginiwa, Sho; Kurotsu, Shota; Tani, Hidenori; Wang, Li; Qian, Li; Inoue, Makoto; Ide, Yoshinori; Kurokawa, Junko; Yamamoto, Tsunehisa; Seki, Tomohisa; Aeba, Ryo; Yamagishi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki
2018-01-04
Direct cardiac reprogramming holds great promise for regenerative medicine. We previously generated directly reprogrammed induced cardiomyocyte-like cells (iCMs) by overexpression of Gata4, Mef2c, and Tbx5 (GMT) using retrovirus vectors. However, integrating vectors pose risks associated with insertional mutagenesis and disruption of gene expression and are inefficient. Here, we show that Sendai virus (SeV) vectors expressing cardiac reprogramming factors efficiently and rapidly reprogram both mouse and human fibroblasts into integration-free iCMs via robust transgene expression. SeV-GMT generated 100-fold more beating iCMs than retroviral-GMT and shortened the duration to induce beating cells from 30 to 10 days in mouse fibroblasts. In vivo lineage tracing revealed that the gene transfer of SeV-GMT was more efficient than retroviral-GMT in reprogramming resident cardiac fibroblasts into iCMs in mouse infarct hearts. Moreover, SeV-GMT improved cardiac function and reduced fibrosis after myocardial infarction. Thus, efficient, non-integrating SeV vectors may serve as a powerful system for cardiac regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.
Vector tomography for reconstructing electric fields with non-zero divergence in bounded domains
NASA Astrophysics Data System (ADS)
Koulouri, Alexandra; Brookes, Mike; Rimpiläinen, Ville
2017-01-01
In vector tomography (VT), the aim is to reconstruct an unknown multi-dimensional vector field using line integral data. In the case of a 2-dimensional VT, two types of line integral data are usually required. These data correspond to integration of the parallel and perpendicular projection of the vector field along the integration lines and are called the longitudinal and transverse measurements, respectively. In most cases, however, the transverse measurements cannot be physically acquired. Therefore, the VT methods are typically used to reconstruct divergence-free (or source-free) velocity and flow fields that can be reconstructed solely from the longitudinal measurements. In this paper, we show how vector fields with non-zero divergence in a bounded domain can also be reconstructed from the longitudinal measurements without the need of explicitly evaluating the transverse measurements. To the best of our knowledge, VT has not previously been used for this purpose. In particular, we study low-frequency, time-harmonic electric fields generated by dipole sources in convex bounded domains which arise, for example, in electroencephalography (EEG) source imaging. We explain in detail the theoretical background, the derivation of the electric field inverse problem and the numerical approximation of the line integrals. We show that fields with non-zero divergence can be reconstructed from the longitudinal measurements with the help of two sparsity constraints that are constructed from the transverse measurements and the vector Laplace operator. As a comparison to EEG source imaging, we note that VT does not require mathematical modeling of the sources. By numerical simulations, we show that the pattern of the electric field can be correctly estimated using VT and the location of the source activity can be determined accurately from the reconstructed magnitudes of the field.
USDA-ARS?s Scientific Manuscript database
Newcastle disease virus (NDV) has been developed as a vector for vaccine and gene therapy purposes. However, the optimal insertion site for foreign gene expression remained to be determined. In the present study, we inserted the green fluorescence protein (GFP) gene into five different intergenic ...
Kusumawathie, Pad; Palihawadana, Paba; Janaki, Sakoo; Wijemuni, Ruwan; Wilder-Smith, Annelies; Tissera, Hasitha A.
2016-01-01
Introduction Dengue has emerged as a major public health problem in Sri Lanka. Vector control at community level is a frequent and widespread strategy for dengue control. The aim of the study was to assess Aedes mosquito breeding sites and the prevention practices of community members in a heavily urbanized part of Colombo. Methods A cross-sectional entomological survey was conducted from April to June 2013 in 1469 premises located in a subdistrict of the City of Colombo. Types of breeding sites and, where found, their infestation with larvae or pupae were recorded. Furthermore, a questionnaire was administered to the occupants of these premises to record current practices of dengue vector control. Results The surveyed premises consisted of 1341 residential premises and 110 non-residential premises (11 schools, 99 work or public sites), 5 open lands, and 13 non-specified. In these 1469 premises, 15447 potential breeding sites suitable to host larvae of pupae were found; of these sites18.0% contained water. Among the 2775 potential breeding sites that contained water, 452 (16.3%) were positive for larvae and/or pupae. Schools were associated with the proportionally highest number of breeding sites; 85 out of 133 (63.9%) breeding sites were positive for larvae and/or pupae in schools compared with 338 out of 2288 (14.8%) in residential premises. The odds ratio (OR) for schools and work or public sites for being infested with larvae and/or pupae was 2.77 (95% CI 1.58, 4.86), when compared to residential premises. Occupants of 80.8% of the residential premises, 54.5% of the schools and 67.7% of the work or public sites reported using preventive measures. The main prevention practices were coverage of containers and elimination of mosquito breeding places. Occupants of residential premises were much more likely to practice preventive measures than were those of non-residential premises (OR 2.23; 1.49, 3.36). Conclusion Schools and working sites were associated with the highest numbers of breeding sites and lacked preventive measures for vector control. In addition to pursuing vector control measures at residential level, public health strategies should be expanded in schools and work places. PMID:27241954
Gu, Haihui; Huang, Xia; Xu, Jing; Song, Lili; Liu, Shuping; Zhang, Xiao-Bing; Yuan, Weiping; Li, Yanxin
2018-06-15
Generation of induced pluripotent stem cells (iPSCs) from human peripheral blood provides a convenient and low-invasive way to obtain patient-specific iPSCs. The episomal vector is one of the best approaches for reprogramming somatic cells to pluripotent status because of its simplicity and affordability. However, the efficiency of episomal vector reprogramming of adult peripheral blood cells is relatively low compared with cord blood and bone marrow cells. In the present study, integration-free human iPSCs derived from peripheral blood were established via episomal technology. We optimized mononuclear cell isolation and cultivation, episomal vector promoters, and a combination of transcriptional factors to improve reprogramming efficiency. Here, we improved the generation efficiency of integration-free iPSCs from human peripheral blood mononuclear cells by optimizing the method of isolating mononuclear cells from peripheral blood, by modifying the integration of culture medium, and by adjusting the duration of culture time and the combination of different episomal vectors. With this optimized protocol, a valuable asset for banking patient-specific iPSCs has been established.
Modulation of an ultraviolet mutational hotspot in a shuttle vector Xeroderma cells.
Seetharam, S; Seidman, M M
1991-01-01
Ultraviolet mutagenesis of the shuttle vector plasmid pZ189 in Xeroderma Pigmentosum cells yields a mutational pattern marked by hotspots at photoproduct sites on both strands of the supF marker gene. In order to test the influence of strand orientation on the appearance of hotspots the mutagenesis study was repeated on a vector with the supF gene in the inverted orientation. We recovered a pattern the same as that in the earlier work and conclude that the nature of the DNA polymerase involved in the replication of specific strands is not a primary determinant of hotspot occurrence in this system. One of the hotspots lies in an 8 base palindrome while the corresponding site on the other strand was not a hotspot. These results were obtained with calcium phosphate transfection of the UV treated vector. When DEAE dextran was used as a transfection agent both sites in the palindrome were hotspots. In a mixing experiment the calcium phosphate pattern was recovered. Our data suggest that the sequence determinants of mutational probability at these two sites lie outside the 8 bases of the palindrome and that mutagenesis at one, but not the other, site is sensitive to perturbation of cellular calcium levels. PMID:2027767
Crysalis: an integrated server for computational analysis and design of protein crystallization.
Wang, Huilin; Feng, Liubin; Zhang, Ziding; Webb, Geoffrey I; Lin, Donghai; Song, Jiangning
2016-02-24
The failure of multi-step experimental procedures to yield diffraction-quality crystals is a major bottleneck in protein structure determination. Accordingly, several bioinformatics methods have been successfully developed and employed to select crystallizable proteins. Unfortunately, the majority of existing in silico methods only allow the prediction of crystallization propensity, seldom enabling computational design of protein mutants that can be targeted for enhancing protein crystallizability. Here, we present Crysalis, an integrated crystallization analysis tool that builds on support-vector regression (SVR) models to facilitate computational protein crystallization prediction, analysis, and design. More specifically, the functionality of this new tool includes: (1) rapid selection of target crystallizable proteins at the proteome level, (2) identification of site non-optimality for protein crystallization and systematic analysis of all potential single-point mutations that might enhance protein crystallization propensity, and (3) annotation of target protein based on predicted structural properties. We applied the design mode of Crysalis to identify site non-optimality for protein crystallization on a proteome-scale, focusing on proteins currently classified as non-crystallizable. Our results revealed that site non-optimality is based on biases related to residues, predicted structures, physicochemical properties, and sequence loci, which provides in-depth understanding of the features influencing protein crystallization. Crysalis is freely available at http://nmrcen.xmu.edu.cn/crysalis/.
Crysalis: an integrated server for computational analysis and design of protein crystallization
Wang, Huilin; Feng, Liubin; Zhang, Ziding; Webb, Geoffrey I.; Lin, Donghai; Song, Jiangning
2016-01-01
The failure of multi-step experimental procedures to yield diffraction-quality crystals is a major bottleneck in protein structure determination. Accordingly, several bioinformatics methods have been successfully developed and employed to select crystallizable proteins. Unfortunately, the majority of existing in silico methods only allow the prediction of crystallization propensity, seldom enabling computational design of protein mutants that can be targeted for enhancing protein crystallizability. Here, we present Crysalis, an integrated crystallization analysis tool that builds on support-vector regression (SVR) models to facilitate computational protein crystallization prediction, analysis, and design. More specifically, the functionality of this new tool includes: (1) rapid selection of target crystallizable proteins at the proteome level, (2) identification of site non-optimality for protein crystallization and systematic analysis of all potential single-point mutations that might enhance protein crystallization propensity, and (3) annotation of target protein based on predicted structural properties. We applied the design mode of Crysalis to identify site non-optimality for protein crystallization on a proteome-scale, focusing on proteins currently classified as non-crystallizable. Our results revealed that site non-optimality is based on biases related to residues, predicted structures, physicochemical properties, and sequence loci, which provides in-depth understanding of the features influencing protein crystallization. Crysalis is freely available at http://nmrcen.xmu.edu.cn/crysalis/. PMID:26906024
AAV Vectorization of DSB-mediated Gene Editing Technologies.
Moser, Rachel J; Hirsch, Matthew L
2016-01-01
Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.
Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming
2013-01-01
Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.
Cunningham, Sharon C; Siew, Susan M; Hallwirth, Claus V; Bolitho, Christine; Sasaki, Natsuki; Garg, Gagan; Michael, Iacovos P; Hetherington, Nicola A; Carpenter, Kevin; de Alencastro, Gustavo; Nagy, Andras; Alexander, Ian E
2015-08-01
Liver-targeted gene therapy based on recombinant adeno-associated viral vectors (rAAV) shows promising therapeutic efficacy in animal models and adult-focused clinical trials. This promise, however, is not directly translatable to the growing liver, where high rates of hepatocellular proliferation are accompanied by loss of episomal rAAV genomes and subsequently a loss in therapeutic efficacy. We have developed a hybrid rAAV/piggyBac transposon vector system combining the highly efficient liver-targeting properties of rAAV with stable piggyBac-mediated transposition of the transgene into the hepatocyte genome. Transposition efficiency was first tested using an enhanced green fluorescent protein expression cassette following delivery to newborn wild-type mice, with a 20-fold increase in stably gene-modified hepatocytes observed 4 weeks posttreatment compared to traditional rAAV gene delivery. We next modeled the therapeutic potential of the system in the context of severe urea cycle defects. A single treatment in the perinatal period was sufficient to confer robust and stable phenotype correction in the ornithine transcarbamylase-deficient Spf(ash) mouse and the neonatal lethal argininosuccinate synthetase knockout mouse. Finally, transposon integration patterns were analyzed, revealing 127,386 unique integration sites which conformed to previously published piggyBac data. Using a hybrid rAAV/piggyBac transposon vector system, we achieved stable therapeutic protection in two urea cycle defect mouse models; a clinically conceivable early application of this technology in the management of severe urea cycle defects could be as a bridging therapy while awaiting liver transplantation; further improvement of the system will result from the development of highly human liver-tropic capsids, the use of alternative strategies to achieve transient transposase expression, and engineered refinements in the safety profile of piggyBac transposase-mediated integration. © 2015 by the American Association for the Study of Liver Diseases.
The prospect of gene therapy for prostate cancer: update on theory and status.
Koeneman, K S; Hsieh, J T
2001-09-01
Molecularly based novel therapeutic agents are needed to address the problem of locally recurrent, or metastatic, advanced hormone-refractory prostate cancer. Recent basic science advances in mechanisms of gene expression, vector delivery, and targeting have rendered clinically relevant gene therapy to the prostatic fossa and distant sites feasible in the near future. Current research and clinical investigative efforts involving methods for more effective vector delivery and targeting, with enhanced gene expression to selected (specific) sites, are reviewed. These areas of research involve tissue-specific promoters, transgene exploration, vector design and delivery, and selective vector targeting. The 'vectorology' involved mainly addresses selective tissue homing with ligands, mechanisms of innate immune system evasion for durable transgene expression, and the possibility of repeat administration.
An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.
Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J
2018-05-01
A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.
[BLG gene knockout and hLF gene knock-in at BLG locus in goat by TALENs].
Song, Shaozheng; Zhu, Mengmin; Yuan, Yuguo; Rong, Yao; Xu, Sheng; Chen, Si; Mei, Junyan; Cheng, Yong
2016-03-01
To knock out β-lactoglobulin (BLG) gene and insert human lactoferrin (hLF) coding sequence at BLG locus of goat, the transcription activator-like effector nucleases (TALEN) mediated recombination was used to edit the BLG gene of goat fetal fibroblast, then as donor cells for somatic cell nuclear transfer. We designed a pair of specific plasmid TALEN-3-L/R for goat BLG exon III recognition sites, and BLC14-TK vector containing a negative selection gene HSV-TK, was used for the knock in of hLF gene. TALENs plasmids were transfected into the goat fetal fibroblast cells, and the cells were screened three days by 2 μg/mL puromycin. DNA cleavage activities of cells were verified by PCR amplification and DNA production sequencing. Then, targeting vector BLC14-TK and plasmids TALEN-3-L/R were co-transfected into goat fetal fibroblasts, both 700 μg/mL G418 and 2 μg/mL GCV were simultaneously used to screen G418-resistant cells. Detections of integration and recombination were implemented to obtain cells with hLF gene site-specific integration. We chose targeting cells as donor cells for somatic cell nuclear transfer. The mutagenicity of TALEN-3-L/R was between 25% and 30%. A total of 335 reconstructed embryos with 6 BLG-/hLF+ targeting cell lines were transferred into 16 recipient goats. There were 9 pregnancies confirmed by ultrasound on day 30 to 35 (pregnancy rate of 39.1%), and one of 50-day-old fetus with BLG-/hLF+ was achieved. These results provide the basis for hLF gene knock-in at BLG locus of goat and cultivating transgenic goat of low allergens and rich hLF in the milk.
Olano, Víctor Alberto; Matiz, María Inés; Lenhart, Audrey; Cabezas, Laura; Vargas, Sandra Lucía; Jaramillo, Juan Felipe; Sarmiento, Diana; Alexander, Neal; Stenström, Thor Axel; Overgaard, Hans J
2015-09-01
Dengue and other vector-borne diseases are of great public health importance in Colombia. Vector surveillance and control activities are often focused at the household level. Little is known about the importance of nonhousehold sites, including schools, in maintaining vector-borne disease transmission. The objectives of this paper were to determine the mosquito species composition in rural schools in 2 municipalities in Colombia and to assess the potential risk of vector-borne disease transmission in school settings. Entomological surveys were carried out in rural schools during the dry and rainy seasons of 2011. A total of 12 mosquito species were found: Aedes aegypti, Anopheles pseudopunctipennis, Culex coronator, Cx. quinquefasciatus, and Limatus durhamii in both immature and adult forms; Ae. fluviatilis, Cx. nigripalpus, Cx. corniger, and Psorophora ferox in immature forms only; and Ae. angustivittatus, Haemagogus equinus, and Trichoprosopon lampropus in adult forms only. The most common mosquito species was Cx. quinquefasciatus. Classrooms contained the greatest abundance of adult female Ae. aegypti and Cx. quinquefasciatus. The most common Ae. aegypti breeding sites were containers classified as "others" (e.g., cans), followed by containers used for water storage. A high level of Ae. aegypti infestation was found during the wet season. Our results suggest that rural schools are potentially important foci for the transmission of dengue and other mosquito-borne diseases. We propose that public health programs should be implemented in rural schools to prevent vector-borne diseases.
NASA Astrophysics Data System (ADS)
Tejeda-Sánchez, C.; Muñoz-Nieto, A.; Rodríguez-Gonzálvez, P.
2018-05-01
Visualization and analysis use to be the final steps in Geomatics. This paper shows the workflow followed to set up a hybrid 3D archaeological viewer. Data acquisition of the site survey was done by means of low-cost close-range photogrammetric methods. With the aim not only to satisfy the general public but also the technicians, a large group of Geomatic products has been obtained (2d plans, 3d models, orthophotos, CAD models coming from vectorization, virtual anastylosis, and cross sections). Finally, all these products have been integrated into a three-dimensional archaeological information system. The hybrid archaeological viewer designed allows a metric and quality approach to the scientific analysis of the ruins, improving, thanks to the implementation of a database, and its potential for queries, the benefits of an ordinary topographic survey.
Okamoto, Kenichi W; Gould, Fred; Lloyd, Alun L
2016-03-01
Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication) can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted). We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences-consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even modest perturbations induced by weak interventions can exhibit strong, albeit transient, epidemiological effects. This, together with our finding that under some conditions combining strategies could have transient adverse epidemiological effects suggests that a relatively long time horizon may be necessary to discern the efficacy of alternative intervention strategies.
Okamoto, Kenichi W.; Gould, Fred; Lloyd, Alun L.
2016-01-01
Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication) can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted). We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences—consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even modest perturbations induced by weak interventions can exhibit strong, albeit transient, epidemiological effects. This, together with our finding that under some conditions combining strategies could have transient adverse epidemiological effects suggests that a relatively long time horizon may be necessary to discern the efficacy of alternative intervention strategies. PMID:26962871
Structure of adeno-associated virus-2 in complex with neutralizing monoclonal antibody A20
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCraw, Dustin M.; O'Donnell, Jason K.; Taylor, Kenneth A.
2012-09-15
The use of adeno-associated virus (AAV) as a gene therapy vector is limited by the host neutralizing immune response. The cryo-electron microscopy (EM) structure at 8.5 A resolution is determined for a complex of AAV-2 with the Fab' fragment of monoclonal antibody (MAb) A20, the most extensively characterized AAV MAb. The binding footprint is determined through fitting the cryo-EM reconstruction with a homology model following sequencing of the variable domain, and provides a structural basis for integrating diverse prior epitope mappings. The footprint extends from the previously implicated plateau to the side of the spike, and into the conserved canyon,more » covering a larger area than anticipated. Comparison with structures of binding and non-binding serotypes indicates that recognition depends on a combination of subtle serotype-specific features. Separation of the neutralizing epitope from the heparan sulfate cell attachment site encourages attempts to develop immune-resistant vectors that can still bind to target cells.« less
Manoharan, Vinoth K; Khattar, Sunil K; LaBranche, Celia C; Montefiori, David C; Samal, Siba K
2018-06-12
SIV infection in macaques is a relevant animal model for HIV pathogenesis and vaccine study in humans. To design a safe and effective vaccine against HIV, we evaluated the suitability of naturally-occurring avirulent Newcastle disease virus (NDV) strains and several modified versions of NDV as vectors for the expression and immunogenicity of SIV envelope protein gp160. All the NDV vectors expressed gp160 protein in infected cells. The gp160 expressed by these vectors formed oligomers and was incorporated into the NDV envelope. All the NDV vectors expressing gp160 were attenuated in chickens. Intranasal immunization of guinea pigs with modified NDV vectors such as rNDV-APMV-2CS/gp160 and rNDV-APMV-8CS/gp160 (NDV strain LaSota containing the cleavage site sequences of F protein of avian paramyxovirus (APMV) serotype 2 and 8, respectively), and rNDV-BC-F-HN/gp160 (NDV strain BC containing LaSota F cleavage site and LaSota F and HN genes) elicited improved SIV-specific humoral and mucosal immune responses compared to other NDV vectors. These modified vectors were also efficient in inducing neutralizing antibody responses to tier 1 A SIVmac251.6 and tier 1B SIVmac251/M766 strains. This study suggests that our novel modified NDV vectors are safe and immunogenic and can be used as vaccine vector to control HIV.
Real Time Data Management for Estimating Probabilities of Incidents and Near Misses
NASA Astrophysics Data System (ADS)
Stanitsas, P. D.; Stephanedes, Y. J.
2011-08-01
Advances in real-time data collection, data storage and computational systems have led to development of algorithms for transport administrators and engineers that improve traffic safety and reduce cost of road operations. Despite these advances, problems in effectively integrating real-time data acquisition, processing, modelling and road-use strategies at complex intersections and motorways remain. These are related to increasing system performance in identification, analysis, detection and prediction of traffic state in real time. This research develops dynamic models to estimate the probability of road incidents, such as crashes and conflicts, and incident-prone conditions based on real-time data. The models support integration of anticipatory information and fee-based road use strategies in traveller information and management. Development includes macroscopic/microscopic probabilistic models, neural networks, and vector autoregressions tested via machine vision at EU and US sites.
Wong, Meng L.; Chua, Tock H.; Leong, Cherng S.; Khaw, Loke T.; Fornace, Kimberly; Wan-Sulaiman, Wan-Yusoff; William, Timothy; Drakeley, Chris; Ferguson, Heather M.; Vythilingam, Indra
2015-01-01
Background The simian malaria parasite Plasmodium knowlesi is emerging as a public health problem in Southeast Asia, particularly in Malaysian Borneo where it now accounts for the greatest burden of malaria cases and deaths. Control is hindered by limited understanding of the ecology of potential vector species. Methodology/Principal Findings We conducted a one year longitudinal study of P. knowlesi vectors in three sites within an endemic area of Sabah, Malaysia. All mosquitoes were captured using human landing catch. Anopheles mosquitoes were dissected to determine, oocyst, sporozoites and parous rate. Anopheles balabacensis is confirmed as the primary vector of. P. knowlesi (using nested PCR) in Sabah for the first time. Vector densities were significantly higher and more seasonally variable in the village than forest or small scale farming site. However An. balabacensis survival and P. knowlesi infection rates were highest in forest and small scale farm sites. Anopheles balabacensis mostly bites humans outdoors in the early evening between 1800 to 2000hrs. Conclusions/Significance This study indicates transmission is unlikely to be prevented by bednets. This combined with its high vectorial capacity poses a threat to malaria elimination programmes within the region. PMID:26448052
NASA Astrophysics Data System (ADS)
Kevorkyants, S. S.
2018-03-01
For theoretically studying the intensity of the influence exerted by the polarization of the rocks on the results of direct current (DC) well logging, a solution is suggested for the direct inner problem of the DC electric logging in the polarizable model of plane-layered medium containing a heterogeneity by the example of the three-layer model of the hosting medium. Initially, the solution is presented in the form of a traditional vector volume-integral equation of the second kind (IE2) for the electric current density vector. The vector IE2 is solved by the modified iteration-dissipation method. By the transformations, the initial IE2 is reduced to the equation with the contraction integral operator for an axisymmetric model of electrical well-logging of the three-layer polarizable medium intersected by an infinitely long circular cylinder. The latter simulates the borehole with a zone of penetration where the sought vector consists of the radial J r and J z axial (relative to the cylinder's axis) components. The decomposition of the obtained vector IE2 into scalar components and the discretization in the coordinates r and z lead to a heterogeneous system of linear algebraic equations with a block matrix of the coefficients representing 2x2 matrices whose elements are the triple integrals of the mixed derivatives of the second-order Green's function with respect to the parameters r, z, r', and z'. With the use of the analytical transformations and standard integrals, the integrals over the areas of the partition cells and azimuthal coordinate are reduced to single integrals (with respect to the variable t = cos ϕ on the interval [-1, 1]) calculated by the Gauss method for numerical integration. For estimating the effective coefficient of polarization of the complex medium, it is suggested to use the Siegel-Komarov formula.
A Hybrid Neuro-Fuzzy Model For Integrating Large Earth-Science Datasets
NASA Astrophysics Data System (ADS)
Porwal, A.; Carranza, J.; Hale, M.
