The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bender, M.A.; Gelinas, R.E.; Miller

1989-04-01

Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

Alternative options for DNA-based experimental therapy of β-thalassemia.

PubMed

Gambari, Roberto

2012-04-01

Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

PubMed

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

PubMed

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

PubMed

Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

2016-09-01

Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

PubMed Central

Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

2011-01-01

Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

Structural and Functional Analysis of an mRNP Complex That Mediates the High Stability of Human β-Globin mRNA

PubMed Central

Yu, Jia; Russell, J. Eric

2001-01-01

Human globins are encoded by mRNAs exhibiting high stabilities in transcriptionally silenced erythrocyte progenitors. Unlike α-globin mRNA, whose stability is enhanced by assembly of a specific messenger RNP (mRNP) α complex on its 3′ untranslated region (UTR), neither the structure(s) nor the mechanism(s) that effects the high-level stability of human β-globin mRNA has been identified. The present work describes an mRNP complex assembling on the 3′ UTR of the β-globin mRNA that exhibits many of the properties of the stability-enhancing α complex. The β-globin mRNP complex is shown to contain one or more factors homologous to αCP, a 39-kDa RNA-binding protein that is integral to α-complex assembly. Sequence analysis implicates a specific 14-nucleotide pyrimidine-rich track within its 3′ UTR as the site of β-globin mRNP assembly. The importance of this track to mRNA stability is subsequently verified in vivo using mice expressing human β-globin transgenes that contain informative mutations in this region. In combination, the in vitro and in vivo analyses indicate that the high stabilities of the α- and β-globin mRNAs are maintained through related mRNP complexes that may share a common regulatory pathway. PMID:11486027

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

Preclinical Evaluation of Efficacy and Safety of an Improved Lentiviral Vector for the Treatment of β-Thalassemia and Sickle Cell Disease

PubMed Central

Negre, Olivier; Bartholomae, Cynthia; Beuzard, Yves; Cavazzana, Marina; Christiansen, Lauryn; Courne, Céline; Deichmann, Annette; Denaro, Maria; de Dreuzy, Edouard; Finer, Mitchell; Fronza, Raffaele; Gillet-Legrand, Béatrix; Joubert, Christophe; Kutner, Robert; Leboulch, Philippe; Maouche, Leïla; Paulard, Anaïs; Pierciey, Francis J.; Rothe, Michael; Ryu, Byoung; Schmidt, Manfred; von Kalle, Christof; Payen, Emmanuel; Veres, Gabor

2015-01-01

A previously published clinical trial demonstrated the benefit of autologous CD34+ cells transduced with a self-inactivating lentiviral vector (HPV569) containing an engineered β-globin gene (βA-T87Q-globin) in a subject with β-thalassemia major. This vector has been modified to increase transduction efficacy without compromising safety. In vitro analyses indicated that the changes resulted in both increased vector titers (3 to 4 fold) and increased transduction efficacy (2 to 3 fold). An in vivo study in which 58 β-thalassemic mice were transplanted with vector- or mock-transduced syngenic bone marrow cells indicated sustained therapeutic efficacy. Secondary transplantations involving 108 recipients were performed to evaluate long-term safety. The six month study showed no hematological or biochemical toxicity. Integration site (IS) profile revealed an oligo/polyclonal hematopoietic reconstitution in the primary transplants and reduced clonality in secondary transplants. Tumor cells were detected in the secondary transplant mice in all treatment groups (including the control group), without statistical differences in the tumor incidence. Immunohistochemistry and quantitative PCR demonstrated that tumor cells were not derived from transduced donor cells. This comprehensive efficacy and safety data provided the basis for initiating two clinical trials with this second generation vector (BB305) in Europe and in the USA in patients with β-thalassemia major and sickle cell disease. PMID:25429463

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

PubMed

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

Exploring the Common Dynamics of Homologous Proteins. Application to the Globin Family

PubMed Central

Maguid, Sandra; Fernandez-Alberti, Sebastian; Ferrelli, Leticia; Echave, Julian

2005-01-01

We present a procedure to explore the global dynamics shared between members of the same protein family. The method allows the comparison of patterns of vibrational motion obtained by Gaussian network model analysis. After the identification of collective coordinates that were conserved during evolution, we quantify the common dynamics within a family. Representative vectors that describe these dynamics are defined using a singular value decomposition approach. As a test case, the globin heme-binding family is considered. The two lowest normal modes are shown to be conserved within this family. Our results encourage the development of models for protein evolution that take into account the conservation of dynamical features. PMID:15749782

Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

PubMed Central

Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

2010-01-01

Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

Insulated piggyBac vectors for insect transgenesis

PubMed Central

Sarkar, Abhimanyu; Atapattu, Asela; Belikoff, Esther J; Heinrich, Jörg C; Li, Xuelei; Horn, Carsten; Wimmer, Ernst A; Scott, Maxwell J

2006-01-01

Background Germ-line transformation of insects is now a widely used method for analyzing gene function and for the development of genetically modified strains suitable for pest control programs. The most widely used transposable element for the germ-line transformation of insects is piggyBac. The site of integration of the transgene can influence gene expression due to the effects of nearby transcription enhancers or silent heterochromatic regions. Position effects can be minimized by flanking a transgene with insulator elements. The scs/scs' and gypsy insulators from Drosophila melanogaster as well as the chicken β-globin HS4 insulator function in both Drosophila and mammalian cells. Results To minimize position effects we have created a set of piggyBac transformation vectors that contain either the scs/scs', gypsy or chicken β-globin HS4 insulators. The vectors contain either fluorescent protein or eye color marker genes and have been successfully used for germ-line transformation of Drosophila melanogaster. A set of the scs/scs' vectors contains the coral reef fluorescent protein marker genes AmCyan, ZsGreen and DsRed that have not been optimized for translation in human cells. These marker genes are controlled by a combined GMR-3xP3 enhancer/promoter that gives particularly strong expression in the eyes. This is also the first report of the use of the ZsGreen and AmCyan reef fluorescent proteins as transformation markers in insects. Conclusion The insulated piggyBac vectors should protect transgenes against position effects and thus facilitate fine control of gene expression in a wide spectrum of insect species. These vectors may also be used for transgenesis in other invertebrate species. PMID:16776846

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

PubMed Central

Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

2007-01-01

The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

Enrichment of human hematopoietic stem/progenitor cells facilitates transduction for stem cell gene therapy.

PubMed

Baldwin, Kismet; Urbinati, Fabrizia; Romero, Zulema; Campo-Fernandez, Beatriz; Kaufman, Michael L; Cooper, Aaron R; Masiuk, Katelyn; Hollis, Roger P; Kohn, Donald B

2015-05-01

Autologous hematopoietic stem cell (HSC) gene therapy for sickle cell disease has the potential to treat this illness without the major immunological complications associated with allogeneic transplantation. However, transduction efficiency by β-globin lentiviral vectors using CD34-enriched cell populations is suboptimal and large vector production batches may be needed for clinical trials. Transducing a cell population more enriched for HSC could greatly reduce vector needs and, potentially, increase transduction efficiency. CD34(+) /CD38(-) cells, comprising ∼1%-3% of all CD34(+) cells, were isolated from healthy cord blood CD34(+) cells by fluorescence-activated cell sorting and transduced with a lentiviral vector expressing an antisickling form of beta-globin (CCL-β(AS3) -FB). Isolated CD34(+) /CD38(-) cells were able to generate progeny over an extended period of long-term culture (LTC) compared to the CD34(+) cells and required up to 40-fold less vector for transduction compared to bulk CD34(+) preparations containing an equivalent number of CD34(+) /CD38(-) cells. Transduction of isolated CD34(+) /CD38(-) cells was comparable to CD34(+) cells measured by quantitative PCR at day 14 with reduced vector needs, and average vector copy/cell remained higher over time for LTC initiated from CD34(+) /38(-) cells. Following in vitro erythroid differentiation, HBBAS3 mRNA expression was similar in cultures derived from CD34(+) /CD38(-) cells or unfractionated CD34(+) cells. In vivo studies showed equivalent engraftment of transduced CD34(+) /CD38(-) cells when transplanted in competition with 100-fold more CD34(+) /CD38(+) cells. This work provides initial evidence for the beneficial effects from isolating human CD34(+) /CD38(-) cells to use significantly less vector and potentially improve transduction for HSC gene therapy. © 2015 AlphaMed Press.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Highly efficient expression of interleukin-2 under the control of rabbit β-globin intron II gene enhances protective immune responses of porcine reproductive and respiratory syndrome (PRRS) DNA vaccine in pigs.

PubMed

Du, Yijun; Lu, Yu; Wang, Xinglong; Qi, Jing; Liu, Jiyu; Hu, Yue; Li, Feng; Wu, Jiaqiang; Guo, Lihui; Liu, Junzhen; Tao, Haiying; Sun, Wenbo; Chen, Lei; Cong, Xiaoyan; Ren, Sufang; Shi, Jianli; Li, Jun; Wang, Jinbao; Huang, Baohua; Wan, Renzhong

2014-01-01

Highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) had caused catastrophic losses in swine industry in China. The current inactivated vaccine provided only limited protection, and the attenuated live vaccine could protect piglets against the HP-PRRSV but there was a possibility that the attenuated virus returned to high virulence. In this study, the eukaryotic expression vector pVAX1© was modified under the control of rabbit β-globin intron II gene and the modified vector pMVAX1© was constructed. Porcine interleukin-2 (IL-2) and GP3-GP5 fusion protein of HP-PRRSV strain SD-JN were highly expressed by pMVAX1©. Mice inoculated with pMVAX1©-GP35 developed significantly higher PRRSV-specific antibody responses and T cell proliferation than those vaccinated with pVAX1©-GP35. pMVAX1©-GP35 was selected as PRRS DNA vaccine candidate and co-administrated with pVAX1©-IL-2 or pMVAX1©-IL-2 in pigs. pMVAX1©-IL-2+pMVAX1©-GP35 could provide enhanced PRRSV-specific antibody responses, T cell proliferation, Th1-type and Th2-type cytokine responses and CTL responses than pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35. Following homologous challenge with HP-PRRSV strain SD-JN, similar with attenuated PRRS vaccine group, pigs inoculated with pMVAX1©-IL-2+pMVAX1©-GP35 showed no clinical signs, almost no lung lesions and no viremia, as compared to those in pMVAX1©-GP35 and pVAX1©-IL-2+pMVAX1©-GP35 groups. It indicated that pMVAX1©-IL-2 effectively increases humoral and cell mediated immune responses of pMVAX1©-GP35. Co-administration of pMVAX1©-IL-2 and pMVAX1©-GP35 might be attractive candidate vaccines for preventing HP-PRRSV infections.

The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

PubMed

Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

2015-06-15

Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

PubMed

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

PubMed Central

Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

2011-01-01

In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

Three mouse models of human thalassemia.

PubMed Central

Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

1981-01-01

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

Recent trends in the gene therapy of β-thalassemia

PubMed Central

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

PubMed

Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

2008-07-25

Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression profiles in different lineages.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

All of the human beta-type globin genes compete for LCR enhancer activity in embryonic erythroid cells of yeast artificial chromosome transgenic mice.

PubMed

Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji

2009-12-01

In primitive erythroid cells of human beta-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal epsilon- and gamma-globin genes are transcribed, whereas the distal delta- and beta-globin genes are silent. It is generally accepted that the beta-globin gene is competitively suppressed by gamma-globin gene expression at this developmental stage. Previously, however, we observed that epsilon-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that beta-globin gene might also be silenced because of its great distance from the LCR. Here, to clarify the beta-globin gene silencing mechanism, we established TgM lines carrying either gamma- or epsilon- plus gamma-globin promoter deletions, without significantly altering the distance between the beta-globin gene and the LCR. Precocious expression of delta- and beta-globin genes was observed in primitive erythroid cells of mutant, but not wild-type TgM, which was most evident when both the epsilon and gamma promoters were deleted. Thus, we clearly demonstrated that the repression of the delta- and beta-globin genes in primitive erythroid cells is dominated by competitive silencing by the epsilon- and gamma-globin gene promoters, and that epsilon- and the other beta-like globin genes might be activated by two distinct mechanisms by the LCR.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Correction of the sickle cell disease mutation in human hematopoietic stem/progenitor cells.

PubMed

Hoban, Megan D; Cost, Gregory J; Mendel, Matthew C; Romero, Zulema; Kaufman, Michael L; Joglekar, Alok V; Ho, Michelle; Lumaquin, Dianne; Gray, David; Lill, Georgia R; Cooper, Aaron R; Urbinati, Fabrizia; Senadheera, Shantha; Zhu, Allen; Liu, Pei-Qi; Paschon, David E; Zhang, Lei; Rebar, Edward J; Wilber, Andrew; Wang, Xiaoyan; Gregory, Philip D; Holmes, Michael C; Reik, Andreas; Hollis, Roger P; Kohn, Donald B

2015-04-23

Sickle cell disease (SCD) is characterized by a single point mutation in the seventh codon of the β-globin gene. Site-specific correction of the sickle mutation in hematopoietic stem cells would allow for permanent production of normal red blood cells. Using zinc-finger nucleases (ZFNs) designed to flank the sickle mutation, we demonstrate efficient targeted cleavage at the β-globin locus with minimal off-target modification. By co-delivering a homologous donor template (either an integrase-defective lentiviral vector or a DNA oligonucleotide), high levels of gene modification were achieved in CD34(+) hematopoietic stem and progenitor cells. Modified cells maintained their ability to engraft NOD/SCID/IL2rγ(null) mice and to produce cells from multiple lineages, although with a reduction in the modification levels relative to the in vitro samples. Importantly, ZFN-driven gene correction in CD34(+) cells from the bone marrow of patients with SCD resulted in the production of wild-type hemoglobin tetramers. © 2015 by The American Society of Hematology.

Predicting Natural Neuroprotection in Marine Mammals: Environmental and Biological Factors Affecting the Vulnerability to Acoustically Mediated Tissue Trauma in Marine Species

DTIC Science & Technology

2013-09-30

comparing both globin deposition profiles from carcasses ranging in age from neonates to adults, as well as the change in mass-specific metabolic demands...to acoustically mediated trauma, 1) molecular and biochemical evaluation of neuroprotection at the tissue level, and 2) whole animal /physiological...Noren, UCSC.) The second component of this study examined the susceptibility of marine mammals to decompression illness at the whole animal

THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

PubMed Central

Gay, Frederick P.; Robertson, T. Brailsford

1913-01-01

This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

Genetic dissection of the α-globin super-enhancer in vivo

PubMed Central

Hay, Deborah; Hughes, Jim R.; Rode, Christina; Li, Pik-Shan; Pennacchio, Len A.; Sloane-Stanley, Jacqueline A.; Ayyub, Helena; Butler, Sue; Sauka-Spengler, Tatjana; Gibbons, Richard J.; Smith, Andrew J.H.; Wood, William G.; Higgs, Douglas R.

2016-01-01

Many genes determining cell identity are regulated by clusters of mediator-bound enhancer elements collectively referred to as super-enhancers. These have been proposed to manifest higher-order properties important in development and disease. Here, we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer singly and in informative combinations, we demonstrate that each constituent enhancer appears to act independently and in an additive fashion with respect to hematologic phenotype, gene expression, chromatin structure and chromosome conformation, without clear evidence of synergistic or higher-order effects. Our study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation. PMID:27376235

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

PubMed

Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

2018-06-27

The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

CCAR1/CoCoA pair-mediated recruitment of the Mediator defines a novel pathway for GATA1 function.

PubMed

Mizuta, Shumpei; Minami, Tomoya; Fujita, Haruka; Kaminaga, Chihiro; Matsui, Keiji; Ishino, Ruri; Fujita, Azusa; Oda, Kasumi; Kawai, Asami; Hasegawa, Natsumi; Urahama, Norinaga; Roeder, Robert G; Ito, Mitsuhiro

2014-01-01

The MED1 subunit of the Mediator transcriptional coregulator complex coactivates GATA1 and induces erythropoiesis. Here, we show the dual mechanism of GATA1- and MED1-mediated transcription. MED1 expression levels in K562 erythroleukemia cells paralleled the levels of GATA1-targeted gene transcription and erythroid differentiation. An N-terminal fragment of MED1, MED1(1-602), which is incapable of interacting with GATA1, enhanced GATA1-targeted gene transcription and erythroid differentiation, and introduction of MED1(1-602) into Med1(-/-) mouse embryonic fibroblasts (MEFs) partially rescued GATA1-mediated transcription. The C-terminal zinc-finger domain of GATA1 interacts with the MED1(1-602)-interacting coactivator CCAR1, CoCoA and MED1(681-715). CCAR1 and CoCoA synergistically enhanced GATA1-mediated transcription from the γ-globin promoter in MEFs. Recombinant GATA1, CCAR1, CoCoA and MED1(1-602) formed a complex in vitro, and GATA1, CCAR1, CoCoA and MED1 were recruited to the γ-globin promoter in K562 cells during erythroid differentiation. Therefore, in addition to the direct interaction between GATA1 and MED1, CoCoA and CCAR1 appear to relay the GATA1 signal to MED1, and multiple modes of the GATA1-MED1 axis may help to fine-tune GATA1 function during GATA1-mediated homeostasis events. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

PubMed

Wilson, G M; Vasa, M Z; Deeley, R G

1998-05-01

The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

PubMed

Gallagher, Michael D; Macqueen, Daniel J

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

NASA Astrophysics Data System (ADS)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Genetic dissection of the α-globin super-enhancer in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hay, Deborah; Hughes, Jim R.; Babbs, Christian

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

Genetic dissection of the α-globin super-enhancer in vivo

DOE PAGES

Hay, Deborah; Hughes, Jim R.; Babbs, Christian; ...

2016-07-04

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, S.D.; Cooper, P.; Fung, J.

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression ofmore » human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.« less

Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

PubMed

Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-10-01

Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

Running exercise alleviates trabecular bone loss and osteopenia in hemizygous β-globin knockout thalassemic mice.

PubMed

Thongchote, Kanogwun; Svasti, Saovaros; Teerapornpuntakit, Jarinthorn; Krishnamra, Nateetip; Charoenphandhu, Narattaphol

2014-06-15

A marked decrease in β-globin production led to β-thalassemia, a hereditary anemic disease associated with bone marrow expansion, bone erosion, and osteoporosis. Herein, we aimed to investigate changes in bone mineral density (BMD) and trabecular microstructure in hemizygous β-globin knockout thalassemic (BKO) mice and to determine whether endurance running (60 min/day, 5 days/wk for 12 wk in running wheels) could effectively alleviate bone loss in BKO mice. Both male and female BKO mice (1-2 mo old) showed growth retardation as indicated by smaller body weight and femoral length than their wild-type littermates. A decrease in BMD was more severe in female than in male BKO mice. Bone histomorphometry revealed that BKO mice had decreases in trabecular bone volume, trabecular number, and trabecular thickness, presumably due to suppression of osteoblast-mediated bone formation and activation of osteoclast-mediated bone resorption, the latter of which was consistent with elevated serum levels of osteoclastogenic cytokines IL-1α and -1β. As determined by peripheral quantitative computed tomography, running increased cortical density and thickness in the femoral and tibial diaphyses of BKO mice compared with those of sedentary BKO mice. Several histomorphometric parameters suggested an enhancement of bone formation (e.g., increased mineral apposition rate) and suppression of bone resorption (e.g., decreased osteoclast surface), which led to increases in trabecular bone volume and trabecular thickness in running BKO mice. In conclusion, BKO mice exhibited pervasive osteopenia and impaired bone microstructure, whereas running exercise appeared to be an effective intervention in alleviating bone microstructural defect in β-thalassemia. Copyright © 2014 the American Physiological Society.

Evolution and Expression of Tissue Globins in Ray-Finned Fishes

PubMed Central

Gallagher, Michael D.

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

PubMed

Fedosyuk, Halyna; Peterson, Kenneth R

2007-01-01

A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2006-07-01

The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

Gene Therapy in Patients with Transfusion-Dependent β-Thalassemia.

PubMed

Thompson, Alexis A; Walters, Mark C; Kwiatkowski, Janet; Rasko, John E J; Ribeil, Jean-Antoine; Hongeng, Suradej; Magrin, Elisa; Schiller, Gary J; Payen, Emmanuel; Semeraro, Michaela; Moshous, Despina; Lefrere, Francois; Puy, Hervé; Bourget, Philippe; Magnani, Alessandra; Caccavelli, Laure; Diana, Jean-Sébastien; Suarez, Felipe; Monpoux, Fabrice; Brousse, Valentine; Poirot, Catherine; Brouzes, Chantal; Meritet, Jean-François; Pondarré, Corinne; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Teachey, David T; Anurathapan, Usanarat; Ho, P Joy; von Kalle, Christof; Kletzel, Morris; Vichinsky, Elliott; Soni, Sandeep; Veres, Gabor; Negre, Olivier; Ross, Robert W; Davidson, David; Petrusich, Alexandria; Sandler, Laura; Asmal, Mohammed; Hermine, Olivier; De Montalembert, Mariane; Hacein-Bey-Abina, Salima; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

2018-04-19

Donor availability and transplantation-related risks limit the broad use of allogeneic hematopoietic-cell transplantation in patients with transfusion-dependent β-thalassemia. After previously establishing that lentiviral transfer of a marked β-globin (β A-T87Q ) gene could substitute for long-term red-cell transfusions in a patient with β-thalassemia, we wanted to evaluate the safety and efficacy of such gene therapy in patients with transfusion-dependent β-thalassemia. In two phase 1-2 studies, we obtained mobilized autologous CD34+ cells from 22 patients (12 to 35 years of age) with transfusion-dependent β-thalassemia and transduced the cells ex vivo with LentiGlobin BB305 vector, which encodes adult hemoglobin (HbA) with a T87Q amino acid substitution (HbA T87Q ). The cells were then reinfused after the patients had undergone myeloablative busulfan conditioning. We subsequently monitored adverse events, vector integration, and levels of replication-competent lentivirus. Efficacy assessments included levels of total hemoglobin and HbA T87Q , transfusion requirements, and average vector copy number. At a median of 26 months (range, 15 to 42) after infusion of the gene-modified cells, all but 1 of the 13 patients who had a non-β 0 /β 0 genotype had stopped receiving red-cell transfusions; the levels of HbA T87Q ranged from 3.4 to 10.0 g per deciliter, and the levels of total hemoglobin ranged from 8.2 to 13.7 g per deciliter. Correction of biologic markers of dyserythropoiesis was achieved in evaluated patients with hemoglobin levels near normal ranges. In 9 patients with a β 0 /β 0 genotype or two copies of the IVS1-110 mutation, the median annualized transfusion volume was decreased by 73%, and red-cell transfusions were discontinued in 3 patients. Treatment-related adverse events were typical of those associated with autologous stem-cell transplantation. No clonal dominance related to vector integration was observed. Gene therapy with autologous CD34+ cells transduced with the BB305 vector reduced or eliminated the need for long-term red-cell transfusions in 22 patients with severe β-thalassemia without serious adverse events related to the drug product. (Funded by Bluebird Bio and others; HGB-204 and HGB-205 ClinicalTrials.gov numbers, NCT01745120 and NCT02151526 .).

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

PubMed

Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

PubMed

Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

2017-09-04

β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

PubMed Central

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with Hb E-beta-thalassemia and Hb E trait. The initial rate of beta-globin synthesis (betaE/alpha=0.20-0.34) was less than expected on the basis of gene dosage, or comparable studies of other compound heterozygous states for beta-thalassemia and structurally abnormal beta-chains. betaE-globin synthesis was not only reduced during short-term incubations (1-5 min), but also remained relatively unchanged during long-term pulse or chase incubations up to 5h. Analysis of globin mRNA by cell-free translation and molecular hybridization confirmed that the unexpectedly low levels of betaE-globin synthesis were associated with comparable reduction in the levels of beta-globin mRNA. In Hb E-beta-thalassemia the betaA + betaE (alpha globin nRNA ratio observed were substantially lower than those obtained from reticulocytes of patients with heterozygous beta-thalassemia, or Hb S-betaO-thalassemia, while in Hb E trait, the betaA + betaE/alpha mRNA ratio was in the ranged observed for beta-thalassemia trait. The betaE-globin gene specifies reduced accumulation of betaE-globin mRNA, a property characteristic of other forms of beta-thalassemia. The beta-thalassemia phenotype associated with inheritance of Hb E is thus determined at the level of beta-globin mRNA metabolism. PMID:6166632

Hydroxylamine-induced oxidation of ferrous carbonylated truncated hemoglobins from Mycobacterium tuberculosis and Campylobacter jejuni is limited by carbon monoxide dissociation.

PubMed

Ascenzi, Paolo; Ciaccio, Chiara; Gasperi, Tecla; Pesce, Alessandra; Caporaso, Lucia; Coletta, Massimo

2017-08-01

Hydroxylamine (HA) is an oxidant of ferrous globins and its action has been reported to be inhibited by CO, even though this mechanism has not been clarified. Here, kinetics of the HA-mediated oxidation of ferrous carbonylated Mycobacterium tuberculosis truncated hemoglobin N and O (Mt-trHbN(II)-CO and Mt-trHbO(II)-CO, respectively) and Campylobacter jejuni truncated hemoglobin P (Cj-trHbP(II)-CO), at pH 7.2 and 20.0 °C, are reported. Mixing Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO solution with the HA solution brings about absorption spectral changes reflecting the disappearance of the ferrous carbonylated derivatives with the concomitant formation of the ferric species. HA oxidizes irreversibly Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO with the 1:2 stoichiometry. The dissociation of CO turns out to be the rate-limiting step for the oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO by HA. Values of the second-order rate constant for HA-mediated oxidation of Mt-trHbN(II)-CO, Mt-trHbO(II)-CO, and Cj-trHbP(II)-CO range between 8.8 × 10 4 and 8.6 × 10 7 M -1 s -1 , reflecting different structural features of the heme distal pocket. This study (1) demonstrates that the inhibitory effect of CO is linked to the dissociation of this ligand, giving a functional basis to previous studies, (2) represents the first comparative investigation of the oxidation of ferrous carbonylated bacterial 2/2 globins belonging to the N, O, and P groups by HA, (3) casts light on the correlation between kinetics of HA-mediated oxidation and carbonylation of globins, and (4) focuses on structural determinants modulating the HA-induced oxidation process.

Genetic treatment of a molecular disorder: gene therapy approaches to sickle cell disease

PubMed Central

Hoban, Megan D.; Bauer, Daniel E.

2016-01-01

Effective medical management for sickle cell disease (SCD) remains elusive. As a prevalent and severe monogenic disorder, SCD has been long considered a logical candidate for gene therapy. Significant progress has been made in moving toward this goal. These efforts have provided substantial insight into the natural regulation of the globin genes and illuminated challenges for genetic manipulation of the hematopoietic system. The initial γ-retroviral vectors, next-generation lentiviral vectors, and novel genome engineering and gene regulation approaches each share the goal of preventing erythrocyte sickling. After years of preclinical studies, several clinical trials for SCD gene therapies are now open. This review focuses on progress made toward achieving gene therapy, the current state of the field, consideration of factors that may determine clinical success, and prospects for future development. PMID:26758916

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

PubMed Central

Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.

PubMed

Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu

2015-05-01

Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Association of an α-globin gene cluster duplication and heterozygous β-thalassemia in a patient with a severe thalassemia syndrome.

PubMed

Jiang, Hua; Liu, Sha; Zhang, Yong-Ling; Wan, Jun-Hui; Li, Ru; Li, Dong-Zhi

2015-01-01

We describe a new case of a β-thalassemia (β-thal) heterozygote with the mutation IVS-II-654 (C>T) presenting with a transfusion-dependent phenotype. Multiplex ligation-dependent probe amplification (MLPA) and array comparative genomic hybridization (CGH) analyses of the α-globin gene cluster revealed a full duplication of the α-globin genes including the upstream regulatory element. The duplicated allele and the normal allele in trans resulted in a total of six active α-globin genes. The severe clinical phenotype seemed to be related to the considerable excess of the α- and β-globin deficit caused by the presence of the β-thal. α-Globin cluster duplication should be considered in patients heterozygous for β-thal who show a more severe phenotype than β-thal trait.

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Deletion of transcription factor binding motifs using the CRISPR/spCas9 system in the β-globin LCR.

PubMed

Kim, Yea Woon; Kim, AeRi

2017-07-20

Transcription factors play roles in gene transcription through direct binding to their motifs in genome, and inhibiting this binding provides an effective strategy for studying their roles. Here we applied the CRISPR/spCas9 system to mutate the binding motifs of transcription factors. Binding motifs for erythroid specific transcription factors were mutated in the locus control region hypersensitive sites of the human β-globin locus. Guide RNAs targeting binding motifs were cloned into lentiviral CRISPR vector containing the spCas9 gene, and transduced into MEL/ch11 cells carrying a human chromosome 11. DNA mutations in clonal cells were initially screened by quantitative PCR in genomic DNA and then clarified by sequencing. Mutations in binding motifs reduced occupancy by transcription factors in a chromatin environment. Characterization of mutations revealed that the CRISPR/spCas9 system mainly induced deletions in short regions of <20 bp and preferentially deleted nucleotides around the fifth nucleotide upstream of Protospacer adjacent motifs. These results indicate that the CRISPR/Cas9 system is suitable for mutating the binding motifs of transcription factors, and, consequently, would contribute to elucidate the direct roles of transcription factors. ©2017 The Author(s).

Understanding α-globin gene regulation and implications for the treatment of β-thalassemia.

PubMed

Mettananda, Sachith; Gibbons, Richard J; Higgs, Douglas R

2016-03-01

Over the past three decades, a vast amount of new information has been uncovered describing how the globin genes are regulated. This knowledge has provided significant insights into the general understanding of the regulation of human genes. It is now known that molecular defects within and around the α- and β-globin genes, as well as in the distant regulatory elements, can cause thalassemia. Unbalanced production of globin chains owing to defective synthesis of one, and the continued unopposed synthesis of another, is the central causative factor in the cellular pathology and pathophysiology of thalassemia. A large body of clinical, genetic, and experimental evidence suggests that altering globin chain imbalance by reducing the production of α-globin synthesis ameliorates the disease severity in patients with β-thalassemia. With the development of new genetic-based therapeutic tools that have a potential to decrease the expression of a selected gene in a tissue-specific manner, the possibility of decreasing expression of the α-globin gene to improve the clinical severity of β-thalassemia could become a reality. © 2015 New York Academy of Sciences.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

PubMed

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

Genetic treatment of a molecular disorder: gene therapy approaches to sickle cell disease.

