Sample records for vector-based rna interference

  1. Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

    PubMed

    Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

    2005-12-01

    RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

  2. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    PubMed

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  3. Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

    PubMed

    Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

    2012-02-01

    Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

  4. A simple and robust vector-based shRNA expression system used for RNA interference.

    PubMed

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  5. RNA interference mediated in human primary cells via recombinant baculoviral vectors.

    PubMed

    Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

    2005-04-01

    The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

  6. Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

    PubMed Central

    Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

    2012-01-01

    The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

  7. Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

    PubMed Central

    Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

    2017-01-01

    Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

  8. Construction of siRNA/miRNA expression vectors based on a one-step PCR process

    PubMed Central

    Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

    2009-01-01

    Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

  9. RNA Interference in Infectious Tropical Diseases

    PubMed Central

    Hong, Young S.

    2008-01-01

    Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

  10. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

    PubMed

    Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

    2017-01-01

    The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

  11. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

    PubMed Central

    Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

    2017-01-01

    ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

  12. RNA Interference for improving the Outcome of Islet Transplantation

    PubMed Central

    Li, Feng; Mahato, Ram I

    2010-01-01

    Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

  13. Establishment of conditional vectors for hairpin siRNA knockdowns

    PubMed Central

    Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

    2003-01-01

    Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

  14. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

    PubMed Central

    Santangeloyz, K.S.; Bertoneyz, A.L.

    2011-01-01

    summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

  15. RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

    PubMed

    Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

    2018-01-01

    Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

  16. Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

    PubMed Central

    Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

    2018-01-01

    Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

  17. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    PubMed Central

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  18. Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

    PubMed

    Santangelo, K S; Bertone, A L

    2011-12-01

    To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  19. RNA Interference in Insect Vectors for Plant Viruses.

    PubMed

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-12-12

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

  20. RNA Interference in Insect Vectors for Plant Viruses

    PubMed Central

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

  1. Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

    PubMed Central

    Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

    2008-01-01

    RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

  2. RNA interference targets arbovirus replication in Culicoides cells.

    PubMed

    Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

    2013-03-01

    Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

  3. Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kanungo, Jyotshna

    RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

  4. Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

    PubMed

    Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

    2017-08-01

    RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

  5. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

    PubMed

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

    2016-07-08

    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  6. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    PubMed

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  7. [Herpes simplex virus-mediated RNA interference targeting vesicular glutamate transporter 3 attenuates tactile allodynia in mice].

    PubMed

    Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang

    2016-11-20

    To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.

  8. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    PubMed Central

    2010-01-01

    Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

  9. Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

    PubMed

    Whitten, Miranda; Dyson, Paul

    2017-03-01

    Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

  10. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

    PubMed

    Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

    2016-11-15

    Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

    PubMed Central

    Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

    2016-01-01

    ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding the flavivirus transmission cycle is important to identify novel targets to interfere with disease and to aid development of virus control strategies. Flaviviruses produce an abundant noncoding viral RNA called sfRNA in both arthropod and mammalian cells. To evaluate the role of sfRNA in flavivirus transmission, we infected mosquitoes with the flavivirus West Nile virus and an sfRNA-deficient mutant West Nile virus. We demonstrate that sfRNA determines the infection and transmission rates of West Nile virus in Culex pipiens mosquitoes. Comparison of infection via the blood meal versus intrathoracic injection, which bypasses the midgut, revealed that sfRNA is important to overcome the mosquito midgut barrier. We also show that sfRNA is processed by the antiviral RNA interference machinery in mosquitoes. This is the first report to describe a pivotal biological function of sfRNA in arthropods. The results explain why sfRNA production is evolutionarily conserved. PMID:27581979

  12. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    PubMed

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-06-01

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

  13. Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

    PubMed

    Hassan, Ali

    2006-06-01

    RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

  14. Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

    PubMed

    Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

    2013-01-01

    The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

  15. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    PubMed Central

    Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

    2009-01-01

    RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

  16. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

    PubMed Central

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

  17. HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

    PubMed

    Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

    2015-01-01

    Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

  18. The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

    PubMed

    Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

    2014-01-24

    This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    PubMed

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  20. Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

    PubMed

    Chen, Y; Redinbaugh, M G; Michel, A P

    2015-06-01

    Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

  1. Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

    PubMed Central

    Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

    2015-01-01

    Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

  2. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    PubMed

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  3. Silencing Genes in the Heart.

    PubMed

    Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

    2017-01-01

    Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

  4. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  5. shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

    PubMed

    Basit, Abdul; Tang, Wenwen; Wu, Dianqing

    2016-01-01

    To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

  6. Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

    USDA-ARS?s Scientific Manuscript database

    Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

  7. Special Issue: Gene Therapy with Emphasis on RNA Interference

    PubMed Central

    Lundstrom, Kenneth

    2015-01-01

    Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

  8. Tripartite polyionic complex (PIC) micelles as non-viral vectors for mesenchymal stem cell siRNA transfection.

    PubMed

    Raisin, Sophie; Morille, Marie; Bony, Claire; Noël, Danièle; Devoisselle, Jean-Marie; Belamie, Emmanuel

    2017-08-22

    In the context of regenerative medicine, the use of RNA interference mechanisms has already proven its efficiency in targeting specific gene expression with the aim of enhancing, accelerating or, more generally, directing stem cell differentiation. However, achievement of good transfection levels requires the use of a gene vector. For in vivo applications, synthetic vectors are an interesting option to avoid possible issues associated with viral vectors (safety, production costs, etc.). Herein, we report on the design of tripartite polyionic complex micelles as original non-viral polymeric vectors suited for mesenchymal stem cell transfection with siRNA. Three micelle formulations were designed to exhibit pH-triggered disassembly in an acidic pH range comparable to that of endosomes. One formulation was selected as the most promising with the highest siRNA loading capacity while clearly maintaining pH-triggered disassembly properties. A thorough investigation of the internalization pathway of micelles into cells with tagged siRNA was made before showing an efficient inhibition of Runx2 expression in primary bone marrow-derived stem cells. This work evidenced PIC micelles as promising synthetic vectors that allow efficient MSC transfection and control over their behavior, from the perspective of their clinical use.

  9. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

    PubMed Central

    Wuriyanghan, Hada; Falk, Bryce W.

    2013-01-01

    The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081

  10. Flavivirus RNAi suppression: decoding non-coding RNA.

    PubMed

    Pijlman, Gorben P

    2014-08-01

    Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

    PubMed Central

    Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

    2009-01-01

    Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

  12. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    USDA-ARS?s Scientific Manuscript database

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  13. Molecular interactions and immune responses between maize fine streak virus and the leafhopper vector G. nigrifrons through differential expression and RNA interference

    USDA-ARS?s Scientific Manuscript database

    Maize fine streak virus (MFSV) is an emerging virus of maize that is transmitted by an insect vector, the leafhopper called Graminella nigrifrons. Virus transmission by the leafhopper requires that the virus enter into and multiply in insect cells, tissues and organs before being transmitted to a ne...