2004-12-01
A GIS-based hybrid neuro-fuzzy approach to integration of large earth-science datasets for mineral prospectivity mapping is described. It implements a Takagi-Sugeno type fuzzy inference system in the framework of a four-layered feed-forward adaptive neural network. Each unique combination of the datasets is considered a feature vector whose components are derived by knowledge-based ordinal encoding of the constituent datasets. A subset of feature vectors with a known output target vector (i.e., unique conditions known to be associated with either a mineralized or a barren location) is used for the training of an adaptive neuro-fuzzy inference system. Training involves iterative adjustment of parameters of the adaptive neuro-fuzzy inference system using a hybrid learning procedure for mapping each training vector to its output target vector with minimum sum of squared error. The trained adaptive neuro-fuzzy inference system is used to process all feature vectors. The output for each feature vector is a value that indicates the extent to which a feature vector belongs to the mineralized class or the barren class. These values are used to generate a prospectivity map. The procedure is demonstrated by an application to regional-scale base metal prospectivity mapping in a study area located in the Aravalli metallogenic province (western India). A comparison of the hybrid neuro-fuzzy approach with pure knowledge-driven fuzzy and pure data-driven neural network approaches indicates that the former offers a superior method for integrating large earth-science datasets for predictive spatial mathematical modelling.
Monte Carlo Simulation of Seismic Location Errors for Moving Vehicles
2001-10-04
Smart Weapons Test Range 9/14/200 Four wheel Drive; File 14, Aberdeen, MD, Site 1 June 11, 1996, 10c runs, Piston Tank ; 10:18 34:42 53:55 58:64...72:79 92:97 105:118 % file vector Ft. Greely, AK, Site 1 1/27/1997, , Piston Tank ; 34:42 53:64 % file vector Ft. Greely, AK, Site 2...Dec 11, 1997 ; File 56, , Piston Tank Aberdeen, MD, Site 2 10/28/97 File84; File 56 200 400 600 800 1000 1200 -160 -150 -140 -130 -120 fL fH
USDA-ARS?s Scientific Manuscript database
Newcastle disease virus (NDV), avian paramyxovirus type 1, has been developed as a vector to express foreign genes for vaccine and gene therapy purposes. The foreign genes are usually inserted into a non-coding region of the NDV genome as an independent transcription unit (ITU), which potentially a...
Computation of Surface Integrals of Curl Vector Fields
ERIC Educational Resources Information Center
Hu, Chenglie
2007-01-01
This article presents a way of computing a surface integral when the vector field of the integrand is a curl field. Presented in some advanced calculus textbooks such as [1], the technique, as the author experienced, is simple and applicable. The computation is based on Stokes' theorem in 3-space calculus, and thus provides not only a means to…
West Nile virus surveillance in Europe: moving towards an integrated animal-human-vector approach.
Gossner, Céline M; Marrama, Laurence; Carson, Marianne; Allerberger, Franz; Calistri, Paolo; Dilaveris, Dimitrios; Lecollinet, Sylvie; Morgan, Dilys; Nowotny, Norbert; Paty, Marie-Claire; Pervanidou, Danai; Rizzo, Caterina; Roberts, Helen; Schmoll, Friedrich; Van Bortel, Wim; Gervelmeyer, Andrea
2017-05-04
This article uses the experience of five European countries to review the integrated approaches (human, animal and vector) for surveillance and monitoring of West Nile virus (WNV) at national and European levels. The epidemiological situation of West Nile fever in Europe is heterogeneous. No model of surveillance and monitoring fits all, hence this article merely encourages countries to implement the integrated approach that meets their needs. Integration of surveillance and monitoring activities conducted by the public health authorities, the animal health authorities and the authorities in charge of vector surveillance and control should improve efficiency and save resources by implementing targeted measures. The creation of a formal interagency working group is identified as a crucial step towards integration. Blood safety is a key incentive for public health authorities to allocate sufficient resources for WNV surveillance, while the facts that an effective vaccine is available for horses and that most infected animals remain asymptomatic make the disease a lesser priority for animal health authorities. The examples described here can support other European countries wishing to strengthen their WNV surveillance or preparedness, and also serve as a model for surveillance and monitoring of other (vector-borne) zoonotic infections. This article is copyright of The Authors, 2017.
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-01-01
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830
Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi
2015-10-09
Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.
Kesari, Shreekant; Bhunia, Gouri Sankar; Kumar, Vijay; Jeyaram, Algarswamy; Ranjan, Alok; Das, Pradeep
2011-08-01
In visceral leishmaniasis, phlebotomine vectors are targets for control measures. Understanding the ecosystem of the vectors is a prerequisite for creating these control measures. This study endeavours to delineate the suitable locations of Phlebotomus argentipes with relation to environmental characteristics between endemic and non-endemic districts in India. A cross-sectional survey was conducted on 25 villages in each district. Environmental data were obtained through remote sensing images and vector density was measured using a CDC light trap. Simple linear regression analysis was used to measure the association between climatic parameters and vector density. Using factor analysis, the relationship between land cover classes and P. argentipes density among the villages in both districts was investigated. The results of the regression analysis indicated that indoor temperature and relative humidity are the best predictors for P. argentipes distribution. Factor analysis confirmed breeding preferences for P. argentipes by landscape element. Minimum Normalised Difference Vegetation Index, marshy land and orchard/settlement produced high loading in an endemic region, whereas water bodies and dense forest were preferred in non-endemic sites. Soil properties between the two districts were studied and indicated that soil pH and moisture content is higher in endemic sites compared to non-endemic sites. The present study should be utilised to make critical decisions for vector surveillance and controlling Kala-azar disease vectors.
VectorBase: a data resource for invertebrate vector genomics
Lawson, Daniel; Arensburger, Peter; Atkinson, Peter; Besansky, Nora J.; Bruggner, Robert V.; Butler, Ryan; Campbell, Kathryn S.; Christophides, George K.; Christley, Scott; Dialynas, Emmanuel; Hammond, Martin; Hill, Catherine A.; Konopinski, Nathan; Lobo, Neil F.; MacCallum, Robert M.; Madey, Greg; Megy, Karine; Meyer, Jason; Redmond, Seth; Severson, David W.; Stinson, Eric O.; Topalis, Pantelis; Birney, Ewan; Gelbart, William M.; Kafatos, Fotis C.; Louis, Christos; Collins, Frank H.
2009-01-01
VectorBase (http://www.vectorbase.org) is an NIAID-funded Bioinformatic Resource Center focused on invertebrate vectors of human pathogens. VectorBase annotates and curates vector genomes providing a web accessible integrated resource for the research community. Currently, VectorBase contains genome information for three mosquito species: Aedes aegypti, Anopheles gambiae and Culex quinquefasciatus, a body louse Pediculus humanus and a tick species Ixodes scapularis. Since our last report VectorBase has initiated a community annotation system, a microarray and gene expression repository and controlled vocabularies for anatomy and insecticide resistance. We have continued to develop both the software infrastructure and tools for interrogating the stored data. PMID:19028744
Walz, M; Kück, U
1995-12-01
The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.
Code of Federal Regulations, 2011 CFR
2011-07-01
... DISPOSAL OF SEWAGE SLUDGE Pathogens and Vector Attraction Reduction § 503.30 Scope. (a) This subpart... land, forest, or a reclamation site. (d) This subpart contains alternative vector attraction reduction...
Code of Federal Regulations, 2010 CFR
2010-07-01
... DISPOSAL OF SEWAGE SLUDGE Pathogens and Vector Attraction Reduction § 503.30 Scope. (a) This subpart... land, forest, or a reclamation site. (d) This subpart contains alternative vector attraction reduction...
Optimal multiguidance integration in insect navigation.
Hoinville, Thierry; Wehner, Rüdiger
2018-03-13
In the last decades, desert ants have become model organisms for the study of insect navigation. In finding their way, they use two major navigational routines: path integration using a celestial compass and landmark guidance based on sets of panoramic views of the terrestrial environment. It has been claimed that this information would enable the insect to acquire and use a centralized cognitive map of its foraging terrain. Here, we present a decentralized architecture, in which the concurrently operating path integration and landmark guidance routines contribute optimally to the directions to be steered, with "optimal" meaning maximizing the certainty (reliability) of the combined information. At any one time during its journey, the animal computes a path integration (global) vector and landmark guidance (local) vector, in which the length of each vector is proportional to the certainty of the individual estimates. Hence, these vectors represent the limited knowledge that the navigator has at any one place about the direction of the goal. The sum of the global and local vectors indicates the navigator's optimal directional estimate. Wherever applied, this decentralized model architecture is sufficient to simulate the results of quite a number of diverse cue-conflict experiments, which have recently been performed in various behavioral contexts by different authors in both desert ants and honeybees. They include even those experiments that have deliberately been designed by former authors to strengthen the evidence for a metric cognitive map in bees.
Jin, Chuan; Fotaki, Grammatiki; Ramachandran, Mohanraj; Nilsson, Berith; Essand, Magnus; Yu, Di
2016-07-01
Chimeric antigen receptor (CAR) T-cell therapy is a new successful treatment for refractory B-cell leukemia. Successful therapeutic outcome depends on long-term expression of CAR transgene in T cells, which is achieved by delivering transgene using integrating gamma retrovirus (RV) or lentivirus (LV). However, uncontrolled RV/LV integration in host cell genomes has the potential risk of causing insertional mutagenesis. Herein, we describe a novel episomal long-term cell engineering method using non-integrating lentiviral (NILV) vector containing a scaffold/matrix attachment region (S/MAR) element, for either expression of transgenes or silencing of target genes. The insertional events of this vector into the genome of host cells are below detection level. CD19 CAR T cells engineered with a NILV-S/MAR vector have similar levels of CAR expression as T cells engineered with an integrating LV vector, even after numerous rounds of cell division. NILV-S/MAR-engineered CD19 CAR T cells exhibited similar cytotoxic capacity upon CD19(+) target cell recognition as LV-engineered T cells and are as effective in controlling tumor growth in vivo We propose that NILV-S/MAR vectors are superior to current options as they enable long-term transgene expression without the risk of insertional mutagenesis and genotoxicity. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1
Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.
2009-01-01
Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021
Ghosh, Srikant; Nagar, Gaurav
2014-12-01
Ticks, as vectors of several zoonotic diseases, are ranked second only to mosquitoes as vectors. The diseases spread by ticks are a major constraint to animal productivity while causing morbidity and mortality in both animals and humans. A number of tick species have been recognised since long as vectors of lethal pathogens, viz. Crimean-Congo haemorrhagic fever virus (CCHFV), Kyasanur forest disease virus (KFDV), Babesia spp, Theileria, Rickettsia conorii, Anaplasma marginale, etc. and the damages caused by them are well-recognised. There is a need to reassess the renewed threat posed by the tick vectors and to prioritize the tick control research programme. This review is focused on the major tick-borne human and animal diseases in India and the progress in vector control research with emphasis on acaricide resistance, tick vaccine and the development of potential phytoacaricides as an integral part of integrated tick control programme.
Towards an integrated approach in surveillance of vector-borne diseases in Europe
2011-01-01
Vector borne disease (VBD) emergence is a complex and dynamic process. Interactions between multiple disciplines and responsible health and environmental authorities are often needed for an effective early warning, surveillance and control of vectors and the diseases they transmit. To fully appreciate this complexity, integrated knowledge about the human and the vector population is desirable. In the current paper, important parameters and terms of both public health and medical entomology are defined in order to establish a common language that facilitates collaboration between the two disciplines. Special focus is put on the different VBD contexts with respect to the current presence or absence of the disease, the pathogen and the vector in a given location. Depending on the context, whether a VBD is endemic or not, surveillance activities are required to assess disease burden or threat, respectively. Following a decision for action, surveillance activities continue to assess trends. PMID:21967706
Lebl, Karin; Zittra, Carina; Silbermayr, Katja; Obwaller, Adelheid; Berer, Dominik; Brugger, Katharina; Walter, Melanie; Pinior, Beate; Fuehrer, Hans-Peter; Rubel, Franz
2015-02-01
Mosquitoes (Diptera: Culicidae) are important vectors for a wide range of pathogenic organisms. As large parts of the human population in developed countries live in cities, the occurrence of vector-borne diseases in urban areas is of particular interest for epidemiologists and public health authorities. In this study, we investigated the mosquito occurrence in the city of Vienna, Austria, in order to estimate the risk of transmission of mosquito-borne diseases. Mosquitoes were captured using different sampling techniques at 17 sites in the city of Vienna. Species belonging to the Culex pipiens complex (78.8 %) were most abundant, followed by Coquillettidia richiardii (10.2 %), Anopheles plumbeus (5.4 %), Aedes vexans (3.8 %), and Ochlerotatus sticticus (0.7 %). Individuals of the Cx. pipiens complex were found at 80.2 % of the trap sites, while 58.8 % of the trap sites were positive for Cq. richiardii and Ae. vexans. Oc. sticticus was captured at 35.3 % of the sites, and An. plumbeus only at 23.5 % of the trap sites. Cx. pipiens complex is known to be a potent vector and pathogens like West Nile virus (WNV), Usutu virus (USUV), Tahyna virus (TAHV), Sindbis virus (SINV), Plasmodium sp., and Dirofilaria repens can be transmitted by this species. Cq. richiardii is a known vector species for Batai virus (BATV), SINV, TAHV, and WNV, while Ae. vexans can transmit TAHV, USUV, WNV, and Dirofilaria repens. An. plumbeus and Oc. sticticus seem to play only a minor role in the transmission of vector-borne diseases in Vienna. WNV, which is already wide-spread in Europe, is likely to be the highest threat in Vienna as it can be transmitted by several of the most common species, has already been shown to pose a higher risk in cities, and has the possibility to cause severe illness.
A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.
Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei
2018-05-01
Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.
Proper projective symmetry in LRS Bianchi type V spacetimes
NASA Astrophysics Data System (ADS)
Shabbir, Ghulam; Mahomed, K. S.; Mahomed, F. M.; Moitsheki, R. J.
2018-04-01
In this paper, we investigate proper projective vector fields of locally rotationally symmetric (LRS) Bianchi type V spacetimes using direct integration and algebraic techniques. Despite the non-degeneracy in the Riemann tensor eigenvalues, we classify proper Bianchi type V spacetimes and show that the above spacetimes do not admit proper projective vector fields. Here, in all the cases projective vector fields are Killing vector fields.
Vector neural network signal integration for radar application
NASA Astrophysics Data System (ADS)
Bierman, Gregory S.
1994-07-01
The Litton Data Systems Vector Neural Network (VNN) is a unique multi-scan integration algorithm currently in development. The target of interest is a low-flying cruise missile. Current tactical radar cannot detect and track the missile in ground clutter at tactically useful ranges. The VNN solves this problem by integrating the energy from multiple frames to effectively increase the target's signal-to-noise ratio. The implementation plan is addressing the APG-63 radar. Real-time results will be available by March 1994.
Makungu, Christina; Stephen, Stephania; Kumburu, Salome; Govella, Nicodem J; Dongus, Stefan; Hildon, Zoe Jane-Lara; Killeen, Gerry F; Jones, Caroline
2017-10-11
The effectiveness of malaria prevention with long-lasting insecticidal nets and indoor residual spraying is limited by emerging insecticide resistance, evasive mosquito behaviours that include outdoor biting, sub-optimal implementation and inappropriate use. New vector control interventions are required and their potential effectiveness will be enhanced if existing household perceptions and practices are integrated into intervention design. This qualitative descriptive study used focus groups discussions, in-depth interviews and photovoice methods to explore mosquito control perceptions and practices among residents in four study sites in Dar es Salaam, Tanzania. Mosquitoes were perceived as a growing problem, directly attributed to widespread environmental deterioration and lack of effective mosquito control interventions. Malaria and nuisance biting were perceived as the main problem caused by mosquitoes. Breeding sites were clearly distinguished from resting sites but residents did not differentiate between habitats producing malaria vector mosquitoes and others producing mostly nuisance mosquitoes. The most frequently mentioned protection methods in the wealthiest locations were bed nets, aerosol insecticide sprays, window screens, and fumigation, while bed nets were most frequently mentioned and described as 'part of the culture' in the least wealthy locations. Mosquito-proofed housing was consistently viewed as desirable, but considered unaffordable outside wealthiest locations. Slapping and covering up with clothing were most commonly used to prevent biting outdoors. Despite their utility outdoors, topical repellents applied to the skin were considered expensive, and viewed with suspicion due to perceived side effects. Improving the local environment was the preferred method for preventing outdoor biting. Affordability, effectiveness, availability, practicality, as well as social influences, such as government recommendations, socialization and internalization (familiarization and habit) were described as key factors influencing uptake. Outdoor transmission is widely accepted as an obstacle to malaria elimination. Larval source management, targeting both malaria vectors and nuisance-biting mosquitoes, is the preferred method for mosquito control among the residents of Dar es Salaam and should be prioritized for development alongside new methods for outdoor personal protection. Even if made available, effective and affordable, these additional interventions may require time and user experience to achieve positive reputations and trustworthiness.
Lockaby, Graeme; Noori, Navideh; Morse, Wayde; Zipperer, Wayne; Kalin, Latif; Governo, Robin; Sawant, Rajesh; Ricker, Matthew
2016-12-01
The integrated effects of the many risk factors associated with West Nile virus (WNV) incidence are complex and not well understood. We studied an array of risk factors in and around Atlanta, GA, that have been shown to be linked with WNV in other locations. This array was comprehensive and included climate and meteorological metrics, vegetation characteristics, land use / land cover analyses, and socioeconomic factors. Data on mosquito abundance and WNV mosquito infection rates were obtained for 58 sites and covered 2009-2011, a period following the combined storm water - sewer overflow remediation in that city. Risk factors were compared to mosquito abundance and the WNV vector index (VI) using regression analyses individually and in combination. Lagged climate variables, including soil moisture and temperature, were significantly correlated (positively) with vector index as were forest patch size and percent pine composition of patches (both negatively). Socioeconomic factors that were most highly correlated (positively) with the VI included the proportion of low income households and homes built before 1960 and housing density. The model selected through stepwise regression that related risk factors to the VI included (in the order of decreasing influence) proportion of houses built before 1960, percent of pine in patches, and proportion of low income households. © 2016 The Society for Vector Ecology.
Erlanger, Tobias E; Keiser, Jennifer; Caldas De Castro, Marcia; Bos, Robert; Singer, Burton H; Tanner, Marcel; Utzinger, Jürg
2005-09-01
Lymphatic filariasis (LF) is a debilitating disease overwhelmingly caused by Wuchereria bancrofti, which is transmitted by various mosquito species. Here, we present a systematic literature review with the following objectives: (i) to establish global and regional estimates of populations at risk of LF with particular consideration of water resource development projects, and (ii) to assess the effects of water resource development and management on the frequency and transmission dynamics of the disease. We estimate that globally, 2 billion people are at risk of LF. Among them, there are 394.5 million urban dwellers without access to improved sanitation and 213 million rural dwellers living in close proximity to irrigation. Environmental changes due to water resource development and management consistently led to a shift in vector species composition and generally to a strong proliferation of vector populations. For example, in World Health Organization (WHO) subregions 1 and 2, mosquito densities of the Anopheles gambiae complex and Anopheles funestus were up to 25-fold higher in irrigated areas when compared with irrigation-free sites. Although the infection prevalence of LF often increased after the implementation of a water project, there was no clear association with clinical symptoms. Concluding, there is a need to assess and quantify changes of LF transmission parameters and clinical manifestations over the entire course of water resource developments. Where resources allow, integrated vector management should complement mass drug administration, and broad-based monitoring and surveillance of the disease should become an integral part of large-scale waste management and sanitation programs, whose basic rationale lies in a systemic approach to city, district, and regional level health services and disease prevention.
Rizzo, Caterina; Napoli, Christian; Venturi, Giulietta; Pupella, Simonetta; Lombardini, Letizia; Calistri, Paolo; Monaco, Federica; Cagarelli, Roberto; Angelini, Paola; Bellini, Romeo; Tamba, Marco; Piatti, Alessandra; Russo, Francesca; Palù, Giorgio; Chiari, Mario; Lavazza, Antonio; Bella, Antonino
2016-09-15
In Italy a national Plan for the surveillance of imported and autochthonous human vector-borne diseases (chikungunya, dengue, Zika virus disease and West Nile virus (WNV) disease) that integrates human and veterinary (animals and vectors) surveillance, is issued and revised annually according with the observed epidemiological changes. Here we describe results of the WNV integrated veterinary and human surveillance systems in Italy from 2008 to 2015. A real time data exchange protocol is in place between the surveillance systems to rapidly identify occurrence of human and animal cases and to define and update the map of affected areas i.e. provinces during the vector activity period from June to October. WNV continues to cause severe illnesses in Italy during every transmission season, albeit cases are sporadic and the epidemiology varies by virus lineage and geographic area. The integration of surveillance activities and a multidisciplinary approach made it possible and have been fundamental in supporting implementation of and/or strengthening preventive measures aimed at reducing the risk of transmission of WNV trough blood, tissues and organ donation and to implementing further measures for vector control. This article is copyright of The Authors, 2016.
O Electromagnetic Power Waves and Power Density Components.
NASA Astrophysics Data System (ADS)
Petzold, Donald Wayne
1980-12-01
On January 10, 1884 Lord Rayleigh presented a paper entitled "On the Transfer of Energy in the Electromagnetic Field" to the Royal Society of London. This paper had been authored by the late Fellow of Trinity College, Cambridge, Professor J. H. Poynting and in it he claimed that there was a general law for the transfer of electromagnetic energy. He argued that associated with each point in space is a quantity, that has since been called the Poynting vector, that is a measure of the rate of energy flow per unit area. His analysis was concerned with the integration of this power density vector at all points over an enclosing surface of a specific volume. The interpretation of this Poynting vector as a true measure of the local power density was viewed with great skepticism unless the vector was integrated over a closed surface, as the development of the concept required. However, within the last decade or so Shadowitz indicates that a number of prominent authors have argued that the criticism of the interpretation of Poynting's vector as a local power density vector is unjustified. The present paper is not concerned with these arguments but instead is concerned with a decomposition of Poynting's power density vector into two and only two components: one vector which has the same direction as Poynting's vector and which is called the forward power density vector, and another vector, directed opposite to the Poynting vector and called the reverse power density vector. These new local forward and reverse power density vectors will be shown to be dependent upon forward and reverse power wave vectors and these vectors in turn will be related to newly defined forward and reverse components of the electric and magnetic fields. The sum of these forward and reverse power density vectors, which is simply the original Poynting vector, is associated with the total electromagnetic energy traveling past the local point. Another vector which is the difference between the forward and reverse power density vectors and which will be shown to be associated with the total electric and magnetic field energy densities existing at a local point will also be introduced. These local forward and reverse power density vectors may be integrated over a surface to determine the forward and reverse powers and from these results problems related to maximum power transfer or efficiency of electromagnetic energy transmission in space may be studied in a manner similar to that presently being done with transmission lines, wave guides, and more recently with two port multiport lumped parameter systems. These new forward and reverse power density vectors at a point in space are analogous to the forward and revoltages or currents and power waves as used with the transmission line, waveguide, or port. These power wave vectors in space are a generalization of the power waves as developed by Penfield, Youla, and Kurokawa and used with the scattering parameters associated with transmission lines, waveguides and ports.
Fotakis, Emmanouil A; Chaskopoulou, Alexandra; Grigoraki, Linda; Tsiamantas, Alexandros; Kounadi, Stella; Georgiou, Loukas; Vontas, John
2017-10-01
Greece has been recently affected by several mosquito borne diseases with the West Nile Virus (WNV) outbreak in 2010 being one of the largest reported in Europe. Currently at the epicenter of an economic and refugee crisis and visited by over 16 million tourists a year the integrated management of diseases transmitted by mosquitoes is a public health and economic priority. Vector control programs rely mainly on insecticides, however data on insecticide resistance and the mosquito fauna is essential for successful applications. We determined the mosquito species composition and population dynamics in areas of increased vulnerability to vector borne disease transmission, as well as investigated the resistance status of major nuisance and disease vectors to insecticides. High mosquito densities were recorded in Thessaloniki and Evros, with Aedes caspius, a nuisance species, Culex pipiens, a known vector of WNV and Anopheles hyrcanus a potential vector of malaria being among the most prevalent species. Both vector species populations reached their peak in late summer. Aedes albopictus was recorded at high densities in Thessaloniki, but not in Evros. Notably, Cx. pipiens hybrids, which show an opportunistic biting behavior and are suspected to be involved in the transmission of the WNV, were recorded in considerable numbers in Thessaloniki and Attica. Culex pipiens and An. hyrcanus, but not Ae. caspius mosquitoes, showed moderate levels of resistance to deltamethrin. The presence of resistance in areas not exposed to vector control indicates that other factors could be selecting for resistance, i.e. pesticide applications for agriculture. Both L1014F and L101C kdr mutations were detected in Cx. pipiens populations. Anopheles hyrcanus resistance was not associated with mutations at the L1014 site. The Ace-1 mutations conferring insensitivity to organophosphates and carbamates were detected at low frequencies in all Cx. pipiens populations. Increased activity of P450s and esterases was found in Cx. pipiens individuals from Thessaloniki. Our study contributes evidence for sustainable and efficient vector control strategies and the prevention of disease outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.
Bouzid, Maha; Brainard, Julii; Hooper, Lee; Hunter, Paul R.