PubMed

Hoban, Megan D; Orkin, Stuart H; Bauer, Daniel E

2016-02-18

Effective medical management for sickle cell disease (SCD) remains elusive. As a prevalent and severe monogenic disorder, SCD has been long considered a logical candidate for gene therapy. Significant progress has been made in moving toward this goal. These efforts have provided substantial insight into the natural regulation of the globin genes and illuminated challenges for genetic manipulation of the hematopoietic system. The initial γ-retroviral vectors, next-generation lentiviral vectors, and novel genome engineering and gene regulation approaches each share the goal of preventing erythrocyte sickling. After years of preclinical studies, several clinical trials for SCD gene therapies are now open. This review focuses on progress made toward achieving gene therapy, the current state of the field, consideration of factors that may determine clinical success, and prospects for future development. © 2016 by The American Society of Hematology.

Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

PubMed

Sawado, T; Igarashi, K; Groudine, M

2001-08-28

The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Lalley, P.A.; Whitney, J.B.

A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

PubMed

Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

2010-05-07

Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

PubMed Central

Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

2009-01-01

Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

PubMed

Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

2016-06-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

PubMed

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

PubMed

Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

1986-02-01

A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

PubMed Central

Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

2006-01-01

We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

PubMed Central

Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

2011-01-01

Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

PubMed

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

PubMed Central

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

High-Efficiency Promoter-Dependent Transduction by Adeno-Associated Virus Type 6 Vectors in Mouse Lung

PubMed Central

HALBERT, CHRISTINE L.; LAM, SIU-LING; MILLER, A. DUSTY

2014-01-01

The transduction efficiency of adeno-associated virus (AAV) vectors in various somatic tissues has been shown to depend heavily on the AAV type from which the vector capsid proteins are derived. Among the AAV types studied, AAV6 efficiently transduces cells of the airway epithelium, making it a good candidate for the treatment of lung diseases such as cystic fibrosis. Here we have evaluated the effects of various promoter sequences on transduction rates and gene expression levels in the lung. Of the strong viral promoters examined, the Rous sarcoma virus (RSV) promoter performed significantly better than a human cytomegalovirus (CMV) promoter in the airway epithelium. However, a hybrid promoter consisting of a CMV enhancer, β-actin promoter and splice donor, and a β-globin splice acceptor (CAG promoter) exhibited even higher expression than either of the strong viral promoters alone, showing a 38-fold increase in protein expression over the RSV promoter. In addition, we show that vectors containing either the RSV or CAG promoter expressed well in the nasal and tracheal epithelium. Transduction rates in the 90% range were achieved in many airways with the CAG promoter, showing that with the proper AAV capsid proteins and promoter sequences, highly efficient transduction can be achieved. PMID:17430088

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception ofmore » closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.« less

Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

PubMed Central

Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

2014-01-01

The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PubMed

Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

2011-03-15

Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

Molecular Basis and Genetic Modifiers of Thalassemia.

PubMed

Mettananda, Sachith; Higgs, Douglas R

2018-04-01

Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

PubMed

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

PubMed

Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

2016-10-01

Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

Recent advance on genome editing for therapy of β-hemoglobinopathies.

PubMed

Liu, Jia-Wei; Hong, Tao; Qin, Xin; Liang, Ying-Min; Zhang, Ping

2018-02-20

β-hemoglobinopathies are one of six groups of common illnesses affecting human health. Although the genetic mechanisms have been elucidated for several decades, curable treatment options, other than allogeneic bone marrow transplantation, are still lacking. In recent years, rapid development in genome editing technologies and their clinical applications have opened up new directions for treatment of β-hemoglobinopathies. Genome editing technologies, as applied in autologous CD34 + hematopoietic stem and progenitor cells, represents a promising remedial means for the β-globin disorders. Hemoglobin gene mutations could be corrected with homologous recombination-mediated DNA repair pathway to repair the genetic defects, while the nonhomologous end-joining pathway may be used to silence the key repressor of fetal globin expression and reactivate fetal hemoglobin expression, thereby alleviating the clinical symptoms of β-hemoglobinopathies in patients. This review summarizes the recent advances on genome editing of β-hemoglobinopathies from the bench design to the establishment of clinical translational platforms, thereby providing critical insights and references on the application of genome editing technologies for the development of therapeutic strategies for β-hemoglobinopathies.

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression.

PubMed

Chen, Diyu; Zuo, Yangjin; Zhang, Xinhua; Ye, Yuhua; Bao, Xiuqin; Huang, Haiyan; Tepakhan, Wanicha; Wang, Lijuan; Ju, Junyi; Chen, Guangfu; Zheng, Mincui; Liu, Dun; Huang, Shuodan; Zong, Lu; Li, Changgang; Chen, Yajun; Zheng, Chenguang; Shi, Lihong; Zhao, Quan; Wu, Qiang; Fucharoen, Supan; Zhao, Cunyou; Xu, Xiangmin

2017-07-06

A delayed fetal-to-adult hemoglobin (Hb) switch ameliorates the severity of β-thalassemia and sickle cell disease. The molecular mechanism underlying the epigenetic dysregulation of the switch is unclear. To explore the potential cis-variants responsible for the Hb switching, we systematically analyzed an 80-kb region spanning the β-globin cluster using capture-based next-generation sequencing of 1142 Chinese β-thalassemia persons and identified 31 fetal hemoglobin (HbF)-associated haplotypes of the selected 28 tag regulatory single-nucleotide polymorphisms (rSNPs) in seven linkage disequilibrium (LD) blocks. A Ly1 antibody reactive (LYAR)-binding motif disruptive rSNP rs368698783 (G/A) from LD block 5 in the proximal promoter of hemoglobin subunit gamma 1 (HBG1) was found to be a significant predictor for β-thalassemia clinical severity by epigenetic-mediated variant-dependent HbF elevation. We found this rSNP accounted for 41.6% of β-hemoglobinopathy individuals as an ameliorating factor in a total of 2,738 individuals from southern China and Thailand. We uncovered that the minor allele of the rSNP triggers the attenuation of LYAR and two repressive epigenetic regulators DNA methyltransferase 3 alpha (DNMT3A) and protein arginine methyltransferase 5 (PRMT5) from the HBG promoters, mediating allele-biased γ-globin elevation by facilitating demethylation of HBG core promoter CpG sites in erythroid progenitor cells from β-thalassemia persons. The present study demonstrates that this common rSNP in the proximal A γ-promoter is a major genetic modifier capable of ameliorating the severity of thalassemia major through the epigenetic-mediated regulation of the delayed fetal-to-adult Hb switch and provides potential targets for the treatment of β-hemoglobinopathy. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Diverse hematological phenotypes of β-thalassemia carriers.

PubMed

Luo, Hong-Yuan; Chui, David H K

2016-03-01

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

Whole-Genome Duplication and the Functional Diversification of Teleost Fish Hemoglobins

PubMed Central

Opazo, Juan C.; Butts, G. Tyler; Nery, Mariana F.; Storz, Jay F.; Hoffmann, Federico G.

2013-01-01

Subsequent to the two rounds of whole-genome duplication that occurred in the common ancestor of vertebrates, a third genome duplication occurred in the stem lineage of teleost fishes. This teleost-specific genome duplication (TGD) is thought to have provided genetic raw materials for the physiological, morphological, and behavioral diversification of this highly speciose group. The extreme physiological versatility of teleost fish is manifest in their diversity of blood–gas transport traits, which reflects the myriad solutions that have evolved to maintain tissue O2 delivery in the face of changing metabolic demands and environmental O2 availability during different ontogenetic stages. During the course of development, regulatory changes in blood–O2 transport are mediated by the expression of multiple, functionally distinct hemoglobin (Hb) isoforms that meet the particular O2-transport challenges encountered by the developing embryo or fetus (in viviparous or oviparous species) and in free-swimming larvae and adults. The main objective of the present study was to assess the relative contributions of whole-genome duplication, large-scale segmental duplication, and small-scale gene duplication in producing the extraordinary functional diversity of teleost Hbs. To accomplish this, we integrated phylogenetic reconstructions with analyses of conserved synteny to characterize the genomic organization and evolutionary history of the globin gene clusters of teleosts. These results were then integrated with available experimental data on functional properties and developmental patterns of stage-specific gene expression. Our results indicate that multiple α- and β-globin genes were present in the common ancestor of gars (order Lepisoteiformes) and teleosts. The comparative genomic analysis revealed that teleosts possess a dual set of TGD-derived globin gene clusters, each of which has undergone lineage-specific changes in gene content via repeated duplication and deletion events. Phylogenetic reconstructions revealed that paralogous genes convergently evolved similar functional properties in different teleost lineages. Consistent with other recent studies of globin gene family evolution in vertebrates, our results revealed evidence for repeated evolutionary transitions in the developmental regulation of Hb synthesis. PMID:22949522

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

PubMed Central

Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

2013-01-01

Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

β-Thalassemia.

PubMed

Origa, Raffaella

2017-06-01

β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

Sickle cell disease caused by heterozygosity for Hb S and novel LCR deletion: Report of two patients.

PubMed

Koenig, Sara C; Becirevic, Esmira; Hellberg, Miriam S C; Li, Michael Y; So, Jason C C; Hankins, Jane S; Ware, Russell E; McMahon, Lillian; Steinberg, Martin H; Luo, Hong-Yuan; Chui, David H K

2009-09-01

The b-globin gene LCR is located approximately 6 kb upstream of the embryonic epsilon-globin gene, and is made up of five DNase I hypersensitive sites (HSs), HS 1-5. LCR plays a pivotal role in regulating the expression of downstream epsilon-, (G)gamma-, (A)gamma-, delta-, and beta-globin genes in cis [1]. Deletions removing the LCR and parts of the downstream beta-globin gene cluster in patients have been described [2]. These individuals present with a (gammadeltabeta)0-thalassemia carrier phenotype. We now report two patients with severe sickle cell disease who were compound heterozygous for Hb S mutation and novel LCR deletion. In one case, HS 1-3 were deleted; in the other, HS 1-5 were deleted. In both cases, the b-like globin genes in cis to the LCR deletions were intact. Genotypically, both patients appeared to have sickle cell trait. Coinherited with either LCR deletion, these individuals presented as sickle cell disease patients. The breakpoints of these LCR deletions were defined. These results affirm that HS 2 and 3 are primarily responsible for conferring erythroid specific high-level expression of cis-linked beta-like globin genes. Furthermore, LCR deletions might cause hemolytic disease of newborns.

Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

PubMed

Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

2017-03-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PubMed

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

2006-07-28

Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

PubMed

Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

2018-02-28

Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite isomerisation in vitro, indicating its potential role in the scavenging of reactive nitrogen species. Here we present in vitro evidence for the detoxification of NO by Ph-2/2HbO-2217. Copyright © 2017. Published by Elsevier Inc.

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

Structural polymorphism at LCR and its role in beta-globin gene regulation.

PubMed

Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree

2010-09-01

Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Stimulation of globin synthesis: relative responsiveness of reticulocytes and nucleated erythroid cells

PubMed Central

Waxman, Herbert S.

1970-01-01

The effects of iron, cobalt, hemin, and plasma on hemoglobin synthesis by suspensions of rabbit reticulocytes and nucleated bone marrow cells were studied. L-Leucine-14C and sodium pyruvate-3-14C were employed to measure globin and heme synthesis, respectively. Normal plasma (or serum) was found to stimulate the rate of globin synthesis in both systems. The stimulatory effects of iron and hemin were additive to those of plasma or serum only in the reticulocytes. Cobaltous ion, at concentrations less than 1.0 mmole/liter, was found to stimulate globin synthesis by reticulocytes as effectively as ferrous ion; cobalt was inhibitory only at concentrations greater than 3.0-5.0 mmoles/liter. Heme synthesis by reticulocytes was inhibited at all concentrations employed (0.2-5.0 mmoles/liter). In bone marrow nucleated erythroid cells, globin synthesis was markedly enhanced by exogenous hemin. In contrast to reticulocytes, however, bone marrow cells were unresponsive to either cobalt or transferrin-bound iron. Possible implications of these findings on regulation of the rate and mechanism of iron uptake and hemoglobin synthesis in vivo are discussed. PMID:5443172

Thalassemia

MedlinePlus

... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

PubMed

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

Developmental regulation of DNA replication timing at the human beta globin locus.

PubMed

Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

2001-11-01

The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

PubMed

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

PubMed

Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

2016-12-01

The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

NASA Astrophysics Data System (ADS)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

AHSP: a novel hemoglobin helper

PubMed Central

Bank, Arthur

2007-01-01

Recently, the small protein α hemoglobin–stabilizing protein (AHSP) was identified and found to specifically bind α-globin, stabilize its structure, and limit the toxic effects of excess α-globin, which are manifest in the inherited blood disorder β thalassemia. In this issue of the JCI, Yu, Weiss, and colleagues show that AHSP is also critical to the formation and stabilization of normal amounts of hemoglobin, even when α-globin is deficient, indicating unique and previously unidentified roles for this molecule (see the related article beginning on page 1856). PMID:17607349

DOE Office of Scientific and Technical Information (OSTI.GOV)

Louie, E.; Dietz, L.; Shafer, F.

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

Genetics Home Reference: sickle cell disease

MedlinePlus

... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Hemoglobins, Hemorphins, and 11p15.5 Chromosomal Region in Cancer Biology and İmmunity with Special Emphasis for Brain Tumors.

PubMed

Altinoz, Meric Adil; Elmaci, Ilhan; Ince, Bahri; Ozpinar, Aysel; Sav, Aydin Murat

2016-05-01

In systemic cancers, increased hemolysis leads to extracellular hemoglobin (HB), and experimental studies have shown its provoking role on tumor growth and metastasis. However, investigations have shown that HB chains presented by tumor vascular pericytes or serum protein complexes of HB could also induce antitumor immunity, which may be harnessed to treat refractory cancers and brain tumors. Mounting recent evidence shows that expression of HBs is not restricted to erythrocytes and that HBs exist in the cells of lung and kidney, in macrophages, and in neurons and glia of the central nervous system (CNS). HBs mediate coping with hypoxia and free radical stress in normal and tumor cells, and they are increased in certain tumors including breast, lung, colon, and squamous cell cancers. Recent studies showed HBs in meningioma, in the cyst fluid of craniopharyngioma, in the cerebrospinal fluid (CSF) of pediatric patients with posterior fossa tumors, and in glioblastoma cell lines. Hemorphins, abundant brain peptides formed via HB-chain cleavage, exert opioid activity and antiproliferative and immunomodifier effects. Hence mutations in HBs may modify brain tumorigenesis via influencing hemorphins and perturbing regulations of immune surveillance and cell growth in the neuroectodermal tissues. The β-globin gene cluster resides in the chromosome region 11p15.5, harboring important immunity genes and IGF2, H19, PHLDA2/TSSC3, TRIM3, and SLC22A18 genes associated with cancers and gliomas. 11p15.5 is a prominent region subject to epigenetic regulation. Thus the β-globin loci may exert haplotypal interactions with these. Some clues support this theory. It is well established that iron load induces liver cancer in thalassemia major; however iron load-independent associations also exist. Enhanced rates of hematologic malignancies are associated with HB Lepore, association of hemoglobin E with cholangiocarcinoma, and enhanced gastric cancer rates in the thalassemia trait. In the African Herero population, a mutant form of δ-globin is very prevalent, and this population has higher rates of pediatric brain tumors. Globins are also expressed in healthy endothelia and in tumoral vessels, indicating potential involvement in angiogenesis. Studies on HBs and their cleavage peptides in cancers and brain tumors may lead to innovative treatment strategies. Georg Thieme Verlag KG Stuttgart · New York.

Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

PubMed Central

Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

2010-01-01

Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

PubMed

Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

2005-08-01

Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

Recombinase-Mediated Cassette Exchange Using Adenoviral Vectors.

PubMed

Kolb, Andreas F; Knowles, Christopher; Pultinevicius, Patrikas; Harbottle, Jennifer A; Petrie, Linda; Robinson, Claire; Sorrell, David A

2017-01-01

Site-specific recombinases are important tools for the modification of mammalian genomes. In conjunction with viral vectors, they can be utilized to mediate site-specific gene insertions in animals and in cell lines which are difficult to transfect. Here we describe a method for the generation and analysis of an adenovirus vector supporting a recombinase-mediated cassette exchange reaction and discuss the advantages and limitations of this approach.

Understanding the kinetics of ligand binding to globins with molecular dynamics simulations: the necessity of multiple state models.

PubMed

Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel

2015-10-01

Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.

Diagnostic difficulty of beta-thalassemia syndrome in a multi-transfused patient: contribution of myelogram and studying parents.

PubMed

Trawinski, Élisabeth; Fenneteau, Odile; Le Mouel, Lou; Ithier, Ghislaine; Couque, Nathalie

2017-10-01

We report the case of a 5 year old, initially followed for congenital sideroblastic anemia, whose explorations reveal a complex family hemoglobinopathy. Myelogram performed in children, reveals dystrophic mature erythroblasts with hemoglobinization defect and basophil punctuations. These abnormalities point towards an abnormal synthesis of heme or globin chains. Iterative transfusions in child do not allow interpreting a search for abnormal hemoglobin. However, the analysis carried out in his parents, with increased HBA2 rate and microcytosis concluded in beta-thalassemia trait for father and mother. Knowing that beta-thalassemia syndrome is a genetic condition, usually recessive, the presence of beta-thalassemia trait in parents is in favor of a beta-thalassemia syndrome in child. This diagnostic hypothesis is confirmed by molecular study of globin genes that will reveal a complex hemoglobinopathie for all family's members. The parents are carriers for heterozygous mutation of β + thalassemia that the sick child presents in homozygous state supporting the diagnosis of beta-thalassemia syndrome. Moreover, a triple α globin gene is present respectively at heterozygous state for mother and at homozygous state for father and child. The triple α globin gene is a known factor of aggravation of beta-thalassemia and this clinical case with continuum observed, perfectly illustrates the intricacies between α and β globin genes.

Hemoglobin genetics: recent contributions of GWAS and gene editing

PubMed Central

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

β-Globin chain abnormalities with coexisting α-thalassemia mutations

PubMed Central

Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction The frequency of hemoglobinopathies is still high in Adana, the biggest city of the Cukurova Region that is located in the southern part of Turkey. Our aim was to identify the concomitant mutations in α- and β-globin genes which lead to complex hemoglobinopathies and to establish an appropriate plan of action for each subject, particularly when prenatal diagnosis is necessary. Material and methods We studied the association between the β-globin gene and α-thalassemia genotypes. The reverse hybridization technique was employed to perform molecular analysis, and the results were confirmed by amplification refractory mutation system (ARMS) or restriction fragment length polymorphism (RFLP) technique. Results We evaluated 36 adult subjects (28 female and 8 male; age range: 18-52 years) with concomitant mutations in their α- and β-globin genes. The –α3.7/αα deletion was the commonest defect in the α-chain as expected, followed by α3.7/–α3.7 deletion. Twenty-five of 36 cases were sickle cell trait with coexisting α-thalassemia, while seven Hb S/S patients had concurrent mutations in their α-genes. The coexistence of αPolyA-2α/αα with Hb A/D and with Hb S/D, which is very uncommon, was also detected. There was a subject with compound heterozygosity for β-globin chain (–α3.7/αα with IVSI.110/S), and also a case who had –α3.7/αα deletion with IVSI.110/A. Conclusions Although limited, our data suggest that it would be valuable to study coexisting α-globin mutations in subjects with sickle cell disease or β-thalassemia trait during the screening programs for premarital couples, especially in populations with a high frequency of hemoglobinopathies. PMID:23056075

Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

PubMed Central

Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

2012-01-01

Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

Protein adducts as biomarkers of exposure to aromatic diisocyanates in workers manufacturing polyurethane (PUR) foam.

PubMed

Säkkinen, Kirsi; Tornaeus, Jarkko; Hesso, Antti; Hirvonen, Ari; Vainio, Harri; Norppa, Hannu; Rosenberg, Christina

2011-04-01

This work was undertaken to investigate the usefulness of diisocyanate-related protein adducts in blood samples as biomarkers of occupational exposure to toluene diisocyanate (TDI; 2,4- and 2,6-isomers) and 4,4'-methylenediphenyl diisocyanate (MDI). Quantification of adducts as toluene diamines (TDAs) and methylenedianiline (MDA) was performed on perfluoroacylated derivatives by gas chromatography-mass spectrometry (GC-MS/MS) in negative chemical ionisation mode. TDI-derived adducts were found in 77% of plasma and in 59% of globin samples from exposed workers manufacturing flexible polyurethane foam. The plasma levels ranged from 0.003 to 0.58 nmol mL(-1) and those in globin from 0.012 to 0.33 nmol g(-1). The 2,6-isomer amounted to about two-thirds of the sum concentration of TDA isomers. MDI-derived adducts were detected in 3.5% of plasma and in 7% of globin samples from exposed workers manufacturing rigid polyurethane foam. A good correlation was found between the sum of TDA isomers in urine and that in plasma. The relationship between globin adducts and urinary metabolites was ambiguous. Monitoring TDI-derived TDA in plasma thus appears to be an appropriate method for assessing occupational exposure. Contrary to TDI exposure, adducts in plasma or globin were not useful in assessing workers' exposure to MDI. An important outcome of the study was that no amine-related adducts were detected in globin samples from TDI- or MDI-exposed workers, alleviating concerns that TDI or MDI might pose a carcinogenic hazard. Further studies are nevertheless required to judge whether diisocyanates per se could be such a hazard.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

PubMed Central

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

PubMed

Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2017-01-01

The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

PubMed Central

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

PubMed

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

PubMed

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

Computational model of a vector-mediated epidemic

NASA Astrophysics Data System (ADS)

Dickman, Adriana Gomes; Dickman, Ronald

2015-05-01

We discuss a lattice model of vector-mediated transmission of a disease to illustrate how simulations can be applied in epidemiology. The population consists of two species, human hosts and vectors, which contract the disease from one another. Hosts are sedentary, while vectors (mosquitoes) diffuse in space. Examples of such diseases are malaria, dengue fever, and Pierce's disease in vineyards. The model exhibits a phase transition between an absorbing (infection free) phase and an active one as parameters such as infection rates and vector density are varied.

Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

PubMed

Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

Vectorization of morpholino oligomers by the (R-Ahx-R)4 peptide allows efficient splicing correction in the absence of endosomolytic agents.

PubMed

Abes, Saïd; Moulton, Hong M; Clair, Philippe; Prevot, Paul; Youngblood, Derek S; Wu, Rebecca P; Iversen, Patrick L; Lebleu, Bernard

2006-12-01

The efficient and non-toxic nuclear delivery of steric-block oligonucleotides (ON) is a prerequisite for therapeutic strategies involving splice correction or exon skipping. Cationic cell penetrating peptides (CPPs) have given rise to much interest for the intracellular delivery of biomolecules, but their efficiency in promoting cytoplasmic or nuclear delivery of oligonucleotides has been hampered by endocytic sequestration and subsequent degradation of most internalized material in endocytic compartments. In the present study, we compared the splice correction activity of three different CPPs conjugated to PMO(705), a steric-block ON targeted against the mutated splicing site of human beta-globin pre-mRNA in the HeLa pLuc705 splice correction model. In contrast to Tat48-60 (Tat) and oligoarginine (R(9)F(2)) PMO(705) conjugates, the 6-aminohexanoic-spaced oligoarginine (R-Ahx-R)(4)-PMO(705) conjugate was able to promote an efficient splice correction in the absence of endosomolytic agents. Our mechanistic investigations about its uptake mechanisms lead to the conclusion that these three vectors are internalized using the same endocytic route involving proteoglycans, but that the (R-Ahx-R)(4)-PMO(705) conjugate has the unique ability to escape from lysosomial fate and to access to the nuclear compartment. This vector, which has displays an extremely low cytotoxicity, the ability to function without chloroquine adjunction and in the presence of serum proteins. It thus offers a promising lead for the development of vectors able to enhance the delivery of therapeutic steric-block ON in clinically relevant models.

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

EXPERIMENTAL STUDIES IN ACUTE RENAL FAILURE

PubMed Central

Menefee, Max G.; Mueller, C. Barber; Miller, Tracy B.; Myers, Joseph K.; Bell, Allen L.

1964-01-01

When purified human globin is injected intravenously into rats it produces acute renal failure characterized by tubular casts and oliguria. The globin is identifiable within vesicles and channels in the cytoplasm of the proximal tubules, through which it passes from lumen to basal side with no apparent serious effect on the cells. When a very minimal amount of globin is taken up by cells of the distal limb of Henle's loop or distal tubules (lower nephron), a markedly deleterious effect is apparent and the cells die within a short time. The mixture of cell debris and precipitated globin forms plugs within the confines of the basement membranes of the former distal limbs and distal tubules. After a number of lower nephrons are plugged a disruption of proximal tubules is found, which apparently results from the effect of back pressure in the obstructed nephrons. We suggest that any amount in excess of a low threshold of globin, either alone or combined with heme or related material, has a toxic effect on lower nephron cells. Once initiated, the toxic effect is not reversible and the resulting plug of debris and precipitate will occlude the lumen. If a sufficient number of nephrons are made non-functional the animal becomes anuric; otherwise it is oliguric. A high rate of urine flow will protect against the excess absorption of material and thus against acute renal failure. PMID:14238931

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

Search for dark matter produced with an energetic jet or a hadronically decaying W or Z boson at $$\\sqrt{s}=13 $$ TeV

DOE PAGES

Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...

2017-07-05

A search for dark matter particles is performed using events with large missing transverse momentum, at least one energetic jet, and no leptons, in proton-proton collisions atmore » $$ \\sqrt{s}=13 $$ TeV collected with the CMS detector at the LHC. The data sample corresponds to an integrated luminosity of 12.9 fb -1. The search includes events with jets from the hadronic decays of a W or Z boson. The data are found to be in agreement with the predicted background contributions from standard model processes. The results are presented in terms of simplified models in which dark matter particles are produced through interactions involving a vector, axial-vector, scalar, or pseudoscalar mediator. Vector and axial-vector mediator particles with masses up to 1.95 TeV, and scalar and pseudoscalar mediator particles with masses up to 100 and 430 GeV respectively, are excluded at 95% confidence level. The results are also interpreted in terms of the invisible decays of the Higgs boson, yielding an observed (expected) 95% confidence level upper limit of 0.44 (0.56) on the corresponding branching fraction. The results of this search provide the strongest constraints on the dark matter pair production cross section through vector and axial-vector mediators at a particle collider. When compared to the direct detection experiments, the limits obtained from this search provide stronger constraints for dark matter masses less than 5, 9, and 550 GeV, assuming vector, scalar, and axial-vector mediators, respectively. In conclusion, the search yields stronger constraints for dark matter masses less than 200 GeV, assuming a pseudoscalar mediator, when compared to the indirect detection results from Fermi-LAT.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirunyan, A. M.; Tumasyan, A.; Adam, W.

A search for dark matter particles is performed using events with large missing transverse momentum, at least one energetic jet, and no leptons, in proton-proton collisions atmore » $$ \\sqrt{s}=13 $$ TeV collected with the CMS detector at the LHC. The data sample corresponds to an integrated luminosity of 12.9 fb -1. The search includes events with jets from the hadronic decays of a W or Z boson. The data are found to be in agreement with the predicted background contributions from standard model processes. The results are presented in terms of simplified models in which dark matter particles are produced through interactions involving a vector, axial-vector, scalar, or pseudoscalar mediator. Vector and axial-vector mediator particles with masses up to 1.95 TeV, and scalar and pseudoscalar mediator particles with masses up to 100 and 430 GeV respectively, are excluded at 95% confidence level. The results are also interpreted in terms of the invisible decays of the Higgs boson, yielding an observed (expected) 95% confidence level upper limit of 0.44 (0.56) on the corresponding branching fraction. The results of this search provide the strongest constraints on the dark matter pair production cross section through vector and axial-vector mediators at a particle collider. When compared to the direct detection experiments, the limits obtained from this search provide stronger constraints for dark matter masses less than 5, 9, and 550 GeV, assuming vector, scalar, and axial-vector mediators, respectively. In conclusion, the search yields stronger constraints for dark matter masses less than 200 GeV, assuming a pseudoscalar mediator, when compared to the indirect detection results from Fermi-LAT.« less

Correlations between oxygen affinity and sequence classifications of plant hemoglobins

USDA-ARS?s Scientific Manuscript database

Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full length globins with the classical 8 helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobin...

AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

PubMed Central

White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

2013-01-01

RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

The Use of Transcription Terminators to Generate Transgenic Lines of Chinese Hamster Ovary Cells (CHO) with Stable and High Level of Reporter Gene Expression.

PubMed

Gasanov, N B; Toshchakov, S V; Georgiev, P G; Maksimenko, O G

2015-01-01

Mammalian cell lines are widely used to produce recombinant proteins. Stable transgenic cell lines usually contain many insertions of the expression vector in one genomic region. Transcription through transgene can be one of the reasons for target gene repression after prolonged cultivation of cell lines. In the present work, we used the known transcription terminators from the SV40 virus, as well as the human β- and γ-globin genes, to prevent transcription through transgene. The transcription terminators were shown to increase and stabilize the expression of the EGFP reporter gene in transgenic lines of Chinese hamster ovary (CHO) cells. Hence, transcription terminators can be used to create stable mammalian cells with a high and stable level of recombinant protein production.

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

Pathophysiology and Clinical Manifestations of the β-Thalassemias

PubMed Central

Nienhuis, Arthur W.; Nathan, David G.

2012-01-01

The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

Genotoxicity of retroviral hematopoietic stem cell gene therapy

PubMed Central

Trobridge, Grant D

2012-01-01

Introduction Retroviral vectors have been developed for hematopoietic stem cell (HSC) gene therapy and have successfully cured X-linked severe combined immunodeficiency (SCID-X1), adenosine deaminase deficiency (ADA-SCID), adrenoleukodystrophy, and Wiskott-Aldrich syndrome. However, in HSC gene therapy clinical trials, genotoxicity mediated by integrated vector proviruses has led to clonal expansion, and in some cases frank leukemia. Numerous studies have been performed to understand the molecular basis of vector-mediated genotoxicity with the aim of developing safer vectors and safer gene therapy protocols. These genotoxicity studies are critical to advancing HSC gene therapy. Areas covered This review provides an introduction to the mechanisms of retroviral vector genotoxicity. It also covers advances over the last 20 years in designing safer gene therapy vectors, and in integration site analysis in clinical trials and large animal models. Mechanisms of retroviral-mediated genotoxicity, and the risk factors that contribute to clonal expansion and leukemia in HSC gene therapy are introduced. Expert opinion Continued research on virus–host interactions and next-generation vectors should further improve the safety of future HSC gene therapy vectors and protocols. PMID:21375467

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Popp, D.M.; Johnson, F.M.

Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

PubMed

Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

2017-12-22

The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

PubMed

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

A Systematic Review of Known Mechanisms of Hydroxyurea-induced Foetal Haemoglobin for Treatment of Sickle Cell Disease

PubMed Central

Pule, Gift D.; Mowla, Shaheen; Novitzky, Nicolas; Wiysonge, Charles S.; Wonkam, Ambroise

2016-01-01

Aims To report on molecular mechanisms of foetal haemoglobin (HbF) induction by hydroxyurea (HU) for the treatment of Sickle Cell Disease (SCD). Study Design Systematic review. Results Studies have provided consistent associations between genomic variations in HbF-promoting loci and variable HbF level in response to HU. Numerous signal transduction pathways have been implicated, through the identification of key genomic variants in BCL11A, HBS1L-MYB, SAR1 or XmnI polymorphism that predispose the response to the treatment, and signal transduction pathways, that modulate γ-globin expression (cAMP/cGMP; Giα/JNK/Jun; methylation and microRNA). Three main molecular pathways have been reported: 1) Epigenetic modifications, transcriptional events and signalling pathways involved in HU-mediated response, 2) Signalling pathways involving HU-mediated response and 3) Post-transcriptional pathways (regulation by microRNAs). Conclusions The complete picture of HU-mediated mechanisms of HbF production in SCD remains elusive. Research on post-transcriptional mechanisms could lead to therapeutic targets that may minimize alterations to the cellular transcriptome. PMID:26327494

A systematic review of known mechanisms of hydroxyurea-induced fetal hemoglobin for treatment of sickle cell disease.

PubMed

Pule, Gift D; Mowla, Shaheen; Novitzky, Nicolas; Wiysonge, Charles S; Wonkam, Ambroise

2015-10-01

To report on molecular mechanisms of fetal hemoglobin (HbF) induction by hydroxyurea (HU) for the treatment of sickle cell disease. Systematic review. Studies have provided consistent associations between genomic variations in HbF-promoting loci and variable HbF level in response to HU. Numerous signal transduction pathways have been implicated, through the identification of key genomic variants in BCL11A, HBS1L-MYB, SAR1 or XmnI polymorphism that predispose the response to the treatment, and signal transduction pathways that modulate γ-globin expression (cAMP/cGMP; Giα/c-Jun N-terminal kinase/Jun; methylation and miRNA). Three main molecular pathways have been reported: i) Epigenetic modifications, transcriptional events and signaling pathways involved in HU-mediated response, ii) Signaling pathways involving HU-mediated response and iii) Post-transcriptional pathways (regulation by miRNAs). The complete picture of HU-mediated mechanisms of HbF production in Sickle Cell Disease remains elusive. Research on post-transcriptional mechanisms could lead to therapeutic targets that may minimize alterations to the cellular transcriptome.

Erythroid Promoter Confines FGF2 Expression to the Marrow after Hematopoietic Stem Cell Gene Therapy and Leads to Enhanced Endosteal Bone Formation

PubMed Central

Meng, Xianmei; Baylink, David J.; Sheng, Matilda; Wang, Hongjie; Gridley, Daila S.; Lau, K.-H. William; Zhang, Xiao-Bing

2012-01-01

Fibroblast growth factor-2 (FGF2) has been demonstrated to be a promising osteogenic factor for treating osteoporosis. Our earlier study shows that transplantation of mouse Sca-1+ hematopoietic stem/progenitor cells that are engineered to express a modified FGF2 leads to considerable endosteal/trabecular bone formation, but it also induces adverse effects like hypocalemia and osteomalacia. Here we report that the use of an erythroid specific promoter, β-globin, leads to a 5-fold decrease in the ratio of serum FGF2 to the FGF2 expression in the marrow cavity when compared to the use of a ubiquitous promoter spleen focus-forming virus (SFFV). The confined FGF2 expression promotes considerable trabeculae bone formation in endosteum and does not yield anemia and osteomalacia. The avoidance of anemia in the mice that received Sca1+ cells transduced with FGF2 driven by the β-globin promoter is likely due to attenuation of high-level serum FGF2-mediated stem cell mobilization observed in the SFFV-FGF2 animals. The prevention of osteomalacia is associated with substantially reduced serum Fgf23/hypophosphatemia, and less pronounced secondary hyperparathyroidism. Our improved stem cell gene therapy strategy represents one step closer to FGF2-based clinical therapy for systemic skeletal augmentation. PMID:22629419

Antibody-mediated targeting of replication-competent retroviral vectors.

PubMed

Tai, Chien-Kuo; Logg, Christopher R; Park, Jinha M; Anderson, W French; Press, Michael F; Kasahara, Noriyuki

2003-05-20

Replication-competent murine leukemia virus (MLV) vectors can be engineered to achieve high efficiency gene transfer to solid tumors in vivo and tumor-restricted replication, however their safety can be further enhanced by redirecting tropism of the virus envelope. We have therefore tested the targeting capability and replicative stability of ecotropic and amphotropic replication-competent retrovirus (RCR) vectors containing two tandem repeats from the immunoglobulin G-binding domain of Staphylococcal protein A inserted into the proline-rich "hinge" region of the envelope, which enables modular use of antibodies of various specificities for vector targeting. The modified envelopes were efficiently expressed and incorporated into virions, were capable of capturing monoclonal anti-HER2 antibodies, and mediated efficient binding of the virus-antibody complex to HER2-positive target cells. While infectivity was markedly reduced by pseudotyping with targeted envelopes alone, coexpression of wild-type envelope rescued efficient cellular entry. Both ecotropic and amphotropic RCR vector/anti-HER2 antibody complexes achieved significant enhancement of transduction on murine target cells overexpressing HER2, which could be competed by preincubation with excess free antibodies. Interestingly, HER2-expressing human breast cancer cells did not show enhancement of transduction despite efficient antibody-mediated cell surface binding, suggesting that target cell-specific parameters markedly affect the efficiency of post-binding entry processes. Serial replication of targeted vectors resulted in selection of Z domain deletion variants, but reduction of the overall size of the vector genome enhanced its stability. Application of antibody-mediated targeting to the initial localization of replication-competent virus vectors to tumor sites will thus require optimized target selection and vector design.

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNAmore » expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.« less

Characterising dark matter searches at colliders and direct detection experiments: Vector mediators

DOE PAGES

Buchmueller, Oliver; Dolan, Matthew J.; Malik, Sarah A.; ...

2015-01-09

We introduce a Minimal Simplified Dark Matter (MSDM) framework to quantitatively characterise dark matter (DM) searches at the LHC. We study two MSDM models where the DM is a Dirac fermion which interacts with a vector and axial-vector mediator. The models are characterised by four parameters: m DM, M med , g DM and g q, the DM and mediator masses, and the mediator couplings to DM and quarks respectively. The MSDM models accurately capture the full event kinematics, and the dependence on all masses and couplings can be systematically studied. The interpretation of mono-jet searches in this framework canmore » be used to establish an equal-footing comparison with direct detection experiments. For theories with a vector mediator, LHC mono-jet searches possess better sensitivity than direct detection searches for light DM masses (≲5 GeV). For axial-vector mediators, LHC and direct detection searches generally probe orthogonal directions in the parameter space. We explore the projected limits of these searches from the ultimate reach of the LHC and multi-ton xenon direct detection experiments, and find that the complementarity of the searches remains. In conclusion, we provide a comparison of limits in the MSDM and effective field theory (EFT) frameworks to highlight the deficiencies of the EFT framework, particularly when exploring the complementarity of mono-jet and direct detection searches.« less

Telomerase-mediated life-span extension of human primary fibroblasts by human artificial chromosome (HAC) vector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko

2008-05-09

Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-{beta}-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 daysmore » after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells.« less

Chromosomal integration of adenoviral vector DNA in vivo.

PubMed

Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan

2010-10-01

So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

PubMed

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

PubMed

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Hydroxyurea therapy requires HbF induction for clinical benefit in a sickle cell mouse model

PubMed Central

Lebensburger, Jeffrey D.; Pestina, Tamara I.; Ware, Russell E.; Boyd, Kelli L.; Persons, Derek A.

2010-01-01

Hydroxyurea has proven clinical efficacy in patients with sickle cell disease. Potential mechanisms for the beneficial effects include fetal hemoglobin induction and the reduction of cell adhesive properties, inflammation and hypercoagulability. Using a murine model of sickle cell disease in which fetal hemoglobin induction does not occur, we evaluated whether hydroxyurea administration would still yield improvements in hematologic parameters and reduce end-organ damage. Animals given a maximally tolerated dose of hydroxyurea that resulted in significant reductions in the neutrophil and platelet counts showed no improvement in hemolytic anemia and end-organ damage compared to control mice. In contrast, animals having high levels of fetal hemoglobin due to gene transfer with a γ-globin lentiviral vector showed correction of anemia and organ damage. These data suggest that induction of fetal hemoglobin by hydroxyurea is an essential mechanism for its clinical benefits. PMID:20378564

Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

PubMed

Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

2007-01-01

A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

PubMed

Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

2017-01-01

Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

PubMed

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

PubMed

Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

2014-01-01

The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

PubMed

Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

2017-01-01

Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

PubMed Central

Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

1985-01-01

A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

PubMed

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ryan, Q.C.

There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

Annual Research Progress Report.

DTIC Science & Technology

1979-09-30

will be trained in SLRL test procedures and the methodology will be developed for the incorporation of test materials into the standard rearing diet ...requirements exist for system software maintenance and development of software to report dosing data, to calculate diet preparation data, to manage collected...influence of diet and exercise on myo- globin and metmyoglobin reductase were evaluated in the rat. The activity of inetmyo- globin reductase was

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

PubMed

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

An intriguing high performance liquid chromatogram of a double heterozygosity for Hb Q-India/Hb D-Punjab.

PubMed

Badyal, Rama Kumari; Chhabra, Sanjeev; Sharma, Prashant; Das, Reena

2014-01-01

Cation exchange high performance liquid chromatography (HPLC) is commonly utilized as the first method of screening for thalassemias and hemoglobinopathies worldwide. This method of diagnosis requires knowledge of the clinical background and complete blood counts as well as skill and experience in interpreting the sometimes complex results produced. An asymptomatic 27-year-old pregnant North Indian woman was found to have a highly unusual chromatographic pattern with multiple unexpected peaks during routine antenatal screening. Most concerning was a C-window peak as Hb C (HBB: c.19G>A) is rare in ethnic Asian Indian populations. Cellulose acetate electrophoresis at alkaline pH (8.6) and parental screening were performed. These revealed the correct diagnosis to be a double heterozygosity for Hb Q-India (HBA1: c.193G>C) (an uncommon asymptomatic α-globin chain variant) plus Hb D-Punjab (HBB: c.364G>C) (a β-globin chain variant that is common in this region and is asymptomatic in the heterozygous state). The unexpected C-window peak was the hybrid of the abnormal α-Q-India and β-D-Punjab globin chains. Another small peak was explained as a variant Hb A2 formed by the combination of α-Q-India and δ-globin chains. Hematopathologists should be cognizant of the complex pattern resulting from coinheritance of both α- and β-globin structural variants. Second-line testing and parental testing are invaluable in resolving unknown peaks, especially if rare or unexpected variants are being considered. Although both Hb Q-India and Hb D-Punjab are relatively common in northwestern India, to the best of our knowledge, only two recent reports describe a total of three cases of such diagnostically puzzling coinheritance.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

PubMed

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

PubMed

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

PubMed

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

High Risk Behaviors in Marine Mammals: Linking Behavioral Responses to Anthropogenic Disturbance to Biological Consequences

DTIC Science & Technology

2014-09-30

98) Prescribed by ANSI Std Z39-18 2 injury via cardiovascular performance during submergence. Neuro -protection through globin deposition and...relationships for stroking costs, aerobic dive limits, types of neuro -protection (globin deposition, capillarity), and cardiac risk factors that will be mapped...Greenland. A custom built ECG recorder with 3- axis accelerometer recorder and pressure transducer was combined with retrieval transmitters (Argos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baserga, S.J.; Benz, E.J. Jr.

A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

PubMed

Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

2014-06-01

Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2–654 (C > T) mutation in β-thalassemia-derived iPSCs

PubMed Central

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-01-01

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases. PMID:26156589

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

PubMed

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-07-09

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

Homozygosity for the AATAAA > AATA- - Polyadenylation Site Mutation on the α2-Globin Gene Causing Transfusion-Dependent Hb H Disease in an Iranian Patient: A Case Report.

PubMed

Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein

2015-01-01

We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.

Light-induced protoporphyrin release from erythrocytes in erythropoietic protoporphyria.

PubMed Central

Sandberg, S; Brun, A

1982-01-01

The photohemolysis of normal erythrocytes incubated with protoporphyrin is reduced in the presence of albumin. When globin is added to normal erythrocytes loaded with protoporphyrin, protoporphyrin is bound to globin. During irradiation protoporphyrin moves from globin to the erythrocyte membrane and photohemolysis is initiated. Erythrocytes in patients with erythropoietic protoporphyria contain large amounts of protoporphyrin bound to hemoglobin. Upon irradiation of these cells in the absence of albumin, 40% of protoporphyrin and 80% of hemoglobin is released after 240 kJ/m2. The released protoporphyrin is hemoglobin bound. In contrast, when albumin is present only 8% of hemoglobin is released whereas protoporphyrin is released to 76%. The released protoporphyrin is albumin bound. A hypothesis for the release of erythrocyte protoporphyrin in erythropoietic protoporphyria without simultaneous hemolysis is proposed. Upon irradiation protoporphyrin photodamages its binding sites on hemoglobin, moves through the plasma membrane, and is bound to albumin in plasma. PMID:7107898

Pathophysiologically based drug treatment of sickle cell disease.

PubMed

Steinberg, Martin H

2006-04-01

Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.

Neuroglobin and cytoglobin: two new members of globin family

PubMed Central

Tosqui, Priscilla; Colombo, Marcio Francisco

2011-01-01

The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323

Comparison of different methods for erythroid differentiation in the K562 cell line.

PubMed

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Erythroid differentiation ability of butyric acid analogues: identification of basal chemical structures of new inducers of foetal haemoglobin.

PubMed

Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto

2015-04-05

Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.

Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

PubMed Central

Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

2010-01-01

Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

PubMed

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

PubMed

Balakrishnan, R; Bolten, B; Backman, K C

1994-01-28

A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

The effect of histone deacetylase inhibitors on AHSP expression

PubMed Central

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

Probing Low-Mass Vector Bosons with Parity Nonconservation and Nuclear Anapole Moment Measurements in Atoms and Molecules

NASA Astrophysics Data System (ADS)

Dzuba, V. A.; Flambaum, V. V.; Stadnik, Y. V.

2017-12-01

In the presence of P -violating interactions, the exchange of vector bosons between electrons and nucleons induces parity-nonconserving (PNC) effects in atoms and molecules, while the exchange of vector bosons between nucleons induces anapole moments of nuclei. We perform calculations of such vector-mediated PNC effects in Cs, Ba+ , Yb, Tl, Fr, and Ra+ using the same relativistic many-body approaches as in earlier calculations of standard-model PNC effects, but with the long-range operator of the weak interaction. We calculate nuclear anapole moments due to vector-boson exchange using a simple nuclear model. From measured and predicted (within the standard model) values for the PNC amplitudes in Cs, Yb, and Tl, as well as the nuclear anapole moment of 133Cs, we constrain the P -violating vector-pseudovector nucleon-electron and nucleon-proton interactions mediated by a generic vector boson of arbitrary mass. Our limits improve on existing bounds from other experiments by many orders of magnitude over a very large range of vector-boson masses.

The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

PubMed Central

Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

2004-01-01

Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

Familial congenital cyanosis caused by Hb-MYantai(α-76 GAC → TAC, Asp → Tyr)

PubMed Central

2010-01-01

Methemoglobin (Hb-M) is a rare hemoglobinopathy in China. We hereby report on a family living in Yantai, East China, with congenital cyanosis due to Hb-M mutation. The proband, a 65-year-old female, presented 63% oxygen saturation. Both Hb-M concentration and arterial oxygen saturation remained unchanged, even following intravenous treatment with methylene blue. There was also no change in blood-color (chocolate-brown) after adding 0.1% KCN. A fast-moving band (Hb-X) in hemolysates was found by cellulose acetate electrophoresis, the Hb-X/Hb-A ratio exceeding 10%. GT transition at 131nt of exon 2, although present in one of the α2 -globin alleles, was not found in α1 -globin alleles as a whole. This mutation leads to the aspartic acid to tyrosine substitution (Asp76Tyr). In this family, the novel mutation in the α2 -globin gene resulted in a rare form of congenital cyanosis due to Hb-M. This hemoglobin was named Hb-M Yantai . PMID:21637412

Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

PubMed

Thein, Swee Lay

2017-01-01

β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

PubMed

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

Detection of neuroendocrine tumors using promoter-specific secreted Gaussia luciferase.

PubMed

Tseng, Alan Wei-Shun; Akerstrom, Victoria; Chen, Chiachen; Breslin, Mary B; Lan, Michael S

2016-01-01

Accurate detection of neuroendocrine (NE) tumors is critically important for better prognosis and treatment outcomes in patients. To demonstrate the efficacy of using an adenoviral vector for the detection of NE tumors, we have constructed a pair of adenoviral vectors which, in combination, can conditionally replicate and release Gaussia luciferase into the circulation after infecting the NE tumors. The expression of these two vectors is regulated upstream by an INSM1-promoter (insulinoma-associated-1) that is specifically active in NE tumors and developing NE tissues, but silenced in normal adult tissues. In order to retain the tumor-specificity of the INSM1 promoter, we have modified the promoter using the core insulator sequence from the chicken β-globin HS4 insulator and the neuronal restrictive silencing element (NRSE). This modified INSM1-promoter can retain NE tumor specificity in an adenoviral construct while driving a mutated adenovirus E1A gene (∆24E1A), the Metridia, or Gaussia luciferase gene. The in vitro cell line and mouse xenograft human tumor studies revealed the NE specificity of the INSM1-promoter in NE lung cancer, neuroblastoma, medulloblastoma, retinoblastoma, and insulinoma. When we combined the INSM1-promoter driven Gaussia luciferase with ∆24E1A, the co-infected NE tumor secreted higher levels of Gaussia luciferase as compared to the INSM1p-Gaussia virus alone. In a mouse subcutaneous xenograft tumor model, the combination viruses secreted detectable level of Gaussia luciferase after infecting an INSM1-positive NE lung tumor for ≥12 days. Therefore, the INSM1-promoter specific conditional replicating adenovirus represents a sensitive diagnostic tool to aid clinicians in the detection of NE tumors.

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

PubMed Central

Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

2015-01-01

The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Evaluation and mechanism studies of PEGylated dendrigraft poly-L-lysines as novel gene delivery vectors.

PubMed

Huang, Rongqin; Liu, Shuhuan; Shao, Kun; Han, Liang; Ke, Weilun; Liu, Yang; Li, Jianfeng; Huang, Shixian; Jiang, Chen

2010-07-02

Dendrimers have attracted great interest in the field of gene delivery due to their synthetic controllability and excellent gene transfection efficiency. In this work, dendrigraft poly-L-lysines (DGLs) were evaluated as a novel gene vector for the first time. Derivatives of DGLs (generation 2 and 3) with different extents of PEGylation were successfully synthesized and used to compact pDNA as complexes. The result of gel retardation assay showed that pDNA could be effectively packed by all the vectors at a DGLs to pDNA weight ratio greater than 2. An increase in the PEGylation extent of vectors resulted in a decrease in the incorporation efficiency and cytotoxicity of complexes in 293 cells, which also decreased the zeta potential a little but did not affect the mean diameter of complexes. Higher generation of DGLs could mediate higher gene transfection in vitro. Confocal microscopy and cellular uptake inhibition studies demonstrated that caveolae-mediated process and macropinocytosis were involved in the cellular uptake of DGLs-based complexes. Also the results indicate that proper PEGylated DGLs could mediate efficient gene transfection, showing their potential as an alternate biodegradable vector in the field of nonviral gene delivery.

A versatile targeting system with lentiviral vectors bearing the biotin-adaptor peptide

PubMed Central

Morizono, Kouki; Xie, Yiming; Helguera, Gustavo; Daniels, Tracy R.; Lane, Timothy F.; Penichet, Manuel L.; Chen, Irvin S. Y.

2010-01-01

Background Targeted gene transduction in vivo is the ultimate preferred method for gene delivery. We previously developed targeting lentiviral vectors that specifically recognize cell surface molecules with conjugated antibodies and mediate targeted gene transduction both in vitro and in vivo. Although effective in some experimental settings, the conjugation of virus with antibodies is mediated by the interaction between protein A and the Fc region of antibodies, which is not as stable as covalent conjugation. We have now developed a more stable conjugation strategy utilizing the interaction between avidin and biotin. Methods We inserted the biotin-adaptor-peptide, which was biotinylated by secretory biotin ligase at specific sites, into our targeting envelope proteins, enabling conjugation of the pseudotyped virus with avidin, streptavidin or neutravidin. Results When conjugated with avidin-antibody fusion proteins or the complex of avidin and biotinylated targeting molecules, the vectors could mediate specific transduction to targeted cells recognized by the targeting molecules. When conjugated with streptavidin-coated magnetic beads, transduction by the vectors was targeted to the locations of magnets. Conclusions This targeting vector system can be used for broad applications of targeted gene transduction using biotinylated targeting molecules or targeting molecules fused with avidin. PMID:19455593

You can hide but you have to run: direct detection with vector mediators

NASA Astrophysics Data System (ADS)

D'Eramo, Francesco; Kavanagh, Bradley J.; Panci, Paolo

2016-08-01

We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some cases the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Finally, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.

Copolymers of poly-L-lysine with serine and tryptophan form stable DNA vectors: implications for receptor-mediated gene transfer.

PubMed

Gómez-Valadés, A G; Molas, M; Vidal-Alabró, A; Bermúdez, J; Bartrons, R; Perales, J C

2005-01-20

Inefficient gene transfer and poor stability in physiological medium are important shortcomings for receptor-mediated gene transfer vectors. Here, we evaluate vectors formulated with random copolymers of L-lysine/L-serine (3:1) and L-lysine/L-tryptophan (4:1), focusing on both their biophysical and functional characterization. By means of dynamic light scattering (DLS) and transmission electron microscopy (TEM), we demonstrate that poly-L-lysine (pK), poly-L-lysine-L-tryptophan (pKW) and poly-L-lysine-L-serine (pKS) are able to form compacted, small particles when mixed with plasmid DNA in the absence of salt. Upon dilution in physiological medium, copolymers of both lys/ser and lys/trp do not aggregate, in contrast with poly-L-lysine DNA complexes as determined by scattering, DLS and TEM measurements. Tight packing, as demonstrated by resistance to heparin, SDS and trypsin treatments, is also featured in tryptophan-containing complexes. Successful receptor-mediated endocytosis gene transfer using galactosylated copolymers into cells expressing the asiagloglycoprotein receptor correlated with lack of aggregation. Particles obtained using galactosylated poly-L-lysine-L-tryptophan (Gal-pKW) copolymer demonstrated specific receptor-mediated gene transfer since reporter gene activity dropped in the presence of an excess ligand in the culture medium during transfection. Although copolymers of galactosylated poly-L-lysine-L-serine (Gal-pKS) do not aggregate in the presence of salt, they are not able to internalize in a specific receptor-mediated endocytosis fashion. The introduction of bulky aromatic/hydrophobic (tryptophan) or hydrophillic (serine) moieties into the positively charged vectors allows the compacted particles to disperse into salt-containing medium avoiding salt-induced aggregation. Moreover, tryptophan-containing particles are able to mediate specific gene transfer via receptor-mediated endocytosis.

Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

PubMed Central

Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

1986-01-01

The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pirastu, M.; Galanello, R.; Doherty, M.A.

The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.

PubMed

Fowler, S J; Gill, P; Werrett, D J; Higgs, D R

1988-06-01

A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.

Host structural carbohydrate induces vector transmission of a bacterial plant pathogen.

PubMed

Killiny, Nabil; Almeida, Rodrigo P P

2009-12-29

Many insect-borne pathogens have complex life histories because they must colonize both hosts and vectors for successful dissemination. In addition, the transition from host to vector environments may require changes in gene expression before the pathogen's departure from the host. Xylella fastidiosa is a xylem-limited plant-pathogenic bacterium transmitted by leafhopper vectors that causes diseases in a number of economically important plants. We hypothesized that factors of host origin, such as plant structural polysaccharides, are important in regulating X. fastidiosa gene expression and mediating vector transmission of this pathogen. The addition of pectin and glucan to a simple defined medium resulted in dramatic changes in X. fastidiosa's phenotype and gene-expression profile. Cells grown in the presence of pectin became more adhesive than in other media tested. In addition, the presence of pectin and glucan in media resulted in significant changes in the expression of several genes previously identified as important for X. fastidiosa's pathogenicity in plants. Furthermore, vector transmission of X. fastidiosa was induced in the presence of both polysaccharides. Our data show that host structural polysaccharides mediate gene regulation in X. fastidiosa, which results in phenotypic changes required for vector transmission. A better understanding of how vector-borne pathogens transition from host to vector, and vice versa, may lead to previously undiscovered disease-control strategies.

Recombinant AAV-directed gene therapy for type I glycogen storage diseases

PubMed Central

Chou, JY; Mansfield, BC

2011-01-01

Introduction Glycogen storage disease (GSD) type Ia and Ib are disorders of impaired glucose homeostasis affecting the liver and kidney. GSD-Ib also affects neutrophils. Current dietary therapies cannot prevent long-term complications. In animal studies, recombinant adeno-associated virus (rAAV) vector-mediated gene therapy can correct or minimize multiple aspects of the disorders, offering hope for human gene therapy. Areas covered A summary of recent progress in rAAV-mediated gene therapy for GSD-I; strategies to improve rAAV-mediated gene delivery, transduction efficiency and immune avoidance; and vector refinements that improve expression. Expert opinion rAAV-mediated gene delivery to the liver can restore glucose homeostasis in preclinical models of GSD-I, but some long-term complications of the liver and kidney remain. Gene therapy for GSD-Ib is less advanced than for GSD-Ia and only transient correction of myeloid dysfunction has been achieved. A question remains whether a single rAAV vector can meet the expression efficiency and tropism required to treat all aspects of GSD-I, or if a multi-prong approach is needed. An understanding of the strengths and weaknesses of rAAV vectors in the context of strategies to achieve efficient transduction of the liver, kidney, and hematopoietic stem cells is required for treating GSD-I. PMID:21504389

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

PubMed

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2016-11-30

Thalassemia is an inherited autosomal recessive blood disorder, caused by mutations in globin genes or their regulatory regions. This results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains precipitate in red blood cells, leading to their destruction (haemolysis) and ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the curative potential. This is an update of a previously published Cochrane Review. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 18 August 2016. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Monitoring exposure to acrylonitrile using adducts with N-terminal valine in hemoglobin.

PubMed

Osterman-Golkar, S M; MacNeela, J P; Turner, M J; Walker, V E; Swenberg, J A; Sumner, S J; Youtsey, N; Fennell, T R

1994-12-01

Human exposure to acrylonitrile (ACN), a carcinogen in rats, may occur in industrial settings, through waste water and tobacco smoke. ACN is an electrophilic compound and binds covalently to nucleophilic sites in macromolecules. Measurements of adducts with hemoglobin could be utilized for improved exposure assessments. In this study, a method for quantification of N-(2-cyanoethyl)valine (CEVal), the product of reaction of ACN with N-terminal valine in hemoglobin has been developed. The method is based on the N-alkyl Edman procedure, which involves derivatization of the globin with pentafluorophenyl isothiocyanate and gas chromatographic-mass spectrometric analysis of the resulting thiohydantoin. An internal standard was prepared by reacting valylglycylglycine with [2H3]ACN, spiked with [14C]ACN to a known sp. act. Levels of CEVal were measured in globin from rats exposed to 3-300 p.p.m. ACN in drinking water for 105 days and from humans (four smokers and four non-smokers). CEVal was detected at all exposure levels in the drinking water study. The relationship between adduct level and water concentration was linear at concentrations of 10 p.p.m. (corresponding to an average daily uptake of c. 0.74 mg ACN/kg body wt during the 65 days prior to sacrifice) and below, with a slope of 37.7 pmol CEVal/g globin/p.p.m. At higher concentrations, adduct levels increased sublinearly, indicating saturation of a metabolic process for elimination of ACN. Comparison of adduct formation with the estimated dose (mg/kg/day) of ACN indicated that at low dose (0-10 p.p.m.) CEVal = 0.508 x ACN dose + 0.048 and at high dose (35-300 p.p.m.) CEVal = 1.142 x ACN dose - 1.098. Globin from the smokers (10-20 cigarettes/day) contained about 90 pmol CEVal/g, whereas the adduct levels in globin from non-smokers were below the detection limit. The analytical sensitivity should be sufficient to allow monitoring of occupationally exposed workers at levels well below the current Occupational Safety and Health Administration standard of 2 p.p.m.

You can hide but you have to run: Direct detection with vector mediators

DOE PAGES

D’Eramo, Francesco; Kavanagh, Bradley J.; Panci, Paolo

2016-08-18

We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some casesmore » the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Lastly, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.« less

You can hide but you have to run: Direct detection with vector mediators

DOE Office of Scientific and Technical Information (OSTI.GOV)

D’Eramo, Francesco; Kavanagh, Bradley J.; Panci, Paolo

We study direct detection in simplified models of Dark Matter (DM) in which interactions with Standard Model (SM) fermions are mediated by a heavy vector boson. We consider fully general, gauge-invariant couplings between the SM, the mediator and both scalar and fermion DM. We account for the evolution of the couplings between the energy scale of the mediator mass and the nuclear energy scale. This running arises from virtual effects of SM particles and its inclusion is not optional. We compare bounds on the mediator mass from direct detection experiments with and without accounting for the running. In some casesmore » the inclusion of these effects changes the bounds by several orders of magnitude, as a consequence of operator mixing which generates new interactions at low energy. We also highlight the importance of these effects when translating LHC limits on the mediator mass into bounds on the direct detection cross section. For an axial-vector mediator, the running can alter the derived bounds on the spin-dependent DM-nucleon cross section by a factor of two or more. Lastly, we provide tools to facilitate the inclusion of these effects in future studies: general approximate expressions for the low energy couplings and a public code runDM to evolve the couplings between arbitrary energy scales.« less

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

PubMed Central

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

PubMed

Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

2017-10-01

The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P < 0·003). Receiver operator characteristic analyses revealed an area under the curve of 0·978 for the α-Hb pool measurement at a threshold of 120 ng free α-Hb/mg of total Hb/ml of haemolysate (ppm) with a sensitivity and specificity of 86% and 100%, respectively, to discriminate between β-thal and not β-thal subjects. Significant correlations were observed between the α-Hb pool and biological parameters of β-thal, the most significant association being observed with red cell hexokinase activity. This study indicates that the α-Hb pool could be a new marker for assistance in diagnostic orientation of β-thal intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

Molecular Mechanism of Yisui Shengxue Granule, a Complex Chinese Medicine, on Thalassemia Patients Suffering from Hemolysis and Anemia of Erythrocytes

PubMed Central

Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling

2014-01-01

The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

[HSV-1 based vector mediated IL-1Rα gene for knee osteoarthritis in rabbits].