  14. Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

    PubMed

    Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

    2008-05-01

    West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

  15. Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

    PubMed

    Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

    2010-01-01

    Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

  16. Design and cloning strategies for constructing shRNA expression vectors

    PubMed Central

    McIntyre, Glen J; Fanning, Gregory C

    2006-01-01

    Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

  17. Using RNA-seq and targeted nucleases to identify mechanisms of drug resistance in acute myeloid leukemia.

    PubMed

    Rathe, Susan K; Moriarity, Branden S; Stoltenberg, Christopher B; Kurata, Morito; Aumann, Natalie K; Rahrmann, Eric P; Bailey, Natashay J; Melrose, Ellen G; Beckmann, Dominic A; Liska, Chase R; Largaespada, David A

    2014-08-13

    The evolution from microarrays to transcriptome deep-sequencing (RNA-seq) and from RNA interference to gene knockouts using Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and Transcription Activator-Like Effector Nucleases (TALENs) has provided a new experimental partnership for identifying and quantifying the effects of gene changes on drug resistance. Here we describe the results from deep-sequencing of RNA derived from two cytarabine (Ara-C) resistance acute myeloid leukemia (AML) cell lines, and present CRISPR and TALEN based methods for accomplishing complete gene knockout (KO) in AML cells. We found protein modifying loss-of-function mutations in Dck in both Ara-C resistant cell lines. CRISPR and TALEN-based KO of Dck dramatically increased the IC₅₀ of Ara-C and introduction of a DCK overexpression vector into Dck KO clones resulted in a significant increase in Ara-C sensitivity. This effort demonstrates the power of using transcriptome analysis and CRISPR/TALEN-based KOs to identify and verify genes associated with drug resistance.

  18. Biodegradable charged polyester-based vectors (BCPVs) as an efficient non-viral transfection nanoagent for gene knockdown of the BCR-ABL hybrid oncogene in a human chronic myeloid leukemia cell line

    NASA Astrophysics Data System (ADS)

    Yang, Chengbin; Panwar, Nishtha; Wang, Yucheng; Zhang, Butian; Liu, Maixian; Toh, Huiting; Yoon, Ho Sup; Tjin, Swee Chuan; Chong, Peter Han Joo; Law, Wing-Cheung; Chen, Chih-Kuang; Yong, Ken-Tye

    2016-04-01

    First-line therapy of chronic myelogenous leukemia (CML) has always involved the use of BCR-ABL tyrosine-kinase inhibitors which is associated with an abnormal chromosome called Philadelphia chromosome. Although the overall survival rate has been improved by the current therapeutic regime, the presence of resistance has resulted in limited efficacy. In this study, an RNA interference (RNAi)-based therapeutic regime is proposed with the aim to knockdown the BCR-ABL hybrid oncogene using small interfering RNA (siRNA). The siRNA transfection rates have usually been limited due to the declining contact probability among polyplexes and the non-adherent nature of leukemic cells. Our work aims at addressing this limitation by using a biodegradable charged polyester-based vector (BCPV) as a nanocarrier for the delivery of BCR-ABL-specific siRNA to the suspension culture of a K562 CML cell line. BCR-ABL siRNAs were encapsulated in the BCPVs by electrostatic force. Cell internalization was facilitated by the BCPV and assessed by confocal microscopy and flow cytometry. The regulation of the BCR-ABL level in K562 cells as a result of RNAi was analyzed by real-time polymerase chain reaction (RT-PCR). We observed that BCPV was able to form stable nanoplexes with siRNA molecules, even in the presence of fetal bovine serum (FBS), and successfully assisted in vitro siRNA transfection in the non-adherent K562 cells. As a consequence of downregulation of BCR-ABL, BCPV-siRNA nanoplexes inhibited cell proliferation and promoted cell apoptosis. All results were compared with a commercial transfection reagent, Lipofectamine2000™, which served as a positive control. More importantly, this class of non-viral vector exhibits biodegradable features and negligible cytotoxicity, thus providing a versatile platform to deliver siRNA to non-adherent leukemia cells with high transfection efficiency by effectively overcoming extra- and intra-cellular barriers. Due to the excellent in vitro transfection results from BCPV-siRNA, a newly developed biodegradable transfection agent, BCPV, is being probed for transfection performance in an animal model.

  19. Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.

    PubMed Central

    Hu, W S; Bowman, E H; Delviks, K A; Pathak, V K

    1997-01-01

    Homologous recombination and deletions occur during retroviral replication when reverse transcriptase switches templates. While recombination occurs solely by intermolecular template switching (between copackaged RNAs), deletions can occur by an intermolecular or an intramolecular template switch (within the same RNA). To directly compare the rates of intramolecular and intermolecular template switching, two spleen necrosis virus-based vectors were constructed. Each vector contained a 110-bp direct repeat that was previously shown to delete at a high rate. The 110-bp direct repeat was flanked by two different sets of restriction site markers. These vectors were used to form heterozygotic virions containing RNAs of each parental vector, from which recombinant viruses were generated. By analyses of the markers flanking the direct repeats in recombinant and nonrecombinant proviruses, the rates of intramolecular and intermolecular template switching were determined. The results of these analyses indicate that intramolecular template switching is much more efficient than intermolecular template switching and that direct repeat deletions occur primarily through intramolecular template switching events. These studies also indicate that retroviral recombination occurs within a distinct viral subpopulation and exhibits high negative interference, whereby the selection of one recombination event increases the probability that a second recombination event will be observed. PMID:9223494

  20. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle

    PubMed Central

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-01-01

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike. PMID:23591809

  1. Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

    PubMed

    Poller, W; Fechner, H

    2010-01-01

    Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

  2. [Mechanism of protective effects of tumor necrosis factor receptor associated protein 1 on hypoxic cardiomyocytes of rats].