2016-01-01
Background There is renewed interest in effective measures to control Zika and dengue vectors. A synthesis of published literature with a focus on the quality of evidence is warranted to determine the effectiveness of vector control strategies. Methodology We conducted a meta-review assessing the effectiveness of any Aedes control measure. We searched Scopus and Medline for relevant reviews through to May 2016. Titles, abstracts and full texts were assessed independently for inclusion by two authors. Data extraction was performed in duplicate and validity of the evidence was assessed using GRADE criteria. Findings 13 systematic reviews that investigated the effect of control measures on entomological parameters or disease incidence were included. Biological controls seem to achieve better reduction of entomological indices than chemical controls, while educational campaigns can reduce breeding habitats. Integrated vector control strategies may not always increase effectiveness. The efficacy of any control programme is dependent on local settings, intervention type, resources and study duration, which may partly explain the varying degree of success between studies. Nevertheless, the quality of evidence was mostly low to very low due to poor reporting of study design, observational methodologies, heterogeneity, and indirect outcomes, thus hindering an evidence-based recommendation. Conclusions The evidence for the effectiveness of Aedes control measures is mixed. Chemical control, which is commonly used, does not appear to be associated with sustainable reductions of mosquito populations over time. Indeed, by contributing to a false sense of security, chemical control may reduce the effectiveness of educational interventions aimed at encouraging local people to remove mosquito breeding sites. Better quality studies of the impact of vector control interventions on the incidence of human infections with Dengue or Zika are still needed. PMID:27926934
Abel Lopez-Buenfil, Jose; Abrahan Ramirez-Pool, Jose; Ruiz-Medrano, Roberto; Del Carmen Montes-Horcasitas, Maria; Chavarin-Palacio, Claudio; Moya-Hinojosa, Jesus; Javier Trujillo-Arriaga, Francisco; Carmona, Rosalia Lira; Xoconostle-Cazares, Beatriz
2017-01-01
The bacterial disease citrus huanglongbing (HLB), associated with "Candidatus Liberibacter asiaticus" (C.Las) has severely impacted the citrus industry, causing a significant reduction in production and fruit quality. In the present study, it was monitored the C.Las population dynamics in symptomatic, HLB-positive Mexican lime trees (Citrus aurantifolia Swingle) in a tropical, citrus-producing area of Mexico. The objective of this study was to identify the dynamics of the population of huanglongbing-associated bacterium Candidatus Liberibacter asiaticus and its insect vector in Citrus aurantifolia Swingle (Mexican lime). Leaf samples were collected every 2 months over a period of 26 months for quantification of bacterial titers and young and mature leaves were collected in each season to determine preferential sites of bacterial accumulation. The proportion of living and dead bacterial cells could be determined through the use of quantitative real-time PCR in the presence of ethidium monoazide (EMA-qPCR). It was observed a lower bacterial titer at high temperatures in the infected trees relative to titers in mild weather, despite a higher accumulation of the insect vector Diaphorina citri in these conditions. This study also revealed seasonal fluctuations in the titers of bacteria in mature leaves when compared to young leaves. No statistically significant correlation between any meteorological variable, C.Las concentration and D. citri population could be drawn. Although, HLB management strategies have focused on vector control, host tree phenology may be important. The evaluation of citrus phenology, C.Las concentration, ACP population and environmental conditions provides insights into the cyclical, seasonal variations of both the HLB pathogen and its vector. These findings should help in the design of integrative HLB control strategies that take into account the accumulation of the pathogen and the presence of its vector.
Predicting protein amidation sites by orchestrating amino acid sequence features
NASA Astrophysics Data System (ADS)
Zhao, Shuqiu; Yu, Hua; Gong, Xiujun
2017-08-01
Amidation is the fourth major category of post-translational modifications, which plays an important role in physiological and pathological processes. Identifying amidation sites can help us understanding the amidation and recognizing the original reason of many kinds of diseases. But the traditional experimental methods for predicting amidation sites are often time-consuming and expensive. In this study, we propose a computational method for predicting amidation sites by orchestrating amino acid sequence features. Three kinds of feature extraction methods are used to build a feature vector enabling to capture not only the physicochemical properties but also position related information of the amino acids. An extremely randomized trees algorithm is applied to choose the optimal features to remove redundancy and dependence among components of the feature vector by a supervised fashion. Finally the support vector machine classifier is used to label the amidation sites. When tested on an independent data set, it shows that the proposed method performs better than all the previous ones with the prediction accuracy of 0.962 at the Matthew's correlation coefficient of 0.89 and area under curve of 0.964.
Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong
2011-10-11
Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.
Vontas, John; Mitsakakis, Konstantinos; Zengerle, Roland; Yewhalaw, Delenasaw; Sikaala, Chadwick Haadezu; Etang, Josiane; Fallani, Matteo; Carman, Bill; Müller, Pie; Chouaïbou, Mouhamadou; Coleman, Marlize; Coleman, Michael
2016-01-01
Malaria is a life-threatening disease that caused more than 400,000 deaths in sub-Saharan Africa in 2015. Mass prevention of the disease is best achieved by vector control which heavily relies on the use of insecticides. Monitoring mosquito vector populations is an integral component of control programs and a prerequisite for effective interventions. Several individual methods are used for this task; however, there are obstacles to their uptake, as well as challenges in organizing, interpreting and communicating vector population data. The Horizon 2020 project "DMC-MALVEC" consortium will develop a fully integrated and automated multiplex vector-diagnostic platform (LabDisk) for characterizing mosquito populations in terms of species composition, Plasmodium infections and biochemical insecticide resistance markers. The LabDisk will be interfaced with a Disease Data Management System (DDMS), a custom made data management software which will collate and manage data from routine entomological monitoring activities providing information in a timely fashion based on user needs and in a standardized way. The ResistanceSim, a serious game, a modern ICT platform that uses interactive ways of communicating guidelines and exemplifying good practices of optimal use of interventions in the health sector will also be a key element. The use of the tool will teach operational end users the value of quality data (relevant, timely and accurate) to make informed decisions. The integrated system (LabDisk, DDMS & ResistanceSim) will be evaluated in four malaria endemic countries, representative of the vector control challenges in sub-Saharan Africa, (Cameroon, Ivory Coast, Ethiopia and Zambia), highly representative of malaria settings with different levels of endemicity and vector control challenges, to support informed decision-making in vector control and disease management.
Van Maele, Bénédicte; De Rijck, Jan; De Clercq, Erik; Debyser, Zeger
2003-01-01
Lentiviral vectors derived from human immunodeficiency virus type 1 (HIV-1) show great promise as gene carriers for future gene therapy. Insertion of a fragment containing the central polypurine tract (cPPT) in HIV-1 vector constructs is known to enhance transduction efficiency drastically, reportedly by facilitating the nuclear import of HIV-1 cDNA through a central DNA flap. We have studied the impact of the cPPT on the kinetics of HIV-1 vector transduction by real-time PCR. The kinetics of total HIV-1 DNA, two-long-terminal-repeat (2-LTR) circles, and, by an Alu-PCR, integrated proviral DNA were monitored. About 6 to 12 h after transduction, the total HIV-1 DNA reached a maximum level, followed by a steep decrease. The 2-LTR circles peaked after 24 to 48 h and were diluted upon cell division. Integration of HIV-1 DNA was first detected at 12 h postinfection. When HIV-1 vectors that contained the cPPT were used, DNA synthesis was similar but a threefold higher amount of 2-LTR circles was detected, confirming the impact on nuclear import. Moreover, a 10-fold increase in the amount of integrated DNA was observed in the presence of the cPPT. Only in the absence of the cPPT was a saturation in 2-LTR circle formation seen at a high multiplicity of infection, suggesting a role for the cPPT in overcoming a barrier to the nuclear import of HIV-1 DNA. A major effect of the central DNA flap on the juxtaposition of both LTRs is unlikely, since transduction with HIV-1 vectors containing ectopic cPPT fragments resulted in increased amounts of 2-LTR circles as well as integrated DNA. Inhibitors of transduction by cPPT-containing HIV vectors were also studied by real-time PCR. The reverse transcriptase inhibitor azidothymidine (AZT) and the nonnucleoside reverse transcriptase inhibitor α-APA clearly inhibited viral DNA synthesis, whereas integrase inhibitors such as the diketo acid L-708,906 and the pyranodipyrimidine V-165 specifically inhibited integration. PMID:12663775
Brough, Rachel; Papanastasiou, Antigoni M; Porter, Andrew CG
2007-01-01
Background The ability to regulate transgene expression has many applications, mostly concerning the analysis of gene function. Desirable induction characteristics, such as low un-induced expression, high induced expression and limited cellular heterogeneity, can be seriously impaired by chromosomal position effects at the site of transgene integration. Many clones may therefore need to be screened before one with optimal induction characteristics is identified. Furthermore, such screens must be repeated for each new transgene investigated, and comparisons between clones with different transgenes is complicated by their different integration sites. Results To circumvent these problems we have developed a "screen and insert" strategy in which clones carrying a transgene for a fluorescent reporter are first screened for those with optimal induction characteristics. Site-specific recombination (SSR) is then be used repeatedly to insert any new transgene at the reporter transgene locus of such clones so that optimal induction characteristics are conferred upon it. Here we have tested in a human fibrosarcoma cell line (HT1080) two of many possible implementations of this approach. Clones (e.g. Rht14-10) in which a GFP reporter gene is very stringently regulated by the tetracycline (tet) transactivator (tTA) protein were first identified flow-cytometrically. Transgenes encoding luciferase, I-SceI endonuclease or Rad52 were then inserted by SSR at a LoxP site adjacent to the GFP gene resulting stringent tet-regulated transgene expression. In clone Rht14-10, increases in expression from essentially background levels (+tet) to more than 104-fold above background (-tet) were reproducibly detected after Cre-mediated insertion of either the luciferase or the I-SceI transgenes. Conclusion Although previous methods have made use of SSR to integrate transgenes at defined sites, none has effectively combined this with a pre-selection step to identify integration sites that support optimal regulatory characteristics. Rht14-10 and similar HT1080-derived clones can now be used in conjunction with a convenient delivery vector (pIN2-neoMCS), in a simple 3-step protocol leading to stringent and reproducible transgene regulation. This approach will be particularly useful for transgenes whose products are very active at low concentrations and/or for comparisons of multiple related transgenes. PMID:17493262
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Advances in Non-Viral DNA Vectors for Gene Therapy
Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn
2017-01-01
Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635
BOREAS TE-20 Soils Data Over the NSA-MSA and Tower Sites in Vector Format
NASA Technical Reports Server (NTRS)
Hall, Forrest G. (Editor); Veldhuis, Hugo; Knapp, David
2000-01-01
The BOREAS TE-20 team collected several data sets for use in developing and testing models of forest ecosystem dynamics. This data set contains vector layers of soil maps that were received from Dr. Hugo Veldhuis, who did the original mapping in the field during 1994. The vector layers were converted to ARCANFO EXPORT files. These data cover 1-kilometer diameters around each of the NSA tower sites, and another layer covers the NSA-MSA. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).
Parallel/Vector Integration Methods for Dynamical Astronomy
NASA Astrophysics Data System (ADS)
Fukushima, Toshio
1999-01-01
This paper reviews three recent works on the numerical methods to integrate ordinary differential equations (ODE), which are specially designed for parallel, vector, and/or multi-processor-unit(PU) computers. The first is the Picard-Chebyshev method (Fukushima, 1997a). It obtains a global solution of ODE in the form of Chebyshev polynomial of large (> 1000) degree by applying the Picard iteration repeatedly. The iteration converges for smooth problems and/or perturbed dynamics. The method runs around 100-1000 times faster in the vector mode than in the scalar mode of a certain computer with vector processors (Fukushima, 1997b). The second is a parallelization of a symplectic integrator (Saha et al., 1997). It regards the implicit midpoint rules covering thousands of timesteps as large-scale nonlinear equations and solves them by the fixed-point iteration. The method is applicable to Hamiltonian systems and is expected to lead an acceleration factor of around 50 in parallel computers with more than 1000 PUs. The last is a parallelization of the extrapolation method (Ito and Fukushima, 1997). It performs trial integrations in parallel. Also the trial integrations are further accelerated by balancing computational load among PUs by the technique of folding. The method is all-purpose and achieves an acceleration factor of around 3.5 by using several PUs. Finally, we give a perspective on the parallelization of some implicit integrators which require multiple corrections in solving implicit formulas like the implicit Hermitian integrators (Makino and Aarseth, 1992), (Hut et al., 1995) or the implicit symmetric multistep methods (Fukushima, 1998), (Fukushima, 1999).
Application of aerial photography to water-related programs in Michigan
NASA Technical Reports Server (NTRS)
Enslin, W. R.; Hill-Rowley, R.; Tilmann, S. E.
1977-01-01
The paper describes the use of aerial photography and information system technology in the provision of information required for the effective operation of three water-related programs in Michigan. Potential mosquito breeding sites were identified from specially acquired low altitude 70 mm color photography for the City of Lansing Vector Control Area. A comprehensive inventory of surface water sources and potential access sites was prepared to assist fire departments in Antrim County with fire truck water-recharge operations. Remotely-sensed land cover/use data for Windsor Township, Eaton County were integrated with other resource data into a computer-based information system for regional water quality studies. Eleven thematic maps specifically focussed on landscape features affecting non-point water pollution and waste disposal were generated from analyses of a four-hectare grid-based data file containing land cover/use, soils, topographic and geologic (well-log) data.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
The Cost of Dengue Vector Control Activities in Malaysia by Different Service Providers.
Packierisamy, P Raviwharmman; Ng, Chiu-Wan; Dahlui, Maznah; Venugopalan, B; Halasa, Yara A; Shepard, Donald S
2015-11-01
We examined variations in dengue vector control costs and resource consumption between the District Health Departments (DHDs) and Local Authorities (LAs) to assist informed decision making as to the future roles of these agencies in the delivery of dengue vector control services in Malaysia. Data were collected from the vector control units of DHDs and LAs in 8 selected districts. We captured costs and resource consumption in 2010 for premise inspection for mosquito breeding sites, fogging to destroy adult mosquitoes and larviciding of potential breeding sites. Overall, DHDs spent US$5.62 million or US$679 per case and LAs spent US$2.61 million or US$499 per case. The highest expenditure for both agencies was for fogging, 51.0% and 45.8% of costs for DHDs and LAs, respectively. The DHDs had higher resource costs for human personnel, vehicles, pesticides, and equipment. The findings provide some evidence to rationalize delivery of dengue vector control services in Malaysia. © 2015 APJPH.
Moore, Amy T.; O'Brien, Valerie A.
2012-01-01
Abstract Invasive species can disrupt natural disease dynamics by altering pathogen transmission among native hosts and vectors. The relatively recent occupancy of cliff swallow (Petrochelidon pyrrhonota) nesting colonies in western Nebraska by introduced European house sparrows (Passer domesticus) has led to yearly increases in the prevalence of an endemic arbovirus, Buggy Creek virus (BCRV), in its native swallow bug (Oeciacus vicarius) vector at sites containing both the invasive sparrow host and the native swallow host. At sites without the invasive host, no long-term changes in prevalence have occurred. The percentage of BCRV isolates exhibiting cytopathicity in Vero-cell culture assays increased significantly with year at sites with sparrows but not at swallow-only sites, suggesting that the virus is becoming more virulent to vertebrates in the presence of the invasive host. Increased BCRV prevalence in bug vectors at mixed-species colonies may reflect high virus replication rates in house sparrow hosts, resulting in frequent virus transmission between sparrows and swallow bugs. This case represents a rare empirical example of a pathogen effectively switching to an invasive host, documented in the early phases of the host's arrival in a specialized ecosystem and illustrating how an invasive species can promote long-term changes in host–parasite transmission dynamics. PMID:21923265
Hydrological and geomorphological controls of malaria transmission
NASA Astrophysics Data System (ADS)
Smith, M. W.; Macklin, M. G.; Thomas, C. J.
2013-01-01
Malaria risk is linked inextricably to the hydrological and geomorphological processes that form vector breeding sites. Yet environmental controls of malaria transmission are often represented by temperature and rainfall amounts, ignoring hydrological and geomorphological influences altogether. Continental-scale studies incorporate hydrology implicitly through simple minimum rainfall thresholds, while community-scale coupled hydrological and entomological models do not represent the actual diversity of the mosquito vector breeding sites. The greatest range of malaria transmission responses to environmental factors is observed at the catchment scale where seemingly contradictory associations between rainfall and malaria risk can be explained by hydrological and geomorphological processes that govern surface water body formation and persistence. This paper extends recent efforts to incorporate ecological factors into malaria-risk models, proposing that the same detailed representation be afforded to hydrological and, at longer timescales relevant for predictions of climate change impacts, geomorphological processes. We review existing representations of environmental controls of malaria and identify a range of hydrologically distinct vector breeding sites from existing literature. We illustrate the potential complexity of interactions among hydrology, geomorphology and vector breeding sites by classifying a range of water bodies observed in a catchment in East Africa. Crucially, the mechanisms driving surface water body formation and destruction must be considered explicitly if we are to produce dynamic spatial models of malaria risk at catchment scales.
A T Matrix Method Based upon Scalar Basis Functions
NASA Technical Reports Server (NTRS)
Mackowski, D.W.; Kahnert, F. M.; Mishchenko, Michael I.
2013-01-01
A surface integral formulation is developed for the T matrix of a homogenous and isotropic particle of arbitrary shape, which employs scalar basis functions represented by the translation matrix elements of the vector spherical wave functions. The formulation begins with the volume integral equation for scattering by the particle, which is transformed so that the vector and dyadic components in the equation are replaced with associated dipole and multipole level scalar harmonic wave functions. The approach leads to a volume integral formulation for the T matrix, which can be extended, by use of Green's identities, to the surface integral formulation. The result is shown to be equivalent to the traditional surface integral formulas based on the VSWF basis.
Roark, E. Brendan; Hamer, Gabriel L.
2017-01-01
The dispersal patterns of mosquito vectors are important drivers of vector-borne infectious disease dynamics and understanding movement patterns is pivotal to devise successful intervention strategies. Here, we investigate the dispersal patterns of two globally important mosquito vectors, Aedes albopictus and Culex quinquefasciatus, by marking naturally-occurring larvae with stable isotopes (13C or 15N). Marked individuals were captured with 32 CDC light trap, 32 gravid trap, and 16 BG Sentinel at different locations within two-kilometer radii of six larval habitats enriched with either 13C or 15N. In total, 720 trap nights from July to August 2013 yielded a total of 32,140 Cx. quinquefasciatus and 7,722 Ae. albopictus. Overall, 69 marked female mosquitoes and 24 marked male mosquitoes were captured throughout the study period. The distance that Cx. quinquefasciatus females traveled differed for host-seeking and oviposition-seeking traps, with females seeking oviposition sites traveling further than those seeking hosts. Our analysis suggests that 41% of Cx. quinquefasciatus females that were host-seeking occurred 1–2 kilometer from their respective natal site, while 59% remained within a kilometer of their natal site. In contrast, 59% of Cx. quinquefasciatus females that were seeking oviposition sites occurred between 1–2 kilometer away from their larval habitat, while 15% occurred > 2 kilometer away from their natal site. Our analysis estimated that approximately 100% of Ae. albopictus females remained within 1 km of their respective natal site, with 79% occurring within 250m. In addition, we found that male Ae. albopictus dispersed farther than females, suggesting male-biased dispersal in this Ae. albopictus population. This study provides important insights on the dispersal patterns of two globally relevant vector species, and will be important in planning next generation vector control strategies that mitigate mosquito-borne disease through sterile insect techniques, novel Wolbachia infection, and gene drive strategies. PMID:28135281
Chang, Chia-Wei; Lai, Yi-Shin; Pawlik, Kevin M; Liu, Kaimao; Sun, Chiao-Wang; Li, Chao; Schoeb, Trenton R; Townes, Tim M
2009-05-01
We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3' long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic "hit and run" vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells.
Schmeisser, Falko; Weir, Jerry P
2007-01-01
Background Targeted mutagenesis of the herpesvirus genomes has been facilitated by the use of bacterial artificial chromosome (BAC) technology. Such modified genomes have potential uses in understanding viral pathogenesis, gene identification and characterization, and the development of new viral vectors and vaccines. We have previously described the construction of a herpes simplex virus 2 (HSV-2) BAC and the use of an allele replacement strategy to construct HSV-2 recombinants. While the BAC mutagenesis procedure is a powerful method to generate HSV-2 recombinants, particularly in the absence of selective marker in eukaryotic culture, the mutagenesis procedure is still difficult and cumbersome. Results Here we describe the incorporation of a phage lambda recombination system into an allele replacement vector. This strategy enables any DNA fragment containing the phage attL recombination sites to be efficiently inserted into the attR sites of the allele replacement vector using phage lambda clonase. We also describe how the incorporation of EGFP into the allele replacement vector can facilitate the selection of the desired cross-over recombinant BACs when the allele replacement reaction is a viral gene deletion. Finally, we incorporate the lambda phage recombination sites directly into an HSV-2 BAC vector for direct recombination of gene cassettes using the phage lambda clonase-driven recombination reaction. Conclusion Together, these improvements to the techniques of HSV BAC mutagenesis will facilitate the construction of recombinant herpes simplex viruses and viral vectors. PMID:17501993
Current Advances and Future Challenges in Adenoviral Vector Biology and Targeting
Campos, Samuel K.; Barry, Michael A.
2008-01-01
Gene delivery vectors based on Adenoviral (Ad) vectors have enormous potential for the treatment of both hereditary and acquired disease. Detailed structural analysis of the Ad virion, combined with functional studies has broadened our knowledge of the structure/function relationships between Ad vectors and host cells/tissues and substantial achievement has been made towards a thorough understanding of the biology of Ad vectors. The widespread use of Ad vectors for clinical gene therapy is compromised by their inherent immunogenicity. The generation of safer and more effective Ad vectors, targeted to the site of disease, has therefore become a great ambition in the field of Ad vector development. This review provides a synopsis of the structure/function relationships between Ad vectors and host systems and summarizes the many innovative approaches towards achieving Ad vector targeting. PMID:17584037
NASA Technical Reports Server (NTRS)
Estes, J. E.; Tinney, L. R. (Principal Investigator); Streich, T.
1981-01-01
The use of digital LANDSAT techniques for monitoring agricultural land use conversions was studied. Two study areas were investigated: one in Ventura County and the other in Fresno County (California). Ventura test site investigations included the use of three dates of LANDSAT data to improve classification performance beyond that previously obtained using single data techniques. The 9% improvement is considered highly significant. Also developed and demonstrated using Ventura County data is an automated cluster labeling procedure, considered a useful example of vertical data integration. Fresno County results for a single data LANDSAT classification paralleled those found in Ventura, demonstrating that the urban/rural fringe zone of most interest is a difficult environment to classify using LANDSAT data. A general raster to vector conversion program was developed to allow LANDSAT classification products to be transferred to an operational county level geographic information system in Fresno.
Genetics and evolution of triatomines: from phylogeny to vector control
Gourbière, S; Dorn, P; Tripet, F; Dumonteil, E
2012-01-01
Triatomines are hemipteran bugs acting as vectors of the protozoan parasite Trypanosoma cruzi. This parasite causes Chagas disease, one of the major parasitic diseases in the Americas. Studies of triatomine genetics and evolution have been particularly useful in the design of rational vector control strategies, and are reviewed here. The phylogeography of several triatomine species is now slowly emerging, and the struggle to reconcile the phenotypic, phylogenetic, ecological and epidemiological species concepts makes for a very dynamic field. Population genetic studies using different markers indicate a wide range of population structures, depending on the triatomine species, ranging from highly fragmented to mobile, interbreeding populations. Triatomines transmit T. cruzi in the context of complex interactions between the insect vectors, their bacterial symbionts and the parasites; however, an integrated view of the significance of these interactions in triatomine biology, evolution and in disease transmission is still lacking. The development of novel genetic markers, together with the ongoing sequencing of the Rhodnius prolixus genome and more integrative studies, will provide key tools to expanding our understanding of these important insect vectors and allow the design of improved vector control strategies. PMID:21897436
Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.
Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo
2015-09-11
We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Macoris, Maria de Lourdes; Martins, Ademir Jesus; Andrighetti, Maria Teresa Macoris; Lima, José Bento Pereira; Valle, Denise
2018-03-01
Aedes aegypti, vector of dengue, chikungunya and Zika viruses, is found at high densities in tropical urban areas. The dissemination of this vector is partially the consequence of failures in current vector control methods, still mainly relying upon insecticides. In the State of São Paulo (SP), Brazil, public health managers employed pyrethroids against Ae. aegypti adults from 1989 to 2000, when a robust insecticide resistance monitoring system detected resistance to pyrethroids in several Ae. aegypti populations. However, pyrethroids are also the preferred compounds engaged in household applications due to their rapid knockdown effect, lower toxicity to mammals and less irritating smell. We evaluated pyrethroid resistance in Ae. aegypti populations over the course of a decade, from 2004 to 2015, after interruption of pyrethroid public applications in SP. Qualitative bioassays with papers impregnated with a deltamethrin diagnostic dose (DD) performed with insects from seven SP municipalities and evaluated yearly from 2006 to 2014, detected resistance in most of the cases. Quantitative bioassays were also carried out with four populations in 2011, suggesting a positive correlation between resistance level and survivorship in the DD bioassays. Biochemical tests conducted with seven insect populations in 2006 and 2015, detected increasing metabolic alterations of all major classes of detoxifying enzymes, mostly of mixed function oxidases. Genotyping of the voltage-gated sodium channel (AaNaV, the pyrethroid target-site) with a TaqMan real time PCR based technique was performed from 2004 to 2014 in all seven localities. The two kdr mutations, Val1016Ile and Phe1534Cys, known to be spread throughout Brazil, were always present with a severe decrease of the susceptible allele over time. These results are discussed in the context of public and domestic insecticide use, the necessity of implementation of a strong integrated vector control strategy and the conceptual misunderstanding between 'vector control' and 'chemical control of vectors'.