PubMed

Wu, Yi; Li, Jianming; Kong, Ying; Chen, Ding; Liu, Bo; Wang, Wanchun

2013-06-01

To investigate the effect and mechanism of herpes simplex virus type 1 (HSV-1) based vector mediated interlukin-1 receptor antagonist (IL-1Rα) gene for knee osteoarthritis in rabbits. HSV-1 vectors containing IL-1Rα genes were constructed and injected into the joint space of the osteoarthritis knee in rabbits for 4 weeks. The rabbits were sacrificed, and the knees were lavaged, dissected and the effect of transgene expression was analyzed. Levels of IL-1Rα and IL-1 expression in the recovered lavage fluids were measured with a cytokine ELISA kit. Cartilage from the lesion areas of medial femoral condyle and synovium were observed with hematoxylin and eosin (cartilage and synovium) and toluidine blue (cartilage). The blank control group was injected pHSV-LacZ vector into rabbit knees. Intra-articular delivery of pHSV-IL-1Rα-LacZ resulted in a significant inhibition of IL-1 level and cartilage degradation compared with those in the blank control group (P<0.05). pHSV-LacZ is an ideal vector to mediate intra-articular gene delivery in the rabbit model of osteoarthritis. Continuous intra-articular expression of IL-1Rα can treat knee osteoarthritis by inhibiting IL-1.

Cre/lox-Recombinase-Mediated Cassette Exchange for Reversible Site-Specific Genomic Targeting of the Disease Vector, Aedes aegypti.

PubMed

Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F

2017-03-07

Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.

In vivo gene delivery and expression by bacteriophage lambda vectors.

PubMed

Lankes, H A; Zanghi, C N; Santos, K; Capella, C; Duke, C M P; Dewhurst, S

2007-05-01

Bacteriophage vectors have potential as gene transfer and vaccine delivery vectors because of their low cost, safety and physical stability. However, little is known concerning phage-mediated gene transfer in mammalian hosts. We therefore performed experiments to examine phage-mediated gene transfer in vivo. Mice were inoculated with recombinant lambda phage containing a mammalian expression cassette encoding firefly luciferase (luc). Efficient, dose-dependent in vivo luc expression was detected, which peaked within 24 h of delivery and declined to undetectable levels within a week. Display of an integrin-binding peptide increased cellular internalization of phage in vitro and enhanced phage-mediated gene transfer in vivo. Finally, in vivo depletion of phagocytic cells using clodronate liposomes had only a minor effect on the efficiency of phage-mediated gene transfer. Unmodified lambda phage particles are capable of transducing mammalian cells in vivo, and may be taken up -- at least in part -- by nonphagocytic mechanisms. Surface modifications that enhance phage uptake result in more efficient in vivo gene transfer. These experiments shed light on the mechanisms involved in phage-mediated gene transfer in vivo, and suggest new approaches that may enhance the efficiency of this process.

Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

PubMed

Rath, A V; Schmahl, G E; Niemeyer, C M

1997-01-01

During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

Dynamics of active sites in biological macromolecules using a Green-function approach: An application to heme vibrational dynamics in myoglobin

NASA Astrophysics Data System (ADS)

Rai, Brajesh; Prohofsky, Earl

2003-03-01

Dynamics of functionally active regions of biological macromolecules can be studied using a Green-function technique. This approach uses the fact that in most cases one has a good set of force constants for active sites, and rather poorly defined force field parameters for other regions of the macromolecule. The Green-function method is applied to study the iron vibrational modes of the heme active site in myoglobin. In this approach, the heme active site is viewed as a system interacting with surrounding globin, which acts as an excitation bath. The normal modes of heme and globin are separately calculated using the best available force fields for the two entities. The iron vibrational spectrum of myoglobin is then obtained using the solutions of the heme and globin, and by considering physically meaningful interactions between the two units. The refinement of the Green-function calculations to the experimental data from an x-ray synchrotron-based Nuclear Resonance Vibrational Spectroscopy provides important insights into the character of iron normal modes of myoglobin.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

PubMed

Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

2018-05-28

N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Thalassaemia.

PubMed

Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George

2012-01-28

Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Extended Minus-Strand DNA as Template for R-U5-Mediated Second-Strand Transfer in Recombinational Rescue of Primer Binding Site-Modified Retroviral Vectors

PubMed Central

Mikkelsen, Jacob Giehm; Lund, Anders H.; Dybkær, Karen; Duch, Mogens; Pedersen, Finn Skou

1998-01-01

We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of reverse transcription (Mikkelsen et al., J. Virol. 70:1439–1447, 1996). By use of the same forced recombination system, we have now found recombinant proviruses of different structures, suggesting that PBS knockout vectors may be rescued through initial priming on endogenous virus RNA, read-through of the mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution are discussed. PMID:9499117

Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

PubMed

Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

2007-08-01

Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

Oxidative stress in β-thalassaemia and sickle cell disease

PubMed Central

Voskou, S.; Aslan, M.; Fanis, P.; Phylactides, M.; Kleanthous, M.

2015-01-01

Sickle cell disease and β-thalassaemia are inherited haemoglobinopathies resulting in structural and quantitative changes in the β-globin chain. These changes lead to instability of the generated haemoglobin or to globin chain imbalance, which in turn impact the oxidative environment both intracellularly and extracellularly. The ensuing oxidative stress and the inability of the body to adequately overcome it are, to a large extent, responsible for the pathophysiology of these diseases. This article provides an overview of the main players and control mechanisms involved in the establishment of oxidative stress in these haemoglobinopathies. PMID:26285072

In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA

PubMed Central

Landau, Dustin J; Brooks, Elizabeth Drake; Perez-Pinera, Pablo; Amarasekara, Hiruni; Mefferd, Adam; Li, Songtao; Bird, Andrew; Gersbach, Charles A; Koeberl, Dwight D

2016-01-01

Glycogen storage disease type Ia (GSD Ia) is caused by glucose-6-phosphatase (G6Pase) deficiency in association with severe, life-threatening hypoglycemia that necessitates lifelong dietary therapy. Here we show that use of a zinc-finger nuclease (ZFN) targeted to the ROSA26 safe harbor locus and a ROSA26-targeting vector containing a G6PC donor transgene, both delivered with adeno-associated virus (AAV) vectors, markedly improved survival of G6Pase knockout (G6Pase-KO) mice compared with mice receiving the donor vector alone (P < 0.04). Furthermore, transgene integration has been confirmed by sequencing in the majority of the mice treated with both vectors. Targeted alleles were 4.6-fold more common in livers of mice with GSD Ia, as compared with normal littermates, at 8 months following vector administration (P < 0.02). This suggests a selective advantage for vector-transduced hepatocytes following ZFN-mediated integration of the G6Pase vector. A short-term experiment also showed that 3-month-old mice receiving the ZFN had significantly-improved biochemical correction, in comparison with mice that received the donor vector alone. These data suggest that the use of ZFNs to drive integration of G6Pase at a safe harbor locus might improve vector persistence and efficacy, and lower mortality in GSD Ia. PMID:26865405

AAVrh.10-mediated expression of an anti-cocaine antibody mediates persistent passive immunization that suppresses cocaine-induced behavior.

PubMed

Rosenberg, Jonathan B; Hicks, Martin J; De, Bishnu P; Pagovich, Odelya; Frenk, Esther; Janda, Kim D; Wee, Sunmee; Koob, George F; Hackett, Neil R; Kaminsky, Stephen M; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G; Crystal, Ronald G

2012-05-01

Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity.

Silver nanoparticle-induced hemoglobin decrease involves alteration of histone 3 methylation status.

PubMed

Qian, Yi; Zhang, Jie; Hu, Qinglin; Xu, Ming; Chen, Yue; Hu, Guoqing; Zhao, Meirong; Liu, Sijin

2015-11-01

Silver nanoparticles (nanosilver, AgNPs) have been shown to induce toxicity in vitro and in vivo; however, the molecular bases underlying the detrimental effects have not been thoroughly understood. Although there are numerous studies on its genotoxicity, only a few studies have investigated the epigenetic changes, even less on the changes of histone modifications by AgNPs. In the current study, we probed the AgNP-induced alterations to histone methylation that could be responsible for globin reduction in erythroid cells. AgNP treatment caused a significant reduction of global methylation level for histone 3 (H3) in erythroid MEL cells at sublethal concentrations, devoid of oxidative stress. The ChIP-PCR analyses demonstrated that methylation of H3 at lysine (Lys) 4 (H3K4) and Lys 79 (H3K79) on the β-globin locus was greatly reduced. The reduction in methylation could be attributed to decreased histone methyltransferase DOT-1L and MLL levels as well as the direct binding between AgNPs to H3/H4 that provide steric hindrance to prevent methylation as predicted by the all-atom molecular dynamics simulations. This direct interaction was further proved by AgNP-mediated pull-down assay and immunoprecipitation assay. These changes, together with decreased RNA polymerase II activity and chromatin binding at this locus, resulted in decreased hemoglobin production. By contrast, Ag ion-treated cells showed no alterations in histone methylation level. Taken together, these results showed a novel finding in which AgNPs could alter the methylation status of histone. Our study therefore opens a new avenue to study the biological effects of AgNPs at sublethal concentrations from the perspective of epigenetic mechanisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reactivity of Deoxy- and Oxyferrous Dehaloperoxidase B from Amphitrite ornata: Identification of Compound II and its Ferrous-Hydroperoxide Precursor†

PubMed Central

D’Antonio, Jennifer; Ghiladi, Reza A.

2011-01-01

Dehaloperoxidase (DHP) from the terebellid polychaete Amphitrite ornata is a bifunctional enzyme that possesses both hemoglobin and peroxidase activities. The bifunctional nature of DHP as a globin-peroxidase appears to be at odds with the traditional starting oxidation state for each individual activity. Namely, reversible oxygen-binding is only mediated via a ferrous heme in globins, and peroxidase activity is initiated from ferric centers and to the exclusion of the oxyferrous oxidation state from the peroxidase cycle. Thus, to address what appears to be a paradox, herein we report the details of our investigations into the DHP catalytic cycle when initiated from the deoxy- and oxyferrous states using biochemical assays, stopped-flow UV-visible and rapid-freeze-quench electron paramagnetic resonance spectroscopies, and anaerobic methods. We demonstrate the formation of Compound II directly from deoxyferrous DHP B upon its reaction with hydrogen peroxide, and show that this occurs both in the presence and absence of trihalophenol. Prior to Compound II formation, we have identified a new species which we have preliminarily attributed to a ferrous-hydroperoxide precursor that undergoes heterolysis to generate the aforementioned ferryl intermediate. Taken together, the results demonstrate that the oxyferrous state in DHP is a peroxidase competent starting species, and an updated catalytic cycle for DHP is proposed in which the ferric oxidation state is not an obligatory starting point for the peroxidase catalytic cycle of dehaloperoxidase. The data presented herein provide a link between the peroxidase and oxygen transport activities which furthers our understanding of how this bifunctional enzyme is able to unite its two inherent functions in one system. PMID:21619067

Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

PubMed

Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

2003-10-01

Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

Anti-Inflammatory Effects of Modified Adenoviral Vectors for Gene Therapy: A View through Animal Models Tested.

PubMed

Castañeda-Lopez, M E; Garza-Veloz, I; Lopez-Hernandez, Y; Barbosa-Cisneros, O Y; Martinez-Fierro, M L

2016-07-01

The central dogma of gene therapy relies on the application of novel therapeutic genes to treat or prevent diseases. The main types of vectors used for gene transfer are adenovirus, retrovirus, lentivirus, liposome, and adeno-associated virus vectors. Gene therapy has emerged as a promising alternative for the treatment of inflammatory diseases. The main targets are cytokines, co-stimulatory molecules, and different types of cells from hematological and mesenchymal sources. In this review, we focus on molecules with anti-inflammatory effects used for in vivo gene therapy mediated by adenoviral gene transfer in the treatment of immune-mediated inflammatory diseases, with particular emphasis on autoinflammatory and autoimmune diseases.

Zinc-finger nuclease-mediated gene correction using single AAV vector transduction and enhancement by Food and Drug Administration-approved drugs

PubMed Central

Ellis, BL; Hirsch, ML; Porter, SN; Samulski, RJ; Porteus, MH

2016-01-01

An emerging strategy for the treatment of monogenic diseases uses genetic engineering to precisely correct the mutation(s) at the genome level. Recent advancements in this technology have demonstrated therapeutic levels of gene correction using a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. This strategy requires efficient nucleic acid delivery and among viral vectors, recombinant adeno-associated virus (rAAV) has demonstrated clinical success without pathology. However, a major limitation of rAAV is the small DNA packaging capacity and to date, the use of rAAV for ZFN gene delivery has yet to be reported. Theoretically, an ideal situation is to deliver both ZFNs and the repair substrate in a single vector to avoid inefficient gene targeting and unwanted mutagenesis, both complications of a rAAV co-transduction strategy. Therefore, a rAAV format was generated in which a single polypeptide encodes the ZFN monomers connected by a ribosome skipping 2A peptide and furin cleavage sequence. On the basis of this arrangement, a DNA repair substrate of 750 nucleotides was also included in this vector. Efficient polypeptide processing to discrete ZFNs is demonstrated, as well as the ability of this single vector format to stimulate efficient gene targeting in a human cell line and mouse model derived fibroblasts. Additionally, we increased rAAV-mediated gene correction up to sixfold using a combination of Food and Drug Administration-approved drugs, which act at the level of AAV vector transduction. Collectively, these experiments demonstrate the ability to deliver ZFNs and a repair substrate by a single AAV vector and offer insights for the optimization of rAAV-mediated gene correction using drug therapy. PMID:22257934

Prevalence of Vector-Borne Pathogens in Southern California Dogs With Clinical and Laboratory Abnormalities Consistent With Immune-Mediated Disease.

PubMed

Kidd, L; Qurollo, B; Lappin, M; Richter, K; Hart, J R; Hill, S; Osmond, C; Breitschwerdt, E B

2017-07-01

Studies investigating the prevalence of vector-borne pathogens in southern California dogs are limited. Occult infections might be misdiagnosed as idiopathic immune-mediated disease. (1) To determine the prevalence of vector-borne pathogens in southern California dogs with compatible clinical findings using PCR and serologic panels and (2) to determine whether testing convalescent samples and repeating PCR on acute samples using the same and different gene targets enhance detection. Forty-two client-owned dogs with clinical signs of vector-borne disease presenting to specialty practices in San Diego County. Combined prospective and retrospective observational study. Forty-two acute and 27 convalescent samples were collected. Acute samples were prospectively tested for antibodies to Rickettsia, Ehrlichia, Bartonella, Babesia, Borrelia, and Anaplasma species. PCR targeting Ehrlichia, Babesia, Anaplasma, hemotropic Mycoplasma, and Bartonella species was also performed. Retrospectively, convalescent samples were tested for the same organisms using serology, and for Ehrlichia, Babesia, Anaplasma, and Bartonella species using PCR. Acute samples were retested using PCR targeting Ehrlichia and Babesia species. Evidence of exposure to or infection with a vector-borne pathogen was detected in 33% (14/42) of dogs. Ehrlichia and Babesia species were most common; each was identified in 5 dogs. Convalescent serologic testing, repeating PCR, and using novel PCR gene targets increased detection by 30%. Repeated testing using serology and PCR enhances detection of infection by vector-borne pathogens in dogs with clinical signs of immune-mediated disease. Larger prevalence studies of emerging vector-borne pathogens in southern California dogs are warranted. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Repeat Transduction in the Mouse Lung by Using Adeno-Associated Virus Vectors with Different Serotypes

PubMed Central

Halbert, Christine L.; Rutledge, Elizabeth A.; Allen, James M.; Russell, David W.; Miller, A. Dusty

2000-01-01

Vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in the lung; however, we have found that while gene expression can persist for at least 8 months in mice, it was reduced dramatically in rabbits over a period of 2 months. The efficiency and persistence of AAV2-mediated gene expression in the human lung have yet to be determined, but it seems likely that readministration will be necessary over the lifetime of an individual. Unfortunately, we have found that transduction by a second administration of an AAV2 vector is blocked, presumably due to neutralizing antibodies generated in response to the primary vector exposure. Here, we have explored the use of AAV2 vectors pseudotyped with capsid proteins from AAV serotypes 2, 3, and 6 for readministration in the mouse lung. We found that an AAV6 vector transduced airway epithelial and alveolar cells in the lung at rates that were at least as high as those of AAV2 pseudotype vectors, while transduction rates mediated by AAV3 were much lower. AAV6 pseudotype vector transduction was unaffected by prior administration of an AAV2 or AAV3 vector, and transduction by an AAV2 pseudotype vector was unaffected by prior AAV6 vector administration, showing that cross-reactive neutralizing antibodies against AAV2 and AAV6 are not generated in mice. Interestingly, while prior administration of an AAV2 vector completely blocked transduction by a second AAV2 pseudotype vector, prior administration of an AAV6 vector only partially inhibited transduction by a second administration of an AAV6 pseudotype vector. Analysis of sera obtained from mice and humans showed that AAV6 is less immunogenic than AAV2, which helps explain this finding. These results support the development of AAV6 vectors for lung gene therapy both alone and in combination with AAV2 vectors. PMID:10627564

Jaagsiekte Sheep Retrovirus Envelope Efficiently Pseudotypes Human Immunodeficiency Virus Type 1-Based Lentiviral Vectors

PubMed Central

Liu, Shan-Lu; Halbert, Christine L.; Miller, A. Dusty

2004-01-01

Jaagsiekte sheep retrovirus (JSRV) infects lung epithelial cells in sheep, and oncoretroviral vectors bearing JSRV Env can mediate transduction of human cells, suggesting that such vectors might be useful for lung-directed gene therapy. Here we show that JSRV Env can also efficiently pseudotype a human immunodeficiency virus type 1-based lentiviral vector, a more suitable vector for transduction of slowly dividing lung epithelial cells. We created several chimeric Env proteins that, unlike the parental Env, do not transform rodent fibroblasts but are still capable of pseudotyping lentiviral and oncoretroviral vectors. PMID:14963173

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

PubMed

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

PubMed

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

PubMed Central

Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

2012-01-01

Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

In vivo reduction or blockade of interleukin-1β in primary osteoarthritis influences expression of mediators implicated in pathogenesis

PubMed Central

Santangelo, K. S.; Nuovo, G. J.; Bertone, A. L.

2012-01-01

Summary Objective Diminish interleukin-1β (IL-1β) signaling in a model of primary osteoarthritis by RNA interference-based transcript reduction or receptor blockade, and quantify changes incurred on transcript expression of additional mediators. Methods Knees of Hartley guinea pigs were collected at 120 and 180 days of age following injection with viral vectors (N=4/treatment group/date) at 60 days. Two groups received either adeno-associated viral serotype 5 vector containing a knockdown sequence (TV), or adenoviral vector encoding for IL-1 receptor antagonist protein (Ad-IRAP); treatments were contrasted with opposite knees administered corresponding vector controls. A third group evaluated TV relative to saline-only injected knees. Chondropathy and immunohistochemistry findings were compared to untreated guinea pigs. Transcript expression levels in cartilage were calculated using the comparative CT (2−ΔΔCT) method and analyzed by one-way ANOVA with pairwise comparisons using Tukey 95% confidence intervals. Results Vector transduction was confirmed at both harvest dates. TV and Ad-IRAP, relative to vector controls, significantly decreased IL-1β. Inflammatory mediators [tumor necrosis factor-α (TNF-α), interleukin-8 (IL-8), interferon-γ (IFN-γ)], and catabolic matrix metalloproteinase 13 (MMP13) were also decreased, while anabolic transforming growth factor-β1 (TGF-β1) was increased. IL-1β was also decreased by TV versus saline, with a decrease in MMP13 and increase TGF-β1; TNF-α, IL-8, and IFN-γ were transiently increased. Conclusions This work confirmed that a reduction in IL-1β signaling was accomplished by either method, resulting in decreased expression of three inflammatory mediators and one catabolic agent, and increased expression of an anabolic molecule. Thus, evidence is provided that IL-1β serves a role in vivo in spontaneous osteoarthritis and that these translational tools may provide beneficial disease modification. PMID:22935786

Role of cellular FKBP52 protein in intracellular trafficking of recombinant adeno-associated virus 2 vectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao Weihong; Wu Jianqing; Zhong Li

2006-09-30

We have reported that tyrosine-phosphorylated forms of a cellular protein, FKBP52, inhibit the second-strand DNA synthesis of adeno-associated virus 2 (AAV), leading to inefficient transgene expression from recombinant AAV vectors. To further explore the role of FKBP52 in AAV-mediated transduction, we established murine embryo fibroblasts (MEFs) cultures from FKBP52 wild-type (WT), heterozygous (HE), and knockout (KO) mice. Conventional AAV vectors failed to transduce WT MEFs efficiently, and the transduction efficiency was not significantly increased in HE or KO MEFs. AAV vectors failed to traffic efficiently to the nucleus in these cells. Treatment with hydroxyurea (HU) increased the transduction efficiency ofmore » conventional AAV vectors by {approx}25-fold in WT MEFs, but only by {approx}4-fold in KO MEFs. The use of self-complementary AAV (scAAV) vectors, which bypass the requirement of viral second-strand DNA synthesis, revealed that HU treatment increased the transduction efficiency {approx}23-fold in WT MEFs, but only {approx}4-fold in KO MEFs, indicating that the lack of HU treatment-mediated increase in KO MEFs was not due to failure of AAV to undergo viral second-strand DNA synthesis. Following HU treatment, {approx}59% of AAV genomes were present in the nuclear fraction from WT MEFs, but only {approx}28% in KO MEFs, indicating that the pathway by which HU treatment mediates nuclear transport of AAV was impaired in KO MEFs. When KO MEFs were stably transfected with an FKBP52 expression plasmid, HU treatment-mediated increase in the transduction efficiency was restored in these cells, which correlated directly with improved intracellular trafficking. Intact AAV particles were also shown to interact with FKBP52 as well as with dynein, a known cellular protein involved in AAV trafficking. These studies suggest that FKBP52, being a cellular chaperone protein, facilitates intracellular trafficking of AAV, which has implications in the optimal use of recombinant AAV vectors in human gene therapy.« less

Search for dark matter in proton-proton collisions at 8 TeV with missing transverse momentum and vector boson tagged jets

DOE PAGES

Khachatryan, Vardan

2016-12-16

A search is presented for an excess of events with large missing transverse momentum in association with at least one highly energetic jet, in a data sample of proton-proton collisions at a centre-of-mass energy of 8 TeV. The data correspond to an integrated luminosity of 19.7 inverse femtobarns collected by the CMS experiment at the LHC. The results are interpreted using a set of simplified models for the production of dark matter via a scalar, pseudoscalar, vector, or axial vector mediator. Additional sensitivity is achieved by tagging events consistent with the jets originating from a hadronically decaying vector boson. Thismore » search uses jet substructure techniques to identify hadronically decaying vector bosons in both Lorentz-boosted and resolved scenarios. This analysis yields improvements of 80% in terms of excluded signal cross sections with respect to the previous CMS analysis using the same data set. No significant excess with respect to the standard model expectation is observed and limits are placed on the parameter space of the simplified models. As a result, mediator masses between 80 and 400 GeV in the scalar and pseudoscalar models, and up to 1.5 TeV in the vector and axial vector models, are excluded.« less

Search for dark matter in proton-proton collisions at 8 TeV with missing transverse momentum and vector boson tagged jets

NASA Astrophysics Data System (ADS)