    PubMed

    Xiang, F; Zhang, D X; Ma, S Y; Huang, Y S

    2016-12-20

    Objective: To investigate the mechanism of protective effects of tumor necrosis factor receptor associated protein 1 (TRAP1) on hypoxic cardiomyocytes of rats. Methods: Primary cultured cardiomyocytes were obtained from neonatal Sprague-Dawley rats (aged 1 to 3 days) and then used in the following experiments. (1) Cells were divided into group TRAP1 and control group according to the random number table (the same grouping method below), and then the total protein of cells was extracted. Total protein of cells in group TRAP1 was added with mouse anti-rat TRAP1 monoclonal antibody, while that in control group was added with the same type of IgG from mouse. Co-immunoprecipitation and protein mass spectrography analysis were used to determine the possible proteins interacted with TRAP1. (2) Cells were divided into normoxia blank control group (NBC), normoxia+ TRAP1 interference control group (NTIC), normoxia+ TRAP1 interference group (NTI), normoxia+ TRAP1 over-expression control group (NTOC), and normoxia+ TRAP1 over-expression group (NTO), with 1 well in each group. Cells in group NBC were routinely cultured, while cells in the latter four groups were respectively added with TRAP1 RNA interference empty virus vector, TRAP1 RNA interference adenovirus vector, TRAP1 over-expression empty virus vector, and TRAP1 over-expression adenovirus vector. Another batch of cells were divided into group NBC, hypoxic blank control group (HBC), hypoxic+ TRAP1 interference control group (HTIC), hypoxic+ TRAP1 interference group (HTI), hypoxic+ TRAP1 over-expression control group (HTOC), and hypoxic+ TRAP1 over-expression group (HTO), with 1 well in each group. Cells in hypoxic groups were under hypoxic condition for 6 hours after being treated as those in the corresponding normoxia groups, respectively. The mRNA expression of cytochrome c oxidase subunit Ⅱ (COXⅡ) of cells in each group was detected by real time fluorescent quantitive reverse transcription polymerase chain reaction. Experiments were repeated for three times. (3) Cells were divided into group NBC, group HBC, group HTOC, group HTO, hypoxic+ TRAP1 over-expression+ COXⅡinterference control group (HTOCIC), and hypoxic+ TRAP1 over-expression+ COXⅡinterference group (HTOCI), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTOCIC and HTOCI were respectively transfected with COXⅡ RNA interference empty virus vector and COXⅡ RNA interference adenovirus vector, and then both added with TRAP1 over-expression adenovirus vector. The proliferation activity of cells was determined by cell counting kit 8 and microplate reader, and the ratio of death cells was measured by propidium lodide and Hoechst 33342 staining. Another batch of cells were divided into group NBC, group HBC, group HTIC, group HTI, hypoxic+ TRAP1 interference+ COXⅡover-expression control group (HTICOC), and hypoxic+ TRAP1 interference+ COXⅡ over-expression group (HTICO), with 3 wells in each group. Cells in the previous 4 groups were treated as those in experiment (2). Cells in group HTICOC and HTICO were both transfected with TRAP1 RNA interference adenovirus vector, and then respectively added with COXⅡ over-expression empty virus vector and COXⅡ over-expression adenovirus vector. The proliferation activity of cells and the ratio of death cells were detected as before. Experiments were repeated for three times. Data were processed with one-way analysis of variance and LSD test. Results: (1) The expression of TRAP1 was found in cells of group TRAP1, while that was not found in cells of control group. The possible proteins interacted with TRAP1 were keratin, COXⅡ, and an unknown protein with predicted molecular weight 13×10 3 . (2) Compared with that in group NBC, the mRNA expression of COXⅡof cells had no significant change in group NTIC and group NTOC (with P values above 0.05), but significantly decreased in group NTI ( P <0.01), and significantly increased in group NTO ( P <0.01). Compared with that in group NBC, the mRNA expression of COXⅡof cells in group HBC was significantly decreased ( P <0.01). Compared with that in group HBC, the mRNA expression of COXⅡof cells had no significant change in group HTIC and group HTOC (with P values above 0.05), but significantly decreased in group HTI ( P <0.01), and significantly increased in group HTO ( P <0.01). (3) The proliferation activity of cells in group NBC, group HBC, group HTOC, group HTO, group HTOCIC, and group HTOCI was respectively 0.498±0.022, 0.303±0.018, 0.313±0.032, 0.456±0.031, 0.448±0.034, and 0.335±0.026, and the ratios of death cells in above groups were respectively (4.7±1.5)%, (24.7±3.1)%, (26.0±2.7)%, (13.3±2.5)%, (12.7±2.1)%, and (21.0±1.7)%. Compared with those in group NBC, the proliferation activity of cells in HBC was decreased, while the ratio of death cells was increased (with P values below 0.01). Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was decreased in group HTO (with P values below 0.01). Compared with those in group HTO, the proliferation activity of cells and the ratio of death cells in group HTOCIC had no significant change (with P values above 0.05), while the proliferation activity of cells was decreased and the ratio of death cells was increased in group HTOCI (with P values below 0.01). (4) The proliferation activity of cells in group NBC, group HBC, group HTIC, group HTI, group HTICOC, and group HTICO was respectively 0.444±0.025, 0.275±0.016, 0.283±0.021, 0.150±0.009, 0.135±0.011, and 0.237±0.017, and the ratios of death cells in above groups were respectively (3.7±0.6)%, (21.0±2.7)%, (20.3±3.1)%, (31.7±2.5)%, (33.3±3.2)%, and (19.3±1.5)%. Compared with those in group HBC, the proliferation activity of cells and the ratio of death cells in group HTIC had no significant change (with P values above 0.05). Compared with those in group HBC and group HTIC, the proliferation activity of cells was decreased and the ratio of death cells was significantly increased in group HTI (with P values below 0.01). Compared with those in group HTI, the proliferation activity of cells and the ratio of death cells in group HTICOC had no significant change (with P values above 0.05), while the proliferation activity of cells was increased and the ratio of death cells was significantly decreased in group HTICO (with P values below 0.01). Conclusions: TRAP1 can up-regulate the expression of COXⅡ mRNA, and COXⅡ is one of the downstream effector molecules that TRAP1 mediates its protective effects on hypoxic cardiomyocytes.

  3. Bacterial delivery of RNAi effectors: transkingdom RNAi.

    PubMed

    Lage, Hermann; Krühn, Andrea

    2010-08-18

    RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

  4. A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method.

    PubMed

    Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

    2016-03-04

    Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications.

  5. A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method

    PubMed Central

    Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

    2016-01-01

    Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications. PMID:26959020

  6. Novel Methods for Mosquito Control using RNAi.

    USDA-ARS?s Scientific Manuscript database

    The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...

  7. Oral delivery of double-stranded RNAs induces mortality in nymphs and adults of the Asian citrus psyllid, Diaphorina citri.

    PubMed

    Galdeano, Diogo Manzano; Breton, Michèle Claire; Lopes, João Roberto Spotti; Falk, Bryce W; Machado, Marcos Antonio

    2017-01-01

    The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, is one of the most important citrus pests. ACP is the vector of the phloem-limited bacteria Candidatus Liberibacter americanus and Candidatus Liberibacter asiaticus, the causal agents of the devastating citrus disease huanglongbing (HLB). The management of HLB is based on the use of healthy young plants, eradication of infected plants and chemical control of the vector. RNA interference (RNAi) has proven to be a promising tool to control pests and explore gene functions. Recently, studies have reported that target mRNA knockdown in many insects can be induced through feeding with double-stranded RNA (dsRNA). In the current study, we targeted the cathepsin D, chitin synthase and inhibitor of apoptosis genes of adult and nymph ACP by feeding artificial diets mixed with dsRNAs and Murraya paniculata leaves placed in dsRNAs solutions, respectively. Adult ACP mortality was positively correlated with the amount of dsRNA used. Both nymphs and adult ACP fed dsRNAs exhibited significantly increased mortality over time compared with that of the controls. Moreover, qRT-PCR analysis confirmed the dsRNA-mediated RNAi effects on target mRNAs. These results showed that RNAi can be a powerful tool for gene function studies in ACP and perhaps for HLB control.

  8. Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

    PubMed

    Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

    2014-01-01

    HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

  9. An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

    PubMed Central

    Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

    2013-01-01

    RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

  10. The NS3 protein of Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and miRNAs

    PubMed Central

    Hemmes, Hans; Lakatos, Lóránt; Goldbach, Rob; Burgyán, József; Prins, Marcel

    2007-01-01

    RNA silencing plays a key role in antiviral defense as well as in developmental processes in plants and insects. Negative strand RNA viruses such as the plant virus Rice hoja blanca tenuivirus (RHBV) replicate in plants and in their insect transmission vector. Like most plant-infecting viruses, RHBV encodes an RNA silencing suppressor, the NS3 protein, and here it is demonstrated that this protein is capable of suppressing RNA silencing in both plants and insect cells. Biochemical analyses showed that NS3 efficiently binds siRNA as well as miRNA molecules. Binding of NS3 is greatly influenced by the size of small RNA molecules, as 21 nucleotide (nt) siRNA molecules are bound > 100 times more efficiently than 26 nt species. Competition assays suggest that the activity of NS3 is based on binding to siRNAs prior to strand separation during the assembly of the RNA-induced silencing complex. In addition, NS3 has a high affinity for miRNA/miRNA* duplexes, indicating that its activity might also interfere with miRNA-regulated gene expression in both insects and plants. PMID:17513697

  11. Effective mRNA Inhibition in PANC-1 Cells in Vitro Mediated via an mPEG-SeSe-PEI Delivery System.

    PubMed

    Zhang, Yuefeng; Yang, Bin; Liu, Yajie; Qin, Wenjie; Li, Chao; Wang, Lantian; Zheng, Wen; Wu, Yulian

    2016-05-01

    RNA interference (RNAi)-mediated gene therapy is a promising approach to cure various diseases. However, developing an effective, safe, specific RNAi delivery system remains a major challenge. In this study, a novel redox-responsive polyetherimide (PEI)-based nanovector, mPEG-SeSe-PEI, was developed and its efficacy evaluated. We prepared three mPEG-SeSe-PEI vector candidates for small interfering glyceraldehyde-3-phosphate dehydrogenase (siGADPH) and determined their physiochemical properties and transfection efficiency using flow cytometry and PEG11.6-SeSe-PEI polymer. We investigated the silencing efficacy of GADPH mRNA expression in PANC-1 cells and observed that PEG11.6-SeSe-PEI/siGADPH (N/P ratio=10) polyplexes possessed the appropriate size and zeta-potential and exhibited excellent in vitro gene silencing effects with the least cytotoxicity in PANC-1 cells. In conclusion, we present PEG11.6-SeSe-PEI as a potential therapeutic gene delivery system for small interfering RNA (siRNA).