Andrighetti, Maria Teresa Macoris; Lima, José Bento Pereira; Valle, Denise
2018-01-01
Background Aedes aegypti, vector of dengue, chikungunya and Zika viruses, is found at high densities in tropical urban areas. The dissemination of this vector is partially the consequence of failures in current vector control methods, still mainly relying upon insecticides. In the State of São Paulo (SP), Brazil, public health managers employed pyrethroids against Ae. aegypti adults from 1989 to 2000, when a robust insecticide resistance monitoring system detected resistance to pyrethroids in several Ae. aegypti populations. However, pyrethroids are also the preferred compounds engaged in household applications due to their rapid knockdown effect, lower toxicity to mammals and less irritating smell. Methodology/Principal findings We evaluated pyrethroid resistance in Ae. aegypti populations over the course of a decade, from 2004 to 2015, after interruption of pyrethroid public applications in SP. Qualitative bioassays with papers impregnated with a deltamethrin diagnostic dose (DD) performed with insects from seven SP municipalities and evaluated yearly from 2006 to 2014, detected resistance in most of the cases. Quantitative bioassays were also carried out with four populations in 2011, suggesting a positive correlation between resistance level and survivorship in the DD bioassays. Biochemical tests conducted with seven insect populations in 2006 and 2015, detected increasing metabolic alterations of all major classes of detoxifying enzymes, mostly of mixed function oxidases. Genotyping of the voltage-gated sodium channel (AaNaV, the pyrethroid target-site) with a TaqMan real time PCR based technique was performed from 2004 to 2014 in all seven localities. The two kdr mutations, Val1016Ile and Phe1534Cys, known to be spread throughout Brazil, were always present with a severe decrease of the susceptible allele over time. Conclusions/Significance These results are discussed in the context of public and domestic insecticide use, the necessity of implementation of a strong integrated vector control strategy and the conceptual misunderstanding between 'vector control' and 'chemical control of vectors'. PMID:29601580
Heading-vector navigation based on head-direction cells and path integration.
Kubie, John L; Fenton, André A
2009-05-01
Insect navigation is guided by heading vectors that are computed by path integration. Mammalian navigation models, on the other hand, are typically based on map-like place representations provided by hippocampal place cells. Such models compute optimal routes as a continuous series of locations that connect the current location to a goal. We propose a "heading-vector" model in which head-direction cells or their derivatives serve both as key elements in constructing the optimal route and as the straight-line guidance during route execution. The model is based on a memory structure termed the "shortcut matrix," which is constructed during the initial exploration of an environment when a set of shortcut vectors between sequential pairs of visited waypoint locations is stored. A mechanism is proposed for calculating and storing these vectors that relies on a hypothesized cell type termed an "accumulating head-direction cell." Following exploration, shortcut vectors connecting all pairs of waypoint locations are computed by vector arithmetic and stored in the shortcut matrix. On re-entry, when local view or place representations query the shortcut matrix with a current waypoint and goal, a shortcut trajectory is retrieved. Since the trajectory direction is in head-direction compass coordinates, navigation is accomplished by tracking the firing of head-direction cells that are tuned to the heading angle. Section 1 of the manuscript describes the properties of accumulating head-direction cells. It then shows how accumulating head-direction cells can store local vectors and perform vector arithmetic to perform path-integration-based homing. Section 2 describes the construction and use of the shortcut matrix for computing direct paths between any pair of locations that have been registered in the shortcut matrix. In the discussion, we analyze the advantages of heading-based navigation over map-based navigation. Finally, we survey behavioral evidence that nonhippocampal, heading-based navigation is used in small mammals and humans. Copyright 2008 Wiley-Liss, Inc.
A New Scheme to Characterize and Identify Protein Ubiquitination Sites.
Nguyen, Van-Nui; Huang, Kai-Yao; Huang, Chien-Hsun; Lai, K Robert; Lee, Tzong-Yi
2017-01-01
Protein ubiquitination, involving the conjugation of ubiquitin on lysine residue, serves as an important modulator of many cellular functions in eukaryotes. Recent advancements in proteomic technology have stimulated increasing interest in identifying ubiquitination sites. However, most computational tools for predicting ubiquitination sites are focused on small-scale data. With an increasing number of experimentally verified ubiquitination sites, we were motivated to design a predictive model for identifying lysine ubiquitination sites for large-scale proteome dataset. This work assessed not only single features, such as amino acid composition (AAC), amino acid pair composition (AAPC) and evolutionary information, but also the effectiveness of incorporating two or more features into a hybrid approach to model construction. The support vector machine (SVM) was applied to generate the prediction models for ubiquitination site identification. Evaluation by five-fold cross-validation showed that the SVM models learned from the combination of hybrid features delivered a better prediction performance. Additionally, a motif discovery tool, MDDLogo, was adopted to characterize the potential substrate motifs of ubiquitination sites. The SVM models integrating the MDDLogo-identified substrate motifs could yield an average accuracy of 68.70 percent. Furthermore, the independent testing result showed that the MDDLogo-clustered SVM models could provide a promising accuracy (78.50 percent) and perform better than other prediction tools. Two cases have demonstrated the effective prediction of ubiquitination sites with corresponding substrate motifs.
Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle
2002-01-01
We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607
Dhimal, Meghnath; Ahrens, Bodo; Kuch, Ulrich
2014-11-28
It is increasingly recognized that climate change can alter the geographical distribution of vector-borne diseases (VBDs) with shifts of disease vectors to higher altitudes and latitudes. In particular, an increasing risk of malaria and dengue fever epidemics in tropical highlands and temperate regions has been predicted in different climate change scenarios. The aim of this paper is to expand the current knowledge on the seasonal occurrence and altitudinal distribution of malaria and other disease vectors in eastern Nepal. Adult mosquitoes resting indoors and outdoors were collected using CDC light trap and aspirators with the support of flash light. Mosquito larvae were collected using locally constructed dippers. We assessed the local residents' perceptions of the distribution and occurrence of mosquitoes using key informant interview techniques. Generalized linear models were fitted to assess the effect of season, resting site and topography on the abundance of malaria vectors. The known malaria vectors in Nepal, Anopheles fluviatilis, Anopheles annularis and Anopheles maculatus complex members were recorded from 70 to 1,820 m above sea level (asl). The vectors of chikungunya and dengue virus, Aedes aegypti and Aedes albopictus, the vector of lymphatic filariasis, Culex quinquefasciatus, and that of Japanese encephalitis, Culex tritaeniorhynchus, were found from 70 to 2,000 m asl in eastern Nepal. Larvae of Anopheles, Culex and Aedes species were recorded up to 2,310 m asl. Only season had a significant effect on the abundance of An. fluviatilis, season and resting site on the abundance of An. maculatus complex members, and season, resting site and topography on the abundance of An. annularis. The perceptions of people on mosquito occurrence are consistent with entomological findings. This study provides the first vertical distribution records of vector mosquitoes in eastern Nepal and suggests that the vectors of malaria and other diseases have already established populations in the highlands due to climatic and other environmental changes. As VBD control programmes have not been focused on the highlands of Nepal, these findings call for actions to start monitoring, surveillance and research on VBDs in these previously disease-free, densely populated and economically important regions.
Can we estimate total magnetization directions from aeromagnetic data using Helbig's integrals?
Phillips, J.D.
2005-01-01
An algorithm that implements Helbig's (1963) integrals for estimating the vector components (mx, my, mz) of tile magnetic dipole moment from the first order moments of the vector magnetic field components (??X, ??Y, ??Z) is tested on real and synthetic data. After a grid of total field aeromagnetic data is converted to vector component grids using Fourier filtering, Helbig's infinite integrals are evaluated as finite integrals in small moving windows using a quadrature algorithm based on the 2-D trapezoidal rule. Prior to integration, best-fit planar surfaces must be removed from the component data within the data windows in order to make the results independent of the coordinate system origin. Two different approaches are described for interpreting the results of the integration. In the "direct" method, results from pairs of different window sizes are compared to identify grid nodes where the angular difference between solutions is small. These solutions provide valid estimates of total magnetization directions for compact sources such as spheres or dipoles, but not for horizontally elongated or 2-D sources. In the "indirect" method, which is more forgiving of source geometry, results of the quadrature analysis are scanned for solutions that are parallel to a specified total magnetization direction.
Song, Xiumei; Wang, Mengfei; Dong, Li
2018-01-01
Peptidoglycan recognition proteins (PGRPs) and commensal microbes mediate pathogen infection outcomes in insect disease vectors. Although PGRP-LD is retained in multiple vectors, its role in host defense remains elusive. Here we report that Anopheles stephensi PGRP-LD protects the vector from malaria parasite infection by regulating gut homeostasis. Specifically, knock down of PGRP-LD (dsLD) increased susceptibility to Plasmodium berghei infection, decreased the abundance of gut microbiota and changed their spatial distribution. This outcome resulted from a change in the structural integrity of the peritrophic matrix (PM), which is a chitinous and proteinaceous barrier that lines the midgut lumen. Reduction of microbiota in dsLD mosquitoes due to the upregulation of immune effectors led to dysregulation of PM genes and PM fragmentation. Elimination of gut microbiota in antibiotic treated mosquitoes (Abx) led to PM loss and increased vectorial competence. Recolonization of Abx mosquitoes with indigenous Enterobacter sp. restored PM integrity and decreased mosquito vectorial capacity. Silencing PGRP-LD in mosquitoes without PM didn’t influence their vector competence. Our results indicate that PGPR-LD protects the gut microbiota by preventing hyper-immunity, which in turn promotes PM structurally integrity. The intact PM plays a key role in limiting P. berghei infection. PMID:29489896
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bricault, Christine A.; Perry, Keith L., E-mail: KLP3@cornell.edu
2013-06-05
In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majoritymore » of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.« less
Madsen, Kristoffer H; Ewald, Lars; Siebner, Hartwig R; Thielscher, Axel
2015-01-01
Field calculations for transcranial magnetic stimulation (TMS) are increasingly implemented online in neuronavigation systems and in more realistic offline approaches based on finite-element methods. They are often based on simplified and/or non-validated models of the magnetic vector potential of the TMS coils. To develop an approach to reconstruct the magnetic vector potential based on automated measurements. We implemented a setup that simultaneously measures the three components of the magnetic field with high spatial resolution. This is complemented by a novel approach to determine the magnetic vector potential via volume integration of the measured field. The integration approach reproduces the vector potential with very good accuracy. The vector potential distribution of a standard figure-of-eight shaped coil determined with our setup corresponds well with that calculated using a model reconstructed from x-ray images. The setup can supply validated models for existing and newly appearing TMS coils. Copyright © 2015 Elsevier Inc. All rights reserved.
Recent Advances in Preclinical Developments Using Adenovirus Hybrid Vectors.
Ehrke-Schulz, Eric; Zhang, Wenli; Gao, Jian; Ehrhardt, Anja
2017-10-01
Adenovirus (Ad)-based vectors are efficient gene-transfer vehicles to deliver foreign DNA into living organisms, offering large cargo capacity and low immunogenicity and genotoxicity. As Ad shows low integration rates of their genomes into host chromosomes, vector-derived gene expression decreases due to continuous cell cycling in regenerating tissues and dividing cell populations. To overcome this hurdle, adenoviral delivery can be combined with mechanisms leading to maintenance of therapeutic DNA and long-term effects of the desired treatment. Several hybrid Ad vectors (AdV) exploiting various strategies for long-term treatment have been developed and characterized. This review summarizes recent developments of preclinical approaches using hybrid AdVs utilizing either the Sleeping Beauty transposase system for somatic integration into host chromosomes or designer nucleases, including transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease for permanent gene editing. Further options on how to optimize these vectors further are discussed, which may lead to future clinical applications of these versatile gene-therapy tools.
Killing-Yano tensors in spaces admitting a hypersurface orthogonal Killing vector
NASA Astrophysics Data System (ADS)
Garfinkle, David; Glass, E. N.
2013-03-01
Methods are presented for finding Killing-Yano tensors, conformal Killing-Yano tensors, and conformal Killing vectors in spacetimes with a hypersurface orthogonal Killing vector. These methods are similar to a method developed by the authors for finding Killing tensors. In all cases one decomposes both the tensor and the equation it satisfies into pieces along the Killing vector and pieces orthogonal to the Killing vector. Solving the separate equations that result from this decomposition requires less computing than integrating the original equation. In each case, examples are given to illustrate the method.
Spatial Variations in Dengue Transmission in Schools in Thailand
Ratanawong, Pitcha; Kittayapong, Pattamaporn; Olanratmanee, Phanthip; Wilder-Smith, Annelies; Byass, Peter; Tozan, Yesim; Dambach, Peter; Quiñonez, Carlos Alberto Montenegro; Louis, Valérie R.
2016-01-01
Background Dengue is an important neglected tropical disease, with more than half of the world’s population living in dengue endemic areas. Good understanding of dengue transmission sites is a critical factor to implement effective vector control measures. Methods A cohort of 1,811 students from 10 schools in rural, semi-rural and semi-urban Thailand participated in this study. Seroconversion data and location of participants’ residences and schools were recorded to determine spatial patterns of dengue infections. Blood samples were taken to confirm dengue infections in participants at the beginning and the end of school term. Entomological factors included a survey of adult mosquito density using a portable vacuum aspirator during the school term and a follow up survey of breeding sites of Aedes vectors in schools after the school term. Clustering analyses were performed to detect spatial aggregation of dengue infections among participants. Results A total of 57 dengue seroconversions were detected among the 1,655 participants who provided paired blood samples. Of the 57 confirmed dengue infections, 23 (40.0%) occurred in students from 6 (6.8%) of the 88 classrooms in 10 schools. Dengue infections did not show significant clustering by residential location in the study area. During the school term, a total of 66 Aedes aegypti mosquitoes were identified from the 278 mosquitoes caught in 50 classrooms of the 10 schools. In a follow-up survey of breeding sites, 484 out of 2,399 water containers surveyed (20.2%) were identified as active mosquito breeding sites. Discussion and Conclusion Our findings suggest that dengue infections were clustered among schools and among classrooms within schools. The schools studied were found to contain a large number of different types of breeding sites. Aedes vector densities in schools were correlated with dengue infections and breeding sites in those schools. Given that only a small proportion of breeding sites in the schools were subjected to vector control measures (11%), this study emphasizes the urgent need to implement vector control strategies at schools, while maintaining efforts at the household level. PMID:27669170
Lara-Silva, Fabiana de Oliveira; Michalsky, Érika Monteiro; Fortes-Dias, Consuelo Latorre; Fiuza, Vanessa de Oliveira Pires; Dias, Edelberto Santos
2017-12-01
Leishmaniases are vector-borne diseases that are transmitted to humans through the bite of Leishmania-infected phlebotomine sand flies (Diptera:Psychodidae). The main proved vector of visceral leishmaniais (VL) in the New World - Lutzomyia longipalpis - is well-adapted to urban areas and has extensive distribution within the five geographical regions of Brazil. Integrated public health actions directed for the vector, domestic reservoir and humans for the control of VL are preferentially applied in municipalities with higher epidemiological risk of transmission. In this study, we evaluated the individual impact of two main vector control actions - chemical spraying and environmental management - in two districts with no reported cases of human VL. Although belonging to an endemic municipality for VL in Brazil, the integrated control actions have not been applied in these districts due to the absence of human cases. The number of L. longipalpis captured in a two-year period was used as indicator of the population density of the vector. After chemical spraying a tendency of reduction in L. longipalpis was observed but with no statistical significance compared to the control. Environmental management was effective in that reduction and it may help in the control of VL by reducing the population density of the vector in a preventive and more permanent action, perhaps associated with chemical spraying. Copyright © 2017 Elsevier B.V. All rights reserved.
Wehmeier, U F
1995-11-07
Four new shuttle vectors for Escherichia coli (Ec) and Streptomyces, pUWL218, pUWL219, pUWL-SK and pUWL-KS, which permit recognition of recombinant (re-) plasmids on XGal plates in Ec, were constructed. These vectors contain the replication functions of the Streptomyces wide-host-range multicopy plasmid pIJ101, the tsr gene conferring resistance to thiostrepton in Streptomyces, the ColEI origin of replication from the pUC plasmids for replication in Ec and the bla gene conferring resistance to ampicillin in Ec. They possess multiple cloning sites with a number of unique restriction sites and allow direct sequencing of re-derivatives using the pUC sequencing primers.
Navigation in wood ants Formica japonica: context dependent use of landmarks.
Fukushi, Tsukasa; Wehner, Rüdiger
2004-09-01
Wood ants Formica japonica can steer their outbound (foraging) and inbound (homing) courses without using celestial compass information, by relying exclusively on landmark cues. This is shown by training ants to run back and forth between the nest and an artificial feeder, and later displacing the trained ants either from the nest (when starting their foraging runs: outbound full-vector ants) or from the feeder (when starting their home runs: inbound full-vector ants) to various nearby release sites. In addition, ants that have already completed their foraging and homing runs are displaced after arrival either at the feeder (outbound zero-vector ants) or at the nest (inbound zero-vector ants), respectively, to the very same release sites. Upon release, the full-vector ants steer their straight courses by referring to panoramic landmark cues, while the zero-vector ants presented with the very same visual scenery immediately search for local landmark cues defining their final goal. Hence, it depends on the context, in this case on the state of the forager's round-trip cycle, what visual cues are picked out from a given set of landmarks and used for navigation.
Yan, Kang K; Zhao, Hongyu; Pang, Herbert
2017-12-06
High-throughput sequencing data are widely collected and analyzed in the study of complex diseases in quest of improving human health. Well-studied algorithms mostly deal with single data source, and cannot fully utilize the potential of these multi-omics data sources. In order to provide a holistic understanding of human health and diseases, it is necessary to integrate multiple data sources. Several algorithms have been proposed so far, however, a comprehensive comparison of data integration algorithms for classification of binary traits is currently lacking. In this paper, we focus on two common classes of integration algorithms, graph-based that depict relationships with subjects denoted by nodes and relationships denoted by edges, and kernel-based that can generate a classifier in feature space. Our paper provides a comprehensive comparison of their performance in terms of various measurements of classification accuracy and computation time. Seven different integration algorithms, including graph-based semi-supervised learning, graph sharpening integration, composite association network, Bayesian network, semi-definite programming-support vector machine (SDP-SVM), relevance vector machine (RVM) and Ada-boost relevance vector machine are compared and evaluated with hypertension and two cancer data sets in our study. In general, kernel-based algorithms create more complex models and require longer computation time, but they tend to perform better than graph-based algorithms. The performance of graph-based algorithms has the advantage of being faster computationally. The empirical results demonstrate that composite association network, relevance vector machine, and Ada-boost RVM are the better performers. We provide recommendations on how to choose an appropriate algorithm for integrating data from multiple sources.
Wolk, C P; Vonshak, A; Kehoe, P; Elhai, J
1984-01-01
Wild-type cyanobacteria of the genus Anabaena are capable of oxygenic photosynthesis, differentiation of cells called heterocysts at semiregular intervals along the cyanobacterial filaments, and aerobic nitrogen fixation by the heterocysts. To foster analysis of the physiological processes characteristic of these cyanobacteria, we have constructed a family of shuttle vectors capable of replication and selection in Escherichia coli and, in unaltered form, in several strains of Anabaena. Highly efficient conjugative transfer of these vectors from E. coli to Anabaena is dependent upon the presence of broad host-range plasmid RP-4 and of helper plasmids. The shuttle vectors contain portions of plasmid pBR322 required for replication and mobilization, with sites for Anabaena restriction enzymes deleted; cyanobacterial replicon pDU1, which lacks such sites; and determinants for resistance to chloramphenicol, streptomycin, neomycin, and erythromycin. Images PMID:6324204
[A longitudinal entomologic survey on the transmission of malaria in Ouagadougou (Burkina Faso)].
Rossi, P; Belli, A; Mancini, L; Sabatinelli, G
1986-04-01
A longitudinal entomological malaria survey was carried out in five zones of the town of Ouagadougou, Burkina Faso, and in three neighbouring villages. The main vector is Anopheles gambiae s.l. with An. funestus having a role in some localities during the dry season. Pyrethrum spray catches were carried out once or twice per month to determine variations in vector density. Inoculation rates were estimated from the number of blood-fed vectors per man and from the sporozoite rates. Larval sampling was routinely carried out all over the urban area in order to map the larval breeding sites. Widely different degrees of malaria transmission were documented in the urban area mainly related to the spatial and temporal distribution of An. gambiae larval breeding sites. Higher inoculation rates, depending both on higher vector densities and sporozoite rates, were documented in the villages.
Blaser, Nicole; Guskov, Sergei I; Entin, Vladimir A; Wolfer, David P; Kanevskyi, Valeryi A; Lipp, Hans-Peter
2014-11-15
The gravity vector theory postulates that birds determine their position to set a home course by comparing the memorized gravity vector at the home loft with the local gravity vector at the release site, and that they should adjust their flight course to the gravity anomalies encountered. As gravity anomalies are often intermingled with geomagnetic anomalies, we released experienced pigeons from the center of a strong circular gravity anomaly (25 km diameter) not associated with magnetic anomalies and from a geophysical control site, equidistant from the home loft (91 km). After crossing the border zone of the anomaly--expected to be most critical for pigeon navigation--they dispersed significantly more than control birds, except for those having met a gravity anomaly en route. These data increase the credibility of the gravity vector hypothesis. © 2014. Published by The Company of Biologists Ltd.
An integrated vector system for cellular studies of phage display-derived peptides.
Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V
2002-09-15
Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.
Some Correlation Functions in Matrix Product Ground States of One-Dimensional Two-State Chains
NASA Astrophysics Data System (ADS)
Shariati, Ahmad; Aghamohammadi, Amir; Fatollahi, Amir H.; Khorrami, Mohammad
2014-04-01
Consider one-dimensional chains with nearest neighbour interactions, for which to each site correspond two independent states (say up and down), and the ground state is a matrix product state. It has been shown [23] that for such systems, the ground states are linear combinations of specific vectors which are essentially direct products of specific numbers of ups and downs, symmetrized in a generalized manner. By a generalized manner, it is meant that the coefficient corresponding to the interchange of states of two sites, in not necessarily plus one or minus one, but a phase which depends on the Hamiltonian and the position of the two sites. Such vectors are characterized by a phase χ, the N-th power of which is one (where N is the number of sites), and an integer. Corresponding to χ, there is another integer M which is the smallest positive integer that χM is one. Two classes of correlation functions for such systems (basically correlation functions for such vectors) are calculated. The first class consists of correlation functions of tensor products of one-site diagonal observables; the second class consists of correlation functions of tensor products of less than M one-site observables (but not necessarily diagonal).
Espinosa, Manuel O; Polop, Francisco; Rotela, Camilo H; Abril, Marcelo; Scavuzzo, Carlos M
2016-11-21
The main objective of this study was to obtain and analyse the space-time dynamics of Aedes aegypti breeding sites in Clorinda City, Formosa Province, Argentina coupled with landscape analysis using the maximum entropy approach in order to generate a dengue vector niche model. In urban areas, without vector control activities, 12 entomologic (larval) samplings were performed during three years (October 2011 to October 2014). The entomologic surveillance area represented 16,511 houses. Predictive models for Aedes distribution were developed using vector breeding abundance data, density analysis, clustering and geoprocessing techniques coupled with Earth observation satellite data. The spatial analysis showed a vector spatial distribution pattern with clusters of high density in the central region of Clorinda with a well-defined high-risk area in the western part of the city. It also showed a differential temporal behaviour among different areas, which could have implications for risk models and control strategies at the urban scale. The niche model obtained for Ae. aegypti, based on only one year of field data, showed that 85.8% of the distribution of breeding sites is explained by the percentage of water supply (48.2%), urban distribution (33.2%), and the percentage of urban coverage (4.4%). The consequences for the development of control strategies are discussed with reference to the results obtained using distribution maps based on environmental variables.
Kaufmann, Kerstin B.; Brendel, Christian; Suerth, Julia D.; Mueller-Kuller, Uta; Chen-Wichmann, Linping; Schwäble, Joachim; Pahujani, Shweta; Kunkel, Hana; Schambach, Axel; Baum, Christopher; Grez, Manuel
2013-01-01
Comparative integrome analysis has revealed that the most neutral integration pattern among retroviruses is attributed to alpharetroviruses. We chose X-linked chronic granulomatous disease (X-CGD) as model to evaluate the potential of self-inactivating (SIN) alpharetroviral vectors for gene therapy of monogenic diseases. Therefore, we combined the alpharetroviral vector backbone with the elongation factor-1α short promoter, both considered to possess a low genotoxic profile, to drive transgene (gp91phox) expression. Following efficient transduction transgene expression was sustained and provided functional correction of the CGD phenotype in a cell line model at low vector copy number. Further analysis in a murine X-CGD transplantation model revealed gene-marking of bone marrow cells and oxidase positive granulocytes in peripheral blood. Transduction of human X-CGD CD34+ cells provided functional correction up to wild-type levels and long-term expression upon transplantation into a humanized mouse model. In contrast to lentiviral vectors, no aberrantly spliced transcripts containing cellular exons fused to alpharetroviral sequences were found in transduced cells, implying that the safety profile of alpharetroviral vectors may extend beyond their neutral integration profile. Taken together, this highlights the potential of this SIN alpharetroviral system as a platform for new candidate vectors for future gene therapy of hematopoietic disorders. PMID:23207695
Severson, David W.; Behura, Susanta K.