CMS Collaboration; Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Hartl, C.; Hörmann, N.; Hrubec, J.; Jeitler, M.; König, A.; Krätschmer, I.; Liko, D.; Matsushita, T.; Mikulec, I.; Rabady, D.; Rad, N.; Rahbaran, B.; Rohringer, H.; Schieck, J.; Strauss, J.; Treberer-Treberspurg, W.; Waltenberger, W.; Wulz, C.-E.; Mossolov, V.; Shumeiko, N.; Suarez Gonzalez, J.; Alderweireldt, S.; De Wolf, E. A.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Van Spilbeeck, A.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; Daci, N.; De Bruyn, I.; Deroover, K.; Heracleous, N.; Lowette, S.; Moortgat, S.; Moreels, L.; Olbrechts, A.; Python, Q.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Caillol, C.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Léonard, A.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Garcia, G.; Gul, M.; Poyraz, D.; Salva, S.; Schöfbeck, R.; Tytgat, M.; Van Driessche, W.; Yazgan, E.; Zaganidis, N.; Bakhshiansohi, H.; Beluffi, C.; Bondu, O.; Brochet, S.; Bruno, G.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Forthomme, L.; Francois, B.; Giammanco, A.; Jafari, A.; Jez, P.; Komm, M.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Nuttens, C.; Piotrzkowski, K.; Quertenmont, L.; Selvaggi, M.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; De Oliveira Martins, C.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Matos Figueiredo, D.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Prado Da Silva, W. L.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Dogra, S.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Moon, C. S.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Rodozov, M.; Stoykova, S.; Sultanov, G.; Vutova, M.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Cheng, T.; Jiang, C. H.; Leggat, D.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Zhang, H.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; Gomez, J. P.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Sanabria, J. C.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Micanovic, S.; Sudic, L.; Susa, T.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; Abdelalim, A. A.; Mohammed, Y.; Salama, E.; Calpas, B.; Kadastik, M.; Murumaa, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Peltola, T.; Tuominiemi, J.; Tuovinen, E.; Wendland, L.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Fabbro, B.; Faure, J. L.; Favaro, C.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Rander, J.; Rosowsky, A.; Titov, M.; Zghiche, A.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Chapon, E.; Charlot, C.; Davignon, O.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Miné, P.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Regnard, S.; Salerno, R.; Sirois, Y.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Agram, J.-L.; Andrea, J.; Aubin, A.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Le Bihan, A.-C.; Merlin, J. A.; Skovpen, K.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Bouvier, E.; Carrillo Montoya, C. A.; Chierici, R.; Contardo, D.; Courbon, B.; Depasse, P.; El Mamouni, H.; Fan, J.; Fay, J.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sabes, D.; Sordini, V.; Vander Donckt, M.; Verdier, P.; Viret, S.; Toriashvili, T.; Tsamalaidze, Z.; Autermann, C.; Beranek, S.; Feld, L.; Heister, A.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Ostapchuk, A.; Preuten, M.; Raupach, F.; Schael, S.; Schomakers, C.; Schulte, J. F.; Schulz, J.; Verlage, T.; Weber, H.; Zhukov, V.; Brodski, M.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Olschewski, M.; Padeken, K.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Sonnenschein, L.; Teyssier, D.; Thüer, S.; Cherepanov, V.; Flügge, G.; Haj Ahmad, W.; Hoehle, F.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Nehrkorn, A.; Nowack, A.; Nugent, I. M.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bin Anuar, A. A.; Borras, K.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Dolinska, G.; Eckerlin, G.; Eckstein, D.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Gunnellini, P.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Karacheban, O.; Kasemann, M.; Keaveney, J.; Kieseler, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Leonard, J.; Lipka, K.; Lobanov, A.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Placakyte, R.; Raspereza, A.; Roland, B.; Sahin, M. Ö.; Saxena, P.; Schoerner-Sadenius, T.; Seitz, C.; Spannagel, S.; Stefaniuk, N.; Trippkewitz, K. D.; Van Onsem, G. P.; Walsh, R.; Wissing, C.; Blobel, V.; Centis Vignali, M.; Draeger, A. R.; Dreyer, T.; Garutti, E.; Goebel, K.; Gonzalez, D.; Haller, J.; Hoffmann, M.; Junkes, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Lapsien, T.; Lenz, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Ott, J.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Poehlsen, J.; Sander, C.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Barth, C.; Baus, C.; Berger, J.; Butz, E.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Fink, S.; Friese, R.; Giffels, M.; Gilbert, A.; Goldenzweig, P.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Katkov, I.; Lobelle Pardo, P.; Maier, B.; Mildner, H.; Mozer, M. U.; Müller, T.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Röcker, S.; Roscher, F.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wagner-Kuhr, J.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Agapitos, A.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Tziaferi, E.; Evangelou, I.; Flouris, G.; Foudas, C.; Kokkas, P.; Loukas, N.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Filipovic, N.; Bencze, G.; Hajdu, C.; Hidas, P.; Horvath, D.; Sikler, F.; Veszpremi, V.; Vesztergombi, G.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Bahinipati, S.; Choudhury, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Bhawandeep, U.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Mehta, A.; Mittal, M.; Singh, J. B.; Walia, G.; Kumar, Ashok; Bhardwaj, A.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Malhotra, S.; Naimuddin, M.; Nishu, N.; Ranjan, K.; Sharma, R.; Sharma, V.; Bhattacharya, R.; Bhattacharya, S.; Chatterjee, K.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Kole, G.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Parida, B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhowmik, S.; Dewanjee, R. K.; Ganguly, S.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Rane, A.; Sharma, S.; Behnamian, H.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Fahim, A.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Caputo, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Fiore, L.; Iaselli, G.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Brigliadori, L.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Chiorboli, M.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Gori, V.; Lenzi, P.; Meschini, M.; Paoletti, S.; Sguazzoni, G.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Lo Vetere, M.; Monge, M. R.; Robutti, E.; Tosi, S.; Brianza, L.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malvezzi, S.; Manzoni, R. A.; Marzocchi, B.; Menasce, D.; Moroni, L.; Paganoni, M.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; De Nardo, G.; Di Guida, S.; Esposito, M.; Fabozzi, F.; Iorio, A. O. M.; Lanza, G.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Dosselli, U.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Margoni, M.; Meneguzzo, A. T.; Pazzini, J.; Pozzobon, N.; Ronchese, P.; Simonetto, F.; Torassa, E.; Zanetti, M.; Zotto, P.; Zucchetta, A.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Bilei, G. M.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Mantovani, G.; Menichelli, M.; Saha, A.; Santocchia, A.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Bernardini, J.; Boccali, T.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Donato, S.; Fedi, G.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; SavoyNavarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; D'imperio, G.; Del Re, D.; Diemoz, M.; Gelli, S.; Jorda, C.; Longo, E.; Margaroli, F.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Finco, L.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; La Licata, C.; Schizzi, A.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, S.; Lee, S. W.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Brochero Cifuentes, J. A.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, B.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Oh, S. B.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Ryu, G.; Ryu, M. S.; Choi, Y.; Goh, J.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Komaragiri, J. R.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Hernandez-Almada, A.; Lopez-Fernandez, R.; Magaña Villalba, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Carpinteyro, S.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Khan, W. A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Romanowska-Rybinska, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Ferreira Parracho, P. G.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Rodrigues Antunes, J.; Seixas, J.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Vischia, P.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Moisenz, P.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Chtchipounov, L.; Golovtsov, V.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Murzin, V.; Oreshkin, V.; Sulimov, V.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Bylinkin, A.; Chistov, R.; Danilov, M.; Rusinov, V.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Leonidov, A.; Rusakov, S. V.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Dubinin, M.; Dudko, L.; Ershov, A.; Gribushin, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Petrushanko, S.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Krychkine, V.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Calvo, E.; Cerrada, M.; Chamizo Llatas, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Navarro De Martino, E.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; de Trocóniz, J. F.; Missiroli, M.; Moran, D.; Cuevas, J.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Suárez Andrés, I.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Castiñeiras De Saa, J. R.; Curras, E.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Auzinger, G.; Bachtis, M.; Baillon, P.; Ball, A. H.; Barney, D.; Bloch, P.; Bocci, A.; Bonato, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; D'Alfonso, M.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Guio, F.; De Roeck, A.; Di Marco, E.; Dobson, M.; Dorney, B.; du Pree, T.; Duggan, D.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Fartoukh, S.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Girone, M.; Glege, F.; Gulhan, D.; Gundacker, S.; Guthoff, M.; Hammer, J.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Kousouris, K.; Krammer, M.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Mersi, S.; Meschi, E.; Moortgat, F.; Morovic, S.; Mulders, M.; Neugebauer, H.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Ruan, M.; Sakulin, H.; Sauvan, J. B.; Schäfer, C.; Schwick, C.; Seidel, M.; Sharma, A.; Silva, P.; Simon, M.; Sphicas, P.; Steggemann, J.; Stoye, M.; Takahashi, Y.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Veres, G. I.; Wardle, N.; Zagozdzinska, A.; Zeuner, W. D.; Bertl, W.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Bachmair, F.; Bäni, L.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Eller, P.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Lecomte, P.; Lustermann, W.; Mangano, B.; Marionneau, M.; Martinez Ruiz del Arbol, P.; Masciovecchio, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Rossini, M.; Schönenberger, M.; Starodumov, A.; Tavolaro, V. R.; Theofilatos, K.; Wallny, R.; Aarrestad, T. K.; Amsler, C.; Caminada, L.; Canelli, M. F.; De Cosa, A.; Galloni, C.; Hinzmann, A.; Hreus, T.; Kilminster, B.; Lange, C.; Ngadiuba, J.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Yang, Y.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Konyushikhin, M.; Kuo, C. M.; Lin, W.; Lu, Y. J.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chang, Y. H.; Chang, Y. W.; Chao, Y.; Chen, K. F.; Chen, P. H.; Dietz, C.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Miñano Moya, M.; Paganis, E.; Psallidas, A.; Tsai, J. f.; Tzeng, Y. M.; Asavapibhop, B.; Singh, G.; Srimanobhas, N.; Suwonjandee, N.; Adiguzel, A.; Cerci, S.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Dumanoglu, I.; Girgis, S.; Gokbulut, G.; Guler, Y.; Gurpinar, E.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Sunar Cerci, D.; Tali, B.; Topakli, H.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Bilmis, S.; Isildak, B.; Karapinar, G.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Yetkin, E. A.; Yetkin, T.; Cakir, A.; Cankocak, K.; Sen, S.; Grynyov, B.; Levchuk, L.; Sorokin, P.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Baber, M.; Bainbridge, R.; Buchmuller, O.; Bundock, A.; Burton, D.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Dunne, P.; Elwood, A.; Futyan, D.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lucas, R.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Nash, J.; Nikitenko, A.; Pela, J.; Penning, B.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Seez, C.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Leslie, D.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Charaf, O.; Cooper, S. I.; Henderson, C.; Rumerio, P.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Berry, E.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Jesus, O.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Piperov, S.; Sagir, S.; Spencer, E.; Syarif, R.; Breedon, R.; Breto, G.; Burns, D.; Calderon De La Barca Sanchez, M.; Chauhan, S.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Ricci-Tam, F.; Shalhout, S.; Smith, J.; Squires, M.; Stolp, D.; Tripathi, M.; Wilbur, S.; Yohay, R.; Cousins, R.; Everaerts, P.; Florent, A.; Hauser, J.; Ignatenko, M.; Saltzberg, D.; Takasugi, E.; Valuev, V.; Weber, M.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Malberti, M.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cerati, G. B.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Holzner, A.; Klein, D.; Krutelyov, V.; Letts, J.; Macneill, I.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Welke, C.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Flowers, K.; Franco Sevilla, M.; Geffert, P.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mccoll, N.; Mullin, S. D.; Ovcharova, A.; Richman, J.; Stuart, D.; Suarez, I.; West, C.; Yoo, J.; Anderson, D.; Apresyan, A.; Bendavid, J.; Bornheim, A.; Bunn, J.; Chen, Y.; Duarte, J.; Lawhorn, J. M.; Mott, A.; Newman, H. B.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhu, R. Y.; Andrews, M. B.; Azzolini, V.; Carlson, B.; Ferguson, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Nicolas Kaufman, G.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Winn, D.; Abdullin, S.; Albrow, M.; Apollinari, G.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Cheung, H. W. K.; Chlebana, F.; Cihangir, S.; Cremonesi, M.; Elvira, V. D.; Fisk, I.; Freeman, J.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Hare, D.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Linacre, J.; Lincoln, D.; Lipton, R.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; Newman-Holmes, C.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Das, S.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Ma, P.; Matchev, K.; Mei, H.; Milenovic, P.; Mitselmakher, G.; Rank, D.; Shchutska, L.; Sperka, D.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Linn, S.; Markowitz, P.; Martinez, G.; Rodriguez, J. L.; Ackert, A.; Adams, J. R.; Adams, T.; Askew, A.; Bein, S.; Diamond, B.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Khatiwada, A.; Prosper, H.; Santra, A.; Weinberg, M.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Bucinskaite, I.; Cavanaugh, R.; Evdokimov, O.; Gauthier, L.; Gerber, C. E.; Hofman, D. J.; Kurt, P.; O'Brien, C.; Sandoval Gonzalez, I. D.; Turner, P.; Varelas, N.; Wang, H.; Wu, Z.; Zakaria, M.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Anderson, I.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Osherson, M.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; Xin, Y.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Bowen, J.; Bruner, C.; Castle, J.; Kenny, R. P.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Sanders, S.; Stringer, R.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Khalil, S.; Makouski, M.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Lange, D.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Gomez, J. A.; Hadley, N. J.; Jabeen, S.; Kellogg, R. G.; Kolberg, T.; Kunkle, J.; Lu, Y.; Mignerey, A. C.; Shin, Y. H.; Skuja, A.; Tonjes, M. B.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Apyan, A.; Barbieri, R.; Baty, A.; Bi, R.; Bierwagen, K.; Brandt, S.; Busza, W.; Cali, I. A.; Demiragli, Z.; Di Matteo, L.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Krajczar, K.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Sumorok, K.; Tatar, K.; Varma, M.; Velicanu, D.; Veverka, J.; Wang, J.; Wang, T. W.; Wyslouch, B.; Yang, M.; Zhukova, V.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Finkel, A.; Gude, A.; Hansen, P.; Kalafut, S.; Kao, S. C.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Tambe, N.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bartek, R.; Bloom, K.; Bose, S.; Claes, D. R.; Dominguez, A.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Knowlton, D.; Kravchenko, I.; Malta Rodrigues, A.; Meier, F.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; George, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Kaisen, J.; Kharchilava, A.; Kumar, A.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Baumgartel, D.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wang, R.-J.; Wood, D.; Bhattacharya, S.; Hahn, K. A.; Kubik, A.; Kumar, A.; Low, J. F.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Valls, N.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Brinson, J.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Hughes, R.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Luo, J.; Marlow, D.; Medvedeva, T.; Mei, K.; Mooney, M.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Zuranski, A.; Malik, S.; Barker, A.; Barnes, V. E.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Jung, K.; Miller, D. H.; Neumeister, N.; Radburn-Smith, B. C.; Shi, X.; Sun, J.; Svyatkovskiy, A.; Wang, F.; Xie, W.; Xu, L.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Redjimi, R.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Betchart, B.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Chou, J. P.; Contreras-Campana, E.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hidas, D.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Nash, K.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Juska, E.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Rose, A.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Cowden, C.; Damgov, J.; Dragoiu, C.; Dudero, P. R.; Faulkner, J.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Delannoy, A. G.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Goodell, J.; Hirosky, R.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Sun, X.; Wang, Y.; Wolfe, E.; Xia, F.; Clarke, C.; Harr, R.; Karchin, P. E.; Lamichhane, P.; Sturdy, J.; Belknap, D. A.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Ojalvo, I.; Perry, T.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Sharma, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.

2016-12-01

A search is presented for an excess of events with large missing transverse momentum in association with at least one highly energetic jet, in a data sample of proton-proton collisions at a centre-of-mass energy of 8 TeV. The data correspond to an integrated luminosity of 19.7 fb-1 collected by the CMS experiment at the LHC. The results are interpreted using a set of simplified models for the production of dark matter via a scalar, pseudoscalar, vector, or axial vector mediator. Additional sensitivity is achieved by tagging events consistent with the jets originating from a hadronically decaying vector boson. This search uses jet substructure techniques to identify hadronically decaying vector bosons in both Lorentz-boosted and resolved scenarios. This analysis yields improvements of 80% in terms of excluded signal cross sections with respect to the previous CMS analysis using the same data set. No significant excess with respect to the standard model expectation is observed and limits are placed on the parameter space of the simplified models. Mediator masses between 80 and 400 GeV in the scalar and pseudoscalar models, and up to 1.5 TeV in the vector and axial vector models, are excluded. [Figure not available: see fulltext.

Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

PubMed Central

2013-01-01

Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.

PubMed

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.

Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells

PubMed Central

Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M.; Yue, Junming

2017-01-01

CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells. PMID:28123598

An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

PubMed

Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

2016-06-01

The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

Virus altered rice attractiveness to planthoppers is mediated by volatiles and related to virus titre and expression of defence and volatile-biosynthesis genes.

PubMed

Lu, Guanghua; Zhang, Tong; He, Yuange; Zhou, Guohui

2016-12-07

Viruses may induce changes in plant hosts and vectors to enhance their transmission. The white-backed planthopper (WBPH) and brown planthopper (BPH) are vectors of Southern rice black-streaked dwarf virus (SRBSDV) and Rice ragged stunt virus (RRSV), respectively, which cause serious rice diseases. We herein describe the effects of SRBSDV and RRSV infections on host-selection behaviour of vector and non-vector planthoppers at different disease stages. The Y-tube olfactometer choice and free-choice tests indicated that SRBSDV and RRSV infections altered the attractiveness of rice plants to vector and non-vector planthoppers. The attractiveness was mainly mediated by rice volatiles, and varied with disease progression. The attractiveness of the SRBSDV- or RRSV-infected rice plants to the virus-free WBPHs or BPHs initially decreased, then increased, and finally decreased again. For the viruliferous WBPHs and BPHs, SRBSDV or RRSV infection increased the attractiveness of plants more for the non-vector than for the vector planthoppers. Furthermore, we observed that the attractiveness of infected plants to planthoppers was positively correlated with the virus titres. The titre effects were greater for virus-free than for viruliferous planthoppers. Down-regulated defence genes OsAOS1, OsICS, and OsACS2 and up-regulated volatile-biosynthesis genes OsLIS, OsCAS, and OsHPL3 expression in infected plants may influence their attractiveness.

Constraints on muon-specific dark forces

NASA Astrophysics Data System (ADS)

Karshenboim, Savely G.; McKeen, David; Pospelov, Maxim

2014-10-01

The recent measurement of the Lamb shift in muonic hydrogen allows for the most precise extraction of the charge radius of the proton which is currently in conflict with other determinations based on e-p scattering and hydrogen spectroscopy. This discrepancy could be the result of some new muon-specific force with O(1-100) MeV force carrier—in this paper we concentrate on vector mediators. Such an explanation faces challenges from the constraints imposed by the g-2 of the muon and electron as well as precision spectroscopy of muonic atoms. In this work we complement the family of constraints by calculating the contribution of hypothetical forces to the muonium hyperfine structure. We also compute the two-loop contribution to the electron parity-violating amplitude due to a muon loop, which is sensitive to the muon axial-vector coupling. Overall, we find that the combination of low-energy constraints favors the mass of the mediator to be below 10 MeV and that a certain degree of tuning is required between vector and axial-vector couplings of new vector particles to muons in order to satisfy constraints from muon g-2. However, we also observe that in the absence of a consistent standard model embedding high-energy weak-charged processes accompanied by the emission of new vector particles are strongly enhanced by (E/mV)2, with E a characteristic energy scale and mV the mass of the mediator. In particular, leptonic W decays impose the strongest constraints on such models completely disfavoring the remainder of the parameter space.

Post-transcriptional regulation mediated by specific neurofilament introns in vivo.

PubMed

Wang, Chen; Szaro, Ben G

2016-04-01

Neurons regulate genes post-transcriptionally to coordinate the supply of cytoskeletal proteins, such as the medium neurofilament (NEFM), with demand for structural materials in response to extracellular cues encountered by developing axons. By using a method for evaluating functionality of cis-regulatory gene elements in vivo through plasmid injection into Xenopus embryos, we discovered that splicing of a specific nefm intron was required for robust transgene expression, regardless of promoter or cell type. Transgenes utilizing the nefm 3'-UTR but substituting other nefm introns expressed little or no protein owing to defects in handling of the messenger (m)RNA as opposed to transcription or splicing. Post-transcriptional events at multiple steps, but mainly during nucleocytoplasmic export, contributed to these varied levels of protein expression. An intron of the β-globin gene was also able to promote expression in a manner identical to that of the nefm intron, implying a more general preference for certain introns in controlling nefm expression. These results expand our knowledge of intron-mediated gene expression to encompass neurofilaments, indicating an additional layer of complexity in the control of a cytoskeletal gene needed for developing and maintaining healthy axons. © 2016. Published by The Company of Biologists Ltd.

[Construction and characterization of liposomal magnetofection system in pig kidney cells].

PubMed

Chen, Wenjie; Cui, Haixin; Zhao, Xiang; Cui, Jinhui; Wang, Yan; Sun, Changjiao

2014-06-01

Magnetic nano gene vector is one of the non-viral gene vectors, modified by functional group to bind cationic transfect reagents. Coupling magnetofection with the universal lipofection we developed a novel somatic cell transfection method as the so-called liposomal magnetofection (LMF). This approach is potential to provide somatic cell cloning with stable genetic cell lines to cultivate transgenic animals. In order to construct such liposomal magnetic gene vectors complexes system, we used nano magnetic gene vector to combine with liposomal cationic transfect reagents by molecular self-assembly. This vectors system successfully carried exogenous gene and then transfected animal somatic cells. Here, we conducted atomic force microscopy (AFM), zeta potential-diameter analysis and other characterization experiments to investegate the size distribution and morphology of magnetic nanoparticles, the way of the vectors to load and concentrate DNA molecules. Our data reveal that, the LMF of Pig Kidney cells exhibited higher transfection efficiency comparing with the transfection mediated by the commercial lipofectamine2000. Moreover, LMF method overcomes the constraint of transient expression mediated by lipofection. Meanwhile, MTT assay showed low cytotoxicity of LMF. Hence, LMF is a feasible, low cytotoxic and effective method of cell transfection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khachatryan, Vardan

A search is presented for an excess of events with large missing transverse momentum in association with at least one highly energetic jet, in a data sample of proton-proton collisions at a centre-of-mass energy of 8 TeV. The data correspond to an integrated luminosity of 19.7 inverse femtobarns collected by the CMS experiment at the LHC. The results are interpreted using a set of simplified models for the production of dark matter via a scalar, pseudoscalar, vector, or axial vector mediator. Additional sensitivity is achieved by tagging events consistent with the jets originating from a hadronically decaying vector boson. Thismore » search uses jet substructure techniques to identify hadronically decaying vector bosons in both Lorentz-boosted and resolved scenarios. This analysis yields improvements of 80% in terms of excluded signal cross sections with respect to the previous CMS analysis using the same data set. No significant excess with respect to the standard model expectation is observed and limits are placed on the parameter space of the simplified models. As a result, mediator masses between 80 and 400 GeV in the scalar and pseudoscalar models, and up to 1.5 TeV in the vector and axial vector models, are excluded.« less

Fbw7 promotes ubiquitin-dependent degradation of c-Myb: involvement of GSK3-mediated phosphorylation of Thr-572 in mouse c-Myb.

PubMed

Kitagawa, K; Hiramatsu, Y; Uchida, C; Isobe, T; Hattori, T; Oda, T; Shibata, K; Nakamura, S; Kikuchi, A; Kitagawa, M

2009-06-25

Expression of oncoprotein c-Myb oscillates during hematopoiesis and hematological malignancies. Its quantity is not only regulated through transcriptional control but also through the ubiquitin-proteasome pathway, accompanied by phosphorylation, although the mechanisms are poorly understood. In this report, we tried to identify an E3 ubiquitin ligase, which targets c-Myb for ubiquitin-dependent degradation. We found that an F-box protein, Fbw7, interacted with c-Myb, which is mutated in numerous cancers. Fbw7 facilitated ubiquitylation and degradation of c-Myb in intact cells. Moreover, depletion of Fbw7 by RNA interference delayed turnover and increased the abundance of c-Myb in myeloid leukemia cells concomitantly, and suppressed the transcriptional level of gamma-globin, which receives transcriptional repression from c-Myb. In addition, we analysed sites required for both ubiquitylation and degradation of c-Myb. We found that Thr-572 is critical for Fbw7-mediated ubiquitylation in mouse c-Myb using site-directed mutagenesis. Fbw7 recognized the phosphorylation of Thr-572, which was mediated by glycogen synthase kinase 3 (GSK3). In consequence, the c-Myb protein was markedly stabilized by the substitution of Thr-572 to Ala. These observations suggest that SCF(Fbw7) ubiquitin ligase regulates phosphorylation-dependent degradation of c-Myb protein.

[Hemolytic anemia due to hemoglobin Evans in an Argentinean family].

PubMed

Zanotto, María I; Calvo, Karina; Schvartzman, Gabriel; Deana, Alejandra; Noguera, Nélida; Bragós, Irma; Milani, Angela

2010-12-01

Unstable hemoglobins are structural variants of the hemoglobin molecule, mostly originated by single amino-acid replacement in some globin chains. These changes affect molecule stability, leading to loss of solubility, precipitation, and cellular lysis. Patients carrying these unstable hemoglobins may present mild to severe chronic hemolytic anemia. Hemoglobin Evans is an unstable variant originated by replacement of valine with methionine at position 62 of the α-globin chain. We have identified this variant in a girl with an acute hemolytic crisis associated to pharyngitis, as well as in two of her family members. This is the third case of hemolytic anemia due to hemoglobin Evans reported in the literature.

Temporal regulation of Stat5 activity in determination of cell differentiation program

PubMed Central

Hoshino, Akemi; Fujii, Hodaka

2007-01-01

Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

PubMed

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in β-globin expression and erythroid development

PubMed Central

Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry

2005-01-01

The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

PubMed

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Two-photon excited fluorescence emission from hemoglobin

NASA Astrophysics Data System (ADS)

Sun, Qiqi; Zeng, Yan; Zhang, Wei; Zheng, Wei; Luo, Yi; Qu, Jianan Y.

2015-03-01

Hemoglobin, one of the most important proteins in blood, is responsible for oxygen transportation in almost all vertebrates. Recently, we discovered two-photon excited hemoglobin fluorescence and achieved label-free microvascular imaging based on the hemoglobin fluorescence. However, the mechanism of its fluorescence emission still remains unknown. In this work, we studied the two-photon excited fluorescence properties of the hemoglobin subunits, heme/hemin (iron (II)/(III) protoporphyrin IX) and globin. We first studied the properties of heme and the similar spectral and temporal characteristics of heme and hemoglobin fluorescence provide strong evidence that heme is the fluorophore in hemoglobin. Then we studied the fluorescence properties of hemin, globin and methemoglobin, and found that the hemin may have the main effect on the methemoglobin fluorescence and that globin has tryptophan fluorescence like other proteins. Finally, since heme is a centrosymmetric molecule, that the Soret band fluorescence of heme and hemoglobin was not observed in the single photon process in the previous study may be due to the parity selection rule. The discovery of heme two-photon excited fluorescence may open a new window for heme biology research, since heme as a cofactor of hemoprotein has many functions, including chemical catalysis, electron transfer and diatomic gases transportation.

Globins Scavenge Sulfur Trioxide Anion Radical*

PubMed Central

Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.

2015-01-01

Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408

Definition of RNA Polymerase II CoTC Terminator Elements in the Human Genome

PubMed Central

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J.; Dye, Michael J.

2013-01-01

Summary Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. PMID:23562152

Resting lymphocyte transduction with measles virus glycoprotein pseudotyped lentiviral vectors relies on CD46 and SLAM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Qi; Schneider, Irene C.; Gallet, Manuela

2011-05-10

The measles virus (MV) glycoproteins hemagglutinin (H) and fusion (F) were recently shown to mediate transduction of resting lymphocytes by lentiviral vectors. MV vaccine strains use CD46 or signaling lymphocyte activation molecule (SLAM) as receptor for cell entry. A panel of H protein mutants derived from vaccine strain or wild-type MVs that lost or gained CD46 or SLAM receptor usage were investigated for their ability to mediate gene transfer into unstimulated T lymphocytes. The results demonstrate that CD46 is sufficient for efficient vector particle association with unstimulated lymphocytes. For stable gene transfer into these cells, however, both MV receptors weremore » found to be essential.« less

Integration Profile and Safety of an Adenovirus Hybrid-Vector Utilizing Hyperactive Sleeping Beauty Transposase for Somatic Integration

PubMed Central

Zhang, Wenli; Muck-Hausl, Martin; Wang, Jichang; Sun, Chuanbo; Gebbing, Maren; Miskey, Csaba; Ivics, Zoltan; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB) transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR) and linear amplification-mediated PCR (LAM-PCR). Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models. PMID:24124483

HSV-mediated gene transfer of vascular endothelial growth factor to dorsal root ganglia prevents diabetic neuropathy

PubMed Central

Chattopadhyay, M; Krisky, D; Wolfe, D; Glorioso, JC; Mata, M; Fink, DJ

2005-01-01

We examined the utility of herpes simplex virus (HSV) vector-mediated gene transfer of vascular endothelial growth factor (VEGF) in a mouse model of diabetic neuropathy. A replication-incompetent HSV vector with VEGF under the control of the HSV ICP0 promoter (vector T0VEGF) was constructed. T0VEGF expressed and released VEGF from primary dorsal root ganglion (DRG) neurons in vitro, and following subcutaneous inoculation in the foot, expressed VEGF in DRG and nerve in vivo. At 2 weeks after induction of diabetes, subcutaneous inoculation of T0VEGF prevented the reduction in sensory nerve amplitude characteristic of diabetic neuropathy measured 4 weeks later, preserved autonomic function measured by pilocarpine-induced sweating, and prevented the loss of nerve fibers in the skin and reduction of neuropeptide calcitonin gene-related peptide and substance P in DRG neurons of the diabetic mice. HSV-mediated transfer of VEGF to DRG may prove useful in treatment of diabetic neuropathy. PMID:15843809

APOBEC3-mediated hypermutation of retroviral vectors produced from some retrovirus packaging cell lines.

PubMed

Miller, A D; Metzger, M J

2011-05-01

APOBEC3 proteins are packaged into retrovirus virions and can hypermutate retroviruses during reverse transcription. We found that HT-1080 human fibrosarcoma cells hypermutate retroviruses, and that the HT-1080 cell-derived FLYA13 retrovirus packaging cells also hypermutate a retrovirus vector produced using these cells. We found no hypermutation of the same vector produced by the mouse cell-derived packaging line PT67 or by human 293 cells transfected with the vector and retrovirus packaging plasmids. We expect that avoidance of vector hypermutation will be particularly important for vectors used in gene therapy, wherein mutant proteins might stimulate deleterious immune responses.

AAVrh.10-Mediated Expression of an Anti-Cocaine Antibody Mediates Persistent Passive Immunization That Suppresses Cocaine-Induced Behavior

PubMed Central

Rosenberg, Jonathan B.; Hicks, Martin J.; De, Bishnu P.; Pagovich, Odelya; Frenk, Esther; Janda, Kim D.; Wee, Sunmee; Koob, George F.; Hackett, Neil R.; Kaminsky, Stephen M.; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G.

2012-01-01

Abstract Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity. PMID:22486244

The Antibiotic-free pFAR4 Vector Paired with the Sleeping Beauty Transposon System Mediates Efficient Transgene Delivery in Human Cells.

PubMed

Pastor, Marie; Johnen, Sandra; Harmening, Nina; Quiviger, Mickäel; Pailloux, Julie; Kropp, Martina; Walter, Peter; Ivics, Zoltán; Izsvák, Zsuzsanna; Thumann, Gabriele; Scherman, Daniel; Marie, Corinne

2018-06-01

The anti-angiogenic and neurogenic pigment epithelium-derived factor (PEDF) demonstrated a potency to control choroidal neovascularization in age-related macular degeneration (AMD) patients. The goal of the present study was the development of an efficient and safe technique to integrate, ex vivo, the PEDF gene into retinal pigment epithelial (RPE) cells for later transplantation to the subretinal space of AMD patients to allow continuous PEDF secretion in the vicinity of the affected macula. Because successful gene therapy approaches require efficient gene delivery and stable gene expression, we used the antibiotic-free pFAR4 mini-plasmid vector to deliver the hyperactive Sleeping Beauty transposon system, which mediates transgene integration into the genome of host cells. In an initial study, lipofection-mediated co-transfection of HeLa cells with the SB100X transposase gene and a reporter marker delivered by pFAR4 showed a 2-fold higher level of genetically modified cells than when using the pT2 vectors. Similarly, with the pFAR4 constructs, electroporation-mediated transfection of primary human RPE cells led to 2.4-fold higher secretion of recombinant PEDF protein, which was still maintained 8 months after transfection. Thus, our results show that the pFAR4 plasmid is a superior vector for the delivery and integration of transgenes into eukaryotic cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Gene delivery systems by the combination of lipid bubbles and ultrasound.

PubMed

Negishi, Yoichi; Endo-Takahashi, Yoko; Maruyama, Kazuo

2016-11-28

Gene therapy is promising for the treatment of many diseases including cancers and genetic diseases. From the viewpoint of safety, ultrasound (US)-mediated gene delivery with nano/ microbubbles was recently developed as a novel non-viral vector system. US-mediated gene delivery using nano/microbubbles are able to produce transient changes in the permeability of the cell membrane after US-induced cavitation while reducing cellular damage and enables the tissue-specific or the site-specific intracellular delivery of gene both in vitro and in vivo. We have recently developed novel lipid nanobubbles (Lipid Bubbles). These nanobubbles can also be used to enhance the efficacy of the US-mediated genes (plasmid DNA, siRNA, and miRNA etc.) delivery. In this review, we describe US-mediated delivery systems combined with nano/microbubbles and discuss their feasibility as non-viral vector systems.

Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

PubMed

Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

2014-08-21

Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

PubMed Central

Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

2014-01-01

Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

Detection of Sleeping Beauty transposition in the genome of host cells by non-radioactive Southern blot analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravalli, Rajagopal N., E-mail: aravalli@umn.edu; Park, Chang W.; Steer, Clifford J., E-mail: steer001@umn.edu

The Sleeping Beauty transposon (SB-Tn) system is being used widely as a DNA vector for the delivery of therapeutic transgenes, as well as a tool for the insertional mutagenesis in animal models. In order to accurately assess the insertional potential and properties related to the integration of SB it is essential to determine the copy number of SB-Tn in the host genome. Recently developed SB100X transposase has demonstrated an integration rate that was much higher than the original SB10 and that of other versions of hyperactive SB transposases, such as HSB3 or HSB17. In this study, we have constructed amore » series of SB vectors carrying either a DsRed or a human β-globin transgene that was encompassed by cHS4 insulator elements, and containing the SB100X transposase gene outside the SB-Tn unit within the same vector in cis configuration. These SB-Tn constructs were introduced into the K-562 erythroid cell line, and their presence in the genomes of host cells was analyzed by Southern blot analysis using non-radioactive probes. Many copies of SB-Tn insertions were detected in host cells regardless of transgene sequences or the presence of cHS4 insulator elements. Interestingly, the size difference of 2.4 kb between insulated SB and non-insulated controls did not reflect the proportional difference in copy numbers of inserted SB-Tns. We then attempted methylation-sensitive Southern blots to assess the potential influence of cHS4 insulator elements on the epigenetic modification of SB-Tn. Our results indicated that SB100X was able to integrate at multiple sites with the number of SB-Tn copies larger than 6 kb in size. In addition, the non-radioactive Southern blot protocols developed here will be useful to detect integrated SB-Tn copies in any mammalian cell type.« less

A disposable laser print-cut-laminate polyester microchip for multiplexed PCR via infra-red-mediated thermal control.