  12. Small silencing RNAs: state-of-the-art.

    PubMed

    Grimm, Dirk

    2009-07-25

    Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.

  13. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    NASA Astrophysics Data System (ADS)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  14. Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma

    PubMed Central

    Xie, Yuran; Merkel, Olivia M

    2015-01-01

    Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454

  15. Triatominae-Trypanosoma cruzi/T. rangeli: Vector-parasite interactions.

    PubMed

    Vallejo, G A; Guhl, F; Schaub, G A

    2009-01-01

    Of the currently known 140 species in the family Reduviidae, subfamily Triatominae, those which are most important as vectors of the aetiologic agent of Chagas disease, Trypanosoma cruzi, belong to the tribes Triatomini and Rhodniini. The latter not only transmit T. cruzi but also Trypanosoma rangeli, which is considered apathogenic for the mammalian host but can be pathogenic for the vectors. Using different molecular methods, two main lineages of T. cruzi have been classified, T. cruzi I and T. cruzi II. Within T. cruzi II, five subdivisions are recognized, T. cruzi IIa-IIe, according to the variability of the ribosomal subunits 24Salpha rRNA and 18S rRNA. In T. rangeli, differences in the organization of the kinetoplast DNA separate two forms denoted T. rangeli KP1+ and KP1-, although differences in the intergenic mini-exon gene and of the small subunit rRNA (SSU rRNA) suggest four subpopulations denoted T. rangeli A, B, C and D. The interactions of these subpopulations of the trypanosomes with different species and populations of Triatominae determine the epidemiology of the human-infecting trypanosomes in Latin America. Often, specific subpopulations of the trypanosomes are transmitted by specific vectors in a particular geographic area. Studies centered on trypanosome-triatomine interaction may allow identification of co-evolutionary processes, which, in turn, could consolidate hypotheses of the evolution and the distribution of T. cruzi/T. rangeli-vectors in America, and they may help to identify the mechanisms that either facilitate or impede the transmission of the parasites in different vector species. Such mechanisms seem to involve intestinal bacteria, especially the symbionts which are needed by the triatomines to complete nymphal development and to produce eggs. Development of the symbionts is regulated by the vector. T. cruzi and T. rangeli interfere with this system and induce the production of antibacterial substances. Whereas T. cruzi is only subpathogenic for the insect host, T. rangeli strongly affects species of the genus Rhodnius and this pathogenicity seems based on a reduction of the number of symbionts.

  16. Dose-dependent Toxicity of Humanized Renilla reniformis GFP (hrGFP) Limits Its Utility as a Reporter Gene in Mouse Muscle.

    PubMed

    Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q

    2013-04-16

    Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as a reporter gene in mouse muscle. These results may impact the design of future preclinical gene therapy studies targeting muscles and non-muscle tissues alike.Molecular Therapy - Nucleic Acids (2013) 2, e86; doi:10.1038/mtna.2013.16; published online 16 April 2013.

  17. RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

    PubMed Central

    Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

    2013-01-01

    Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

  18. Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

    PubMed Central

    Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

    2013-01-01

    RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

  19. Transcriptomics-guided development of RNA interference strategies to manage whiteflies: a globally distributed vector of crop viruses

    USDA-ARS?s Scientific Manuscript database

    Over 300 viruses are transmitted by the whitefly, Bemisia tabaci, with 90% of them belonging to the genus, Begomovirus. Begomoviruses are exclusively transmitted by whiteflies to a range of agriculture crops, resulting in billions of dollars lost annually, while jeopardizing food security worldwide....

  20. Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.

    PubMed

    Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa

    2018-03-21

    Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.

  1. Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

    PubMed

    Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

    2018-05-02

    The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

  2. RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

    PubMed

    He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

    2009-02-01

    The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight and left ventricular weight/body weight were significantly lower in ACE-RNAi rats (3.12+/-0.23 mg/g and 2.24+/-0.19 mg/g) compared with the vehicle controls (4.29+/-0.24 mg/g and 3.21+/-0.13 mg/g; P<0.05) and the vector controls (4.43+/-0.19 mg/g and 3.13+/-0.12 mg/g; P<0.05). The conclusion of the present study is that ACE-silencing had significant antihypertensive effects and reversed hypertensive-induced cardiac hypertrophy in SHRs, and therefore RNAi might be a new strategy in controlling hypertension.

  3. Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

    PubMed

    Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

    2018-04-01

    Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

  4. RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

    PubMed

    Musiyenko, Alla; Bitko, Vira; Barik, Sailen

    2007-07-01

    Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

  5. Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

    PubMed Central

    Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

    2010-01-01

    Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

  6. A chitin deacetylase-like protein is a predominant constituent of tick peritrophic membrane that influences the persistence of Lyme disease pathogens within the vector.

    PubMed

    Kariu, Toru; Smith, Alexis; Yang, Xiuli; Pal, Utpal

    2013-01-01

    Ixodes scapularis is the specific arthropod vector for a number of globally prevalent infections, including Lyme disease caused by the bacterium Borrelia burgdorferi. A feeding-induced and acellular epithelial barrier, known as the peritrophic membrane (PM) is detectable in I. scapularis. However, whether or how the PM influences the persistence of major tick-borne pathogens, such as B. burgdorferi, remains largely unknown. Mass spectrometry-based proteome analyses of isolated PM from fed ticks revealed that the membrane contains a few detectable proteins, including a predominant and immunogenic 60 kDa protein with homology to arthropod chitin deacetylase (CDA), herein termed I. scapularis CDA-like protein or IsCDA. Although IsCDA is primarily expressed in the gut and induced early during tick feeding, its silencing via RNA interference failed to influence either the occurrence of the PM or spirochete persistence, suggesting a redundant role of IsCDA in tick biology and host-pathogen interaction. However, treatment of ticks with antibodies against IsCDA, one of the most predominant protein components of PM, affected B. burgdorferi survival, significantly augmenting pathogen levels within ticks but without influencing the levels of total gut bacteria. These studies suggested a preferential role of tick PM in limiting persistence of B. burgdorferi within the vector. Further understanding of the mechanisms by which vector components contribute to pathogen survival may help the development of new strategies to interfere with the infection.

  7. The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

    PubMed

    Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

    2018-06-01

    Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

  8. Next-generation libraries for robust RNA interference-based genome-wide screens

    PubMed Central

    Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

    2015-01-01

    Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

  9. The promises and pitfalls of RNA-interference-based therapeutics

    PubMed Central

    Castanotto, Daniela; Rossi, John J.

    2009-01-01

    The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

  10. Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus.