2016-01-01
Dengue (DENV), yellow fever, chikungunya, and Zika virus transmission to humans by a mosquito host is confounded by both intrinsic and extrinsic variables. Besides virulence factors of the individual arboviruses, likelihood of virus transmission is subject to variability in the genome of the primary mosquito vector, Aedes aegypti. The “vectorial capacity” of A. aegypti varies depending upon its density, biting rate, and survival rate, as well as its intrinsic ability to acquire, host and transmit a given arbovirus. This intrinsic ability is known as “vector competence”. Based on whole transcriptome analysis, several genes and pathways have been predicated to have an association with a susceptible or refractory response in A. aegypti to DENV infection. However, the functional genomics of vector competence of A. aegypti is not well understood, primarily due to lack of integrative approaches in genomic or transcriptomic studies. In this review, we focus on the present status of genomics studies of DENV vector competence in A. aegypti as limited information is available relative to the other arboviruses. We propose future areas of research needed to facilitate the integration of vector and virus genomics and environmental factors to work towards better understanding of vector competence and vectorial capacity in natural conditions. PMID:27809220
Breeding Sites of Aedes aegypti: Potential Dengue Vectors in Dire Dawa, East Ethiopia
Getachew, Dejene; Tekie, Habte; Gebre-Michael, Teshome; Mesfin, Akalu
2015-01-01
Background and Objectives. Entomological survey was carried out from May-June to September-October 2014 to investigate the presence of dengue vectors in discarded tires and artificial water containers in houses and peridomestic areas. Methods. A cross-sectional immature stage survey was done indoors and outdoors in 301 houses. Mosquito larval sampling was conducted using pipette or dipper depending on container types. Larvae were identified morphologically and larval indices were also calculated. Results. A total of 750 containers were inspected, and of these 405 were positive for mosquito larvae. A total of 1,873 larvae were collected and morphologically identified as Aedes aegypti (n = 1580: 84.4%) and Culex (n = 293: 15.6%). The larval indices, house index, container index, and breteau index, varied from 33.3 to 86.2, from 23.2 to 73.9, and from 56.5 to 188.9, respectively. Conclusion. Aedes aegypti is breeding in a wide range of artificial containers. To control these mosquitoes, the integration of different methods should be taken into consideration. PMID:26435712
A 64-channel ultra-low power system-on-chip for local field and action potentials recording
NASA Astrophysics Data System (ADS)
Rodríguez-Pérez, Alberto; Delgado-Restituto, Manuel; Darie, Angela; Soto-Sánchez, Cristina; Fernández-Jover, Eduardo; Rodríguez-Vázquez, Ángel
2015-06-01
This paper reports an integrated 64-channel neural recording sensor. Neural signals are acquired, filtered, digitized and compressed in the channels. Additionally, each channel implements an auto-calibration mechanism which configures the transfer characteristics of the recording site. The system has two transmission modes; in one case the information captured by the channels is sent as uncompressed raw data; in the other, feature vectors extracted from the detected neural spikes are released. Data streams coming from the channels are serialized by an embedded digital processor. Experimental results, including in vivo measurements, show that the power consumption of the complete system is lower than 330μW.
Alten, Bulent; Maia, Carla; Afonso, Maria Odete; Campino, Lenea; Jiménez, Maribel; González, Estela; Molina, Ricardo; Bañuls, Anne Laure; Prudhomme, Jorian; Vergnes, Baptiste; Toty, Celine; Cassan, Cécile; Rahola, Nil; Thierry, Magali; Sereno, Denis; Bongiorno, Gioia; Bianchi, Riccardo; Khoury, Cristina; Tsirigotakis, Nikolaos; Dokianakis, Emmanouil; Antoniou, Maria; Christodoulou, Vasiliki; Mazeris, Apostolos; Karakus, Mehmet; Ozbel, Yusuf; Arserim, Suha K.; Erisoz Kasap, Ozge; Gunay, Filiz; Oguz, Gizem; Kaynas, Sinan; Tsertsvadze, Nikoloz; Tskhvaradze, Lamzira; Gramiccia, Marina; Volf, Petr; Gradoni, Luigi
2016-01-01
Background The recent geographical expansion of phlebotomine vectors of Leishmania infantum in the Mediterranean subregion has been attributed to ongoing climate changes. At these latitudes, the activity of sand flies is typically seasonal; because seasonal phenomena are also sensitive to general variations in climate, current phenological data sets can provide a baseline for continuing investigations on sand fly population dynamics that may impact on future scenarios of leishmaniasis transmission. With this aim, in 2011–2013 a consortium of partners from eight Mediterranean countries carried out entomological investigations in sites where L. infantum transmission was recently reported. Methods/Principal Findings A common protocol for sand fly collection included monthly captures by CDC light traps, complemented by sticky traps in most of the sites. Collections were replicated for more than one season in order to reduce the effects of local weather events. In each site, the trapping effort was left unchanged throughout the survey to legitimate inter-seasonal comparisons. Data from 99,000 collected specimens were analyzed, resulting in the description of seasonal dynamics of 56,000 sand flies belonging to L. infantum vector species throughout a wide geographical area, namely P. perniciosus (Portugal, Spain and Italy), P. ariasi (France), P. neglectus (Greece), P. tobbi (Cyprus and Turkey), P. balcanicus and P. kandelakii (Georgia). Time of sand fly appearance/disappearance in collections differed between sites, and seasonal densities showed variations in each site. Significant correlations were found between latitude/mean annual temperature of sites and i) the first month of sand fly appearance, that ranged from early April to the first half of June; ii) the type of density trend, varying from a single peak in July/August to multiple peaks increasing in magnitude from May through September. A 3-modal trend, recorded for P. tobbi in Cyprus, represents a novel finding for a L. infantum vector. Adults ended the activity starting from mid September through November, without significant correlation with latitude/mean annual temperature of sites. The period of potential exposure to L.infantum in the Mediterranean subregion, as inferred by adult densities calculated from 3 years, 37 sites and 6 competent vector species, was associated to a regular bell-shaped density curve having a wide peak center encompassing the July-September period, and falling between early May to late October for more than 99% of values. Apparently no risk for leishmaniasis transmission took place from December through March in the years considered. We found a common pattern of nocturnal females activity, whose density peaked between 11 pm and 2 am. Conclusions Despite annual variations, multiple collections performed over consecutive years provided homogeneous patterns of the potential behavior of leishmaniasis vectors in selected sites, which we propose may represent sentinel areas for future monitoring. In the investigated years, higher potential risk for L. infantum transmission in the Mediterranean was identified in the June-October period (97% relative vector density), however such risk was not equally distributed throughout the region, since density waves of adults occurred earlier and were more frequent in southern territories. PMID:26900688
Niang, El Hadji Amadou; Konaté, Lassana; Diallo, Mawlouth; Faye, Ousmane; Dia, Ibrahima
2016-02-05
Malaria vector control in Africa relies on insecticides targeting adult mosquito vectors via insecticide treated nets or indoor residual spraying. Despite the proven efficacy of these strategies, the emergence and rapid rise in insecticide resistance in malaria vectors raises many concerns about their sustainability. Therefore, the monitoring of insecticide resistance is essential for resistance management strategies implementation. We investigated the kdr mutation frequencies in 20 sympatric sites of An. arabiensis Patton, An. coluzzii Coetzee & Wilkerson and An. gambiae Giles and its importance in malaria vector control by evaluating the susceptibility to insecticides in four representative sites in Senegal. Sibling species identification and kdr mutation detection were determined using polymerase chain reaction on mosquitoes collected using pyrethrum sprays collection in 20 sites belonging to two transects with differential insecticide selection pressure. The World Health Organization (WHO) tube test was used to determine phenotypic resistance of An. gambiae s.l. to DDT, deltamethrin, lambdacyholothrin, permethrin, bendiocarb and malathion in four representative sites. The L1014F kdr mutation was widely distributed and was predominant in An. gambiae in comparison to An. arabiensis and An. coluzzii. The bioassay tests showed a general trend with a resistance to DDT and pyrethroids and a susceptibility to organophosphate and carbamate according to WHO thresholds. For deltamethrin and permethrin, the two most used insecticides, no significant difference were observed either between the two transects or between mortality rates suggesting no differential selection pressures on malaria vectors. The study of the KD times showed similar trends as comparable levels of resistance were observed, the effect being more pronounced for permethrin. Our study showed a widespread resistance of malaria vectors to DDT and pyrethroids and a widespread distribution of the 1014F kdr allele. These combined observations could suggest the involvement of the kdr mutation. The existence of other resistance mechanisms could not be ruled out as a proportion of mosquitoes did not harbour the kdr allele whereas the populations were fully resistant. The susceptibility to carbamate and organophosphate could be exploited as alternative for insecticide resistance management.
Valença-Barbosa, Carolina; Lima, Marli M.; Sarquis, Otília; Bezerra, Claudia M.; Abad-Franch, Fernando
2014-01-01
Background Understanding the drivers of habitat selection by insect disease vectors is instrumental to the design and operation of rational control-surveillance systems. One pervasive yet often overlooked drawback of vector studies is that detection failures result in some sites being misclassified as uninfested; naïve infestation indices are therefore biased, and this can confound our view of vector habitat preferences. Here, we present an initial attempt at applying methods that explicitly account for imperfect detection to investigate the ecology of Chagas disease vectors in man-made environments. Methodology We combined triplicate-sampling of individual ecotopes (n = 203) and site-occupancy models (SOMs) to test a suite of pre-specified hypotheses about habitat selection by Triatoma brasiliensis. SOM results were compared with those of standard generalized linear models (GLMs) that assume perfect detection even with single bug-searches. Principal Findings Triatoma brasiliensis was strongly associated with key hosts (native rodents, goats/sheep and, to a lesser extent, fowl) in peridomestic environments; ecotope structure had, in comparison, small to negligible effects, although wooden ecotopes were slightly preferred. We found evidence of dwelling-level aggregation of infestation foci; when there was one such focus, same-dwelling ecotopes, whether houses or peridomestic structures, were more likely to become infested too. GLMs yielded negatively-biased covariate effect estimates and standard errors; both were, on average, about four times smaller than those derived from SOMs. Conclusions/Significance Our results confirm substantial population-level ecological heterogeneity in T. brasiliensis. They also suggest that, at least in some sites, control of this species may benefit from peridomestic rodent control and changes in goat/sheep husbandry practices. Finally, our comparative analyses highlight the importance of accounting for the various sources of uncertainty inherent to vector studies, including imperfect detection. We anticipate that future research on infectious disease ecology will increasingly rely on approaches akin to those described here. PMID:24811125
Practical Integration-Free Episomal Methods for Generating Human Induced Pluripotent Stem Cells.
Kime, Cody; Rand, Tim A; Ivey, Kathryn N; Srivastava, Deepak; Yamanaka, Shinya; Tomoda, Kiichiro
2015-10-06
The advent of induced pluripotent stem (iPS) cell technology has revolutionized biomedicine and basic research by yielding cells with embryonic stem (ES) cell-like properties. The use of iPS-derived cells for cell-based therapies and modeling of human disease holds great potential. While the initial description of iPS cells involved overexpression of four transcription factors via viral vectors that integrated within genomic DNA, advances in recent years by our group and others have led to safer and higher quality iPS cells with greater efficiency. Here, we describe commonly practiced methods for non-integrating induced pluripotent stem cell generation using nucleofection of episomal reprogramming plasmids. These methods are adapted from recent studies that demonstrate increased hiPS cell reprogramming efficacy with the application of three powerful episomal hiPS cell reprogramming factor vectors and the inclusion of an accessory vector expressing EBNA1. Copyright © 2015 John Wiley & Sons, Inc.
Dumonteil, Eric; Nouvellet, Pierre; Rosecrans, Kathryn; Ramirez-Sierra, Maria Jesus; Gamboa-León, Rubi; Cruz-Chan, Vladimir; Rosado-Vallado, Miguel; Gourbière, Sébastien
2013-01-01
Chagas disease is a vector-borne disease of major importance in the Americas. Disease prevention is mostly limited to vector control. Integrated interventions targeting ecological, biological and social determinants of vector-borne diseases are increasingly used for improved control. We investigated key factors associated with transient house infestation by T. dimidiata in rural villages in Yucatan, Mexico, using a mixed modeling approach based on initial null-hypothesis testing followed by multimodel inference and averaging on data from 308 houses from three villages. We found that the presence of dogs, chickens and potential refuges, such as rock piles, in the peridomicile as well as the proximity of houses to vegetation at the periphery of the village and to public light sources are major risk factors for infestation. These factors explain most of the intra-village variations in infestation. These results underline a process of infestation distinct from that of domiciliated triatomines and may be used for risk stratification of houses for both vector surveillance and control. Combined integrated vector interventions, informed by an Ecohealth perspective, should aim at targeting several of these factors to effectively reduce infestation and provide sustainable vector control.
Development of disease-resistant marker-free tomato by R/RS site-specific recombination.
Khan, Raham Sher; Nakamura, Ikuo; Mii, Masahiro
2011-06-01
The selection marker genes, imparting antibiotic or herbicide resistance, in the final transgenics have been criticized by the public and considered a hindrance in their commercialization. Multi-auto-transformation (MAT) vector system has been one of the strategies to produce marker-free transgenic plants without using selective chemicals and plant growth regulators (PGRs). In the study reported here, isopentenyltransferase (ipt) gene was used as a selection marker and wasabi defensin (WD) gene, isolated from Wasabia japonica as a target gene. WD was cloned from the binary vector, pEKH-WD to an ipt-type MAT vector, pMAT21 by gateway cloning and transferred to Agrobacterium tumefaciens strain EHA105. Infected cotyledons of tomato cv. Reiyo were cultured on PGR- and antibiotic-free MS medium. Adventitious shoots were developed by the explants infected with the pMAT21/wasabi defensin. The same PGR- and antibiotic-free MS medium was used in subcultures of the adventitious shoot lines (ASLs) to produce ipt and normal shoots. Approximately, 6 months after infection morphologically normal shoots were produced. Molecular analyses of the developed shoots confirmed the integration of gene of interest (WD) and excision of the selection marker (ipt). Expression of WD was confirmed by Northern blot and Western blot analyses. The marker-free transgenic plants exhibited enhanced resistance against Botrytis cinerea (gray mold), Alternaria solani (early blight), Fusarium oxysporum (Fusarium wilt) and Erysiphe lycopersici (powdery mildew).
Okia, Michael; Okui, Peter; Lugemwa, Myers; Govere, John M; Katamba, Vincent; Rwakimari, John B; Mpeka, Betty; Chanda, Emmanuel
2016-04-14
Integrated vector management (IVM) is the recommended approach for controlling some vector-borne diseases (VBD). In the face of current challenges to disease vector control, IVM is vital to achieve national targets set for VBD control. Though global efforts, especially for combating malaria, now focus on elimination and eradication, IVM remains useful for Uganda which is principally still in the control phase of the malaria continuum. This paper outlines the processes undertaken to consolidate tactical planning and implementation frameworks for IVM in Uganda. The Uganda National Malaria Control Programme with its efforts to implement an IVM approach to vector control was the 'case' for this study. Integrated management of malaria vectors in Uganda remained an underdeveloped component of malaria control policy. In 2012, knowledge and perceptions of malaria vector control policy and IVM were assessed, and recommendations for a specific IVM policy were made. In 2014, a thorough vector control needs assessment (VCNA) was conducted according to WHO recommendations. The findings of the VCNA informed the development of the national IVM strategic guidelines. Information sources for this study included all available data and accessible archived documentary records on VBD control in Uganda. The literature was reviewed and adapted to the local context and translated into the consolidated tactical framework. WHO recommends implementation of IVM as the main strategy to vector control and has encouraged member states to adopt the approach. However, many VBD-endemic countries lack IVM policy frameworks to guide implementation of the approach. In Uganda most VBD coexists and could be managed more effectively if done in tandem. In order to successfully control malaria and other VBD and move towards their elimination, the country needs to scale up proven and effective vector control interventions and also learn from the experience of other countries. The IVM strategy is important in consolidating inter-sectoral collaboration and coordination and providing the tactical direction for effective deployment of vector control interventions along the five key elements of the approach and to align them with contemporary epidemiology of VBD in the country. Uganda has successfully established an evidence-based IVM approach and consolidated strategic planning and operational frameworks for VBD control. However, operating implementation arrangements as outlined in the national strategic guidelines for IVM and managing insecticide resistance, as well as improving vector surveillance, are imperative. In addition, strengthened information, education and communication/behaviour change and communication, collaboration and coordination will be crucial in scaling up and using vector control interventions.
NASA Technical Reports Server (NTRS)
Goorjian, Peter M.; Silberberg, Yaron; Kwak, Dochan (Technical Monitor)
1994-01-01
This paper will present results in computational nonlinear optics. An algorithm will be described that solves the full vector nonlinear Maxwell's equations exactly without the approximations that are currently made. Present methods solve a reduced scalar wave equation, namely the nonlinear Schrodinger equation, and neglect the optical carrier. Also, results will be shown of calculations of 2-D electromagnetic nonlinear waves computed by directly integrating in time the nonlinear vector Maxwell's equations. The results will include simulations of 'light bullet' like pulses. Here diffraction and dispersion will be counteracted by nonlinear effects. The time integration efficiently implements linear and nonlinear convolutions for the electric polarization, and can take into account such quantum effects as Kerr and Raman interactions. The present approach is robust and should permit modeling 2-D and 3-D optical soliton propagation, scattering, and switching directly from the full-vector Maxwell's equations.
Gene Therapy with the Sleeping Beauty Transposon System.
Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán
2017-11-01
The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Goorjian, Peter M.; Silberberg, Yaron; Kwak, Dochan (Technical Monitor)
1995-01-01
This paper will present results in computational nonlinear optics. An algorithm will be described that solves the full vector nonlinear Maxwell's equations exactly without the approximations that we currently made. Present methods solve a reduced scalar wave equation, namely the nonlinear Schrodinger equation, and neglect the optical carrier. Also, results will be shown of calculations of 2-D electromagnetic nonlinear waves computed by directly integrating in time the nonlinear vector Maxwell's equations. The results will include simulations of 'light bullet' like pulses. Here diffraction and dispersion will be counteracted by nonlinear effects. The time integration efficiently implements linear and nonlinear convolutions for the electric polarization, and can take into account such quantum effects as Karr and Raman interactions. The present approach is robust and should permit modeling 2-D and 3-D optical soliton propagation, scattering, and switching directly from the full-vector Maxwell's equations.
Dieng, Hamady; Satho, Tomomitsu; Suradi, Nur Farrahana Binti; Hakim, Hafijah; Abang, Fatimah; Aliasan, Nur Ezzati; Miake, Fumio; Zuharah, Wan Fatma; Kassim, Nur Faeza A; Majid, Abdul Hafiz A; Fadzly, Nik; Vargas, Ronald E Morales; Morales, Noppawan P; Noweg, Gabriel Tonga
2017-12-01
In dengue vector control, attempts to minimize or replace the use of pesticides have mostly involved use of predators, but success has been severely impeded by difficulties associated with financial and environmental costs, predator mass production, and persistence in target habitats. Visual deterrents have been used successfully to control animal pests, in some cases in an effort to replace pesticide use. Despite evidence that visual signals are crucial in site choice for egg deposition by dengue vectors, and that female mosquitoes respond to artificial predation, the role of predator intimidation as it affects the oviposition behavior of dengue vectors remains largely unexplored. Here, we examined the oviposition responses of Aedes aegypti exposed to various mosquito predator pictures. Gravid females were presented with equal opportunities to oviposit in two cups with predator images [Toxorhynchites splendens-TXI, Goldfish (Carassius auratus)-small (SFI) and large (LFI) and Tx. splendens+Goldfish-TXFI] and two others without pictures. Differences in egg deposition were examined between sites with and without these images. When given a chance to oviposit in cups with and without TXI, Ae. aegypti females were similarly attracted to both sites. When provided an opportunity to oviposit in cups displaying pictures of fish (SFI or LFI) and blank cups, egg deposition rates were much lower in the fish picture sites. Females showed a preference for blank cups over TXFI for egg deposition. They also equally avoided cups with pictures of fish, regardless of the size of the picture. Our results indicate that the presence of images of goldfish and their association with Tx. larvae significantly reduced egg deposition by Ae. aegypti, and this was not the case with the predatory larvae alone. The observations that the images of natural predators can repel gravid females of a dengue vector provide novel possibilities to develop effective and inexpensive alternative tools to harmful insecticides. Copyright © 2017 Elsevier B.V. All rights reserved.
Marina, Carlos F; Bond, J Guillermo; Casas, Mauricio; Muñoz, José; Orozco, Arnoldo; Valle, Javier; Williams, Trevor
2011-01-01
Field trials were conducted during the wet and dry seasons in periurban and semi-rural cemeteries in southern Mexico to determine the efficacy of a suspension concentrate formulation of spinosad (Tracer 480SC) on the inhibition of development of Aedes albopictus L. and Ae. aegypti Skuse. For this, oviposition traps were treated with spinosad (1 or 5 mg L(-1)), Bacillus thuringiensis israelensis (Bti, VectoBac 12AS), a sustained release formulation of temephos and a water control. Ae. albopictus was subordinate to Ae. aegypti during the dry season, but became dominant or codominant during the wet season at both sites. The two species could not be differentiated in field counts on oviposition traps. Mean numbers of larvae + pupae of Aedes spp. in Bti-treated containers were similar to the control at both sites during both seasons. The duration of complete absence of aquatic stages varied from 5 to 13 weeks for the spinosad treatments and from 6 to 9 weeks for the temephos treatment, depending on site, season and product concentration. Predatory Toxorhynchites theobaldi Dyar and Knab suffered low mortality in control and Bti treatments, but high mortality in spinosad and temephos treatments. Egg counts and percentage of egg hatch of Aedes spp. increased significantly between the dry and wet seasons, but significant treatment differences were not detected. Temephos granules and a suspension concentrate formulation of spinosad were both highly effective larvicides against Ae. aegypti and Ae. albopictus. These compounds merit detailed evaluation for inclusion in integrated control programs targeted at Ae. aegypti and Ae. albopictus in regions where they represent important vectors of human diseases. Copyright © 2010 Society of Chemical Industry.
Generalized vector calculus on convex domain
NASA Astrophysics Data System (ADS)
Agrawal, Om P.; Xu, Yufeng
2015-06-01
In this paper, we apply recently proposed generalized integral and differential operators to develop generalized vector calculus and generalized variational calculus for problems defined over a convex domain. In particular, we present some generalization of Green's and Gauss divergence theorems involving some new operators, and apply these theorems to generalized variational calculus. For fractional power kernels, the formulation leads to fractional vector calculus and fractional variational calculus for problems defined over a convex domain. In special cases, when certain parameters take integer values, we obtain formulations for integer order problems. Two examples are presented to demonstrate applications of the generalized variational calculus which utilize the generalized vector calculus developed in the paper. The first example leads to a generalized partial differential equation and the second example leads to a generalized eigenvalue problem, both in two dimensional convex domains. We solve the generalized partial differential equation by using polynomial approximation. A special case of the second example is a generalized isoperimetric problem. We find an approximate solution to this problem. Many physical problems containing integer order integrals and derivatives are defined over arbitrary domains. We speculate that future problems containing fractional and generalized integrals and derivatives in fractional mechanics will be defined over arbitrary domains, and therefore, a general variational calculus incorporating a general vector calculus will be needed for these problems. This research is our first attempt in that direction.