PubMed

Ouyang, Yiwen; Duarte, Gabriela R M; Poe, Brian L; Riehl, Paul S; dos Santos, Fernando M; Martin-Didonet, Claudia C G; Carrilho, Emanuel; Landers, James P

2015-12-11

Infrared (IR)-mediated thermal cycling system, a method proven to be a effective for sub-μL scale polymerase chain reaction (PCR) on microchips, has been integrated with DNA extraction and separation on a glass microchip in a fully integrated micro Total Analysis System by Easley et al., in 2006. IR-PCR has been demonstrated on both glass and PMMA microdevices where the fabrication (bonding) is not trivial. Polyester-toner (PeT) microfluidic devices have significant potential as cost-effective, disposable microdevices as a result of the ease of fabrication (∼$0.25 USD and <10 min per device) and availability of commercial substrates. For the first time, we demonstrate here the thermal cycling in PeT microchips on the IR-PCR system. Undesirable IR absorption by the black-toner bonding layer was eliminated with a spatial filter in the form of an aluminum foil mask. The solution heating rate for a black PeT microchip using a tungsten lamp was 10.1 ± 0.7 °C s(-1) with a cooling rate of roughly -12 ± 0.9 °C s(-1) assisted by forced air cooling. Dynamic surface passivation strategies allowed the successful amplification of a 520 bp fragment of the λ-phage genome (in 11 min) and a 1500 bp region of Azospirillum brasilense. Using a centrosymmetric chamber configuration in a multichamber PeT microchip, homogenous temperature distribution over all chambers was achieved with inter-chamber temperature differences at annealing, extension and denaturing steps of less than ±2 °C. The effectiveness of the multichamber system was demonstrated with the simultaneous amplification of a 390 bp amplicon of human β-globin gene in five PeT PCR microchambers. The relative PCR amplification efficiency with a human β-globin DNA fragment ranged from 70% to 90%, in comparison to conventional thermal cyclers, with an inter-chamber standard deviation of ∼10%. Development of PeT microchips for IR-PCR has the potential to provide rapid, low-volume amplification while also integrating PCR with extraction upstream and separation/detection downstream. Copyright © 2015. Published by Elsevier B.V.

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein.

PubMed

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

2016-08-05

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. Copyright © 2016 Elsevier Inc. All rights reserved.

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

PubMed

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

On the interpretation of a possible ~ 750 GeV particle decaying into γγ

DOE PAGES

Ellis, John; Ellis, Sebastian A. R.; Quevillon, Jeremie; ...

2016-03-25

We consider interpretations of the recent ~3σ reports by the CMS and ATLAS collaborations of a possible X(~ 750 GeV) state decaying into yy final states. We focus on the possibilities that this is a scalar or pseudoscalar electroweak isoscalar state produced by gluon-gluon fusion mediated by loops of heavy fermions. We consider several models for these fermions, including a single vector-like charge 2/3 T quark, a doublet of vector-like quarks (T;B), and a vector-like generation of quarks, with or without leptons that also contribute to the X → yy decay amplitude. We also consider the possibility that X(750) ismore » a dark matter mediator, with a neutral vector-like dark matter particle. These scenarios are compatible with the present and prospective direct limits on vector-like fermions from LHC Runs 1 and 2, as well as indirect constraints from electroweak precision measurements, and we show that the required Yukawa-like couplings between the X particle and the heavy vector-like fermions are small enough to be perturbative so long as the X particle has dominant decay modes into gg and yy. In conclusion, the decays X → ZZ,Zy and W +W - are interesting prospective signatures that may help distinguish between different vector-like fermion scenarios.« less

Baculovirus: an Insect-derived Vector for Diverse Gene Transfer Applications

PubMed Central

Airenne, Kari J; Hu, Yu-Chen; Kost, Thomas A; Smith, Richard H; Kotin, Robert M; Ono, Chikako; Matsuura, Yoshiharu; Wang, Shu; Ylä-Herttuala, Seppo

2013-01-01

Insect-derived baculoviruses have emerged as versatile and safe workhorses of biotechnology. Baculovirus expression vectors (BEVs) have been applied widely for crop and forest protection, as well as safe tools for recombinant protein production in insect cells. However, BEVs ability to efficiently transduce noninsect cells is still relatively poorly recognized despite the fact that efficient baculovirus-mediated in vitro and ex vivo gene delivery into dormant and dividing vertebrate cells of diverse origin has been described convincingly by many authors. Preliminary proof of therapeutic potential has also been established in preclinical studies. This review summarizes the advantages and current status of baculovirus-mediated gene delivery. Stem cell transduction, preclinical animal studies, tissue engineering, vaccination, cancer gene therapy, viral vector production, and drug discovery are covered. PMID:23439502

A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].

PubMed

Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R

2010-06-01

We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G

A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia

PubMed Central

Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.

2013-01-01

SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349

Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

PubMed

Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

2007-01-01

Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

Correction of mutant Fanconi anemia gene by homologous recombination in human hematopoietic cells using adeno-associated virus vector.

PubMed

Paiboonsukwong, Kittiphong; Ohbayashi, Fumi; Shiiba, Haruka; Aizawa, Emi; Yamashita, Takayuki; Mitani, Kohnosuke

2009-11-01

Adeno-associated virus (AAV) vectors have been shown to correct a variety of mutations in human cells by homologous recombination (HR) at high rates, which can overcome insertional mutagenesis and transgene silencing, two of the major hurdles in conventional gene addition therapy of inherited diseases. We examined an ability of AAV vectors to repair a mutation in human hematopoietic cells by HR. We infected a human B-lymphoblastoid cell line (BCL) derived from a normal subject with an AAV, which disrupts the hypoxanthine phosphoribosyl transferase1 (HPRT1) locus, to measure the frequency of AAV-mediated HR in BCL cells. We subsequently constructed an AAV vector encoding the normal sequences from the Fanconi anemia group A (FANCA) locus to correct a mutation in the gene in BCL derived from a FANCA patient. Under optimal conditions, approximately 50% of BCL cells were transduced with an AAV serotype 2 (AAV-2) vector. In FANCA BCL cells, up to 0.016% of infected cells were gene-corrected by HR. AAV-mediated restoration of normal genotypic and phenotypic characteristics in FANCA-mutant cells was confirmed at the DNA, protein and functional levels. The results obtained in the present study indicate that AAV vectors may be applicable for gene correction therapy of inherited hematopoietic disorders.

Xylella fastidiosa Afimbrial Adhesins Mediate Cell Transmission to Plants by Leafhopper Vectors▿

PubMed Central

Killiny, Nabil; Almeida, Rodrigo P. P.

2009-01-01

The interactions between the economically important plant-pathogenic bacterium Xylella fastidiosa and its leafhopper vectors are poorly characterized. We used different approaches to determine how X. fastidiosa cells interact with the cuticular surface of the foreguts of vectors. We demonstrate that X. fastidiosa binds to different polysaccharides with various affinities and that these interactions are mediated by cell surface carbohydrate-binding proteins. In addition, competition assays showed that N-acetylglucosamine inhibits bacterial adhesion to vector foregut extracts and intact wings, demonstrating that attachment to leafhopper surfaces is affected in the presence of specific polysaccharides. In vitro experiments with several X. fastidiosa knockout mutants indicated that hemagglutinin-like proteins are associated with cell adhesion to polysaccharides. These results were confirmed with biological experiments in which hemagglutinin-like protein mutants were transmitted to plants by vectors at lower rates than that of the wild type. Furthermore, although these mutants were defective in adhesion to the cuticle of vectors, their growth rate once attached to leafhoppers was similar to that of the wild type, suggesting that these proteins are important for initial adhesion of X. fastidiosa to leafhoppers. We propose that X. fastidiosa colonization of leafhopper vectors is a complex, stepwise process similar to the formation of biofilms on surfaces. PMID:19011051

Characterizing dark matter interacting with extra charged leptons

NASA Astrophysics Data System (ADS)

Barducci, D.; Deandrea, A.; Moretti, S.; Panizzi, L.; Prager, H.

2018-04-01

In the context of a simplified leptophilic dark matter (DM) scenario where the mediator is a new charged fermion carrying leptonic quantum number and the DM candidate is either scalar or vector, the complementarity of different bounds is analyzed. In this framework, the extra lepton and DM are odd under a Z2 symmetry, and hence the leptonic mediator can only interact with the DM state and Standard Model leptons of various flavors. We show that there is the possibility to characterize the DM spin (scalar or vector), as well as the nature of the mediator, through a combined analysis of cosmological, flavor and collider data. We present an explicit numerical analysis for a set of benchmarks points of the viable parameter space of our scenario.

HIV-1-based defective lentiviral vectors efficiently transduce human monocytes-derived macrophages and suppress replication of wild-type HIV-1

PubMed Central

Zeng, Lingbing; Planelles, Vicente; Sui, Ziye; Gartner, Suzanne; Maggirwar, Sanjay B.; Dewhurst, Stephen; Ye, Linbai; Nerurkar, Vivek R.; Yanagihara, Richard; Lu, Yuanan

2010-01-01

Background Human monocytes play an important role in mediating human immunodeficiency virus type 1 (HIV-1) infection of the central nervous system (CNS), and monocytes-derived macrophages (MDM) represent a major viral reservoir within the brain and other target organs. Current gene transduction of MDM is hindered by a limited efficiency. In this study we established a lentiviral vector-based technique for improved gene transfer into human MDM cultures in vitro and demonstrated significant protection of transduced MDM from super-infection with wild-type HIV-1. Methods HIV-1-based lentiviral vector stocks were prepared in 293T cells by the established calcium phosphate transfection method. Human monocytes were isolated from donors' blood by Ficoll-Paque separation and cultured in vitro. To establish an effective technique for vector-mediated gene transfer, primary cultures of human MDM were transduced at varying multiplicities of infection (MOI) and at a range of time points following initial isolation of cells (time-in-culture). Transduced cells were then examined for transgene (green fluorescent protein (GFP)) expression by fluorescent microscopy and reverse transcription polymerase chain reaction (RT-PCR). These cultures were then exposed to wild-type HIV-1, and viral replication was quantitated by p24 assay; production of neurotoxic effector molecules by the transduced MDM was also examined, using indicator neurons. Results We have demonstrated that primary human MDM could be efficiently transduced (>50%) with concentrated HIV-1-based defective lentiviral vectors (DLV). Furthermore, DLV-mediated gene transduction was stable, and the transduced cells exhibited no apparent difference from normal MDM in terms of their morphology, viability and neurotoxin secretion. Challenge of DLV-transduced MDM cultures with HIV-1Ba-L revealed a 4- to 5-fold reduction in viral replication, as measured by p24 antigen production. This effect was associated with the mobilization of the GFP-expressing DLV construct by the wild-type virus. Conclusions These data demonstrate the inhibition of HIV-1 replication in primary MDM, by a DLV vector that lacks any anti-HIV-1 transgene. These findings lay the initial groundwork for future studies on the ability of DLV-modified monocytes to introduce anti-HIV-1 genes into the CNS. Lentiviral vector-mediated gene delivery to the CNS by monocytes/macrophages is a promising, emerging strategy for treating neuro-AIDS. PMID:16142830

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

Genetic correction of β-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.

PubMed

Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong

2012-04-01

The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.

The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China

PubMed Central

Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang

2014-01-01

Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075

Multivariate analysis of matrix-assisted laser desorption/ionization mass spectrometric data related to glycoxidation products of human globins in nephropathic patients.

PubMed

Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro

2007-06-01

To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.

AAV-mediated targeting of gene expression to the peri-infarct region in rat cortical stroke model.

PubMed

Mätlik, Kert; Abo-Ramadan, Usama; Harvey, Brandon K; Arumäe, Urmas; Airavaara, Mikko

2014-10-30

For stroke patients the recovery of cognitive and behavioral functions is often incomplete. Functional recovery is thought to be mediated largely by connectivity rearrangements in the peri-infarct region. A method for manipulating gene expression in this region would be useful for identifying new recovery-enhancing treatments. We have characterized a way of targeting adeno-associated virus (AAV) vectors to the peri-infarct region of cortical ischemic lesion in rats 2days after middle cerebral artery occlusion (MCAo). We used magnetic resonance imaging (MRI) to show that the altered properties of post-ischemic brain tissue facilitate the spreading of intrastriatally injected nanoparticles toward the infarct. We show that subcortical injection of green fluorescent protein-encoding dsAAV7-GFP resulted in transduction of cells in and around the white matter tract underlying the lesion, and in the cortex proximal to the lesion. A similar result was achieved with dsAAV7 vector encoding the cerebral dopamine neurotrophic factor (CDNF), a protein with therapeutic potential. Viral vector-mediated intracerebral gene delivery has been used before in rodent models of ischemic injury. However, the method of targeting gene expression to the peri-infarct region, after the initial phase of ischemic cell death, has not been described before. We demonstrate a straightforward and robust way to target AAV vector-mediated over-expression of genes to the peri-infarct region in a rat stroke model. This method will be useful for studying the action of specific proteins in peri-infarct region during the recovery process. Copyright © 2014 Elsevier B.V. All rights reserved.

Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free βGH globin chain and subunit exchange with a free α-chain pool

PubMed Central

Rieder, Ronald F.

1971-01-01

Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175

Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

PubMed

Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

2016-06-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

HIV-derived vectors for gene therapy targeting dendritic cells.

PubMed

Rossetti, Maura; Cavarelli, Mariangela; Gregori, Silvia; Scarlatti, Gabriella

2013-01-01

Human immunodeficiency virus type 1 (HIV-1)-derived lentiviral vectors (LV) have the potential to mediate stable therapeutic gene transfer. However, similarly to other viral vectors, their benefit is compromised by the induction of an immune response toward transgene-expressing cells that closely mimics antiviral immunity. LV share with the parental HIV the ability to activate dendritic cells (DC), while lack the peculiar ability of subverting DC functions, which is responsible for HIV immune escape. Understanding the interaction between LV and DC, with plasmacytoid and myeloid DC playing fundamental and distinct roles, has paved the way to novel approaches aimed at regulating transgene-specific immune responses. Thanks to the ability to target either DC subsets LV might be a powerful tool to induce immunity (i.e., gene therapy of cancer), cell death (i.e., in HIV/AIDS infection), or tolerance (i.e., gene therapy strategies for monogenic diseases). In this chapter, similarities and differences between the LV-mediated and HIV-mediated induction of immune responses, with specific focus on their interactions with DC, are discussed.

Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

PubMed Central

Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

2012-01-01

The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-07-30

HIV-associated sensory neuropathy affects over 50% of HIV patients and is a common peripheral nerve complication of HIV infection and highly active antiretroviral therapy (HAART). Evidence shows that painful HIV sensory neuropathy is influenced by neuroinflammatory events that include the proinflammatory molecules, MAP Kinase, tumor necrosis factor-α (TNFα), stromal cell-derived factor 1-α (SDF1α), and C-X-C chemokine receptor type 4 (CXCR4). However, the exact mechanisms of painful HIV sensory neuropathy are not known, which hinders our ability to develop effective treatments. In this study, we investigated whether inhibition of proinflammatory factors reduces the HIV-associated neuropathic pain state. Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2',3'-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Mechanical threshold was tested using von Frey filament fibers. Non-replicating herpes simplex virus (HSV) vectors expressing interleukin 10 (IL10) were inoculated into the hindpaws of rats. The expression of TNFα, SDF1α, and CXCR4 in the lumbar spinal cord and L4/5 dorsal root ganglia (DRG) was examined using western blots. IL-10 expression mediated by the HSV vectors resulted in a significant elevation of mechanical threshold. The anti-allodynic effect of IL-10 expression mediated by the HSV vectors lasted more than 3 weeks. The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors. The HSV vectors expressing IL-10 also concomitantly reversed the upregulation of p-p38, TNFα, SDF1α, and CXCR4 induced by gp120 in the lumbar spinal dorsal horn and/or the DRG at 2 and/or 4 weeks. The blocking of the signaling of these proinflammatory molecules is able to reduce HIV-related neuropathic pain, which provide a novel mechanism-based approach to treating HIV-associated neuropathic pain using gene therapy.

IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats

PubMed Central

2014-01-01

Background HIV-associated sensory neuropathy affects over 50% of HIV patients and is a common peripheral nerve complication of HIV infection and highly active antiretroviral therapy (HAART). Evidence shows that painful HIV sensory neuropathy is influenced by neuroinflammatory events that include the proinflammatory molecules, MAP Kinase, tumor necrosis factor-α (TNFα), stromal cell-derived factor 1-α (SDF1α), and C-X-C chemokine receptor type 4 (CXCR4). However, the exact mechanisms of painful HIV sensory neuropathy are not known, which hinders our ability to develop effective treatments. In this study, we investigated whether inhibition of proinflammatory factors reduces the HIV-associated neuropathic pain state. Results Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2′,3′-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Mechanical threshold was tested using von Frey filament fibers. Non-replicating herpes simplex virus (HSV) vectors expressing interleukin 10 (IL10) were inoculated into the hindpaws of rats. The expression of TNFα, SDF1α, and CXCR4 in the lumbar spinal cord and L4/5 dorsal root ganglia (DRG) was examined using western blots. IL-10 expression mediated by the HSV vectors resulted in a significant elevation of mechanical threshold. The anti-allodynic effect of IL-10 expression mediated by the HSV vectors lasted more than 3 weeks. The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors. The HSV vectors expressing IL-10 also concomitantly reversed the upregulation of p-p38, TNFα, SDF1α, and CXCR4 induced by gp120 in the lumbar spinal dorsal horn and/or the DRG at 2 and/or 4 weeks. Conclusion The blocking of the signaling of these proinflammatory molecules is able to reduce HIV-related neuropathic pain, which provide a novel mechanism-based approach to treating HIV-associated neuropathic pain using gene therapy. PMID:25078297

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Semiochemical-mediated flight responses of sap beetle vectors of oak wilt, Ceratocystis fagacearum

Treesearch

John F. Kyhl; Robert J. Bartelt; Allard Cosse; Jennifer Juzwik; Steven J. Seybold

2002-01-01

The sap beetle, Colopterus truncatus (Coleoptera: Nitidulidae), is one of the primary vectors of the oak wilt pathogen, Ceratocystis fagacearum, in the north-central United States. Field behavioral assays utilizing various release rates and blends of three methyl-branched hydrocarbon aggregation pheromone components showed that...

Vector-mediated chromosomal integration of the glutamate decarboxylase gene in streptococcus thermophilus

USDA-ARS?s Scientific Manuscript database

The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

PubMed Central

Kon, Tatsuya; Yoshikawa, Nobuyuki

2014-01-01

Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

Preclinical Demonstration of Lentiviral Vector-mediated Correction of Immunological and Metabolic Abnormalities in Models of Adenosine Deaminase Deficiency

PubMed Central

Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby

2014-01-01

Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635

Combined concurrent nanoshell loaded macrophage-mediated photothermal and photodynamic therapies

NASA Astrophysics Data System (ADS)

Hirschberg, Henry; Trinidad, Anthony; Christie, Catherine E.; Peng, Qian; Kwon, Young J.; Madsen, Steen

2015-02-01

Macrophages loaded with gold nanoshells (AuNS), that convert near infrared light to heat, can be used as transport vectors for photothermal hyperthermia of tumors. The purpose of this study was to investigate the effects of combined macrophage mediated photothermal therapy (PTT) and PDT on head and neck squamous cell carcinoma (HNSCC). The results provide proof of concept for the use of macrophages as a delivery vector of AuNS for photothermal enhancement of the effects of PDT on squamous cell carcinoma. A significant synergy was demonstrated with combined PDT and PTT compared to each modality applied separately.

Decoding the Ubiquitin-Mediated Pathway of Arthropod Disease Vectors

PubMed Central

Choy, Anthony; Severo, Maiara S.; Sun, Ruobai; Girke, Thomas; Gillespie, Joseph J.; Pedra, Joao H. F.

2013-01-01

Protein regulation by ubiquitin has been extensively described in model organisms. However, characterization of the ubiquitin machinery in disease vectors remains mostly unknown. This fundamental gap in knowledge presents a concern because new therapeutics are needed to control vector-borne diseases, and targeting the ubiquitin machinery as a means for disease intervention has been already adopted in the clinic. In this study, we employed a bioinformatics approach to uncover the ubiquitin-mediated pathway in the genomes of Anopheles gambiae, Aedes aegypti, Culex quinquefasciatus, Ixodes scapularis, Pediculus humanus and Rhodnius prolixus. We observed that (1) disease vectors encode a lower percentage of ubiquitin-related genes when compared to Drosophila melanogaster, Mus musculus and Homo sapiens but not Saccharomyces cerevisiae; (2) overall, there are more proteins categorized as E3 ubiquitin ligases when compared to E2-conjugating or E1-activating enzymes; (3) the ubiquitin machinery within the three mosquito genomes is highly similar; (4) ubiquitin genes are more than doubled in the Chagas disease vector (R. prolixus) when compared to other arthropod vectors; (5) the deer tick I. scapularis and the body louse (P. humanus) genomes carry low numbers of E1-activating enzymes and HECT-type E3 ubiquitin ligases; (6) R. prolixus have low numbers of RING-type E3 ubiquitin ligases; and (7) C. quinquefasciatus present elevated numbers of predicted F-box E3 ubiquitin ligases, JAB and UCH deubiquitinases. Taken together, these findings provide novel opportunities to study the interaction between a pathogen and an arthropod vector. PMID:24205097

Tyrosine-phosphorylation of AAV2 vectors and its consequences on viral intracellular trafficking and transgene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong Li; Powell Gene Therapy Center, University of Florida College of Medicine, Gainesville, FL; Genetics Institute, University of Florida College of Medicine, Gainesville, FL

2008-11-25

We have documented that epidermal growth factor receptor protein tyrosine kinase (EGFR-PTK) signaling negatively affects intracellular trafficking and transduction efficiency of recombinant adeno-associated virus 2 (AAV2) vectors. Specifically, inhibition of EGFR-PTK signaling leads to decreased ubiquitination of AAV2 capsid proteins, which in turn, facilitates viral nuclear transport by limiting proteasome-mediated degradation of AAV2 vectors. In the present studies, we observed that AAV capsids can indeed be phosphorylated at tyrosine residues by EGFR-PTK in in vitro phosphorylation assays and that phosphorylated AAV capsids retain their structural integrity. However, although phosphorylated AAV vectors enter cells as efficiently as their unphosphorylated counterparts, theirmore » transduction efficiency is significantly reduced. This reduction is not due to impaired viral second-strand DNA synthesis since transduction efficiency of both single-stranded AAV (ssAAV) and self-complementary AAV (scAAV) vectors is decreased by {approx} 68% and {approx} 74%, respectively. We also observed that intracellular trafficking of tyrosine-phosphorylated AAV vectors from cytoplasm to nucleus is significantly decreased, which results from ubiquitination of AAV capsids followed by proteasome-mediated degradation, although downstream consequences of capsid ubiquitination may also be affected by tyrosine-phosphorylation. These studies provide new insights into the role of tyrosine-phosphorylation of AAV capsids in various steps in the virus life cycle, which has implications in the optimal use of recombinant AAV vectors in human gene therapy.« less

Improved methods of AAV-mediated gene targeting for human cell lines using ribosome-skipping 2A peptide

PubMed Central

Karnan, Sivasundaram; Ota, Akinobu; Konishi, Yuko; Wahiduzzaman, Md; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2016-01-01

The adeno-associated virus (AAV)-based targeting vector has been one of the tools commonly used for genome modification in human cell lines. It allows for relatively efficient gene targeting associated with 1–4-log higher ratios of homologous-to-random integration of targeting vectors (H/R ratios) than plasmid-based targeting vectors, without actively introducing DNA double-strand breaks. In this study, we sought to improve the efficiency of AAV-mediated gene targeting by introducing a 2A-based promoter-trap system into targeting constructs. We generated three distinct AAV-based targeting vectors carrying 2A for promoter trapping, each targeting a GFP-based reporter module incorporated into the genome, PIGA exon 6 or PIGA intron 5. The absolute gene targeting efficiencies and H/R ratios attained using these vectors were assessed in multiple human cell lines and compared with those attained using targeting vectors carrying internal ribosome entry site (IRES) for promoter trapping. We found that the use of 2A for promoter trapping increased absolute gene targeting efficiencies by 3.4–28-fold and H/R ratios by 2–5-fold compared to values obtained with IRES. In CRISPR-Cas9-assisted gene targeting using plasmid-based targeting vectors, the use of 2A did not enhance the H/R ratios but did upregulate the absolute gene targeting efficiencies compared to the use of IRES. PMID:26657635

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

PubMed

Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

2010-04-01

Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

Malaria-induced changes in host odors enhance mosquito attraction

PubMed Central

De Moraes, Consuelo M.; Stanczyk, Nina M.; Betz, Heike S.; Pulido, Hannier; Sim, Derek G.; Read, Andrew F.; Mescher, Mark C.

2014-01-01

Vector-borne pathogens may alter traits of their primary hosts in ways that influence the frequency and nature of interactions between hosts and vectors. Previous work has reported enhanced mosquito attraction to host organisms infected with malaria parasites but did not address the mechanisms underlying such effects. Here we document malaria-induced changes in the odor profiles of infected mice (relative to healthy individuals) over the course of infection, as well as effects on the attractiveness of infected hosts to mosquito vectors. We observed enhanced mosquito attraction to infected mice during a key period after the subsidence of acute malaria symptoms, but during which mice remained highly infectious. This attraction corresponded to an overall elevation in the volatile emissions of infected mice observed during this period. Furthermore, data analyses—using discriminant analysis of principal components and random forest approaches—revealed clear differences in the composition of the volatile blends of infected and healthy individuals. Experimental manipulation of individual compounds that exhibited altered emission levels during the period when differential vector attraction was observed also elicited enhanced mosquito attraction, indicating that compounds being influenced by malaria infection status also mediate vector host-seeking behavior. These findings provide important insights into the cues that mediate vector attraction to hosts infected with transmissible stages of malaria parasites, as well as documenting characteristic changes in the odors of infected individuals that may have potential value as diagnostic biomarkers of infection. PMID:24982164

Malaria-induced changes in host odors enhance mosquito attraction.

PubMed

De Moraes, Consuelo M; Stanczyk, Nina M; Betz, Heike S; Pulido, Hannier; Sim, Derek G; Read, Andrew F; Mescher, Mark C

2014-07-29

Vector-borne pathogens may alter traits of their primary hosts in ways that influence the frequency and nature of interactions between hosts and vectors. Previous work has reported enhanced mosquito attraction to host organisms infected with malaria parasites but did not address the mechanisms underlying such effects. Here we document malaria-induced changes in the odor profiles of infected mice (relative to healthy individuals) over the course of infection, as well as effects on the attractiveness of infected hosts to mosquito vectors. We observed enhanced mosquito attraction to infected mice during a key period after the subsidence of acute malaria symptoms, but during which mice remained highly infectious. This attraction corresponded to an overall elevation in the volatile emissions of infected mice observed during this period. Furthermore, data analyses--using discriminant analysis of principal components and random forest approaches--revealed clear differences in the composition of the volatile blends of infected and healthy individuals. Experimental manipulation of individual compounds that exhibited altered emission levels during the period when differential vector attraction was observed also elicited enhanced mosquito attraction, indicating that compounds being influenced by malaria infection status also mediate vector host-seeking behavior. These findings provide important insights into the cues that mediate vector attraction to hosts infected with transmissible stages of malaria parasites, as well as documenting characteristic changes in the odors of infected individuals that may have potential value as diagnostic biomarkers of infection.

Behavioural response of the malaria vector Anopheles gambiae to host plant volatiles and synthetic blends

USDA-ARS?s Scientific Manuscript database

Sugar feeding is critical for survival of malaria vectors and, although discriminative plant feeding previously has been shown to occur in Anopheles gambiae s.s., little is known about the cues mediating attraction to these plants. In this study, we investigated the role of olfaction in An. gambiae ...

Phage-Mediated Gene Therapy.

PubMed

Hosseinidoust, Zeinab

2017-01-01

Bacteriophages (bacterial viruses) have long been under investigation as vectors for gene therapy. Similar to other viral vectors, the phage coat proteins have evolved over millions of years to protect the viral genome from degradation post injection, offering protection for the valuable therapeutic sequence. However, what sets phage apart from other viral gene delivery vectors is their safety for human use and the relative ease by which foreign molecules can be expressed on the phage outer surface, enabling highly targeted gene delivery. The latter property also makes phage a popular choice for gene therapy target discovery through directed evolution. Although promising, phage-mediated gene therapy faces several outstanding challenges, the most notable being lower gene delivery efficiency compared to animal viruses, vector stability, and nondesirable immune stimulation. This review presents a critical review of promises and challenges of employing phage as gene delivery vehicles as well as an introduction to the concept of phage-based microbiome therapy as the new frontier and perhaps the most promising application of phage-based gene therapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Pharmacologic Effects in vivo in Brain by Vector-Mediated Peptide Drug Delivery

NASA Astrophysics Data System (ADS)

Bickel, Ulrich; Yoshikawa, Takayoshi; Landaw, Elliot M.; Faull, Kym F.; Pardridge, William M.

1993-04-01

Pharmacologic effects in brain caused by systemic administration of neuropeptides are prevented by poor transport of the peptide through the brain vascular endothelium, which comprises the blood-brain barrier in vivo. In the present study, successful application of a chimeric peptide approach to enhance drug delivery through the blood-brain barrier for the purpose of achieving a central nervous system pharmacologic effect is described. The chimeric peptide was formed by linkage of a potent vasoactive intestinal peptide (VIP) analogue, which had been monobiotinylated, to a drug transport vector. The vector consisted of a covalent conjugate of avidin and the OX26 monoclonal antibody to the transferrin receptor. Owing to the high concentration of transferrin receptors on brain capillary endothelia, OX26 targets brain and undergoes receptor-mediated transcytosis through the blood-brain barrier. Systemic infusion of low doses (12 μg/kg) of the VIP chimeric peptide in rats resulted in an in vivo central nervous system pharmacologic effect: a 65% increase in cerebral blood flow. Biotinylated VIP analogue without the brain transport vector was ineffective.

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

PubMed Central

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-01-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events. PMID:24385850

Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

PubMed

Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

2016-04-14

The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

Differences in Hematological Traits between High- and Low-Altitude Lizards (Genus Phrynocephalus)

PubMed Central

Lu, Songsong; Xin, Ying; Tang, Xiaolong; Yue, Feng; Wang, Huihui; Bai, Yucheng; Niu, Yonggang; Chen, Qiang

2015-01-01

Phrynocephalus erythrurus (Lacertilia: Agamidae) is considered to be the highest living reptile in the world (about 4500-5000 m above sea level), whereas Phrynocephalus przewalskii inhabits low altitudes (about 1000-1500 m above sea level). Here, we report the differences in hematological traits between these two different Phrynocephalus species. Compared with P. przewalskii, the results indicated that P. erythrurus own higher oxygen carrying capacity by increasing red blood cell count (RBC), hemoglobin concentration ([Hb]) and hematocrit (Hct) and these elevations could promote oxygen carrying capacity without disadvantage of high viscosity. The lower partial pressure of oxygen in arterial blood (PaO2) of P. erythrurus did not cause the secondary alkalosis, which may be attributed to an efficient pulmonary system for oxygen (O2) loading. The elevated blood-O2 affinity in P. erythrurus may be achieved by increasing intrinsic O2 affinity of isoHbs and balancing the independent effects of potential heterotropic ligands. We detected one α-globin gene and three β-globin genes with 1 and 33 amino acid substitutions between these two species, respectively. Molecular dynamics simulation results showed that amino acids substitutions in β-globin chains could lead to the elimination of hydrogen bonds in T-state Hb models of P. erythrurus. Based on the present data, we suggest that P. erythrurus have evolved an efficient oxygen transport system under the unremitting hypobaric hypoxia. PMID:25955247

Structural analysis of an oxygen-regulated diguanylate cyclase.