    PubMed

    Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian; Wei, Taiyun

    2016-01-15

    Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 10(9) copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. Small Interfering RNA Pathway Modulates Initial Viral Infection in Midgut Epithelium of Insect after Ingestion of Virus

    PubMed Central

    Lan, Hanhong; Chen, Hongyan; Liu, Yuyan; Jiang, Chaoyang; Mao, Qianzhuo; Jia, Dongsheng; Chen, Qian

    2015-01-01

    ABSTRACT Numerous viruses are transmitted in a persistent manner by insect vectors. Persistent viruses establish their initial infection in the midgut epithelium, from where they disseminate to the midgut visceral muscles. Although propagation of viruses in insect vectors can be controlled by the small interfering RNA (siRNA) antiviral pathway, whether the siRNA pathway can control viral dissemination from the midgut epithelium is unknown. Infection by a rice virus (Southern rice black streaked dwarf virus [SRBSDV]) of its incompetent vector (the small brown planthopper [SBPH]) is restricted to the midgut epithelium. Here, we show that the siRNA pathway is triggered by SRBSDV infection in continuously cultured cells derived from the SBPH and in the midgut of the intact insect. Knockdown of the expression of the core component Dicer-2 of the siRNA pathway by RNA interference strongly increased the ability of SRBSDV to propagate in continuously cultured SBPH cells and in the midgut epithelium, allowing viral titers in the midgut epithelium to reach the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) needed for viral dissemination into the SBPH midgut muscles. Our results thus represent the first elucidation of the threshold for viral dissemination from the insect midgut epithelium. Silencing of Dicer-2 further facilitated the transmission of SRBSDV into rice plants by SBPHs. Taken together, our results reveal the new finding that the siRNA pathway can control the initial infection of the insect midgut epithelium by a virus, which finally affects the competence of the virus's vector. IMPORTANCE Many viral pathogens that cause significant global health and agricultural problems are transmitted via insect vectors. The first bottleneck in viral infection, the midgut epithelium, is a principal determinant of the ability of an insect species to transmit a virus. Southern rice black streaked dwarf virus (SRBSDV) is restricted exclusively to the midgut epithelium of an incompetent vector, the small brown planthopper (SBPH). Here, we show that silencing of the core component Dicer-2 of the small interfering RNA (siRNA) pathway increases viral titers in the midgut epithelium past the threshold (1.99 × 109 copies of the SRBSDV P10 gene/μg of midgut RNA) for viral dissemination into the midgut muscles and then into the salivary glands, allowing the SBPH to become a competent vector of SRBSDV. This result is the first evidence that the siRNA antiviral pathway has a direct role in the control of viral dissemination from the midgut epithelium and that it affects the competence of the virus's vector. PMID:26537672

  12. Selective gene silencing by viral delivery of short hairpin RNA

    PubMed Central

    2010-01-01

    RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

  13. Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.

    PubMed

    Xie, Yuran; Merkel, Olivia M

    2015-10-01

    Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. A Role for Peptides in Overcoming Endosomal Entrapment in siRNA Delivery – A Focus on Melittin

    PubMed Central

    Hou, Kirk K.; Pan, Hua; Schlesinger, Paul H.; Wickline, Samuel A.

    2015-01-01

    siRNA has the possibility to revolutionize medicine by enabling highly specific and efficient silencing of proteins involved in disease pathogenesis. Despite nearly 20 years of research dedicated to translating siRNA from a research tool into a clinically relevant therapeutic, minimal success has been had to date. Access to RNA interference machinery located in the cytoplasm is often overlooked, but must be considered when designing the next generation of siRNA delivery strategies. Peptide transduction domains (PTD) have demonstrated moderate siRNA transfection, which is primarily limited by endosomal entrapment. Strategies aimed at overcoming endosomal entrapment associated with peptide vectors are reviewed here, including osmotic methods, lipid conjugation, and fusogenic peptides. As an alternative to traditional PTD, the hemolytic peptide melittin exhibits the native capacity for endosomal disruption but causes cytotoxicity. However, appropriate packaging and protection of melittin with activation and release in the endosomal compartment has allowed melittin-based strategies to demonstrate both in vitro and in vivo safety and efficacy. These data suggest that melittin's membrane disruptive properties can enable safe and effective endosomolysis, building a case for melittin as a key component in a new generation of siRNA therapeutics. PMID:26025036

  15. Assessment of RNAi-induced silencing in banana (Musa spp.).

    PubMed

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

  16. New therapeutic opportunities for Hepatitis C based on small RNA

    PubMed Central

    Pan, Qiu-Wei; Henry, Scot D; Scholte, Bob J; Tilanus, Hugo W; Janssen, Harry LA; van der Laan, Luc JW

    2007-01-01

    Hepatitis C virus (HCV) infection is one of the major causes of chronic liver disease, including cirrhosis and liver cancer and is therefore, the most common indication for liver transplantation. Conventional antiviral drugs such as pegylated interferon-alpha, taken in combination with ribavirin, represent a milestone in the therapy of this disease. However, due to different viral and host factors, clinical success can be achieved only in approximately half of patients, making urgent the requirement of exploiting alternative approaches for HCV therapy. Fortunately, recent advances in the understanding of HCV viral replication and host cell interactions have opened new possibilities for therapeutic intervention. The most recent technologies, such as small interference RNA mediated gene-silencing, anti-sense oligonucleotides (ASO), or viral vector based gene delivery systems, have paved the way to develop novel therapeutic modalities for HCV. In this review, we outline the application of these technologies in the context of HCV therapy. In particular, we will focus on the newly defined role of cellular microRNA (miR-122) in viral replication and discuss its potential for HCV molecular therapy. PMID:17724797

  17. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    PubMed

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  18. Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

    PubMed

    Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

    2016-09-01

    The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

  19. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    PubMed

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  20. Combination of RNA interference and virus receptor trap exerts additive antiviral activity in coxsackievirus B3-induced myocarditis in mice.

    PubMed

    Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens

    2015-02-15

    Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

    PubMed

    Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

    2015-12-01

    A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

  2. Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

    PubMed

    Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

    2017-06-01

    Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

  3. Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

    PubMed Central

    Du, Jing; Sun, Ying; Shi, Qiu-Sheng; Liu, Pei-Feng; Zhu, Ming-Jie; Wang, Chun-Hui; Du, Lian-Fang; Duan, You-Rong

    2012-01-01

    Degradation of mRNA by RNA interference is one of the most powerful and specific mechanisms for gene silencing. However, insufficient cellular uptake and poor stability have limited its usefulness. Here, we report efficient delivery of siRNA via the use of biodegradable nanoparticles (NPs) made from monomethoxypoly(ethylene glycol)-poly(lactic-co-glycolic acid)-poly-l-lysine (mPEG-PLGA-PLL) triblock copolymers. Various physicochemical properties of mPEG-PLGA-PLL NPs, including morphology, size, surface charge, siRNA encapsulation efficiency, and in vitro release profile of siRNA from NPs, were characterized by scanning electron microscope, particle size and zeta potential analyzer, and high performance liquid chromatography. The levels of siRNA uptake and targeted gene inhibition were detected in human lung cancer SPC-A1-GFP cells stably expressing green fluorescent protein. Examination of the cultured SPC-A1-GFP cells with fluorescent microscope and flow cytometry showed NPs loading Cy3-labeled siRNA had much higher intracellular siRNA delivery efficiencies than siRNA alone and Lipofectamine-siRNA complexes. The gene silencing efficiency of mPEG-PLGA-PLL NPs was higher than that of commercially available transfecting agent Lipofectamine while showing no cytotoxicity. Thus, the current study demonstrates that biodegradable NPs of mPEG-PLGA-PLL triblock copolymers can be potentially applied as novel non-viral vectors for improving siRNA delivery and gene silencing. PMID:22312268