Gottdenker, Nicole L.; Chaves, Luis Fernando; Calzada, José E.; Saldaña, Azael; Carroll, C. Ronald
2012-01-01
Background Anthropogenic land use may influence transmission of multi-host vector-borne pathogens by changing diversity, relative abundance, and community composition of reservoir hosts. These reservoir hosts may have varying competence for vector-borne pathogens depending on species-specific characteristics, such as life history strategy. The objective of this study is to evaluate how anthropogenic land use change influences blood meal species composition and the effects of changing blood meal species composition on the parasite infection rate of the Chagas disease vector Rhodnius pallescens in Panama. Methodology/Principal Findings R. pallescens vectors (N = 643) were collected in different habitat types across a gradient of anthropogenic disturbance. Blood meal species in DNA extracted from these vectors was identified in 243 (40.3%) vectors by amplification and sequencing of a vertebrate-specific fragment of the 12SrRNA gene, and T. cruzi vector infection was determined by pcr. Vector infection rate was significantly greater in deforested habitats as compared to contiguous forests. Forty-two different species of blood meal were identified in R. pallescens, and species composition of blood meals varied across habitat types. Mammals (88.3%) dominated R. pallescens blood meals. Xenarthrans (sloths and tamanduas) were the most frequently identified species in blood meals across all habitat types. A regression tree analysis indicated that blood meal species diversity, host life history strategy (measured as rmax, the maximum intrinsic rate of population increase), and habitat type (forest fragments and peridomiciliary sites) were important determinants of vector infection with T. cruzi. The mean intrinsic rate of increase and the skewness and variability of rmax were positively associated with higher vector infection rate at a site. Conclusions/Significance In this study, anthropogenic landscape disturbance increased vector infection with T. cruzi, potentially by changing host community structure to favor hosts that are short-lived with high reproductive rates. Study results apply to potential environmental management strategies for Chagas disease. PMID:23166846
Tissera, Hasitha; Pannila-Hetti, Nimalka; Samaraweera, Preshila; Weeraman, Jayantha; Palihawadana, Paba; Amarasinghe, Ananda
2016-09-01
Dengue is a leading public health problem in Sri Lanka. All 26 districts and all age groups are affected, with high disease transmission; the estimated average annual incidence is 175/100 000 population. Harnessing the World Health Organization Global strategy for dengue prevention and control, 2012-2020, Sri Lanka has pledged in its National Strategic Framework to achieve a mortality from dengue below 0.1% and to reduce morbidity by 50% (from the average of the last 5 years) by 2020. Turning points in the country's dengue-control programme have been the restructuring and restrategizing of the core functions; this has involved establishment of a separate dengue-control unit to coordinate integrated vector management, and creation of a presidential task force. There has been great progress in disease surveillance, clinical management and vector control. Enhanced real-time surveillance for early warning allows ample preparedness for an outbreak. National guidelines with enhanced diagnostics have significantly improved clinical management of dengue, reducing the case-fatality rate to 0.2%. Proactive integrated vector management, with multisector partnership, has created a positive vector-control environment; however, sustaining this momentum is a challenge. Robust surveillance, evidence-based clinical management, sustainable vector control and effective communication are key strategies that will be implemented to achieve set targets. Improved early detection and a standardized treatment protocol with enhanced diagnostics at all medical care institutions will lead to further reduction in mortality. Making the maximum effort to minimize outbreaks through sustainable vector control in the three dimensions of risk mapping, innovation and risk modification will enable a reduction in morbidity.
Progress toward a circulation atlas for application to coastal water siting problems
NASA Technical Reports Server (NTRS)
Munday, J. C., Jr.; Gordon, H. H.
1978-01-01
Circulation data needed to resolve coastal siting problems are assembled from historical hydrographic and remote sensing studies in the form of a Circulation Atlas. Empirical data are used instead of numerical model simulations to achieve fine resolution and include fronts and convergence zones. Eulerian and Langrangian data are collected, transformed, and combined into trajectory maps and current vector maps as a function of tidal phase and wind vector. Initial Atlas development is centered on the Elizabeth River, Hampton Roads, Virgina.
NASA Technical Reports Server (NTRS)
Gilbertsen, Noreen D.; Belytschko, Ted
1990-01-01
The implementation of a nonlinear explicit program on a vectorized, concurrent computer with shared memory is described and studied. The conflict between vectorization and concurrency is described and some guidelines are given for optimal block sizes. Several example problems are summarized to illustrate the types of speed-ups which can be achieved by reprogramming as compared to compiler optimization.
Ecology and control of dengue vector mosquitoes in Taiwan.
Chen, Y R; Hwang, J S; Guo, Y J
1994-12-01
Due to rapid urbanization, industrialization and social changes in recent years, the use of packing materials and tires has dramatically increased in the Taiwan area. What is more is that some parts of southern Taiwan are short of water resources and water preservation with huge containers becomes part of custom in those areas. Storage water containers, waste vessels and tires are good habitats for Aedes. Meanwhile, some persons traveling to dengue endemic countries bring the dengue disease back to Taiwan. Surveys taken since 1988 show that dengue occurs mainly in the urban and coastal areas where Aedes aegypti is prevalent. This species is the most important, if not the only, vector of dengue in Taiwan. It appears that the types of Aedes breeding have changed quickly. In dengue fever epidemic areas, the most popular breeding sites are ornamental containers (38.8%), storage water containers (30.1%), discarded containers (25.4%), receptacles (3.3%) and water collection in the basement (2.2%). In dengue fever epidemic areas, those building basements, huge water containers, waste vessels and waste tires in open fields are most difficult to clean up and manage and become the most popular Aedes habitats. We established a waste recycling system and promoted a breeding site reduction campaign for waste management, including the application of Temephos in containers to kill larvae. For the drinking water management, fish were released in water containers to prevent larval breeding. It should be mentioned that with the integrated pest control and regular inspections of Aedes larvae in Taiwan the density figures 1, 2-5, and 6 or above for Aedes aegypti were 38.7%, 42.9%, and 18.4%, respectively, in 1988, and in 1993 were 90.8%, 9.2% and 0%. The incidence of dengue fever cases has 98% decreased since 1988. In 1990 and 1993, there was no indigenous cases. We have concluded that integrated pest control is the best and most effective method for dengue fever control, including solid waste and drinking water management.
Pyeon, Hye-Rim; Nah, Hee-Ju; Kang, Seung-Hoon; Choi, Si-Sun; Kim, Eung-Soo
2017-05-31
Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes. To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem clusters of pikromycin biosynthetic gene clusters. The 60 kb pikromycin biosynthetic gene cluster was isolated in a single integration pSBAC vector. Introduction of the pikromycin biosynthetic gene cluster into the pikromycin non-producing strains resulted in higher pikromycin production. The utility of the pSBAC system as a precise cloning tool for large-sized biosynthetic gene clusters was verified through heterologous expression of the pikromycin biosynthetic gene cluster. Moreover, this pSBAC-driven heterologous expression strategy was confirmed to be an ideal approach for production of low and inconsistent natural products such as pikromycin in S. venezuelae, implying that this strategy could be employed for development of a custom overexpression scheme of natural product biosynthetic gene clusters in actinomycetes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, X; Yang, D
Purpose: To investigate the method to automatically recognize the treatment site in the X-Ray portal images. It could be useful to detect potential treatment errors, and to provide guidance to sequential tasks, e.g. automatically verify the patient daily setup. Methods: The portal images were exported from MOSAIQ as DICOM files, and were 1) processed with a threshold based intensity transformation algorithm to enhance contrast, and 2) where then down-sampled (from 1024×768 to 128×96) by using bi-cubic interpolation algorithm. An appearance-based vector space model (VSM) was used to rearrange the images into vectors. A principal component analysis (PCA) method was usedmore » to reduce the vector dimensions. A multi-class support vector machine (SVM), with radial basis function kernel, was used to build the treatment site recognition models. These models were then used to recognize the treatment sites in the portal image. Portal images of 120 patients were included in the study. The images were selected to cover six treatment sites: brain, head and neck, breast, lung, abdomen and pelvis. Each site had images of the twenty patients. Cross-validation experiments were performed to evaluate the performance. Results: MATLAB image processing Toolbox and scikit-learn (a machine learning library in python) were used to implement the proposed method. The average accuracies using the AP and RT images separately were 95% and 94% respectively. The average accuracy using AP and RT images together was 98%. Computation time was ∼0.16 seconds per patient with AP or RT image, ∼0.33 seconds per patient with both of AP and RT images. Conclusion: The proposed method of treatment site recognition is efficient and accurate. It is not sensitive to the differences of image intensity, size and positions of patients in the portal images. It could be useful for the patient safety assurance. The work was partially supported by a research grant from Varian Medical System.« less
Otranto, Domenico; Ferroglio, Ezio; Lia, Riccardo P; Traversa, Donato; Rossi, Luca
2003-10-30
Thelazia callipaeda is a spirurid nematode which causes ocular infections in dogs and man and, occasionally, in cats, foxes and rabbits. The intermediate host and vector of T. callipaeda is unknown. For a long time T. callipaeda incidence was reported only from the Russian Federation and the Far East, but recently it has also been found in Italy. In order to investigate the spread of T. callipaeda in Italy, a survey was carried out in two sites, site A in the Piedmont region (North West Italy), and site B in the Basilicata region (Southern Italy). Dogs, cats and foxes in site A and dogs in site B were examined for eyeworms, using different procedures and timing. From January 1995 to August 2002, 91 dogs, 4 cats and 903 fox carcasses were examined in site A, and from October 1999 to January 2003, 443 dogs were examined in site B, and the eyeworms collected were identified using morphological keys. Twenty-one (23.07%) and 185 (41.76%) of the dogs from sites A and B, respectively, were found to be infected by eyeworms; furthermore, all the cats examined and 46 fox carcasses (5.1%) were positive for eyeworms. All the nematodes collected were identified as T. callipaeda. These results indicate that T. callipaeda is not confined to Eastern Europe and Asia, but that it has spread to the Old Continent, and to both Northern and Southern Italy. Considering the high prevalence of infected dogs reported in some municipalities (e.g. 60.14% of 138 dogs examined in a municipality from site B), it is assumed that one or more vectors are significantly present in the areas under investigation. Furthermore, there is good reason to believe that T. callipaeda is also present in other European countries. Speculation as to the origins of this parasitic infestation in Europe and the biology of T. callipaeda and its vector/s is also discussed.
Gurevitz, Juan M.; Ceballos, Leonardo A.; Gaspe, María Sol; Alvarado-Otegui, Julián A.; Enríquez, Gustavo F.; Kitron, Uriel; Gürtler, Ricardo E.
2011-01-01
Background Transmission of Trypanosoma cruzi by Triatoma infestans remains a major public health problem in the Gran Chaco ecoregion, where understanding of the determinants of house infestation is limited. We conducted a cross-sectional study to model factors affecting bug presence and abundance at sites within house compounds in a well-defined rural area in the humid Argentine Chaco. Methodology/Principal Findings Triatoma infestans bugs were found in 45.9% of 327 inhabited house compounds but only in 7.4% of the 2,584 sites inspected systematically on these compounds, even though the last insecticide spraying campaign was conducted 12 years before. Infested sites were significantly aggregated at distances of 0.8–2.5 km. The most frequently infested ecotopes were domiciles, kitchens, storerooms, chicken coops and nests; corrals were rarely infested. Domiciles with mud walls and roofs of thatch or corrugated tarred cardboard were more often infested (32.2%) than domiciles with brick-and-cement walls and corrugated metal-sheet roofs (15.1%). A multi-model inference approach using Akaike's information criterion was applied to assess the relative importance of each variable by running all possible (17,406) models resulting from all combinations of variables. Availability of refuges for bugs, construction with tarred cardboard, and host abundance (humans, dogs, cats, and poultry) per site were positively associated with infestation and abundance, whereas reported insecticide use showed a negative association. Ethnic background (Creole or Toba) adjusted for other factors showed little or no association. Conclusions/Significance Promotion and effective implementation of housing improvement (including key peridomestic structures) combined with appropriate insecticide use and host management practices are needed to eliminate infestations. Fewer refuges are likely to result in fewer residual foci after insecticide spraying, and will facilitate community-based vector surveillance. A more integrated perspective that considers simultaneously social, economic and biological processes at local and regional scales is needed to attain effective, sustainable vector and disease control. PMID:22028941
Gurevitz, Juan M; Ceballos, Leonardo A; Gaspe, María Sol; Alvarado-Otegui, Julián A; Enríquez, Gustavo F; Kitron, Uriel; Gürtler, Ricardo E
2011-10-01
Transmission of Trypanosoma cruzi by Triatoma infestans remains a major public health problem in the Gran Chaco ecoregion, where understanding of the determinants of house infestation is limited. We conducted a cross-sectional study to model factors affecting bug presence and abundance at sites within house compounds in a well-defined rural area in the humid Argentine Chaco. Triatoma infestans bugs were found in 45.9% of 327 inhabited house compounds but only in 7.4% of the 2,584 sites inspected systematically on these compounds, even though the last insecticide spraying campaign was conducted 12 years before. Infested sites were significantly aggregated at distances of 0.8-2.5 km. The most frequently infested ecotopes were domiciles, kitchens, storerooms, chicken coops and nests; corrals were rarely infested. Domiciles with mud walls and roofs of thatch or corrugated tarred cardboard were more often infested (32.2%) than domiciles with brick-and-cement walls and corrugated metal-sheet roofs (15.1%). A multi-model inference approach using Akaike's information criterion was applied to assess the relative importance of each variable by running all possible (17,406) models resulting from all combinations of variables. Availability of refuges for bugs, construction with tarred cardboard, and host abundance (humans, dogs, cats, and poultry) per site were positively associated with infestation and abundance, whereas reported insecticide use showed a negative association. Ethnic background (Creole or Toba) adjusted for other factors showed little or no association. Promotion and effective implementation of housing improvement (including key peridomestic structures) combined with appropriate insecticide use and host management practices are needed to eliminate infestations. Fewer refuges are likely to result in fewer residual foci after insecticide spraying, and will facilitate community-based vector surveillance. A more integrated perspective that considers simultaneously social, economic and biological processes at local and regional scales is needed to attain effective, sustainable vector and disease control.
A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.
Brandenburger, A; Russell, S
1996-10-01
MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.
A new tent trap for monitoring the daily activity of Aedes aegypti and Aedes albopictus.
Casas Martínez, Mauricio; Orozco Bonilla, Arnoldo; Muñoz Reyes, Miguel; Ulloa García, Armando; Bond, J Guillermo; Valle Mora, Javier; Weber, Manuel; Rojas, Julio C
2013-12-01
In this study, we designed a new tent trap; the BioDiVector (BDV) tent trap, consisting of two rectangular tents that use human bait without endangering the technical personnel. The daily activity pattern of Aedes aegypti and Aedes albopictus in intra, peri, and extradomiciliary sites was studied in an endemic area of dengue in southern Mexico by using the BDV tent trap. Totals of 3,128 individuals of Ae. aegypti and 833 Ae. albopictus were captured. More Ae. aegypti males than females were caught, while the opposite was true with Ae. albopictus. The activity of both mosquito species was affected by the interaction between the collection site and time of day. In general, more individuals of both mosquito species were captured at the extradomicillary sites than at the peri and intradomicillary sites. Mosquitoes showed two peaks of activity, one in the morning and the other in the afternoon, but in general this only occurred at the extradomicillary sites, whereas no peak of activity was observed at the intra and peridomicillary sites. Overall, Ae. aegypti had a higher indirect biting rate than Ae. albopictus. Finally, due to its efficiency, simplicity, and low cost, we suggest the use of this innovative tool for entomological surveillance, bionomics and vector incrimination studies in geographical areas where dengue and other arboviruses are present. © 2013 The Society for Vector Ecology.
Gürtler, Ricardo E; Yadon, Zaida E
2015-02-01
This article provides an overview of three research projects which designed and implemented innovative interventions for Chagas disease vector control in Bolivia, Guatemala and Mexico. The research initiative was based on sound principles of community-based ecosystem management (ecohealth), integrated vector management, and interdisciplinary analysis. The initial situational analysis achieved a better understanding of ecological, biological and social determinants of domestic infestation. The key factors identified included: housing quality; type of peridomestic habitats; presence and abundance of domestic dogs, chickens and synanthropic rodents; proximity to public lights; location in the periphery of the village. In Bolivia, plastering of mud walls with appropriate local materials and regular cleaning of beds and of clothes next to the walls, substantially decreased domestic infestation and abundance of the insect vector Triatoma infestans. The Guatemalan project revealed close links between house infestation by rodents and Triatoma dimidiata, and vector infection with Trypanosoma cruzi. A novel community-operated rodent control program significantly reduced rodent infestation and bug infection. In Mexico, large-scale implementation of window screens translated into promising reductions in domestic infestation. A multi-pronged approach including community mobilisation and empowerment, intersectoral cooperation and adhesion to integrated vector management principles may be the key to sustainable vector and disease control in the affected regions. © World Health Organization 2015. The World Health Organization has granted Oxford University Press permission for the reproduction of this article.
Liu, Xia; Li, Tuoping; Hart, Darren J; Gao, Song; Wang, Hongling; Gao, Herui; Xu, Shumin; Zhang, Yifeng; Liu, Yifei; An, Yingfeng
2018-03-18
Currently, the most widely used strategies for molecular cloning are sticky-end ligation-based cloning, TA cloning, blunt-end ligation-based cloning and ligase-independent cloning. In this study we have developed a novel mini-vector pANY1 which can simultaneously meet the requirements of all these cloning strategies. In addition, the selection of appropriate restriction digestion sites is difficult in some cases because of the presence of internal sites. In this study, an annealing of PCR products (APP)-based sticky-end cloning strategy was introduced to avoid this issue. Additionally, false positives occur during molecular cloning, which increases the workload of isolating positive clones. The plasmid pANY1 contains a ccdB cassette between multiple cloning sites, which efficiently avoids these false positives. Therefore, this mini-vector should serve as a useful tool with wide applications in biosciences, agriculture, food technologies, etc. Copyright © 2018 Elsevier Inc. All rights reserved.
Ecological considerations in scrub typhus*
Traub, Robert; Wisseman, Charles L.
1968-01-01
Certain features, characteristic of outbreaks of scrub typhus, can be explained by the behaviour of the chigger vectors which are remarkably hardy and can survive weeks of freezing or immersion in water. The established vectors are all species of the genus Leptotrombidium (Leptotrombidium), i.e., L. (L.) akamushi (Brumpt, 1910), L. (L.) deliense (Walch, 1922), L. (L.) pallidum (Nagayo et al., 1919), and L. (L.) scutellare (Nagayo et al., 1921). These chiggers (i.e. larval mites) infest a broad variety of birds and mammals, and tend to be found in clusters on certain specific sites on the host. However, the precise site for any species of mite varies with the host, and it is believed that the grooming habits of the infested animal account for this “site preference”. The degree of infestation cannot validly be ascribed to the size of the host. L. (L.) pavlovskyi (Schluger, 1948), L. (L.) orientale (Schluger, 1948), L. (L.) arenicola Traub, 1960, and L. (L.) tosa (Sasa & Kowashima, 1951) are regarded as probable vectors. Other species, some belonging to other genera, are under suspicion in this regard. L. (L.) subintermedium (Jameson & Toshioka, 1954) and certain other chiggers were found in “ecological islands” in all montane habitats studied in West Pakistan, despite the intervening high mountains, broad rivers and belts of semi-desert. The infection-rate of Rickettsia tsutsugamushi in vector species in nature is believed to be low, and chiggers may be serving as reservoirs of infection and not just as vectors. PMID:5303405
Killeen, G F; McKenzie, F E; Foy, B D; Schieffelin, C; Billingsley, P F; Beier, J C
2000-05-01
Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other's effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (+/- SD) that are 1.13 +/- 0.37 (range = 0.84-1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education.
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Anomalous Anderson localization
NASA Astrophysics Data System (ADS)
Deng, Wenji
2000-04-01
We propose a generalized Anderson model and study numerically the localization phenomena in one dimension. In our model, not all the sites take on-site random site energy. The on-site energy εn on the nth site is assigned as follows. If n+P-1=0 ( mod P) , where P is a positive integer, εn is assumed to be randomly distributed between - W/2 and W/2. On the other lattice sites, the site energy is fixed, say εn=0.The localization length ξ defined as | t| 2=e -2 L/ ξ, where t is the transmission coefficient, is calculated using the transfer matrix method. It is found that the single-electron states with wave vectors k= π/P, 2 π/P,…,(P-1) π/P are no longer localized as in the standard Anderson model. Compared with the smooth localization length spectrum of the Anderson model, there appear P-1 sharp peaks periodically located at P-1 values of wave vector on the localization length spectrum of the generalized Anderson model with parameter P.
2010-01-01
Background Based on highly successful demonstrations in Israel that attractive toxic sugar bait (ATSB) methods can decimate local populations of mosquitoes, this study determined the effectiveness of ATSB methods for malaria vector control in the semi-arid Bandiagara District of Mali, West Africa. Methods Control and treatment sites, selected along a road that connects villages, contained man-made ponds that were the primary larval habitats of Anopheles gambiae and Anopheles arabiensis. Guava and honey melons, two local fruits shown to be attractive to An. gambiae s.l., were used to prepare solutions of Attractive Sugar Bait (ASB) and ATSB that additionally contained boric acid as an oral insecticide. Both included a color dye marker to facilitate determination of mosquitoes feeding on the solutions. The trial was conducted over a 38-day period, using CDC light traps to monitor mosquito populations. On day 8, ASB solution in the control site and ATSB solution in the treatment site were sprayed using a hand-pump on patches of vegetation. Samples of female mosquitoes were age-graded to determine the impact of ATSB treatment on vector longevity. Results Immediately after spraying ATSB in the treatment site, the relative abundance of female and male An. gambiae s.l. declined about 90% from pre-treatment levels and remained low. In the treatment site, most females remaining after ATSB treatment had not completed a single gonotrophic cycle, and only 6% had completed three or more gonotrophic cycles compared with 37% pre-treatment. In the control site sprayed with ASB (without toxin), the proportion of females completing three or more gonotrophic cycles increased from 28.5% pre-treatment to 47.5% post-treatment. In the control site, detection of dye marker in over half of the females and males provided direct evidence that the mosquitoes were feeding on the sprayed solutions. Conclusion This study in Mali shows that even a single application of ATSB can substantially decrease malaria vector population densities and longevity. It is likely that ATSB methods can be used as a new powerful tool for the control of malaria vectors, particularly since this approach is highly effective for mosquito control, technologically simple, inexpensive, and environmentally safe. PMID:20663142
Vector analogues of the Maggi-Rubinowicz theory of edge diffraction
NASA Astrophysics Data System (ADS)
Meneghini, R.; Shu, P.; Bay, J.
1980-10-01
The Maggi-Rubinowicz technique for scalar and electromagnetic fields is interpreted as a transformation of an integral over an open surface to a line integral around its rim. Maggi-Rubinowicz analogues are found for several vector physical optics representations. For diffraction from a circular aperture, a numerical comparison between these formulations shows the two methods are in agreement. To circumvent certain convergence difficulties in the Maggi-Rubinowicz integrals that occur as the observer approaches the shadow boundary, a variable mesh integration is used. For the examples considered, where the ratio of the aperture diameter to wavelength is about ten, the Maggi-Rubinowicz formulation yields an 8 to 10 fold decrease in computation time relative to the physical optics formulation.
Vector analogues of the Maggi-Rubinowicz theory of edge diffraction
NASA Technical Reports Server (NTRS)
Meneghini, R.; Shu, P.; Bay, J.
1980-01-01
The Maggi-Rubinowicz technique for scalar and electromagnetic fields is interpreted as a transformation of an integral over an open surface to a line integral around its rim. Maggi-Rubinowicz analogues are found for several vector physical optics representations. For diffraction from a circular aperture, a numerical comparison between these formulations shows the two methods are in agreement. To circumvent certain convergence difficulties in the Maggi-Rubinowicz integrals that occur as the observer approaches the shadow boundary, a variable mesh integration is used. For the examples considered, where the ratio of the aperture diameter to wavelength is about ten, the Maggi-Rubinowicz formulation yields an 8 to 10 fold decrease in computation time relative to the physical optics formulation.
Gu, Guiru; Vaillancourt, Jarrod; Lu, Xuejun
2014-10-20
In this paper, we analyze near-field vector components of a metallic circular disk array (MCDA) plasmonic optical antenna and their contribution to quantum dot infrared photodetector (QDIP) enhancement. The near-field vector components of the MCDA optical antenna and their distribution in the QD active region are simulated. The near-field overlap integral with the QD active region is calculated at different wavelengths and compared with the QDIP enhancement spectrum. The x-component (E(x)) of the near-field vector shows a larger intensity overlap integral and stronger correlation with the QDIP enhancement than E(z) and thus is determined to be the major near-field component to the QDIP enhancement.
NASA Technical Reports Server (NTRS)
Ronan, R. S.; Mickey, D. L.; Orrall, F. Q.
1987-01-01
The results of two methods for deriving photospheric vector magnetic fields from the Zeeman effect, as observed in the Fe I line at 6302.5 A at high spectral resolution (45 mA), are compared. The first method does not take magnetooptical effects into account, but determines the vector magnetic field from the integral properties of the Stokes profiles. The second method is an iterative least-squares fitting technique which fits the observed Stokes profiles to the profiles predicted by the Unno-Rachkovsky solution to the radiative transfer equation. For sunspot fields above about 1500 gauss, the two methods are found to agree in derived azimuthal and inclination angles to within about + or - 20 deg.