PubMed

Tarnawski, Miroslaw; Barends, Thomas R M; Schlichting, Ilme

2015-11-01

Cyclic di-GMP is a bacterial second messenger that is involved in switching between motile and sessile lifestyles. Given the medical importance of biofilm formation, there has been increasing interest in understanding the synthesis and degradation of cyclic di-GMPs and their regulation in various bacterial pathogens. Environmental cues are detected by sensing domains coupled to GGDEF and EAL or HD-GYP domains that have diguanylate cyclase and phosphodiesterase activities, respectively, producing and degrading cyclic di-GMP. The Escherichia coli protein DosC (also known as YddV) consists of an oxygen-sensing domain belonging to the class of globin sensors that is coupled to a C-terminal GGDEF domain via a previously uncharacterized middle domain. DosC is one of the most strongly expressed GGDEF proteins in E. coli, but to date structural information on this and related proteins is scarce. Here, the high-resolution structural characterization of the oxygen-sensing globin domain, the middle domain and the catalytic GGDEF domain in apo and substrate-bound forms is described. The structural changes between the iron(III) and iron(II) forms of the sensor globin domain suggest a mechanism for oxygen-dependent regulation. The structural information on the individual domains is combined into a model of the dimeric DosC holoprotein. These findings have direct implications for the oxygen-dependent regulation of the activity of the cyclase domain.

Generation of Mice Deficient in both KLF3/BKLF and KLF8 Reveals a Genetic Interaction and a Role for These Factors in Embryonic Globin Gene Silencing

PubMed Central

Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.

2013-01-01

Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600

Routes for Drug Translocation Across the Blood-Brain Barrier: Exploiting Peptides as Delivery Vectors.

PubMed

Kristensen, Mie; Brodin, Birger

2017-09-01

A number of potent drugs for the treatment of brain diseases are available. However, in order for them to reach their target site of action, they must pass the blood-brain barrier (BBB). The capillary endothelium comprises the major barrier of the BBB and allows only passive permeation of some small lipophilic molecules. Brain delivery of the larger biopharmaceuticals, which today includes an increasing number of novel drug entities, is therefore restricted, both due to their molecular size and their hydrophilic nature. Thus, the development of novel drug entities intended for the treatment of brain diseases such as neurodegenerative diseases or brain cancers require a delivery strategy for overcoming the BBB before reaching its final target within the brain. Peptide-based delivery vector is an emerging tool as shuttles for drug delivery across the BBB and one may explore receptor-mediated transcytosis, adsorptive-mediated transcytosis, and the paracellular route. The latter, however, being controversial due to the risk of co-delivery of blood-borne potential harmful substances. On the other hand, a number of studies report on drug delivery across the BBB exploiting receptor-mediated transcytosis and adsorptive-mediated transcytosis, indicating that peptides and peptide vectors may be of use in a central nervous system delivery context. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Helper-Dependent Adenoviral Vectors.

PubMed

Rosewell, Amanda; Vetrini, Francesco; Ng, Philip

2011-10-29

Helper-dependent adenoviral vectors are devoid of all viral coding sequences, possess a large cloning capacity, and can efficiently transduce a wide variety of cell types from various species independent of the cell cycle to mediate long-term transgene expression without chronic toxicity. These non-integrating vectors hold tremendous potential for a variety of gene transfer and gene therapy applications. Here, we review the production technologies, applications, obstacles to clinical translation and their potential resolutions, and the future challenges and unanswered questions regarding this promising gene transfer technology.

Helper-Dependent Adenoviral Vectors

PubMed Central

Rosewell, Amanda; Vetrini, Francesco; Ng, Philip

2012-01-01

Helper-dependent adenoviral vectors are devoid of all viral coding sequences, possess a large cloning capacity, and can efficiently transduce a wide variety of cell types from various species independent of the cell cycle to mediate long-term transgene expression without chronic toxicity. These non-integrating vectors hold tremendous potential for a variety of gene transfer and gene therapy applications. Here, we review the production technologies, applications, obstacles to clinical translation and their potential resolutions, and the future challenges and unanswered questions regarding this promising gene transfer technology. PMID:24533227

The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

PubMed

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

2016-12-01

Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

PGRP-LD mediates A. stephensi vector competency by regulating homeostasis of microbiota-induced peritrophic matrix synthesis

PubMed Central

Song, Xiumei; Wang, Mengfei; Dong, Li

2018-01-01

Peptidoglycan recognition proteins (PGRPs) and commensal microbes mediate pathogen infection outcomes in insect disease vectors. Although PGRP-LD is retained in multiple vectors, its role in host defense remains elusive. Here we report that Anopheles stephensi PGRP-LD protects the vector from malaria parasite infection by regulating gut homeostasis. Specifically, knock down of PGRP-LD (dsLD) increased susceptibility to Plasmodium berghei infection, decreased the abundance of gut microbiota and changed their spatial distribution. This outcome resulted from a change in the structural integrity of the peritrophic matrix (PM), which is a chitinous and proteinaceous barrier that lines the midgut lumen. Reduction of microbiota in dsLD mosquitoes due to the upregulation of immune effectors led to dysregulation of PM genes and PM fragmentation. Elimination of gut microbiota in antibiotic treated mosquitoes (Abx) led to PM loss and increased vectorial competence. Recolonization of Abx mosquitoes with indigenous Enterobacter sp. restored PM integrity and decreased mosquito vectorial capacity. Silencing PGRP-LD in mosquitoes without PM didn’t influence their vector competence. Our results indicate that PGPR-LD protects the gut microbiota by preventing hyper-immunity, which in turn promotes PM structurally integrity. The intact PM plays a key role in limiting P. berghei infection. PMID:29489896

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

PubMed Central

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

PubMed

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Construction of a star-shaped copolymer as a vector for FGF receptor-mediated gene delivery in vitro and in vivo.

PubMed

Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun

2010-09-13

The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.

Definition of RNA polymerase II CoTC terminator elements in the human genome.

PubMed

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J; Dye, Michael J

2013-04-25

Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Cytoglobin regulates blood pressure and vascular tone through nitric oxide metabolism in the vascular wall

PubMed Central

Liu, Xiaoping; El-Mahdy, Mohamed A.; Boslett, James; Varadharaj, Saradhadevi; Hemann, Craig; Abdelghany, Tamer M.; Ismail, Raed S.; Little, Sean C.; Zhou, Danlei; Thuy, Le Thi Thanh; Kawada, Norifumi; Zweier, Jay L.

2017-01-01

The identity of the specific nitric oxide dioxygenase (NOD) that serves as the main in vivo regulator of O2-dependent NO degradation in smooth muscle remains elusive. Cytoglobin (Cygb) is a recently discovered globin expressed in fibroblasts and smooth muscle cells with unknown function. Cygb, coupled with a cellular reducing system, efficiently regulates the rate of NO consumption by metabolizing NO in an O2-dependent manner with decreased NO consumption in physiological hypoxia. Here we show that Cygb is a major regulator of NO degradation and cardiovascular tone. Knockout of Cygb greatly prolongs NO decay, increases vascular relaxation, and lowers blood pressure and systemic vascular resistance. We further demonstrate that downregulation of Cygb prevents angiotensin-mediated hypertension. Thus, Cygb has a critical role in the regulation of vascular tone and disease. We suggest that modulation of the expression and NOD activity of Cygb represents a strategy for the treatment of cardiovascular disease. PMID:28393874

Hexamethylenebisacetamide modulation of thyroglobulin and protein levels in thyroid cells is not mediated by phosphatidylinositol-3-kinase: a study with wortmannin.

PubMed

Aouani, A; Samih, N; Amphoux-Fazekas, T; Hovsépian, S; Fayet, G

1999-04-01

Hexamethylenebisacetamide (HMBA) induces in murine erythroleukemia cells (MELC) the commitment to terminal differentiation leading to globin gene expression. In the thyroid, HMBA acts as a growth factor and also as a differentiating agent. In the present paper, we studied the effect of HMBA on the very specific thyroid marker thyroglobulin (Tg) in two different thyroid cell systems, i.e., porcine cells in primary culture and ovine cells in long term culture. Using wortmannin, a specific inhibitor of phosphatidylinositol-3-kinase, we investigated whether this enzyme is involved in HMBA mode of action. We found that HMBA is a positive modulator of Tg production in porcine cells, but a negative effector in the OVNIS cell line. As all HMBA effects studied in the present paper, i.e., Tg production and total protein levels, are not inhibited by wortmannin, we suggest the non-involvement of phosphatidylinositol-3-kinase in HMBA mode of action.

In vivo correction of anaemia in β-thalassemic mice by γPNA-mediated gene editing with nanoparticle delivery

PubMed Central

Bahal, Raman; Ali McNeer, Nicole; Quijano, Elias; Liu, Yanfeng; Sulkowski, Parker; Turchick, Audrey; Lu, Yi-Chien; Bhunia, Dinesh C.; Manna, Arunava; Greiner, Dale L.; Brehm, Michael A.; Cheng, Christopher J.; López-Giráldez, Francesc; Ricciardi, Adele; Beloor, Jagadish; Krause, Diane S.; Kumar, Priti; Gallagher, Patrick G.; Braddock, Demetrios T.; Mark Saltzman, W.; Ly, Danith H.; Glazer, Peter M.

2016-01-01

The blood disorder, β-thalassaemia, is considered an attractive target for gene correction. Site-specific triplex formation has been shown to induce DNA repair and thereby catalyse genome editing. Here we report that triplex-forming peptide nucleic acids (PNAs) substituted at the γ position plus stimulation of the stem cell factor (SCF)/c-Kit pathway yielded high levels of gene editing in haematopoietic stem cells (HSCs) in a mouse model of human β-thalassaemia. Injection of thalassemic mice with SCF plus nanoparticles containing γPNAs and donor DNAs ameliorated the disease phenotype, with sustained elevation of blood haemoglobin levels into the normal range, reduced reticulocytosis, reversal of splenomegaly and up to 7% β-globin gene correction in HSCs, with extremely low off-target effects. The combination of nanoparticle delivery, next generation γPNAs and SCF treatment may offer a minimally invasive treatment for genetic disorders of the blood that can be achieved safely and simply by intravenous administration. PMID:27782131

Cytoglobin regulates blood pressure and vascular tone through nitric oxide metabolism in the vascular wall

NASA Astrophysics Data System (ADS)

Liu, Xiaoping; El-Mahdy, Mohamed A.; Boslett, James; Varadharaj, Saradhadevi; Hemann, Craig; Abdelghany, Tamer M.; Ismail, Raed S.; Little, Sean C.; Zhou, Danlei; Thuy, Le Thi Thanh; Kawada, Norifumi; Zweier, Jay L.

2017-04-01

The identity of the specific nitric oxide dioxygenase (NOD) that serves as the main in vivo regulator of O2-dependent NO degradation in smooth muscle remains elusive. Cytoglobin (Cygb) is a recently discovered globin expressed in fibroblasts and smooth muscle cells with unknown function. Cygb, coupled with a cellular reducing system, efficiently regulates the rate of NO consumption by metabolizing NO in an O2-dependent manner with decreased NO consumption in physiological hypoxia. Here we show that Cygb is a major regulator of NO degradation and cardiovascular tone. Knockout of Cygb greatly prolongs NO decay, increases vascular relaxation, and lowers blood pressure and systemic vascular resistance. We further demonstrate that downregulation of Cygb prevents angiotensin-mediated hypertension. Thus, Cygb has a critical role in the regulation of vascular tone and disease. We suggest that modulation of the expression and NOD activity of Cygb represents a strategy for the treatment of cardiovascular disease.

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

Long-term systemic therapy of Fabry disease in a knockout mouse by adeno-associated virus-mediated muscle-directed gene transfer

PubMed Central

Takahashi, Hiroshi; Hirai, Yukihiko; Migita, Makoto; Seino, Yoshihiko; Fukuda, Yuh; Sakuraba, Hitoshi; Kase, Ryoichi; Kobayashi, Toshihide; Hashimoto, Yasuhiro; Shimada, Takashi

2002-01-01

Fabry disease is a systemic disease caused by genetic deficiency of a lysosomal enzyme, α-galactosidase A (α-gal A), and is thought to be an important target for enzyme replacement therapy. We studied the feasibility of gene-mediated enzyme replacement for Fabry disease. The adeno-associated virus (AAV) vector containing the α-gal A gene was injected into the right quadriceps muscles of Fabry knockout mice. A time course study showed that α-gal A activity in plasma was increased to ≈25% of normal mice and that this elevated activity persisted for up to at least 30 weeks without development of anti-α-gal A antibodies. The α-gal A activity in various organs of treated Fabry mice remained 5–20% of those observed in normal mice. Accumulated globotriaosylceramide in these organs was completely cleared by 25 weeks after vector injection. Reduction of globotriaosylceramide levels was also confirmed by immunohistochemical and electronmicroscopic analyses. Echocardiographic examination of treated mice demonstrated structural improvement of cardiac hypertrophy 25 weeks after the treatment. AAV vector-mediated muscle-directed gene transfer provides an efficient and practical therapeutic approach for Fabry disease. PMID:12370426

Evolving lessons on nanomaterial-coated viral vectors for local and systemic gene therapy

PubMed Central

Kasala, Dayananda; Yoon, A-Rum; Hong, Jinwoo; Kim, Sung Wan; Yun, Chae-Ok

2016-01-01

Viral vectors are promising gene carriers for cancer therapy. However, virus-mediated gene therapies have demonstrated insufficient therapeutic efficacy in clinical trials due to rapid dissemination to nontarget tissues and to the immunogenicity of viral vectors, resulting in poor retention at the disease locus and induction of adverse inflammatory responses in patients. Further, the limited tropism of viral vectors prevents efficient gene delivery to target tissues. In this regard, modification of the viral surface with nanomaterials is a promising strategy to augment vector accumulation at the target tissue, circumvent the host immune response, and avoid nonspecific interactions with the reticuloendothelial system or serum complement. In the present review, we discuss various chemical modification strategies to enhance the therapeutic efficacy of viral vectors delivered either locally or systemically. We conclude by highlighting the salient features of various nanomaterial-coated viral vectors and their prospects and directions for future research. PMID:27348247

Development of Novel Adenoviral Vectors to Overcome Challenges Observed With HAdV-5–based Constructs

PubMed Central

Alonso-Padilla, Julio; Papp, Tibor; Kaján, Győző L; Benkő, Mária; Havenga, Menzo; Lemckert, Angelique; Harrach, Balázs; Baker, Andrew H

2016-01-01

Recombinant vectors based on human adenovirus serotype 5 (HAdV-5) have been extensively studied in preclinical models and clinical trials over the past two decades. However, the thorough understanding of the HAdV-5 interaction with human subjects has uncovered major concerns about its product applicability. High vector-associated toxicity and widespread preexisting immunity have been shown to significantly impede the effectiveness of HAdV-5–mediated gene transfer. It is therefore that the in-depth knowledge attained working on HAdV-5 is currently being used to develop alternative vectors. Here, we provide a comprehensive overview of data obtained in recent years disqualifying the HAdV-5 vector for systemic gene delivery as well as novel strategies being pursued to overcome the limitations observed with particular emphasis on the ongoing vectorization efforts to obtain vectors based on alternative serotypes. PMID:26478249

Pre-existing immunity against vaccine vectors – friend or foe?

PubMed Central

Saxena, Manvendra; Van, Thi Thu Hao; Baird, Fiona J.; Coloe, Peter J.

2013-01-01

Over the last century, the successful attenuation of multiple bacterial and viral pathogens has led to an effective, robust and safe form of vaccination. Recently, these vaccines have been evaluated as delivery vectors for heterologous antigens, as a means of simultaneous vaccination against two pathogens. The general consensus from published studies is that these vaccine vectors have the potential to be both safe and efficacious. However, some of the commonly employed vectors, for example Salmonella and adenovirus, often have pre-existing immune responses in the host and this has the potential to modify the subsequent immune response to a vectored antigen. This review examines the literature on this topic, and concludes that for bacterial vectors there can in fact, in some cases, be an enhancement in immunogenicity, typically humoral, while for viral vectors pre-existing immunity is a hindrance for subsequent induction of cell-mediated responses. PMID:23175507

Customizing the genome as therapy for the β-hemoglobinopathies

PubMed Central

Canver, Matthew C.

2016-01-01

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats–based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34+ hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. PMID:27053533

Involvement of H-ras in erythroid differentiation of TF1 and human umbilical cord blood CD34 cells.

PubMed

Ge, Y; Li, Z H; Marshall, M S; Broxmeyer, H E; Lu, L

1998-06-01

To investigate the role of the ras gene in erythroid differentiation, a human erythroleukemic cell line, TF1, was transduced with a selectable retroviral vector carrying a mammalian wild type H-ras gene or a cytoplasmic dominant negative RAS1 gene. Transduction of TF1 cells with the wild type H-ras gene resulted in changes of cell types and up-regulation of erythroid-specific gene expression similar to that seen in differentiating erythroid cells. The number of red blood cell containing colonies derived from TF1 cells transduced with wild type H-ras cDNA was significantly increased and the cells in the colonies were more hemoglobinized as estimated by a deeper red color compared to those colony cells from mock or dominant negative RAS1 gene transduced TF1 cells, suggesting increased erythroid differentiation of TF1 cells after transduction of wild type H-ras in vitro. The mRNA levels of beta- and gamma-, but not alpha-, globin genes were significantly higher in H-ras transduced TF1 cells than those in TF1 cells transduced with mock or dominant negative RAS1 gene. Moreover, a 4kb pre-mRNA of the Erythropoietin receptor (EpoR) was highly expressed only in H-ras transduced TF1 cells. Additionally, human umbilical cord blood (CB) CD34 cells which are highly enriched for hematopoietic stem/progenitor cells were transduced with the same retroviral vectors to evaluate in normal primary cells the activities of H-ras in erythroid differentiation. Increased numbers of erythroid cell containing colonies (BFU-E and CFU-GEMM) were observed in CD34 cells transduced with the H-ras cDNA, compared to that from mock transduced cells. These data suggest a possible role for ras in erythroid differentiation.

Baculovirus GP64-mediated entry into mammalian cells.

PubMed

Kataoka, Chikako; Kaname, Yuuki; Taguwa, Shuhei; Abe, Takayuki; Fukuhara, Takasuke; Tani, Hideki; Moriishi, Kohji; Matsuura, Yoshiharu

2012-03-01

The baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV) serves as an efficient viral vector, not only for abundant gene expression in insect cells, but also for gene delivery into mammalian cells. Lentivirus vectors pseudotyped with the baculovirus envelope glycoprotein GP64 have been shown to acquire more potent gene transduction than those with vesicular stomatitis virus (VSV) envelope glycoprotein G. However, there are conflicting hypotheses about the molecular mechanisms of the entry of AcMNPV. Moreover, the mechanisms of the entry of pseudotyped viruses bearing GP64 into mammalian cells are not well characterized. Determination of the entry mechanisms of AcMNPV and the pseudotyped viruses bearing GP64 is important for future development of viral vectors that can deliver genes into mammalian cells with greater efficiency and specificity. In this study, we generated three pseudotyped VSVs, NPVpv, VSVpv, and MLVpv, bearing envelope proteins of AcMNPV, VSV, and murine leukemia virus, respectively. Depletion of membrane cholesterol by treatment with methyl-β-cyclodextrin, which removes cholesterol from cellular membranes, inhibited GP64-mediated internalization in a dose-dependent manner but did not inhibit attachment to the cell surface. Treatment of cells with inhibitors or the expression of dominant-negative mutants for dynamin- and clathrin-mediated endocytosis abrogated the internalization of AcMNPV and NPVpv into mammalian cells, whereas inhibition of caveolin-mediated endocytosis did not. Furthermore, inhibition of macropinocytosis reduced GP64-mediated internalization. These results suggest that cholesterol in the plasma membrane, dynamin- and clathrin-dependent endocytosis, and macropinocytosis play crucial roles in the entry of viruses bearing baculovirus GP64 into mammalian cells.

Biosafety considerations for attenuated measles virus vectors used in virotherapy and vaccination.

PubMed

Baldo, Aline; Galanis, Evanthia; Tangy, Frédéric; Herman, Philippe

2016-05-03

Attenuated measles virus (MV) is one of the most effective and safe vaccines available, making it attractive candidate vector to prevent infectious diseases. Attenuated MV have acquired the ability to use the complement regulator CD46 as a major receptor to mediate virus entry and intercellular fusion. Therefore, attenuated MV strains preferentially infect and destroy a wide variety of cancer cells making them also attractive oncolytic vectors. The use of recombinant MV vector has to comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The present article highlights the main characteristics of MV and recombinant MV vectors used for vaccination and virotherapy and discusses these features from a biosafety point of view.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubo, Yoshinao; Yoshii, Hiroaki; Kamiyama, Haruka

Ezrin, radixin, and moesin (ERM) proteins supply functional linkage between integral membrane proteins and cytoskeleton in mammalian cells to regulate membrane protein dynamisms and cytoskeleton rearrangement. To assess potential role of the ERM proteins in HIV-1 lifecycle, we examined if suppression of ERM function in human cells expressing HIV-1 infection receptors influences HIV-1 envelope (Env)-mediated HIV-1-vector transduction and cell-cell fusion. Expression of an ezrin dominant negative mutant or knockdown of ezrin, radixin, or moesin with siRNA uniformly decreased transduction titers of HIV-1 vectors having X4-tropic Env. In contrast, transduction titers of R5-tropic Env HIV-1 vectors were decreased only by radixinmore » knockdown: ezrin knockdown had no detectable effects and moesin knockdown rather increased transduction titer. Each of the ERM suppressions had no detectable effects on cell surface expression of CD4, CCR5, and CXCR4 or VSV-Env-mediated HIV-1 vector transductions. Finally, the individual knockdown of ERM mRNAs uniformly decreased efficiency of cell-cell fusion mediated by X4- or R5-tropic Env and HIV-1 infection receptors. These results suggest that (i) the ERM proteins function as positive regulators of infection by X4-tropic HIV-1, (ii) moesin additionally functions as a negative regulator of R5-tropic HIV-1 virus infection at the early step(s) after the membrane fusion, and (iii) receptor protein dynamisms are regulated differently in R5- and X4-tropic HIV-1 infections.« less

Plasmodium evasion of mosquito immunity and global malaria transmission: The lock-and-key theory.

PubMed

Molina-Cruz, Alvaro; Canepa, Gaspar E; Kamath, Nitin; Pavlovic, Noelle V; Mu, Jianbing; Ramphul, Urvashi N; Ramirez, Jose Luis; Barillas-Mury, Carolina

2015-12-08

Plasmodium falciparum malaria originated in Africa and became global as humans migrated to other continents. During this journey, parasites encountered new mosquito species, some of them evolutionarily distant from African vectors. We have previously shown that the Pfs47 protein allows the parasite to evade the mosquito immune system of Anopheles gambiae mosquitoes. Here, we investigated the role of Pfs47-mediated immune evasion in the adaptation of P. falciparum to evolutionarily distant mosquito species. We found that P. falciparum isolates from Africa, Asia, or the Americas have low compatibility to malaria vectors from a different continent, an effect that is mediated by the mosquito immune system. We identified 42 different haplotypes of Pfs47 that have a strong geographic population structure and much lower haplotype diversity outside Africa. Replacement of the Pfs47 haplotypes in a P. falciparum isolate is sufficient to make it compatible to a different mosquito species. Those parasites that express a Pfs47 haplotype compatible with a given vector evade antiplasmodial immunity and survive. We propose that Pfs47-mediated immune evasion has been critical for the globalization of P. falciparum malaria as parasites adapted to new vector species. Our findings predict that this ongoing selective force by the mosquito immune system could influence the dispersal of Plasmodium genetic traits and point to Pfs47 as a potential target to block malaria transmission. A new model, the "lock-and-key theory" of P. falciparum globalization, is proposed, and its implications are discussed.

A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

PubMed Central

Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

2014-01-01

Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

A Drosophila melanogaster hobo-white + vector mediates low frequency gene transfer in D. vlrllls with full Interspecific white + complementation

USDA-ARS?s Scientific Manuscript database

Transformation of a Drosophila virilis white mutant host strain was attempted by using a hobo vector containing the D. melanogaster mini-white+ cassette (H[w+, hawN]) and an unmodified or heat shock regulated hobo transposase helper. Two transformant lines were recovered with the unmodified helper (...

Hemoglobin stability: observations on the denaturation of normal and abnormal hemoglobins by oxidant dyes, heat, and alkali

PubMed Central

Rieder, Ronald F.

1970-01-01

Several unstable mutant hemoglobins have alterations which affect areas of the molecule involved in the attachment of heme to globin. Loss of heme from globin has been demonstrated during the denaturation of some of these unstable mutants. The importance of heme ligands for the stability of hemoglobin was illustrated in the present experiments on the denaturation of several hemoglobins and hemoglobin derivatives by heat, oxidative dyes, and alkali. Heating of normal hemolysates diluted to 4 g of hemoglobin per 100 ml at 50°C for 20 hr in 0.05 M sodium phosphate, pH 7.4, caused precipitation of 23-54% of the hemoglobin. Dialysis against water or dilution of the sample decreased denaturation to 12-20%. Precipitation was decreased to less than 3.5% by the presence of 0.015 M potassium cyanide. Increasing the ionic strength of the medium increased precipitation. Cyanide prevented the formation of inclusion bodies when red cells containing unstable hemoglobin Philly, β35 tyr → phe, were incubated with the redox dye new methylene blue. Conversion to methemoglobin increased the rate of alkali denaturation of hemoglobin but the presence of potassium cyanide returned the denaturation rate to that of ferrohemoglobin. The ability of cyanide to decrease heat precipitation of hemoglobin may depend on a dimeric or tetrameric state of the hemoglobin molecule. Purified β-chains, which exist as tetramers, were stabilized but purified monomeric α-chains were not rendered more heat resistant by the ligand. Stabilization of hemoglobin by cyanide required binding of the ligand to only one heme of an αβ-dimer. Hemoglobin Gun Hill, an unstable molecule with heme groups present only on the α-chains was quite heat stable in the presence of cyanide. The binding of cyanide to the iron atom in methemoglobin is thought to be associated with increased planarity of the heme group and increased stability of the heme-globin complex. The stabilizing effect of cyanide in the above experiments suggests that Heinz body formation, heat precipitation of hemoglobin, and the increased alkali denaturation of methemoglobin depend on changes of heme-globin binding. Images PMID:5480860

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2014-10-15

Thalassemia is an inherited blood disorder, caused by mutations in regulatory genes and transmitted as an autosomal recessive disorder, which results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains damage the red blood cell membranes, leading to their destruction and a phenomenon termed ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the potential to definitively cure the disease. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 11 November 2013. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane Collaboration methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Traceless Bioresponsive Shielding of Adenovirus Hexon with HPMA Copolymers Maintains Transduction Capacity In Vitro and In Vivo

PubMed Central

Prill, Jan-Michael; Šubr, Vladimír; Pasquarelli, Noemi; Engler, Tatjana; Hoffmeister, Andrea; Kochanek, Stefan; Ulbrich, Karel; Kreppel, Florian

2014-01-01

Capsid surface shielding of adenovirus vectors with synthetic polymers is an emerging technology to reduce unwanted interactions of the vector particles with cellular and non-cellular host components. While it has been shown that attachment of shielding polymers allows prevention of undesired interactions, it has become evident that a shield which is covalently attached to the vector surface can negatively affect gene transfer efficiency. Reasons are not only a limited receptor-binding ability of the shielded vectors but also a disturbance of intracellular trafficking processes, the latter depending on the interaction of the vector surface with the cellular transport machinery. A solution might be the development of bioresponsive shields that are stably maintained outside the host cell but released upon cell entry to allow for efficient gene delivery to the nucleus. Here we provide a systematic comparison of irreversible versus bioresponsive shields based on synthetic N-(2-hydroxypropyl)methacrylamide (HPMA) copolymers. In addition, the chemical strategy used for generation of the shield allowed for a traceless bioresponsive shielding, i.e., polymers could be released from the vector particles without leaving residual linker residues. Our data demonstrated that only a bioresponsive shield maintained the high gene transfer efficiency of adenovirus vectors both in vitro and in vivo. As an example for bioresponsive HPMA copolymer release, we analyzed the in vivo gene transfer in the liver. We demonstrated that both the copolymer's charge and the mode of shielding (irreversible versus traceless bioresponsive) profoundly affected liver gene transfer and that traceless bioresponsive shielding with positively charged HPMA copolymers mediated FX independent transduction of hepatocytes. In addition, we demonstrated that shielding with HPMA copolymers can mediate a prolonged blood circulation of vector particles in mice. Our results have significant implications for the future design of polymer-shielded Ad and provide a deeper insight into the interaction of shielded adenovirus vector particles with the host after systemic delivery. PMID:24475024

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-09-01

Human immunodeficiency virus (HIV)-associated sensory neuropathy is a common neurological complication of HIV infection affecting up to 30% of HIV-positive individuals. However, the exact neuropathological mechanisms remain unknown, which hinders our ability to develop effective treatments for HIV-related neuropathic pain (NP). In this study, we tested the hypothesis that inhibition of proinflammatory factors with overexpression of interleukin (IL)-10 reduces HIV-related NP in a rat model. NP was induced by the application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve. The hindpaws of rats were inoculated with nonreplicating herpes simplex virus (HSV) vectors expressing anti-inflammatory cytokine IL-10 or control vector. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The mechanical threshold response was assessed over time using the area under curves. The expression of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 in both the lumbar spinal cord and the L4/5 dorsal root ganglia (DRG), was examined at 14 and 28 days after vector inoculation using Western blots. We found that in the gp120-induced NP model, IL-10 overexpression mediated by the HSV vector resulted in a significant elevation of the mechanical threshold that was apparent on day 3 after vector inoculation compared with the control vector (P < 0.001). The antiallodynic effect of the single HSV vector inoculation expressing IL-10 lasted >28 days. The area under curve in the HSV vector expressing IL-10 was increased compared with that in the control vector (P < 0.0001). HSV vectors expressing IL-10 reversed the upregulation of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 expression at 14 and/or 28 days in the DRG and/or the spinal dorsal horn. Our studies demonstrate that blocking the signaling of these proinflammatory molecules in the DRG and/or the spinal cord using the HSV vector expressing IL-10 is able to reduce HIV-related NP. These results provide new insights on the potential mechanisms of HIV-associated NP and a proof of concept for treating painful HIV sensory neuropathy with this type of gene therapy.