  4. Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

    PubMed

    Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

    2015-01-01

    To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

  5. RNA interference-mediated intrinsic antiviral immunity in invertebrates.

    PubMed

    Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

    2013-01-01

    In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

  6. Fluorescent carbon dots as an efficient siRNA nanocarrier for its interference therapy in gastric cancer cells.

    PubMed

    Wang, Qing; Zhang, Chunlei; Shen, Guangxia; Liu, Huiyang; Fu, Hualin; Cui, Daxiang

    2014-12-30

    Fluorescent carbon dots (Cdots) have attracted increasing attention due to their potential applications in sensing, catalysis, and biomedicine. Currently, intensive research has been concentrated on the synthesis and imaging-guided therapy of these benign photoluminescent materials. Meanwhile, Cdots have been explored as nonviral vector for nucleic acid or drug delivery by chemical modification on purpose. We have developed a microwave assisted one-step synthesis of Cdots with citric acid as carbon source and tryptophan (Trp) as both nitrogen source and passivation agent. The Cdots with uniform size show superior water solubility, excellent biocompatibility, and high quantum yield. Afterwards, the PEI (polyethylenimine)-adsorbed Cdots nanoparticles (Cdots@PEI) were applied to deliver Survivin siRNA into human gastric cancer cell line MGC-803. The results have confirmed the nanocarrier exhibited excellent biocompatibility and a significant increase in cellular delivery of siRNA, inducing efficient knockdown for Survivin protein to 6.1%. In addition, PEI@Cdots complexes mediated Survivin silencing, the arrested cell cycle progression in G1 phase as well as cell apoptosis was observed. The Cdots-based and PEI-adsorbed complexes both as imaging agents and siRNA nanocarriers have been developed for Survivin siRNA delivery. And the results indicate that Cdots-based nanocarriers could be utilized in a broad range of siRNA delivery systems for cancer therapy.

  7. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

    PubMed

    Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

    2014-03-01

    Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

  8. Multifunctional nanocarrier based on clay nanotubes for efficient intracellular siRNA delivery and gene silencing.

    PubMed

    Wu, Hui; Shi, Yinfeng; Huang, Chusen; Zhang, Yang; Wu, Jiahui; Shen, Hebai; Jia, Nengqin

    2014-04-01

    RNA interference-mediated gene silencing relating to disease has recently emerged as a powerful method in gene therapy. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. Halloysites are cheap and naturally available aluminosilicate clay nanotubes with high mechanical strength and biocompatibility. In this study, a novel multifunctional nanocarrier based on functionalized halloysite nanotubes (f-HNTs) has been developed via electrostatic layer-by-layer assembling approach for loading and intracellular delivery of therapeutic antisurvivin siRNA and simultaneously tracking their intracellular transport, in which PEI-modified HNTs are used as gene vector, antisurvivin siRNA as gene therapeutic agent, and mercaptoacetic acid-capped CdSe quantum dots as fluorescent labeling probes. The successful assembly of the f-HNTs-siRNA complexes was systematically characterized by transmission electron microscopy (TEM), UV-visible spectrophotometry, Zeta potential measurement, fluorescence spectrophotometry, and electrochemical impedance spectroscopy. Confocal microscopy, biological TEM, and flow cytometry studies revealed that the complexes enabled the efficient intracellular delivery of siRNA for cell-specific gene silencing. MTT assays exhibited that the complexes can enhance antitumor activity. Furthermore, Western blot analysis showed that f-HNTs-mediated siRNA delivery effectively knocked down gene expression of survivin and thereby decreased the levels of target proteins of PANC-1 cells. Therefore, this study suggested that the synthesized f-HNTs were a new effective drug delivery system for potential application in cancer gene therapy.

  9. Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

    PubMed

    Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

    2018-05-29

    The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

  10. Delivery of gene silencing agents for breast cancer therapy

    PubMed Central

    2013-01-01

    The discovery of RNA interference has opened the door for the development of a new class of cancer therapeutics. Small inhibitory RNA oligos are being designed to specifically suppress expression of proteins that are traditionally considered nondruggable, and microRNAs are being evaluated to exert broad control of gene expression for inhibition of tumor growth. Since most naked molecules are not optimized for in vivo applications, the gene silencing agents need to be packaged into delivery vehicles in order to reach the target tissues as their destinations. Thus, the selection of the right delivery vehicles serves as a crucial step in the development of cancer therapeutics. The current review summarizes the status of gene silencing agents in breast cancer and recent development of candidate cancer drugs in clinical trials. Nanotechnology-based delivery vectors for the formulation and packaging of gene silencing agents are also described. PMID:23659575

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

    Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

  12. Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

    PubMed Central

    Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

    2013-01-01

    As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

  13. Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

    PubMed Central

    Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

    2016-01-01

    ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

  14. Highly efficient and specific modulation of cardiac calcium homeostasis by adenovector-derived short hairpin RNA targeting phospholamban.

    PubMed

    Fechner, H; Suckau, L; Kurreck, J; Sipo, I; Wang, X; Pinkert, S; Loschen, S; Rekittke, J; Weger, S; Dekkers, D; Vetter, R; Erdmann, V A; Schultheiss, H-P; Paul, M; Lamers, J; Poller, W

    2007-02-01

    Impaired function of the phospholamban (PLB)-regulated sarcoplasmic reticulum Ca(2+) pump (SERCA2a) contributes to cardiac dysfunction in heart failure (HF). PLB downregulation may increase SERCA2a activity and improve cardiac function. Small interfering (si)RNAs mediate efficient gene silencing by RNA interference (RNAi). However, their use for in vivo gene therapy is limited by siRNA instability in plasma and tissues, and by low siRNA transfer rates into target cells. To address these problems, we developed an adenoviral vector (AdV) transcribing short hairpin (sh)RNAs against rat PLB and evaluated its potential to silence the PLB gene and to modulate SERCA2a-mediated Ca(2+) sequestration in primary neonatal rat cardiomyocytes (PNCMs). Over a period of 13 days, vector transduction resulted in stable > 99.9% ablation of PLB-mRNA at a multiplicity of infection of 100. PLB protein gradually decreased until day 7 (7+/-2% left), whereas SERCA, Na(+)/Ca(2+) exchanger (NCX1), calsequestrin and troponin I protein remained unchanged. PLB silencing was associated with a marked increase in ATP-dependent oxalate-supported Ca(2+) uptake at 0.34 microM of free Ca(2+), and rapid loss of responsiveness to protein kinase A-dependent stimulation of Ca(2+) uptake was maintained until day 7. In summary, these results indicate that AdV-derived PLB-shRNA mediates highly efficient, specific and stable PLB gene silencing and modulation of active Ca(2+) sequestration in PNCMs. The availability of the new vector now enables employment of RNAi for the treatment of HF in vivo.