Advanced Computational Framework for Environmental Management ZEM, Version 1.x
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vesselinov, Velimir V.; O'Malley, Daniel; Pandey, Sachin
2016-11-04
Typically environmental management problems require analysis of large and complex data sets originating from concurrent data streams with different data collection frequencies and pedigree. These big data sets require on-the-fly integration into a series of models with different complexity for various types of model analyses where the data are applied as soft and hard model constraints. This is needed to provide fast iterative model analyses based on the latest available data to guide decision-making. Furthermore, the data and model are associated with uncertainties. The uncertainties are probabilistic (e.g. measurement errors) and non-probabilistic (unknowns, e.g. alternative conceptual models characterizing site conditions).more » To address all of these issues, we have developed an integrated framework for real-time data and model analyses for environmental decision-making called ZEM. The framework allows for seamless and on-the-fly integration of data and modeling results for robust and scientifically-defensible decision-making applying advanced decision analyses tools such as Bayesian- Information-Gap Decision Theory (BIG-DT). The framework also includes advanced methods for optimization that are capable of dealing with a large number of unknown model parameters, and surrogate (reduced order) modeling capabilities based on support vector regression techniques. The framework is coded in Julia, a state-of-the-art high-performance programing language (http://julialang.org). The ZEM framework is open-source and can be applied to any environmental management site. The framework will be open-source and released under GPL V3 license.« less
Remarks towards the spectrum of the Heisenberg spin chain type models
NASA Astrophysics Data System (ADS)
Burdík, Č.; Fuksa, J.; Isaev, A. P.; Krivonos, S. O.; Navrátil, O.
2015-05-01
The integrable close and open chain models can be formulated in terms of generators of the Hecke algebras. In this review paper, we describe in detail the Bethe ansatz for the XXX and the XXZ integrable close chain models. We find the Bethe vectors for two-component and inhomogeneous models. We also find the Bethe vectors for the fermionic realization of the integrable XXX and XXZ close chain models by means of the algebraic and coordinate Bethe ansatz. Special modification of the XXZ closed spin chain model ("small polaron model") is considered. Finally, we discuss some questions relating to the general open Hecke chain models.
Enhancing and targeting nucleic acid delivery by magnetic force.
Plank, Christian; Anton, Martina; Rudolph, Carsten; Rosenecker, Joseph; Krötz, Florian
2003-08-01
Insufficient contact of inherently highly active nucleic acid delivery systems with target cells is a primary reason for their often observed limited efficacy. Physical methods of targeting can overcome this limitation and reduce the risk of undesired side effects due to non-target site delivery. The authors and others have developed a novel means of physical targeting, exploiting magnetic force acting on nucleic acid vectors associated with magnetic particles in order to mediate the rapid contact of vectors with target cells. Here, the principles of magnetic drug and nucleic acid delivery are reviewed, and the facts and potentials of the technique for research and therapeutic applications are discussed. Magnetically enhanced nucleic acid delivery - magnetofection - is universally applicable to viral and non-viral vectors, is extraordinarily rapid, simple and yields saturation level transfection at low dose in vitro. The method is useful for site-specific vector targeting in vivo. Exploiting the full potential of the technique requires an interdisciplinary research effort in magnetic field physics, magnetic particle chemistry, pharmaceutical formulation and medical application.
NASA Technical Reports Server (NTRS)
Robins, A. W.; Beissner, F. L., Jr.; Domack, C. S.; Swanson, E. E.
1985-01-01
A performance study was made of a vertical attitude takeoff and landing (VATOL), supersonic cruise aircraft concept having thrust vectoring integrated into the flight control system. Those characteristics considered were aerodynamics, weight, balance, and performance. Preliminary results indicate that high levels of supersonic aerodynamic performance can be achieved. Further, with the assumption of an advanced (1985 technology readiness) low bypass ratio turbofan engine and advanced structures, excellent mission performance capability is indicated.
Investigation of propagation dynamics of truncated vector vortex beams.
Srinivas, P; Perumangatt, C; Lal, Nijil; Singh, R P; Srinivasan, B
2018-06-01
In this Letter, we experimentally investigate the propagation dynamics of truncated vector vortex beams generated using a Sagnac interferometer. Upon focusing, the truncated vector vortex beam is found to regain its original intensity structure within the Rayleigh range. In order to explain such behavior, the propagation dynamics of a truncated vector vortex beam is simulated by decomposing it into the sum of integral charge beams with associated complex weights. We also show that the polarization of the truncated composite vector vortex beam is preserved all along the propagation axis. The experimental observations are consistent with theoretical predictions based on previous literature and are in good agreement with our simulation results. The results hold importance as vector vortex modes are eigenmodes of the optical fiber.
Dumonteil, Eric; Nouvellet, Pierre; Rosecrans, Kathryn; Ramirez-Sierra, Maria Jesus; Gamboa-León, Rubi; Cruz-Chan, Vladimir; Rosado-Vallado, Miguel; Gourbière, Sébastien
2013-01-01
Background Chagas disease is a vector-borne disease of major importance in the Americas. Disease prevention is mostly limited to vector control. Integrated interventions targeting ecological, biological and social determinants of vector-borne diseases are increasingly used for improved control. Methodology/principal findings We investigated key factors associated with transient house infestation by T. dimidiata in rural villages in Yucatan, Mexico, using a mixed modeling approach based on initial null-hypothesis testing followed by multimodel inference and averaging on data from 308 houses from three villages. We found that the presence of dogs, chickens and potential refuges, such as rock piles, in the peridomicile as well as the proximity of houses to vegetation at the periphery of the village and to public light sources are major risk factors for infestation. These factors explain most of the intra-village variations in infestation. Conclusions/significance These results underline a process of infestation distinct from that of domiciliated triatomines and may be used for risk stratification of houses for both vector surveillance and control. Combined integrated vector interventions, informed by an Ecohealth perspective, should aim at targeting several of these factors to effectively reduce infestation and provide sustainable vector control. PMID:24086790
Factors Contributing to Urban Malaria Transmission in Sub-Saharan Africa: A Systematic Review
De Silva, Prathiba M.; Marshall, John M.
2012-01-01
Sub-Saharan Africa suffers by far the greatest malaria burden worldwide and is currently undergoing a profound demographic change, with a growing proportion of its population moving to urban areas. Urbanisation is generally expected to reduce malaria transmission; however the disease still persists in African cities, in some cases at higher levels than in nearby rural areas. Objective. This paper aims to collate and analyse risk factors for urban malaria transmission throughout sub-Saharan Africa and to discuss their implications for control. Methods. A systematic search on malaria and urbanisation was carried out focusing on sub-Saharan Africa. Particular interest was taken in vector breeding sites in urban and periurban areas. Results. A variety of urban vector breeding sites were catalogued, the majority of which were artificial, including urban agriculture, tyre tracks, and ditches. Natural breeding sites varied according to location. Low socioeconomic status was a significant risk factor for malaria, often present in peri-urban areas. A worrying trend was seen in the adaptation of malaria vector species to the urban environment. Urban malaria is highly focused and control programs should reflect this. Conclusion. As urbanisation continues and vector species adapt, continued monitoring and control of urban malaria in sub-Saharan Africa is essential. PMID:23125863
Dropulic, Boro
2005-07-01
The recent development of leukemia in three patients following retroviral vector gene transfer in hematopoietic stem cells, resulting in the death of one patient, has raised safety concerns for the use of integrating gene transfer vectors for human gene therapy. This review discusses these serious adverse events from the perspective of whether restrictions on vector design and vector-modified target cells are warranted at this time. A case is made against presently establishing specific restrictions for vector design and transduced cells; rather, their safety should be ascertained by empiric evaluation in appropriate preclinical models on a case-by-case basis. Such preclinical data, coupled with proper informed patient consent and a risk-benefit ratio analysis, provide the best available prospective evaluation of gene transfer vectors prior to their translation into the clinic.
Qin, Qian; Li, Yiji; Zhong, Daibin; Zhou, Ning; Chang, Xuelian; Li, Chunyuan; Cui, Liwang; Yan, Guiyun; Chen, Xiao-Guang
2014-03-03
Malaria is one of the most important public health problems in Southeast Asia, including Hainan Island, China. Vector control is the main malaria control measure, and insecticide resistance is a major concern for the effectiveness of chemical insecticide control programs. The objective of this study is to determine the resistance status of the main malaria vector species to pyrethroids and other insecticides recommended by the World Health Organization (WHO) for indoor residual sprays. The larvae and pupae of Anopheles mosquitoes were sampled from multiple sites in Hainan Island, and five sites yielded sufficient mosquitoes for insecticide susceptibility bioassays. Bioassays of female adult mosquitoes three days after emergence were conducted in the two most abundant species, Anopheles sinensis and An. vagus, using three insecticides (0.05% deltamethrin, 4% DDT, and 5% malathion) and following the WHO standard tube assay procedure. P450 monooxygenase, glutathione S-transferase and carboxylesterase activities were measured. Mutations at the knockdown resistance (kdr) gene and the ace-1 gene were detected by DNA sequencing and PCR-RFLP analysis, respectively. An. sinensis and An. vagus were the predominant Anopheles mosquito species. An. sinensis was found to be resistant to DDT and deltamethrin. An. vagus was susceptible to deltamethrin but resistant to DDT and malathion. Low kdr mutation (L1014F) frequency (<10%) was detected in An. sinensis, but no kdr mutation was detected in An. vagus populations. Modest to high (45%-75%) ace-1 mutation frequency was found in An. sinensis populations, but no ace-1 mutation was detected in An. vagus populations. Significantly higher P450 monooxygenase and carboxylesterase activities were detected in deltamethrin-resistant An. sinensis, and significantly higher P450 monooxygenase, glutathione S-transferase and carboxylesterase activities were found in malathion-resistant An. vagus mosquitoes. Multiple insecticide resistance was found in An. sinensis and An. vagus in Hainan Island, a malaria-endemic area of China. Cost-effective integrated vector control programs that go beyond synthetic insecticides are urgently needed.
2013-01-01
Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834
Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs
2013-08-20
Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Global Positioning Systems (GPS) Technology to Study Vector-Pathogen-Host Interactions
2012-10-26
viruses and vectors isolated over different geographic regions promote understanding of virus-vector co-evolution and the impact on dengue virus...AFRIMS Virology field site in KPP to be a participant in a regional phase 3 dengue vaccine efficacy trial. The trial is scheduled to begin in 2Q...important human pathogen producing severe illness known as dengue hemorrhagic fever (DHF). Dengue is considered an emerged global public health
2006-08-15
Programs Section 3. Sampling Equipment Sampling Equipment Solid-State Army Miniature (SSAM) trap ABC style trap Encephalitis Vector Survey Trap CDC...Baseline Survey - these are conducted to determine the types of vectors and pests occurring in the area of operations, their respective breeding sites...or source habitat, and seasonal activity patterns. Operational Survey - data collected in an operational survey are used specifically to aid pest
Larochelle, Andre; Choi, Uimook; Shou, Yan; Naumann, Nora; Loktionova, Natalia A.; Clevenger, Joshua R.; Krouse, Allen; Metzger, Mark; Donahue, Robert E.; Kang, Elizabeth; Stewart, Clinton; Persons, Derek; Malech, Harry L.; Dunbar, Cynthia E.; Sorrentino, Brian P.
2009-01-01
Major limitations to gene therapy using HSCs are low gene transfer efficiency and the inability of most therapeutic genes to confer a selective advantage on the gene-corrected cells. One approach to enrich for gene-modified cells in vivo is to include in the retroviral vector a drug resistance gene, such as the P140K mutant of the DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT*). We transplanted 5 rhesus macaques with CD34+ cells transduced with lentiviral vectors encoding MGMT* and a fluorescent marker, with or without homeobox B4 (HOXB4), a potent stem cell self-renewal gene. Transgene expression and common integration sites in lymphoid and myeloid lineages several months after transplantation confirmed transduction of long-term repopulating HSCs. However, all animals showed only a transient increase in gene-marked lymphoid and myeloid cells after O6-benzylguanine (BG) and temozolomide (TMZ) administration. In 1 animal, cells transduced with MGMT* lentiviral vectors were protected and expanded after multiple courses of BG/TMZ, providing a substantial increase in the maximum tolerated dose of TMZ. Additional cycles of chemotherapy using 1,3-bis-(2-chloroethyl)-1-nitrosourea (BCNU) resulted in similar increases in gene marking levels, but caused high levels of nonhematopoietic toxicity. Inclusion of HOXB4 in the MGMT* vectors resulted in no substantial increase in gene marking or HSC amplification after chemotherapy treatment. Our data therefore suggest that lentivirally mediated gene transfer in transplanted HSCs can provide in vivo chemoprotection of progenitor cells, although selection of long-term repopulating HSCs was not seen. PMID:19509470
Darwish, Nader Ahmed; Khan, Raham Sher; Ntui, Valentine Otang; Nakamura, Ikuo; Mii, Masahiro
2014-03-01
Marker-free transgenic eggplants, exhibiting enhanced resistance to Alternaria solani , can be generated on plant growth regulators (PGRs)- and antibiotic-free MS medium employing the multi-auto-transformation (MAT) vector, pMAT21 - wasabi defensin , wherein isopentenyl transferase ( ipt ) gene is used as a positive selection marker. Use of the selection marker genes conferring antibiotic or herbicide resistance in transgenic plants has been considered a serious problem for environment and the public. Multi-auto-transformation (MAT) vector system has been one of the tools to excise the selection marker gene and produce marker-free transgenic plants. Ipt gene was used as a selection marker gene. Wasabi defensin gene, isolated from Wasabia japonica (a Japanese horseradish which has been a potential source of antimicrobial proteins), was used as a gene of interest. Wasabi defensin gene was cloned from the binary vector, pEKH-WD, to an ipt-type MAT vector, pMAT21, by gateway cloning technology and transferred to Agrobacterium tumefaciens strain EHA105. Infected cotyledon explants of eggplant were cultured on PGRs- and antibiotic-free MS medium. Extreme shooty phenotype/ipt shoots were produced by the explants infected with the pMAT21-wasabi defensin (WD). The same PGRs- and antibiotic-free MS medium was used in subcultures of the ipt shoots. Subsequently, morphologically normal shoots emerged from the Ipt shoots. Molecular analyses of genomic DNA from transgenic plants confirmed the integration of the WD gene and excision of the selection marker (ipt gene). Expression of the WD gene was confirmed by RT-PCR and Northern blot analyses. In vitro whole plant and detached leaf assay of the marker-free transgenic plants exhibited enhanced resistance against Alternaria solani.
Chorny, Michael; Fishbein, Ilia; Tengood, Jillian E.; Adamo, Richard F.; Alferiev, Ivan S.; Levy, Robert J.
2013-01-01
Gene therapeutic strategies have shown promise in treating vascular disease. However, their translation into clinical use requires pharmaceutical carriers enabling effective, site-specific delivery as well as providing sustained transgene expression in blood vessels. While replication-deficient adenovirus (Ad) offers several important advantages as a vector for vascular gene therapy, its clinical applicability is limited by rapid inactivation, suboptimal transduction efficiency in vascular cells, and serious systemic adverse effects. We hypothesized that novel zinc oleate-based magnetic nanoparticles (MNPs) loaded with Ad would enable effective arterial cell transduction by shifting vector processing to an alternative pathway, protect Ad from inactivation by neutralizing factors, and allow site-specific gene transfer to arteries treated with stent angioplasty using a 2-source magnetic guidance strategy. Ad-loaded MNPs effectively transduced cultured endothelial and smooth muscle cells under magnetic conditions compared to controls and retained capacity for gene transfer after exposure to neutralizing antibodies and lithium iodide, a lytic agent causing disruption of free Ad. Localized arterial gene expression significantly stronger than in control animal groups was demonstrated after magnetically guided MNP delivery in a rat stenting model 2 and 9 d post-treatment, confirming feasibility of using Ad-loaded MNPs to achieve site-specific transduction in stented blood vessels. In conclusion, Ad-loaded MNPs formed by controlled precipitation of zinc oleate represent a novel delivery system, well-suited for efficient, magnetically targeted vascular gene transfer.—Chorny, M., Fishbein, I., Tengood, J. E., Adamo, R. F., Alferiev, I. S., Levy, R. J. Site-specific gene delivery to stented arteries using magnetically guided zinc oleate-based nanoparticles loaded with adenoviral vectors. PMID:23407712
Freed, Leonard A; Cann, Rebecca L
2013-11-01
With climate warming, malaria in humans and birds at upper elevations is an emerging infectious disease because development of the parasite in the mosquito vector and vector life history are both temperature dependent. An enhanced-mosquito-movement model from climate warming predicts increased transmission of malaria at upper elevation sites that are too cool for parasite development in the mosquito vector. We evaluate this model with avian malaria (Plasmodium relictum) at 1,900-m elevation on the Island of Hawaii, with air temperatures too low for sporogony in the vector (Culex quinquefasciatus). On a well-defined site over a 14-year period, 10 of 14 species of native and introduced birds became infected, several epizootics occurred, and the increase in prevalence was driven more by resident species than by mobile species that could have acquired their infections at lower elevations. Greater movement of infectious mosquitoes from lower elevations now permits avian malaria to spread at 1,900 m in Hawaii, in advance of climate warming at that elevation. The increase in malaria at upper elevations due to dispersal of infectious mosquitoes is a real alternative to temperature for the increased incidence of human malaria in tropical highlands.
Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A
2001-04-27
Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.
Which coordinate system for modelling path integration?
Vickerstaff, Robert J; Cheung, Allen
2010-03-21
Path integration is a navigation strategy widely observed in nature where an animal maintains a running estimate, called the home vector, of its location during an excursion. Evidence suggests it is both ancient and ubiquitous in nature, and has been studied for over a century. In that time, canonical and neural network models have flourished, based on a wide range of assumptions, justifications and supporting data. Despite the importance of the phenomenon, consensus and unifying principles appear lacking. A fundamental issue is the neural representation of space needed for biological path integration. This paper presents a scheme to classify path integration systems on the basis of the way the home vector records and updates the spatial relationship between the animal and its home location. Four extended classes of coordinate systems are used to unify and review both canonical and neural network models of path integration, from the arthropod and mammalian literature. This scheme demonstrates analytical equivalence between models which may otherwise appear unrelated, and distinguishes between models which may superficially appear similar. A thorough analysis is carried out of the equational forms of important facets of path integration including updating, steering, searching and systematic errors, using each of the four coordinate systems. The type of available directional cue, namely allothetic or idiothetic, is also considered. It is shown that on balance, the class of home vectors which includes the geocentric Cartesian coordinate system, appears to be the most robust for biological systems. A key conclusion is that deducing computational structure from behavioural data alone will be difficult or impossible, at least in the absence of an analysis of random errors. Consequently it is likely that further theoretical insights into path integration will require an in-depth study of the effect of noise on the four classes of home vectors. Copyright 2009 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Choudhury, A. Ghose; Guha, Partha; Khanra, Barun
2009-10-01
The Darboux integrability method is particularly useful to determine first integrals of nonplanar autonomous systems of ordinary differential equations, whose associated vector fields are polynomials. In particular, we obtain first integrals for a variant of the generalized Raychaudhuri equation, which has appeared in string inspired modern cosmology.
Labenski, Verena; Suerth, Julia D; Barczak, Elke; Heckl, Dirk; Levy, Camille; Bernadin, Ornellie; Charpentier, Emmanuelle; Williams, David A; Fehse, Boris; Verhoeyen, Els; Schambach, Axel
2016-08-01
Primary human T lymphocytes represent an important cell population for adoptive immunotherapies, including chimeric-antigen and T-cell receptor applications, as they have the capability to eliminate non-self, virus-infected and tumor cells. Given the increasing numbers of clinical immunotherapy applications, the development of an optimal vector platform for genetic T lymphocyte engineering, which allows cost-effective high-quality vector productions, remains a critical goal. Alpharetroviral self-inactivating vectors (ARV) have several advantages compared to other vector platforms, including a more random genomic integration pattern and reduced likelihood for inducing aberrant splicing of integrated proviruses. We developed an ARV platform for the transduction of primary human T lymphocytes. We demonstrated functional transgene transfer using the clinically relevant herpes-simplex-virus thymidine kinase variant TK.007. Proof-of-concept of alpharetroviral-mediated T-lymphocyte engineering was shown in vitro and in a humanized transplantation model in vivo. Furthermore, we established a stable, human alpharetroviral packaging cell line in which we deleted the entry receptor (SLC1A5) for RD114/TR-pseudotyped ARVs to prevent superinfection and enhance genomic integrity of the packaging cell line and viral particles. We showed that superinfection can be entirely prevented, while maintaining high recombinant virus titers. Taken together, this resulted in an improved production platform representing an economic strategy for translating the promising features of ARVs for therapeutic T-lymphocyte engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Bates, J. R.; Semazzi, F. H. M.; Higgins, R. W.; Barros, Saulo R. M.
1990-01-01
A vector semi-Lagrangian semi-implicit two-time-level finite-difference integration scheme for the shallow water equations on the sphere is presented. A C-grid is used for the spatial differencing. The trajectory-centered discretization of the momentum equation in vector form eliminates pole problems and, at comparable cost, gives greater accuracy than a previous semi-Lagrangian finite-difference scheme which used a rotated spherical coordinate system. In terms of the insensitivity of the results to increasing timestep, the new scheme is as successful as recent spectral semi-Lagrangian schemes. In addition, the use of a multigrid method for solving the elliptic equation for the geopotential allows efficient integration with an operation count which, at high resolution, is of lower order than in the case of the spectral models. The properties of the new scheme should allow finite-difference models to compete with spectral models more effectively than has previously been possible.
Erraguntla, Madhav; Zapletal, Josef; Lawley, Mark
2017-12-01
The impact of infectious disease on human populations is a function of many factors including environmental conditions, vector dynamics, transmission mechanics, social and cultural behaviors, and public policy. A comprehensive framework for disease management must fully connect the complete disease lifecycle, including emergence from reservoir populations, zoonotic vector transmission, and impact on human societies. The Framework for Infectious Disease Analysis is a software environment and conceptual architecture for data integration, situational awareness, visualization, prediction, and intervention assessment. Framework for Infectious Disease Analysis automatically collects biosurveillance data using natural language processing, integrates structured and unstructured data from multiple sources, applies advanced machine learning, and uses multi-modeling for analyzing disease dynamics and testing interventions in complex, heterogeneous populations. In the illustrative case studies, natural language processing from social media, news feeds, and websites was used for information extraction, biosurveillance, and situation awareness. Classification machine learning algorithms (support vector machines, random forests, and boosting) were used for disease predictions.
Wolfs, Esther; Holvoet, Bryan; Ordovas, Laura; Breuls, Natacha; Helsen, Nicky; Schönberger, Matthias; Raitano, Susanna; Struys, Tom; Vanbilloen, Bert; Casteels, Cindy; Sampaolesi, Maurilio; Van Laere, Koen; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M
2017-10-01
Molecular imaging is indispensable for determining the fate and persistence of engrafted stem cells. Standard strategies for transgene induction involve the use of viral vectors prone to silencing and insertional mutagenesis or the use of nonhuman genes. Methods: We used zinc finger nucleases to induce stable expression of human imaging reporter genes into the safe-harbor locus adeno-associated virus integration site 1 in human embryonic stem cells. Plasmids were generated carrying reporter genes for fluorescence, bioluminescence imaging, and human PET reporter genes. Results: In vitro assays confirmed their functionality, and embryonic stem cells retained differentiation capacity. Teratoma formation assays were performed, and tumors were imaged over time with PET and bioluminescence imaging. Conclusion: This study demonstrates the application of genome editing for targeted integration of human imaging reporter genes in human embryonic stem cells for long-term molecular imaging. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.
Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm
2012-01-01
DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.
Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm
2012-01-01
DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238
Narladkar, B. W.
2018-01-01
Broadly, species of arthropods infesting livestock are grouped into flies (biting and non-biting), fleas, lice (biting and sucking), ticks (soft and hard), and mites (burrowing, non-burrowing, and follicular). Among which, biting and non-biting flies and ticks are the potent vectors for many bacterial, viral, rickettsial, and protozoan diseases. Vectors of livestock are having economic significance on three points (1) direct losses from their bite and annoyance, worries, and psychological disturbances produced during the act of biting and feeding, (2) diseases they transmit, and (3) expenditure incurred for their control. Flies such as Culicoides spp. and Musca spp. and various species of hard ticks play important role in disease transmission in addition to their direct effects. For control of vectors, recent concept of integrated pest management (IPM) provides the best solution and also addresses the problems related to acaricide resistance and environmental protection from hazardous chemicals. However, to successfully implement the concept of IPM, for each vector species, estimation of two monitory benchmarks, i.e., economic injury level (EIL) and economic threshold level (ETL) is essential prerequisite. For many vector species and under several circumstances, estimation of EIL and ETL appears to be difficult. Under such scenario, although may not be exact, an approximate estimate can be accrued by taking into account several criteria such as percent prevalence of vectors in a geographical area, percent losses produced, total livestock population, and current prices of livestock products such as milk, meat, and wool. Method for approximate estimation is first time described and elaborated in the present review article. PMID:29657396
Impact of vectorborne parasitic neglected tropical diseases on child health.