Interplay and characterization of Dark Matter searches at colliders and in direct detection experiments

DOE PAGES

Malik, Sarah A.; McCabe, Christopher; Araujo, Henrique; ...

2015-05-18

In our White Paper we present and discuss a concrete proposal for the consistent interpretation of Dark Matter searches at colliders and in direct detection experiments. Furthermore, based on a specific implementation of simplified models of vector and axial-vector mediator exchanges, this proposal demonstrates how the two search strategies can be compared on an equal footing.

Determining putative vectors of the Bogia Coconut Syndrome phytoplasma using loop-mediated isothermal amplification of single-insect feeding media

PubMed Central

Lu, Hengyu; Wilson, Bree A. L.; Ash, Gavin J.; Woruba, Sharon B.; Fletcher, Murray J.; You, Minsheng; Yang, Guang; Gurr, Geoff M.

2016-01-01

Phytoplasmas are insect vectored mollicutes responsible for disease in many economically important crops. Determining which insect species are vectors of a given phytoplasma is important for managing disease but is methodologically challenging because disease-free plants need to be exposed to large numbers of insects, often over many months. A relatively new method to detect likely transmission involves molecular testing for phytoplasma DNA in sucrose solution that insects have fed upon. In this study we combined this feeding medium method with a loop-mediated isothermal amplification (LAMP) assay to study 627 insect specimens of 11 Hemiptera taxa sampled from sites in Papua New Guinea affected by Bogia coconut syndrome (BCS). The LAMP assay detected phytoplasma DNA from the feeding solution and head tissue of insects from six taxa belonging to four families: Derbidae, Lophopidae, Flatidae and Ricaniidae. Two other taxa yielded positives only from the heads and the remainder tested negative. These results demonstrate the utility of combining single-insect feeding medium tests with LAMP assays to identify putative vectors that can be the subject of transmission tests and to better understand phytoplasma pathosystems. PMID:27786249

The Inside Out of Lentiviral Vectors

PubMed Central

Durand, Stéphanie; Cimarelli, Andrea

2011-01-01

Lentiviruses induce a wide variety of pathologies in different animal species. A common feature of the replicative cycle of these viruses is their ability to target non-dividing cells, a property that constitutes an extremely attractive asset in gene therapy. In this review, we shall describe the main basic aspects of the virology of lentiviruses that were exploited to obtain efficient gene transfer vectors. In addition, we shall discuss some of the hurdles that oppose the efficient genetic modification mediated by lentiviral vectors and the strategies that are being developed to circumvent them. PMID:22049307

Insulated Foamy Viral Vectors

PubMed Central

Browning, Diana L.; Collins, Casey P.; Hocum, Jonah D.; Leap, David J.; Rae, Dustin T.; Trobridge, Grant D.

2016-01-01

Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34+ cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy. PMID:26715244

[Retroviral-mediated transfer of a hygromycin phosphotransferase-thymidine kinase fusion gene into human bladder carcinoma cell].

PubMed

Ye, C; Chen, S; Pei, X; Li, L; Feng, K

1999-08-01

To evaluate the therapeutic efficacy of retroviral-mediated hygromycin phosphotransferase-thymidine kinase fusion gene (HyTK)/GCV on human bladder carcinoma cell. A retroviral expression vector pL (HyTK) SN was constructed. By using FuGENE 6-mediated transfection and "ping-pong effect" technique, high-titer of retroviral supernatant was obtained and HyTK gene was transferred into EJ cells. A retroviral vector encoding, enhanced green fluorescent protein, EGFP was used to rapidly detect the transduction efficiency. Antitumor effects were observed after GCV treatment. In vitro experiments demonstrated the EJ cells transferred by HyTK gene were killed in the GCV treatment. Non-transduced parental cells were not sensitive to GCV, but they were dead by the bystander killing of neighboring cells when mixed with EJ/HyTK cells at various ratios. In addition, this not only affect wild-type EJ cells but also cells from different bladder carcinoma cell lines. Retroviral-mediated HyTK/GCV systems were a promising suicide gene therapy for bladder carcinoma. EGFP may act as a convenient and rapid reporter to monitor retroviral-mediated gene transfer and expression in bladder carcinoma cells.

Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ.

PubMed

Aida, Tomomi; Nakade, Shota; Sakuma, Tetsushi; Izu, Yayoi; Oishi, Ayu; Mochida, Keiji; Ishikubo, Harumi; Usami, Takako; Aizawa, Hidenori; Yamamoto, Takashi; Tanaka, Kohichi

2016-11-28

Although CRISPR/Cas enables one-step gene cassette knock-in, assembling targeting vectors containing long homology arms is a laborious process for high-throughput knock-in. We recently developed the CRISPR/Cas-based precise integration into the target chromosome (PITCh) system for a gene cassette knock-in without long homology arms mediated by microhomology-mediated end-joining. Here, we identified exonuclease 1 (Exo1) as an enhancer for PITCh in human cells. By combining the Exo1 and PITCh-directed donor vectors, we achieved convenient one-step knock-in of gene cassettes and floxed allele both in human cells and mouse zygotes. Our results provide a technical platform for high-throughput knock-in.

The Bartonella quintana Extracytoplasmic Function Sigma Factor RpoE Has a Role in Bacterial Adaptation to the Arthropod Vector Environment

PubMed Central

Abromaitis, Stephanie

2013-01-01

Bartonella quintana is a vector-borne bacterial pathogen that causes fatal disease in humans. During the infectious cycle, B. quintana transitions from the hemin-restricted human bloodstream to the hemin-rich body louse vector. Because extracytoplasmic function (ECF) sigma factors often regulate adaptation to environmental changes, we hypothesized that a previously unstudied B. quintana ECF sigma factor, RpoE, is involved in the transition from the human host to the body louse vector. The genomic context of B. quintana rpoE identified it as a member of the ECF15 family of sigma factors found only in alphaproteobacteria. ECF15 sigma factors are believed to be the master regulators of the general stress response in alphaproteobacteria. In this study, we examined the B. quintana RpoE response to two stressors that are encountered in the body louse vector environment, a decreased temperature and an increased hemin concentration. We determined that the expression of rpoE is significantly upregulated at the body louse (28°C) versus the human host (37°C) temperature. rpoE expression also was upregulated when B. quintana was exposed to high hemin concentrations. In vitro and in vivo analyses demonstrated that RpoE function is regulated by a mechanism involving the anti-sigma factor NepR and the response regulator PhyR. The ΔrpoE ΔnepR mutant strain of B. quintana established that RpoE-mediated transcription is important in mediating the tolerance of B. quintana to high hemin concentrations. We present the first analysis of an ECF15 sigma factor in a vector-borne human pathogen and conclude that RpoE has a role in the adaptation of B. quintana to the hemin-rich arthropod vector environment. PMID:23564167

Biosafety considerations for attenuated measles virus vectors used in virotherapy and vaccination

PubMed Central

Baldo, Aline; Galanis, Evanthia; Tangy, Frédéric; Herman, Philippe

2016-01-01

ABSTRACT Attenuated measles virus (MV) is one of the most effective and safe vaccines available, making it attractive candidate vector to prevent infectious diseases. Attenuated MV have acquired the ability to use the complement regulator CD46 as a major receptor to mediate virus entry and intercellular fusion. Therefore, attenuated MV strains preferentially infect and destroy a wide variety of cancer cells making them also attractive oncolytic vectors. The use of recombinant MV vector has to comply with various regulatory requirements, particularly relating to the assessment of potential risks for human health and the environment. The present article highlights the main characteristics of MV and recombinant MV vectors used for vaccination and virotherapy and discusses these features from a biosafety point of view. PMID:26631840

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bank, A.; Anderson, W.F.; Zaino, E.C.

This book discusses the topics presented at the symposium on the subject of 'Thalassemia'. Sickle cell anemia is also briefly discussed. The aspects discussed are chromosomal defects of anemias particularly globin synthesis, and the role of messenger RNA and other chromosomes.

The globins of cyanobacteria and algae.

PubMed

Johnson, Eric A; Lecomte, Juliette T J

2013-01-01

Approximately, 20 years ago, a haemoglobin gene was identified within the genome of the cyanobacterium Nostoc commune. Haemoglobins have now been confirmed in multiple species of photosynthetic microbes beyond N. commune, and the diversity of these proteins has recently come under increased scrutiny. This chapter summarizes the state of knowledge concerning the phylogeny, physiology and chemistry of globins in cyanobacteria and green algae. Sequence information is by far the best developed and the most rapidly expanding aspect of the field. Structural and ligand-binding properties have been described for just a few proteins. Physiological data are available for even fewer. Although activities such as nitric oxide dioxygenation and oxygen scavenging are strong candidates for cellular function, dedicated studies will be required to complete the story on this intriguing and ancient group of proteins. © 2013 Elsevier Ltd. All rights reserved.

Customizing the genome as therapy for the β-hemoglobinopathies.

PubMed

Canver, Matthew C; Orkin, Stuart H

2016-05-26

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats-based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34(+) hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. © 2016 by The American Society of Hematology.

[RDBH-method and big DyeTM terminator technology in accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster].

PubMed

Akperova, G A

2014-11-01

IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.

Insulation of the Chicken β-Globin Chromosomal Domain from a Chromatin-Condensing Protein, MENT

PubMed Central

Istomina, Natalia E.; Shushanov, Sain S.; Springhetti, Evelyn M.; Karpov, Vadim L.; A. Krasheninnikov, Igor; Stevens, Kimberly; Zaret, Kenneth S.; Singh, Prim B.; Grigoryev, Sergei A.

2003-01-01

Active genes are insulated from developmentally regulated chromatin condensation in terminally differentiated cells. We mapped the topography of a terminal stage-specific chromatin-condensing protein, MENT, across the active chicken β-globin domain. We observed two sharp transitions of MENT concentration coinciding with the β-globin boundary elements. The MENT distribution profile was opposite to that of acetylated core histones but correlated with that of histone H3 dimethylated at lysine 9 (H3me2K9). Ectopic MENT expression in NIH 3T3 cells caused a large-scale and specific remodeling of chromatin marked by H3me2K9. MENT colocalized with H3me2K9 both in chicken erythrocytes and NIH 3T3 cells. Mutational analysis of MENT and experiments with deacetylase inhibitors revealed the essential role of the reaction center loop domain and an inhibitory affect of histone hyperacetylation on the MENT-induced chromatin remodeling in vivo. In vitro, the elimination of the histone H3 N-terminal peptide containing lysine 9 by trypsin blocked chromatin self-association by MENT, while reconstitution with dimethylated but not acetylated N-terminal domain of histone H3 specifically restored chromatin self-association by MENT. We suggest that histone H3 modification at lysine 9 directly regulates chromatin condensation by recruiting MENT to chromatin in a fashion that is spatially constrained from active genes by gene boundary elements and histone hyperacetylation. PMID:12944473

Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

PubMed

Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

2015-01-01

To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Iron-heme-Bach1 axis is involved in erythroblast adaptation to iron deficiency.

PubMed

Kobayashi, Masahiro; Kato, Hiroki; Hada, Hiroshi; Itoh-Nakadai, Ari; Fujiwara, Tohru; Muto, Akihiko; Inoguchi, Yukihiro; Ichiyanagi, Kenji; Hojo, Wataru; Tomosugi, Naohisa; Sasaki, Hiroyuki; Harigae, Hideo; Igarashi, Kazuhiko

2017-03-01

Iron plays the central role in oxygen transport by erythrocytes as a constituent of heme and hemoglobin. The importance of iron and heme is also to be found in their regulatory roles during erythroblast maturation. The transcription factor Bach1 may be involved in their regulatory roles since it is deactivated by direct binding of heme. To address whether Bach1 is involved in the responses of erythroblasts to iron status, low iron conditions that induced severe iron deficiency in mice were established. Under iron deficiency, extensive gene expression changes and mitophagy disorder were induced during maturation of erythroblasts. Bach1 -/- mice showed more severe iron deficiency anemia in the developmental phase of mice and a retarded recovery once iron was replenished when compared with wild-type mice. In the absence of Bach1, the expression of globin genes and Hmox1 (encoding heme oxygenase-1) was de-repressed in erythroblasts under iron deficiency, suggesting that Bach1 represses these genes in erythroblasts under iron deficiency to balance the levels of heme and globin. Moreover, an increase in genome-wide DNA methylation was observed in erythroblasts of Bach1 -/- mice under iron deficiency. These findings reveal the principle role of iron as a regulator of gene expression in erythroblast maturation and suggest that the iron-heme-Bach1 axis is important for a proper adaptation of erythroblast to iron deficiency to avoid toxic aggregates of non-heme globin. Copyright© Ferrata Storti Foundation.

An efficient procedure for marker-free mutagenesis of S. coelicolor by site-specific recombination for secondary metabolite overproduction.

PubMed

Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming

2013-01-01

Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.

[Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

PubMed

Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

2016-11-20

To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

A Chimeric HS4-SAR Insulator (IS2) That Prevents Silencing and Enhances Expression of Lentiviral Vectors in Pluripotent Stem Cells

PubMed Central

Gutierrez-Guerrero, Alejandra; Cobo, Marién; Muñoz, Pilar

2014-01-01

Chromatin insulators, such as the chicken β-globin locus control region hypersensitive site 4 (HS4), and scaffold/matrix attachment regions (SARs/MARs) have been incorporated separately or in combination into retroviral vectors (RVs) in order to increase transgene expression levels, avoid silencing and reduce expression variability. However, their incorporation into RVs either produces a reduction on titer and/or expression levels or do not have sufficient effect on stem cells. In order to develop an improved insulator we decided to combine SAR elements with HS4 insulators. We designed several synthetic shorter SAR elements containing 4 or 5 MAR/SARs recognition signatures (MRS) and studied their effects on a lentiviral vector (LV) expressing eGFP through the SFFV promoter (SE). A 388 bp SAR element containing 5 MRS, named SAR2, was as efficient or superior to the other SARs analyzed. SAR2 enhanced transgene expression and reduced silencing and variability on human embryonic stem cells (hESCs). We next compared the effect of different HS4-based insulators, the HS4-Core (250 bp), the HS4-Ext (400 bp) and the HS4-650 (650 bp). All HS4 elements reduced silencing and expression variability but they also had a negative effect on transgene expression levels and titer. In general, the HS4-650 element had a better overall effect. Based on these data we developed a chimeric insulator, IS2, combining the SAR2 and the HS4-650. When incorporated into the 3′ LTR of the SE LV, the IS2 element was able to enhance expression, avoid silencing and reduce variability of expression on hESCs. Importantly, these effects were maintained after differentiation of the transduced hESCs toward the hematopoietic linage. Neither the HS4-650 nor the SAR2 elements had these effects. The IS2 element is therefore a novel insulator that confers expression stability and enhances expression of LVs on stem cells. PMID:24400083

Axial vector Z‧ and anomaly cancellation

NASA Astrophysics Data System (ADS)

Ismail, Ahmed; Keung, Wai-Yee; Tsao, Kuo-Hsing; Unwin, James

2017-05-01

Whilst the prospect of new Z‧ gauge bosons with only axial couplings to the Standard Model (SM) fermions is widely discussed, examples of anomaly-free renormalisable models are lacking in the literature. We look to remedy this by constructing several motivated examples. Specifically, we consider axial vectors which couple universally to all SM fermions, as well as those which are generation-specific, leptophilic, and leptophobic. Anomaly cancellation typically requires the presence of new coloured and charged chiral fermions, and we argue that in a large class of models masses of these new states are expected to be comparable to that of the axial vector. Finally, an axial vector mediator could provide a portal between SM and hidden sector states, and we also consider the possibility that the axial vector couples to dark matter. If the dark matter relic density is set due to freeze-out via the axial vector, this strongly constrains the parameter space.

Adenovirus small interfering RNA targeting ezrin induces apoptosis and inhibits metastasis of human osteosarcoma MG-63 cells.

PubMed

Tao, Zhi-Wei; Zou, Ping-An

2018-06-13

Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).

Recent tissue engineering-based advances for effective rAAV-mediated gene transfer in the musculoskeletal system.

PubMed

Rey-Rico, Ana; Cucchiarini, Magali

2016-04-01

Musculoskeletal tissues are diverse and significantly different in their ability to repair upon injury. Current treatments often fail to reproduce the natural functions of the native tissue, leading to an imperfect healing. Gene therapy might improve the repair of tissues by providing a temporarily and spatially defined expression of the therapeutic gene(s) at the site of the injury. Several gene transfer vehicles have been developed to modify various human cells and tissues from musculoskeletal system among which the non-pathogenic, effective, and relatively safe recombinant adeno-associated viral (rAAV) vectors that have emerged as the preferred gene delivery system to treat human disorders. Adapting tissue engineering platforms to gene transfer approaches mediated by rAAV vectors is an attractive tool to circumvent both the limitations of the current therapeutic options to promote an effective healing of the tissue and the natural obstacles from these clinically adapted vectors to achieve an efficient and durable gene expression of the therapeutic sequences within the lesions.

Lentiviral vector-mediated genetic modification of human neural progenitor cells for ex vivo gene therapy.

PubMed

Capowski, Elizabeth E; Schneider, Bernard L; Ebert, Allison D; Seehus, Corey R; Szulc, Jolanta; Zufferey, Romain; Aebischer, Patrick; Svendsen, Clive N

2007-07-30

Human neural progenitor cells (hNPC) hold great potential as an ex vivo system for delivery of therapeutic proteins to the central nervous system. When cultured as aggregates, termed neurospheres, hNPC are capable of significant in vitro expansion. In the current study, we present a robust method for lentiviral vector-mediated gene delivery into hNPC that maintains the differentiation and proliferative properties of neurosphere cultures while minimizing the amount of viral vector used and controlling the number of insertion sites per population. This method results in long-term, stable expression even after differentiation of the hNPC to neurons and astrocytes and allows for generation of equivalent transgenic populations of hNPC. In addition, the in vitro analysis presented predicts the behavior of transgenic lines in vivo when transplanted into a rodent model of Parkinson's disease. The methods presented provide a powerful tool for assessing the impact of factors such as promoter systems or different transgenes on the therapeutic utility of these cells.

Adenovirus vector-mediated ex vivo gene transfer of brain-derived neurotrophic factor to bone marrow stromal cells promotes axonal regeneration after transplantation in completely transected adult rat spinal cord

PubMed Central

Kamada, Takahito; Hashimoto, Masayuki; Murakami, Masazumi; Shirasawa, Hiroshi; Sakao, Seiichiro; Ino, Hidetoshi; Yoshinaga, Katsunori; Koshizuka, Shuhei; Moriya, Hideshige; Yamazaki, Masashi

2007-01-01

The aim of this study was to evaluate the efficacy in adult rat completely transected spinal cord of adenovirus vector-mediated brain-derived neurotrophic factor (BDNF) ex vivo gene transfer to bone marrow stromal cells (BMSC). BMSC were infected with adenovirus vectors carrying β-galactosidase (AxCALacZ) or BDNF (AxCABDNF) genes. The T8 segment of spinal cord was removed and replaced by graft containing Matrigel alone (MG group) or Matrigel and BMSC infected by AxCALacZ (BMSC-LacZ group) or AxCABDNF (BMSC-BDNF group). Axons in the graft were evaluated by immunohistochemistry and functional recovery was assessed with BBB locomotor scale. In the BMSC-BDNF group, the number of fibers positive for growth associated protein-43, tyrosine hydroxylase, and calcitonin gene-related peptide was significantly larger than numbers found for the MG and BMSC-LacZ groups. Rats from BMSC-BDNF and BMSC-LacZ groups showed significant recovery of hind limb function compared with MG rats; however, there was no significant difference between groups in degree of functional recovery. These findings demonstrate that adenovirus vector-mediated ex vivo gene transfer of BDNF enhances the capacity of BMSC to promote axonal regeneration in this completely transected spinal cord model; however, BDNF failed to enhance hind limb functional recovery. Further investigation is needed to establish an optimal combination of cell therapy and neurotrophin gene transfer for cases of spinal cord injury. PMID:17885772

Gene therapy using retrovirus vectors: vector development and biosafety at clinical trials.

PubMed

Doi, Knayo; Takeuchi, Yasuhiro

2015-01-01

Retrovirus vectors (gammaretroviral and lentiviral vectors) have been considered as promising tools to transfer therapeutic genes into patient cells because they can permanently integrate into host cellular genome. To treat monogenic, inherited diseases, retroviral vectors have been used to add correct genes into patient cells. Conventional gammaretroviral vectors achieved successful results in clinical trials: treated patients had therapeutic gene expression in target cells and had improved symptoms of diseases. However, serious side-effects of leukemia occurred, caused by retroviral insertional mutagenesis (IM). These incidences stressed the importance of monitoring vector integration sites in patient cells as well as of re-consideration on safer vectors. More recently lentiviral vectors which can deliver genes into non-dividing cells started to be used in clinical trials including neurological disorders, showing their efficacy. Vector integration site analysis revealed that lentiviruses integrate less likely to near promoter regions of oncogenes than gammaretroviruses and no adverse events have been reported in lentiviral vector-mediated gene therapy clinical trials. Therefore lentiviral vectors have promises to be applied to a wide range of common diseases in near future. For example, T cells from cancer patients were transduced to express chimeric T cell receptors recognizing their tumour cells enhancing patients' anti-cancer immunity.

Type II flavohemoglobin of Mycobacterium smegmatis oxidizes d-lactate and mediate electron transfer.

PubMed

Thakur, Naveen; Kumar, Ashwani; Dikshit, Kanak L

2018-06-01

Two distantly related flavohemoglobins (FHbs), MsFHbI and MsFHbII, having crucial differences in their heme and reductase domains, co-exist in Mycobacterium smegmatis. Function of MsFHbI is associated with nitric-oxide detoxification but physiological relevance of MsFHbII remains unknown. This study unravels some unique spectral and functional characteristics of MsFHbII. Unlike conventional type I FHbs, MsFHbII lacks nitric-oxide dioxygenase and NADH oxidase activities but utilizes d-lactate as an electron donor to mediate electron transfer. MsFHbII carries a d-lactate dehydrogenase type FAD binding motif in its reductase domain and oxidizes d-lactate in a FAD dependent manner to reduce the heme iron, suggesting that the globin is acting as an electron acceptor. Importantly, expression of MsFHbII in Escherichia coli imparted protection under oxidative stress, suggesting its important role in stress management of its host. Since M. smegmatis lacks the gene encoding for d-lactate dehydrogenase and d-lactate is produced during aerobic metabolism and also as a by-product of lipid peroxidation, the ability of MsFHbII to metabolize d-lactate may provide it a unique ability to balance the oxidative stress generated due to accumulation of d-lactate in the cell and at the same time sequester electrons and pass it to the respiratory apparatus. Copyright © 2018 Elsevier B.V. All rights reserved.

O Antigen Modulates Insect Vector Acquisition of the Bacterial Plant Pathogen Xylella fastidiosa

PubMed Central

Rapicavoli, Jeannette N.; Kinsinger, Nichola; Perring, Thomas M.; Backus, Elaine A.; Shugart, Holly J.; Walker, Sharon

2015-01-01

Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen. PMID:26386068

O antigen modulates insect vector acquisition of the bacterial plant pathogen Xylella fastidiosa.

PubMed

Rapicavoli, Jeannette N; Kinsinger, Nichola; Perring, Thomas M; Backus, Elaine A; Shugart, Holly J; Walker, Sharon; Roper, M Caroline

2015-12-01

Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Hexons from adenovirus serotypes 5 and 48 differentially protect adenovirus vectors from neutralization by mouse and human serum

PubMed Central

Harmon, Andrew W.; Moitra, Rituparna; Xu, Zhili

2018-01-01

Adenovirus vectors are widely used in gene therapy clinical trials, and preclinical studies with these vectors are often conducted in mice. It is therefore critical to understand whether mouse studies adequately predict the behavior of adenovirus vectors in humans. The most commonly-used adenovirus vectors are derived from adenovirus serotype 5 (Ad5). The Ad5 hexon protein can bind coagulation factor X (FX), and binding of FX has a major impact on vector interactions with other blood proteins. In mouse serum, FX protects Ad5 vectors from neutralization by natural antibodies and complement. In the current study, we similarly find that human FX inhibits neutralization of Ad5 vectors by human serum, and this finding is consistent among individual human sera. We show that human IgM and human IgG can each induce complement-mediated neutralization when Ad5 vectors are not protected by FX. Although mouse and human serum had similar effects on Ad5 vectors, we found that this was not true for a chimeric Ad5 vector that incorporated hexon regions from adenovirus serotype 48. Interestingly, this hexon-chimeric vector was neutralized by human serum, but not by mouse serum. These findings indicate that studies in mouse serum accurately predict the behavior of Ad5 vectors in human serum, but mouse serum is not an accurate model system for all adenovirus vectors. PMID:29401488

Foamy Virus Vector Carries a Strong Insulator in Its Long Terminal Repeat Which Reduces Its Genotoxic Potential

PubMed Central

2017-01-01

ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446

Parasite-mediated interactions within the insect vector: Trypanosoma rangeli strategies.

PubMed

Garcia, Eloi S; Castro, Daniele P; Figueiredo, Marcela B; Azambuja, Patrícia

2012-05-30

Trypanosoma rangeli is a protozoan that is non-pathogenic for humans and other mammals but causes pathology in the genus Rhodnius. T. rangeli and R. prolixus is an excellent model for studying the parasite-vector interaction, but its cycle in invertebrates remains unclear. The vector becomes infected on ingesting blood containing parasites, which subsequently develop in the gut, hemolymph and salivary glands producing short and large epimastigotes and metacyclic trypomastigotes, which are the infective forms. The importance of the T. rangeli cycle is the flagellate penetration into the gut cells and invasion of the salivary glands. The establishment of the parasite depends on the alteration of some vector defense mechanisms. Herein, we present our understanding of T. rangeli infection on the vector physiology, including gut and salivary gland invasions, hemolymph reactions and behavior alteration.

Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

PubMed

Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

2018-06-15

In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

Substitution of blood coagulation factor X-binding to Ad5 by position-specific PEGylation: Preventing vector clearance and preserving infectivity.

PubMed

Krutzke, L; Prill, J M; Engler, T; Schmidt, C Q; Xu, Z; Byrnes, A P; Simmet, T; Kreppel, F

2016-08-10

The biodistribution of adenovirus type 5 (Ad5) vector particles is heavily influenced by interaction of the particles with plasma proteins, including coagulation factor X (FX), which binds specifically to the major Ad5 capsid protein hexon. FX mediates hepatocyte transduction by intravenously-injected Ad5 vectors and shields vector particles from neutralization by natural antibodies and complement. In mice, mutant Ad5 vectors that are ablated for FX-binding become detargeted from hepatocytes, which is desirable for certain applications, but unfortunately such FX-nonbinding vectors also become sensitive to neutralization by mouse plasma proteins. To improve the properties of Ad5 vectors for systemic delivery, we developed a strategy to replace the natural FX shield by a site-specific chemical polyethylene glycol shield. Coupling of polyethylene glycol to a specific site in hexon hypervariable region 1 yielded vector particles that were protected from neutralization by natural antibodies and complement although they were unable to bind FX. These vector particles evaded macrophages in vitro and showed significantly improved pharmacokinetics and hepatocyte transduction in vivo. Thus, site-specific shielding of Ad5 vectors with polyethylene glycol rendered vectors FX-independent and greatly improved their properties for systemic gene therapy. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Large Animal Models for Foamy Virus Vector Gene Therapy

PubMed Central

Trobridge, Grant D.; Horn, Peter A.; Beard, Brian C.; Kiem, Hans-Peter

2012-01-01

Foamy virus (FV) vectors have shown great promise for hematopoietic stem cell (HSC) gene therapy. Their ability to efficiently deliver transgenes to multi-lineage long-term repopulating cells in large animal models suggests they will be effective for several human hematopoietic diseases. Here, we review FV vector studies in large animal models, including the use of FV vectors with the mutant O6-methylguanine-DNA methyltransferase, MGMTP140K to increase the number of genetically modified cells after transplantation. In these studies, FV vectors have mediated efficient gene transfer to polyclonal repopulating cells using short ex vivo transduction protocols designed to minimize the negative effects of ex vivo culture on stem cell engraftment. In this regard, FV vectors appear superior to gammaretroviral vectors, which require longer ex vivo culture to effect efficient transduction. FV vectors have also compared favorably with lentiviral vectors when directly compared in the dog model. FV vectors have corrected leukocyte adhesion deficiency and pyruvate kinase deficiency in the dog large animal model. FV vectors also appear safer than gammaretroviral vectors based on a reduced frequency of integrants near promoters and also near proto-oncogenes in canine repopulating cells. Together, these studies suggest that FV vectors should be highly effective for several human hematopoietic diseases, including those that will require relatively high percentages of gene-modified cells to achieve clinical benefit. PMID:23223198

Nanoparticle-mediated gene delivery.

PubMed

Jin, Sha; Leach, John C; Ye, Kaiming

2009-01-01

Nonviral gene delivery has been gaining considerable attention recently. Although the efficacy of DNA transfection, which is a major concern, is low in nonviral vector-mediated gene transfer compared with viral ones, nonviral vectors are relatively easy to prepare, less immunogenic and oncogenic, and have no potential of virus recombination and no limitation on the size of a transferred gene. The ability to incorporate genetic materials such as plasmid DNA, RNA, and siRNA into functionalized nanoparticles with little toxicity demonstrates a new era in pharmacotherapy for delivering genes selectively to tissues and cells. In this chapter, we highlight the basic concepts and applications of nonviral gene delivery using super paramagnetic iron oxide nanoparticles and functionalized silica nanoparticles. The experimental protocols related to these topics are described in the chapter.

Genetics Home Reference: methemoglobinemia, beta-globin type

MedlinePlus

... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.