  15. A novel intranuclear RNA vector system for long-term stem cell modification

    PubMed Central

    Ikeda, Yasuhiro; Makino, Akiko; Matchett, William E.; Holditch, Sara J.; Lu, Brian; Dietz, Allan B.; Tomonaga, Keizo

    2015-01-01

    Genetically modified stem and progenitor cells have emerged as a promising regenerative platform in the treatment of genetic and degenerative disorders, highlighted by their successful therapeutic use in inherent immunodeficiencies. However, biosafety concerns over insertional mutagenesis resulting from integrating recombinant viral vectors have overshadowed the widespread clinical applications of genetically modified stem cells. Here, we report an RNA-based episomal vector system, amenable for long-term transgene expression in stem cells. Specifically, we used a unique intranuclear RNA virus, Borna disease virus (BDV), as the gene transfer vehicle, capable of persistent infections in various cell types. BDV-based vectors allowed for long-term transgene expression in mesenchymal stem cells (MSCs) without affecting cellular morphology, cell surface CD105 expression, or the adipogenicity of MSCs. Similarly, replication-defective BDV vectors achieved long-term transduction of human induced pluripotent stem cells (iPSCs), while maintaining the ability to differentiate into three embryonic germ layers. Thus, the BDV-based vectors offer a genomic modification-free, episomal RNA delivery system for sustained stem cell transduction. PMID:26632671

  16. Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

    PubMed Central

    Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

    2012-01-01

    Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

  17. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    PubMed

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

    PubMed

    Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

    2005-07-20

    Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

  19. RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

    PubMed Central

    Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

    2015-01-01

    Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

  20. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    PubMed

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  1. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    PubMed

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  2. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

    PubMed

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

    2010-02-01

    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (P<0.05). The apoptosis rate of A549/Lv-shCyPA (5.01% +/- 0.5%) was higher than control groups (0.35% +/- 0.17%) (P<0.05). Visible tumors were only detectable at 6th day after inoculated by A549/Lv-shCyPA. The xenograft tumors of A549/Lv-shCyPA remarkably delayed tumor growth and remained at a similarly small average size at 38th days after inoculation compared with the control group (P < 0.05). Lentiviral-vector-mediated siRNA technique effectively inhibits the expression of CyPA, induces the NSCLC cell apoptosis, inhibits the tumor growth. Elucidation of the precise role of CypA in these pathways may lead to new targeted therapies for non-small cell lung cancer.

  3. Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

    PubMed

    Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

    2016-03-20

    RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

  4. Ribosomal targets for antibiotic drug discovery

    DOEpatents

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  5. KHARON Is an Essential Cytoskeletal Protein Involved in the Trafficking of Flagellar Membrane Proteins and Cell Division in African Trypanosomes*

    PubMed Central

    Sanchez, Marco A.; Tran, Khoa D.; Valli, Jessica; Hobbs, Sam; Johnson, Errin; Gluenz, Eva; Landfear, Scott M.

    2016-01-01

    African trypanosomes and related kinetoplastid parasites selectively traffic specific membrane proteins to the flagellar membrane, but the mechanisms for this trafficking are poorly understood. We show here that KHARON, a protein originally identified in Leishmania parasites, interacts with a putative trypanosome calcium channel and is required for its targeting to the flagellar membrane. KHARON is located at the base of the flagellar axoneme, where it likely mediates targeting of flagellar membrane proteins, but is also on the subpellicular microtubules and the mitotic spindle. Hence, KHARON is probably a multifunctional protein that associates with several components of the trypanosome cytoskeleton. RNA interference-mediated knockdown of KHARON mRNA results in failure of the calcium channel to enter the flagellar membrane, detachment of the flagellum from the cell body, and disruption of mitotic spindles. Furthermore, knockdown of KHARON mRNA induces a lethal failure of cytokinesis in both bloodstream (mammalian host) and procyclic (insect vector) life cycle stages, and KHARON is thus critical for parasite viability. PMID:27489106

  6. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    PubMed

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  7. Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

    PubMed Central

    Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

    2012-01-01

    Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

  8. RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

    PubMed

    Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

    2017-04-01

    The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

  9. Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

    PubMed

    Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

    2013-01-01

    This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

  10. FIVQ algorithm for interference hyper-spectral image compression

    NASA Astrophysics Data System (ADS)

    Wen, Jia; Ma, Caiwen; Zhao, Junsuo

    2014-07-01

    Based on the improved vector quantization (IVQ) algorithm [1] which was proposed in 2012, this paper proposes a further improved vector quantization (FIVQ) algorithm for LASIS (Large Aperture Static Imaging Spectrometer) interference hyper-spectral image compression. To get better image quality, IVQ algorithm takes both the mean values and the VQ indices as the encoding rules. Although IVQ algorithm can improve both the bit rate and the image quality, it still can be further improved in order to get much lower bit rate for the LASIS interference pattern with the special optical characteristics based on the pushing and sweeping in LASIS imaging principle. In the proposed algorithm FIVQ, the neighborhood of the encoding blocks of the interference pattern image, which are using the mean value rules, will be checked whether they have the same mean value as the current processing block. Experiments show the proposed algorithm FIVQ can get lower bit rate compared to that of the IVQ algorithm for the LASIS interference hyper-spectral sequences.

  11. Nanobiotechnology: an efficient approach to drug delivery of unstable biomolecules.

    PubMed

    Amaral, A C; Felipe, M S S

    2013-11-01

    Biotechnology and nanotechnology are fields of science that can be applied together to solve a variety of biological issues. In the case of human health, biotechnology attempts to improve advances on the therapy against several diseases. Therapeutic peptides and proteins are promissory molecules for developing new medicines. Gene transfection and RNA interference have been considered important approaches for modern therapy to treat cancer and viral infections. However, because of their instability, these molecules alone cannot be used for in vivo application, since they are easily degraded or presenting a poor efficiency. Nanotechnology can contribute by the development of nanostructured delivery systems to increase the stability and potency of these molecules. Studies involving polymeric and magnetic nanoparticles, dendrimers, and carbon nanotubes have demonstrated a possibility to use these systems as vectors instead of the conventional viral ones, which present adverse effects, such as recombination and immunogenicity. This review presents some possibilities and strategies to efficiently delivery peptides, proteins, gene and RNA interference using nanotechnology approach.

  12. Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

    PubMed

    Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

    2009-08-01

    Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

  13. Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

    PubMed Central

    Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

    2015-01-01

    Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

  14. A Coarse Alignment Method Based on Digital Filters and Reconstructed Observation Vectors

    PubMed Central

    Xu, Xiang; Xu, Xiaosu; Zhang, Tao; Li, Yao; Wang, Zhicheng

    2017-01-01

    In this paper, a coarse alignment method based on apparent gravitational motion is proposed. Due to the interference of the complex situations, the true observation vectors, which are calculated by the apparent gravity, are contaminated. The sources of the interference are analyzed in detail, and then a low-pass digital filter is designed in this paper for eliminating the high-frequency noise of the measurement observation vectors. To extract the effective observation vectors from the inertial sensors’ outputs, a parameter recognition and vector reconstruction method are designed, where an adaptive Kalman filter is employed to estimate the unknown parameters. Furthermore, a robust filter, which is based on Huber’s M-estimation theory, is developed for addressing the outliers of the measurement observation vectors due to the maneuver of the vehicle. A comprehensive experiment, which contains a simulation test and physical test, is designed to verify the performance of the proposed method, and the results show that the proposed method is equivalent to the popular apparent velocity method in swaying mode, but it is superior to the current methods while in moving mode when the strapdown inertial navigation system (SINS) is under entirely self-contained conditions. PMID:28353682

  15. Chemical modification: the key to clinical application of RNA interference?

    PubMed Central

    Corey, David R.

    2007-01-01

    RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

  16. RNA viruses and microRNAs: challenging discoveries for the 21st century

    PubMed Central

    Swaminathan, Gokul; Martin-Garcia, Julio

    2013-01-01

    RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

  17. A stable RNA virus-based vector for citrus trees

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

    Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

  18. [New strategy for RNA vectorization in mammalian cells. Use of a peptide vector].