Barry, Meagan A; Murray, Kristy O; Hotez, Peter J; Jones, Kathryn M
2016-07-01
Chagas disease, leishmaniasis, onchocerciasis and lymphatic filariasis are all vectorborne neglected tropical diseases (NTDs) that are responsible for significant disease burden in impoverished children and adults worldwide. As vectorborne parasitic diseases, they can all be targeted for elimination through vector control strategies. Examples of successful vector control programmes for these diseases over the past two decades have included the Southern Cone Initiative against Chagas disease, the Kala-azar Control Scheme against leishmaniasis, the Onchocerciasis Control Programme and the lymphatic filariasis control programme in The Gambia. A common vector control component in all of these programmes is the use of adulticides including dichlorodiphenyltrichloroethane and newer synthetic pyrethroid insecticides against the insect vectors of disease. Household spraying has been used against Chagas disease and leishmaniasis, and insecticide-treated bed nets have helped prevent leishmaniasis and lymphatic filariasis. Recent trends in vector control focus on collaborations between programmes and sectors to achieve integrated vector management that addresses the holistic vector control needs of a community rather than approaching it on a disease-by-disease basis, with the goals of increased efficacy, sustainability and cost-effectiveness. As evidence of vector resistance to currently used insecticide regimens emerges, research to develop new and improved insecticides and novel control strategies will be critical in reducing disease burden. In the quest to eliminate these vectorborne NTDs, efforts need to be made to continue existing control programmes, further implement integrated vector control strategies and stimulate research into new insecticides and control methods. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Helper-dependent adenoviral vectors for liver-directed gene therapy
Brunetti-Pierri, Nicola; Ng, Philip
2011-01-01
Helper-dependent adenoviral (HDAd) vectors devoid of all viral-coding sequences are promising non-integrating vectors for liver-directed gene therapy because they have a large cloning capacity, can efficiently transduce a wide variety of cell types from various species independent of the cell cycle and can result in long-term transgene expression without chronic toxicity. The main obstacle preventing clinical applications of HDAd for liver-directed gene therapy is the host innate inflammatory response against the vector capsid proteins that occurs shortly after intravascular vector administration resulting in acute toxicity, the severity of which is dependent on vector dose. Intense efforts have been focused on elucidating the factors involved in this acute response and various strategies have been investigated to improve the therapeutic index of HDAd vectors. These strategies have yielded encouraging results with the potential for clinical translation. PMID:21470977
Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi
2013-01-01
We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.
Reverse chemical ecology approach for the identification of a mosquito oviposition attractant
USDA-ARS?s Scientific Manuscript database
Pheromones and other semiochemicals play a crucial role in today’s integrated pest and vector management strategies for controlling populations of insects causing loses to agriculture and vectoring diseases to humans. These semiochemicals are typically discovered by bioassay-guided approaches. Here,...
Test aspects of the JPL Viterbi decoder
NASA Technical Reports Server (NTRS)
Breuer, M. A.
1989-01-01
The generation of test vectors and design-for-test aspects of the Jet Propulsion Laboratory (JPL) Very Large Scale Integration (VLSI) Viterbi decoder chip is discussed. Each processor integrated circuit (IC) contains over 20,000 gates. To achieve a high degree of testability, a scan architecture is employed. The logic has been partitioned so that very few test vectors are required to test the entire chip. In addition, since several blocks of logic are replicated numerous times on this chip, test vectors need only be generated for each block, rather than for the entire circuit. These unique blocks of logic have been identified and test sets generated for them. The approach employed for testing was to use pseudo-exhaustive test vectors whenever feasible. That is, each cone of logid is tested exhaustively. Using this approach, no detailed logic design or fault model is required. All faults which modify the function of a block of combinational logic are detected, such as all irredundant single and multiple stuck-at faults.
Bowen, J K; Templeton, M D; Sharrock, K R; Crowhurst, R N; Rikkerink, E H
1995-01-20
The feasibility of performing routine transformation-mediated mutagenesis in Glomerella cingulata was analysed by adopting three one-step gene disruption strategies targeted at the pectin lyase gene pnlA. The efficiencies of disruption following transformation with gene replacement- or gene truncation-disruption vectors were compared. To effect replacement-disruption, G. cingulata was transformed with a vector carrying DNA from the pnlA locus in which the majority of the coding sequence had been replaced by the gene for hygromycin B resistance. Two of the five transformants investigated contained an inactivated pnlA gene (pnlA-); both also contained ectopically integrated vector sequences. The efficacy of gene disruption by transformation with two gene truncation-disruption vectors was also assessed. Both vectors carried at 5' and 3' truncated copy of the pnlA coding sequence, adjacent to the gene for hygromycin B resistance. The promoter sequences controlling the selectable marker differed in the two vectors. In one vector the homologous G. cingulata gpdA promoter controlled hygromycin B phosphotransferase expression (homologous truncation vector), whereas in the second vector promoter elements were from the Aspergillus nidulans gpdA gene (heterologous truncation vector). Following transformation with the homologous truncation vector, nine transformants were analysed by Southern hybridisation; no transformants contained a disrupted pnlA gene. Of nineteen heterologous truncation vector transformants, three contained a disrupted pnlA gene; Southern analysis revealed single integrations of vector sequence at pnlA in two of these transformants. pnlA mRNA was not detected by Northern hybridisation in pnlA- transformants. pnlA- transformants failed to produce a PNLA protein with a pI identical to one normally detected in wild-type isolates by silver and activity staining of isoelectric focussing gels. Pathogenesis on Capsicum and apple was unaffected by disruption of the pnlA gene, indicating that the corresponding gene product, PNLA, is not essential for pathogenicity. Gene disruption is a feasible method for selectively mutating defined loci in G. cingulata for functional analysis of the corresponding gene products.
JPRS Report, Science & Technology, USSR: Earth Sciences
1988-12-06
Vol 24 No 7, Jul 88] 14 Integral Characteristics of Light Scattering by Large Spherical Particles IE. P. Zege, A. A. Kokhanovskiy; IZVESTIYA AKADEMII...economical that the base not contain a grid model, but the initial contours, represented in vector format, in which case it is called a vector DRM. The...information make it possible to display both screen and vector DRM and from these, retrieve contours in the initial format. The automated forest mapping
Community Response to a Public Health Threat-VEE
ERIC Educational Resources Information Center
McDonald, John L.; Vuturo, Anthony F.
1975-01-01
After identifying the mosquito as the Venezuelan equine encephalitis vector, health officials worked with the community to eliminate mosquito breeding sites. By educating the public first, cooperation was received in opening drainage areas and stocking water collection areas with mosquito eating fish to interrupt the host-vector-recipient cycle.…
Jia, Cangzhi; Zuo, Yun; Zou, Quan; Hancock, John
2018-02-06
Protein O-GlcNAcylation (O-GlcNAc) is an important post-translational modification of serine (S)/threonine (T) residues that involves multiple molecular and cellular processes. Recent studies have suggested that abnormal O-G1cNAcylation causes many diseases, such as cancer and various neurodegenerative diseases. With the available protein O-G1cNAcylation sites experimentally verified, it is highly desired to develop automated methods to rapidly and effectively identify O-G1cNAcylation sites. Although some computational methods have been proposed, their performance has been unsatisfactory, particularly in terms of prediction sensitivity. In this study, we developed an ensemble model O-GlcNAcPRED-II to identify potential O-G1cNAcylation sites. A K-means principal component analysis oversampling technique (KPCA) and fuzzy undersampling method (FUS) were first proposed and incorporated to reduce the proportion of the original positive and negative training samples. Then, rotation forest, a type of classifier-integrated system, was adopted to divide the eight types of feature space into several subsets using four sub-classifiers: random forest, k-nearest neighbour, naive Bayesian and support vector machine. We observed that O-GlcNAcPRED-II achieved a sensitivity of 81.05%, specificity of 95.91%, accuracy of 91.43% and Matthew's correlation coefficient of 0.7928 for five-fold cross-validation run 10 times. Additionally, the results obtained by O-GlcNAcPRED-II on two independent datasets also indicated that the proposed predictor outperformed five published prediction tools. http://121.42.167.206/OGlcPred/. cangzhijia@dlmu.edu.cn or zouquan@nclab.net. © The Author (2018). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
USDA-ARS?s Scientific Manuscript database
A series of Wheat streak mosaic virus (WSMV)-based expression vectors were developed by engineering cycle 3 GFP (GFP) cistron between P1 and HC-Pro cistrons with several catalytic/cleavage peptides at the C-terminus of GFP. WSMV-GFP vectors with the Foot-and-mouth disease virus 1D/2A or 2A catalytic...
Aslan, Hamide; Dey, Ranadhir; Meneses, Claudio; Castrovinci, Philip; Jeronimo, Selma Maria Bezerra; Oliva, Gætano; Fischer, Laurent; Duncan, Robert C.; Nakhasi, Hira L.; Valenzuela, Jesus G.; Kamhawi, Shaden
2013-01-01
Background. Visceral leishmaniasis (VL) is transmitted by sand flies. Protection of needle-challenged vaccinated mice was abrogated in vector-initiated cutaneous leishmaniasis, highlighting the importance of developing natural transmission models for VL. Methods. We used Lutzomyia longipalpis to transmit Leishmania infantum or Leishmania donovani to hamsters. Vector-initiated infections were monitored and compared with intracardiac infections. Body weights were recorded weekly. Organ parasite loads and parasite pick-up by flies were assessed in sick hamsters. Results. Vector-transmitted L. infantum and L. donovani caused ≥5-fold increase in spleen weight compared with uninfected organs and had geometric mean parasite loads (GMPL) comparable to intracardiac inoculation of 107–108 parasites, although vector-initiated disease progression was slower and weight loss was greater. Only vector-initiated L. infantum infections caused cutaneous lesions at transmission and distal sites. Importantly, 45.6%, 50.0%, and 33.3% of sand flies feeding on ear, mouth, and testicular lesions, respectively, were parasite-positive. Successful transmission was associated with a high mean percent of metacyclics (66%–82%) rather than total GMPL (2.0 × 104–8.0 × 104) per midgut. Conclusions. This model provides an improved platform to study initial immune events at the bite site, parasite tropism, and pathogenesis and to test drugs and vaccines against naturally acquired VL. PMID:23288926
Vector competence in West African Aedes aegypti Is Flavivirus species and genotype dependent.
Dickson, Laura B; Sanchez-Vargas, Irma; Sylla, Massamba; Fleming, Karen; Black, William C
2014-10-01
Vector competence of Aedes aegypti mosquitoes is a quantitative genetic trait that varies among geographic locations and among different flavivirus species and genotypes within species. The subspecies Ae. aegypti formosus, found mostly in sub-Saharan Africa, is considered to be refractory to both dengue (DENV) and yellow fever viruses (YFV) compared to the more globally distributed Ae. aegypti aegypti. Within Senegal, vector competence varies with collection site and DENV-2 viral isolate, but knowledge about the interaction of West African Ae. aegypti with different flaviviruses is lacking. The current study utilizes low passage isolates of dengue-2 (DENV-2-75505 sylvatic genotype) and yellow fever (YFV BA-55 -West African Genotype I, or YFV DAK 1279-West African Genotype II) from West Africa and field derived Ae. aegypti collected throughout Senegal to determine whether vector competence is flavivirus or virus genotype dependent. Eight collections of 20-30 mosquitoes from different sites were fed a bloodmeal containing either DENV-2 or either isolate of YFV. Midgut and disseminated infection phenotypes were determined 14 days post infection. Collections varied significantly in the rate and intensity of midgut and disseminated infection among the three viruses. Overall, vector competence was dependent upon both viral and vector strains. Importantly, contrary to previous studies, sylvatic collections of Ae. aegypti showed high levels of disseminated infection for local isolates of both DENV-2 and YFV.
Wong, Jacklyn; Stoddard, Steven T.; Astete, Helvio; Morrison, Amy C.; Scott, Thomas W.
2011-01-01
Background Because no dengue vaccine or antiviral therapy is commercially available, controlling the primary mosquito vector, Aedes aegypti, is currently the only means to prevent dengue outbreaks. Traditional models of Ae. aegypti assume that population dynamics are regulated by density-dependent larval competition for food and little affected by oviposition behavior. Due to direct impacts on offspring survival and development, however, mosquito choice in oviposition site can have important consequences for population regulation that should be taken into account when designing vector control programs. Methodology/Principal Findings We examined oviposition patterns by Ae. aegypti among 591 naturally occurring containers and a set of experimental containers in Iquitos, Peru. Using larval starvation bioassays as an indirect measure of container food content, we assessed whether females select containers with the most food for their offspring. Our data indicate that choice of egg-laying site is influenced by conspecific larvae and pupae, container fill method, container size, lid, and sun exposure. Although larval food positively influenced oviposition, our results did not support the hypothesis that females act primarily to maximize food for larvae. Females were most strongly attracted to sites containing immature conspecifics, even when potential competitors for their progeny were present in abundance. Conclusion/Significance Due to strong conspecific attraction, egg-laying behavior may contribute more to regulating Ae. aegypti populations than previously thought. If highly infested containers are targeted for removal or larvicide application, females that would have preferentially oviposited in those sites may instead distribute their eggs among other suitable, previously unoccupied containers. Strategies that kill mosquitoes late in their development (i.e., insect growth regulators that kill pupae rather than larvae) will enhance vector control by creating “egg sinks,” treated sites that exploit conspecific attraction of ovipositing females, but reduce emergence of adult mosquitoes via density-dependent larval competition and late acting insecticide. PMID:21532736
Thermodynamic integration of the free energy along a reaction coordinate in Cartesian coordinates
NASA Astrophysics Data System (ADS)
den Otter, W. K.
2000-05-01
A generalized formulation of the thermodynamic integration (TI) method for calculating the free energy along a reaction coordinate is derived. Molecular dynamics simulations with a constrained reaction coordinate are used to sample conformations. These are then projected onto conformations with a higher value of the reaction coordinate by means of a vector field. The accompanying change in potential energy plus the divergence of the vector field constitute the derivative of the free energy. Any vector field meeting some simple requirements can be used as the basis of this TI expression. Two classes of vector fields are of particular interest here. The first recovers the conventional TI expression, with its cumbersome dependence on a full set of generalized coordinates. As the free energy is a function of the reaction coordinate only, it should in principle be possible to derive an expression depending exclusively on the definition of the reaction coordinate. This objective is met by the second class of vector fields to be discussed. The potential of mean constraint force (PMCF) method, after averaging over the unconstrained momenta, falls in this second class. The new method is illustrated by calculations on the isomerization of n-butane, and is compared with existing methods.
Entomological profile of yellow fever epidemics in the Central African Republic, 2006-2010.
Ngoagouni, Carine; Kamgang, Basile; Manirakiza, Alexandre; Nangouma, Auguste; Paupy, Christophe; Nakoune, Emmanuel; Kazanji, Mirdad
2012-08-16
The causative agent of yellow fever is an arbovirus of the Flaviviridae family transmitted by infected Aedes mosquitoes, particularly in Africa. In the Central African Republic since 2006, cases have been notified in the provinces of Ombella-Mpoko, Ouham-Pende, Basse-Kotto, Haute-Kotto and in Bangui the capital. As the presence of a vector of yellow fever virus (YFV) represents a risk for spread of the disease, we undertook entomological investigations at these sites to identify potential vectors of YFV and their abundance. Between 2006 and 2010, 5066 mosquitoes belonging to six genera and 43 species were identified. The 20 species of the Aedes genus identified included Ae. aegypti, the main vector of YFV in urban settings, and species found in tropical forests, such as Ae. africanus, Ae. simpsoni, Ae. luteocephalus, Ae. vittatus and Ae. opok. These species were not distributed uniformly in the various sites studied. Thus, the predominant Aedes species was Ae. aegypti in Bangui (90.7 %) and Basse-Kotto (42.2 %), Ae. africanus in Ombella-Mpoko (67.4 %) and Haute-Kotto (77.8 %) and Ae. vittatus in Ouham-Pende (62.2 %). Ae. albopictus was also found in Bangui. The distribution of these dominant species differed significantly according to study site (P < 0.0001). None of the pooled homogenates of Aedes mosquitoes analysed by polymerase chain reaction contained the YFV genome. The results indicate a wide diversity of vector species for YFV in the Central African Republic. The establishment of surveillance and vector control programs should take into account the ecological specificity of each species.
KILLEEN, GERRY F.; McKENZIE, F. ELLIS; FOY, BRIAN D.; SCHIEFFELIN, CATHERINE; BILLINGSLEY, PETER F.; BEIER, JOHN C.
2008-01-01
Malaria transmission intensity is modeled from the starting perspective of individual vector mosquitoes and is expressed directly as the entomologic inoculation rate (EIR). The potential of individual mosquitoes to transmit malaria during their lifetime is presented graphically as a function of their feeding cycle length and survival, human biting preferences, and the parasite sporogonic incubation period. The EIR is then calculated as the product of 1) the potential of individual vectors to transmit malaria during their lifetime, 2) vector emergence rate relative to human population size, and 3) the infectiousness of the human population to vectors. Thus, impacts on more than one of these parameters will amplify each other’s effects. The EIRs transmitted by the dominant vector species at four malaria-endemic sites from Papua New Guinea, Tanzania, and Nigeria were predicted using field measurements of these characteristics together with human biting rate and human reservoir infectiousness. This model predicted EIRs (± SD) that are 1.13 ± 0.37 (range = 0.84–1.59) times those measured in the field. For these four sites, mosquito emergence rate and lifetime transmission potential were more important determinants of the EIR than human reservoir infectiousness. This model and the input parameters from the four sites allow the potential impacts of various control measures on malaria transmission intensity to be tested under a range of endemic conditions. The model has potential applications for the development and implementation of transmission control measures and for public health education. PMID:11289661
Summary of Fluidic Thrust Vectoring Research Conducted at NASA Langley Research Center
NASA Technical Reports Server (NTRS)
Deere, Karen A.
2003-01-01
Interest in low-observable aircraft and in lowering an aircraft's exhaust system weight sparked decades of research for fixed geometry exhaust nozzles. The desire for such integrated exhaust nozzles was the catalyst for new fluidic control techniques; including throat area control, expansion control, and thrust-vector angle control. This paper summarizes a variety of fluidic thrust vectoring concepts that have been tested both experimentally and computationally at NASA Langley Research Center. The nozzle concepts are divided into three categories according to the method used for fluidic thrust vectoring: the shock vector control method, the throat shifting method, and the counterflow method. This paper explains the thrust vectoring mechanism for each fluidic method, provides examples of configurations tested for each method, and discusses the advantages and disadvantages of each method.
Sustainability of keratinocyte gene transfer and cell survival in vivo.
Choate, K A; Khavari, P A
1997-05-20
The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.
Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing
2016-01-01
Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833
Shi, Bingbo; Ding, Qiang; He, Xiaolin; Zhu, Haijing; Niu, Yiyuan; Cai, Bei; Cai, Jiao; Lei, Anming; Kang, Danju; Yan, Hailong; Ma, Baohua; Wang, Xiaolong; Qu, Lei; Chen, Yulin
2017-02-01
Increasing cashmere yield is one of the vital aims of cashmere goats breeding. Compared to traditional breeding methods, transgenic technology is more efficient and the piggyBac (PB) transposon system has been widely applied to generate transgenic animals. For the present study, donor fibroblasts were stably transfected via a PB donor vector containing the coding sequence of cashmere goat thymosin beta-4 (Tβ4) and driven by a hair follicle-specific promoter, the keratin-associated protein 6.1 (KAP6.1) promoter. To obtain genetically modified cells as nuclear donors, we co-transfected donor vectors into fetal fibroblasts of cashmere goats. Five transgenic cashmere goats were generated following somatic cell nuclear transfer (SCNT). Via determination of the copy numbers and integration sites, the Tβ4 gene was successfully inserted into the goat genome. Histological examination of skin tissue revealed that Tβ4-overexpressing, transgenic goats had a higher secondary to primary hair follicle (S/P) ratio compared to wild type goats. This indicates that Tβ4-overexpressing goats possess increased numbers of secondary hair follicles (SHF). Our results indicate that Tβ4-overexpression in cashmere goats could be a feasible strategy to increase cashmere yield.
Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A
1989-10-01
A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.
Engineering more stable, selectable marker-free autoluminescent mycobacteria by one step.
Yang, Feng; Njire, Moses M; Liu, Jia; Wu, Tian; Wang, Bangxing; Liu, Tianzhou; Cao, Yuanyuan; Liu, Zhiyong; Wan, Junting; Tu, Zhengchao; Tan, Yaoju; Tan, Shouyong; Zhang, Tianyu
2015-01-01
In our previous study, we demonstrated that the use of the autoluminescent Mycobacterium tuberculosis as a reporter strain had the potential to drastically reduce the time, effort, animals and costs consumed in evaluation of the activities of drugs and vaccines in live mice. However, the strains were relatively unstable and lost reporter with time without selection. The kanamycin selection marker used wasn't the best choice as it provides resistance to amino glycosides which are an important class of second line drugs used in tuberculosis treatment. In addition, the marker could limit utility of the strains for screening of new potential drugs or evaluating drug combinations for tuberculosis treatment. Limited selection marker genes for mycobacterial genetic manipulation is a major drawback for such a marker-containing strain in many research fields. Therefore, selectable marker-free, more stable autoluminescent mycobacteria are highly needed. After trying several strategies, we created such mycobacterial strains successfully by using an integrative vector and removing both the resistance maker and integrase genes by Xer site-specific recombination in one step. The corresponding plasmid vectors developed in this study could be very convenient in constructing other selectable marker-free, more stable reporter mycobacteria with diverse applications.
Reis, Viviane Castelo Branco; Nicola, André Moraes; de Souza Oliveira Neto, Osmar; Batista, Vinícius Daniel Ferreira; de Moraes, Lidia Maria Pepe; Torres, Fernando Araripe Gonçalves
2012-11-01
Used for millennia to produce beverages and food, Saccharomyces cerevisiae also became a workhorse in the production of biofuels, most notably bioethanol. Yeast strains have acquired distinct characteristics that are the result of evolutionary adaptation to the stresses of industrial ethanol production. JP1 is a dominant industrial S. cerevisiae strain isolated from a sugarcane mill and is becoming increasingly popular for bioethanol production in Brazil. In this work, we carried out the genetic characterization of this strain and developed a set of tools to permit its genetic manipulation. Using flow cytometry, mating type, and sporulation analysis, we verified that JP1 is diploid and homothallic. Vectors with dominant selective markers for G418, hygromycin B, zeocin, and ρ-fluoro-DL-phenylalanine were used to successfully transform JP1 cells. Also, an auxotrophic ura3 mutant strain of JP1 was created by gene disruption using integration cassettes with dominant markers flanked by loxP sites. Marker excision was accomplished by the Cre/loxP system. The resulting auxotrophic strain was successfully transformed with an episomal vector that allowed green fluorescent protein expression.
Display of adenoregulin with a novel Pichia pastoris cell surface display system.
Ren, Ren; Jiang, Zhengbing; Liu, Meiyun; Tao, Xinyi; Ma, Yushu; Wei, Dongzhi
2007-02-01
Two Pichia pastoris cell surface display vectors were constructed. The vectors consisted of the flocculation functional domain of Flo1p with its own secretion signal sequence or the alpha-factor secretion signal sequence, a polyhistidine (6xHis) tag for detection, an enterokinase recognition site, and the insertion sites for target proteins. Adenoregulin (ADR) is a 33-amino-acid antimicrobial peptide isolated from Phyllomedusa bicolor skin. The ADR was expressed and displayed on the Pichia pastoris KM71 cell surface with the system reported. The displayed recombinant ADR fusion protein was detected by fluorescence microscopy and confocal laser scanning microscopy (CLSM). The antimicrobial activity of the recombinant adenoregulin was detected after proteolytic cleavage of the fusion protein on cell surface. The validity of the Pichia pastoris cell surface display vectors was proved by the displayed ADR.
Auto and hetero-associative memory using a 2-D optical logic gate
NASA Technical Reports Server (NTRS)
Chao, Tien-Hsin (Inventor)
1992-01-01
An optical system for auto-associative and hetero-associative recall utilizing Hamming distance as the similarity measure between a binary input image vector V(sup k) and a binary image vector V(sup m) in a first memory array using an optical Exclusive-OR gate for multiplication of each of a plurality of different binary image vectors in memory by the input image vector. After integrating the light of each product V(sup k) x V(sup m), a shortest Hamming distance detection electronics module determines which product has the lowest light intensity and emits a signal that activates a light emitting diode to illuminate a corresponding image vector in a second memory array for display. That corresponding image vector is identical to the memory image vector V(sup m) in the first memory array for auto-associative recall or related to it, such as by name, for hetero-associative recall.
Giraldo-Calderón, Gloria I.; Emrich, Scott J.; MacCallum, Robert M.; Maslen, Gareth; Dialynas, Emmanuel; Topalis, Pantelis; Ho, Nicholas; Gesing, Sandra; Madey, Gregory; Collins, Frank H.; Lawson, Daniel
2015-01-01
VectorBase is a National Institute of Allergy and Infectious Diseases supported Bioinformatics Resource Center (BRC) for invertebrate vectors of human pathogens. Now in its 11th year, VectorBase currently hosts the genomes of 35 organisms including a number of non-vectors for comparative analysis. Hosted data range from genome assemblies with annotated gene features, transcript and protein expression data to population genetics including variation and insecticide-resistance phenotypes. Here we describe improvements to our resource and the set of tools available for interrogating and accessing BRC data including the integration of Web Apollo to facilitate community annotation and providing Galaxy to support user-based workflows. VectorBase also actively supports our community through hands-on workshops and online tutorials. All information and data are freely available from our website at https://www.vectorbase.org/. PMID:25510499
Minimum impulse three-body trajectories.
NASA Technical Reports Server (NTRS)
D'Amario, L.; Edelbaum, T. N.
1973-01-01
A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.