    PubMed

    Vidal, P; Morris, M C; Chaloin, L; Heitz, F; Divita, G

    1997-04-01

    A major barrier for gene delivery is the low permeability of nucleic acids to cellular membranes. The development of antisenses and gene therapy has focused mainly on improving methods of oligonucleotide or gene delivery to the cell. In this report we described a new strategy for RNA cell delivery, based on a short single peptide. This peptide vector is derived from both the fusion domain of the gp41 protein of HIV and the nuclear localization sequence of the SV40 large T antigen. This peptide vector localizes rapidly to the cytoplasm then to the nucleus of human fibroblasts (HS-68) within a few minutes and exhibits a high affinity for a single-stranded mRNA encoding the p66 subunit of the HIV-1 reverse transcriptase (in a 100 nM range). The peptide/RNA complex formation involves mainly electrostatic interactions between the basic residues of the peptide and the charges on the phosphate group of the RNA. In the presence of the peptide-vector fluorescently-labelled mRNA is delivered into the cytoplasm of mammalian cells (HS68 human fibroblasts) in less than 1 h with a relatively high efficiency (80%). This new concept based on a peptide-derived vector offers several advantages compared to other compounds commonly used in gene delivery. This vector is highly soluble and exhibits no cytotoxicity at the concentrations used for optimal gene delivery. This result clearly supports the fact that this peptide vector is a powerful tool and that it can be used widely, as much for laboratory research as for new applications and development in gene and/or antisense therapy.

  19. Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

    PubMed

    Van Ba, Hoa; Hwang, Inho

    2014-02-01

    Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  20. EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

    PubMed Central

    Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

    2013-01-01

    Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

  1. RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice

    PubMed Central

    Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping

    2011-01-01

    The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862

  2. Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

    PubMed

    Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

    2017-01-01

    Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

  3. A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

    PubMed Central

    Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

    2011-01-01

    Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

  4. Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

    PubMed

    Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

    2010-06-20

    We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

  5. High-level systemic expression of conserved influenza epitope in plants on the surface of rod-shaped chimeric particles.

    PubMed

    Petukhova, Natalia V; Gasanova, Tatiana V; Ivanov, Peter A; Atabekov, Joseph G

    2014-04-21

    Recombinant viruses based on the cDNA copy of the tobacco mosaic virus (TMV) genome carrying different versions of the conserved M2e epitope from influenza virus A cloned into the coat protein (CP) gene were obtained and partially characterized by our group previously; cysteines in the human consensus M2e sequence were changed to serine residues. This work intends to show some biological properties of these viruses following plant infections. Agroinfiltration experiments on Nicotiana benthamiana confirmed the efficient systemic expression of M2e peptides, and two point amino acid substitutions in recombinant CPs significantly influenced the symptoms and development of viral infections. Joint expression of RNA interference suppressor protein p19 from tomato bushy stunt virus (TBSV) did not affect the accumulation of CP-M2e-ser recombinant protein in non-inoculated leaves. RT-PCR analysis of RNA isolated from either infected leaves or purified TMV-M2e particles proved the genetic stability of TMV‑based viral vectors. Immunoelectron microscopy of crude plant extracts demonstrated that foreign epitopes are located on the surface of chimeric virions. The rod‑shaped geometry of plant-produced M2e epitopes is different from the icosahedral or helical filamentous arrangement of M2e antigens on the carrier virus-like particles (VLP) described earlier. Thereby, we created a simple and efficient system that employs agrobacteria and plant viral vectors in order to produce a candidate broad-spectrum flu vaccine.

  6. The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

    PubMed

    Grimm, Dirk

    2011-10-26

    For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

  7. Transcript characteristic of myostatin in sheep fibroblasts.

    PubMed

    Lu, Jian; Ren, Hangxing; Sheng, Xihui; Zhang, Xiaoning; Li, Shangang; Zhao, Fuping; Zhou, Xinlei; Zhang, Li; Wei, Caihong; Ding, Jiatong; Li, Bichun; Du, Lixin

    2012-08-01

    Myostatin, a secreted growth factor highly expressed in skeletal muscle, negatively regulates skeletal muscle growth and differentiation. Recently, myostatin is emerged as a potential target for anti-atrophy and anti-fibrotic therapies. Therefore, to investigate the regulation of myostatin in sheep adult fibroblasts, we used the RNA interference mediated by lentiviral vector to gene silence myostatin. Simultaneously, we also had constructed the sheep myostatin overexpression vector to further explore the function of myostatin in fibroblasts. The results here demonstrated that the lentiviral vector could significantly reduce myostatin gene both at mRNA and protein level by 71% and 67%, respectively (P < 0.01). Inhibition of myostatin also resulted in a remarkable increase of activin receptor 2B (ACV2B), p21, PPARγ, leptin, C/EBPβ, and MEF2A expression, and a decrease of Akt1, CDK2, MEF2C, and Myf5 expression. Ectopic myostatin mRNA and protein were also present in the fibroblasts transfection. Furthermore, we observed that overexpression of myostatin contributed to an increase of Akt1, CDK2, Myf5 and PPARγ, and a decrease of p21, C/EBPα and leptin at the transcript level. These results suggested that myostatin positively regulated Akt1, CDK2, Myf5, leptin, and C/EBPα, but negatively regulated p21 mRNA expression in adult fibroblasts, and it also expanded our understanding of the regulation mechanism of myostatin. Moreover, the lentiviral system inactivated myostatin gene in fibroblasts would be used to generate transgenic sheep and to ameliorate muscle fibrosis and atrophy by gene therapy in the future. Copyright © 2012 Wiley Periodicals, Inc.

  8. Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

    PubMed Central

    Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

    2012-01-01

    We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

  9. RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

    USDA-ARS?s Scientific Manuscript database

    Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

  10. Improved nucleic acid descriptors for siRNA efficacy prediction.

    PubMed

    Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

    2013-02-01

    Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

  11. RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

    PubMed

    Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

    2013-08-01

    Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

  12. CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

    PubMed

    Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

    2014-09-05

    Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

  13. Dendrimer Nanovectors for SiRNA Delivery.

    PubMed

    Liu, Xiaoxuan; Peng, Ling

    2016-01-01

    Small interfering RNA (SiRNA) delivery remains a major challenge in RNAi-based therapy. Dendrimers are emerging as appealing nonviral vectors for SiRNA delivery thanks to their well-defined architecture and their unique cooperativity and multivalency confined within a nanostructure. We have recently demonstrated that structurally flexible poly(amidoamine) (PAMAM) dendrimers are safe and effective nanovectors for SiRNA delivery in various disease models in vitro and in vivo. The present chapter showcases these dendrimers can package different SiRNA molecules into stable and nanosized particles, which protect SiRNA from degradation and promote cellular uptake of SiRNA, resulting in potent gene silencing at both mRNA and protein level in the prostate cancer cell model. Our results demonstrate this set of flexible PAMAM dendrimers are indeed safe and effective nonviral vectors for SiRNA delivery and hold great promise for further applications in functional genomics and RNAi-based therapies.

  14. RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

    PubMed

    Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

    2017-03-01

    Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

  15. More complete gene silencing by fewer siRNAs: transparent optimized design and biophysical signature

    PubMed Central

    Ladunga, Istvan

    2007-01-01

    Highly accurate knockdown functional analyses based on RNA interference (RNAi) require the possible most complete hydrolysis of the targeted mRNA while avoiding the degradation of untargeted genes (off-target effects). This in turn requires significant improvements to target selection for two reasons. First, the average silencing activity of randomly selected siRNAs is as low as 62%. Second, applying more than five different siRNAs may lead to saturation of the RNA-induced silencing complex (RISC) and to the degradation of untargeted genes. Therefore, selecting a small number of highly active siRNAs is critical for maximizing knockdown and minimizing off-target effects. To satisfy these needs, a publicly available and transparent machine learning tool is presented that ranks all possible siRNAs for each targeted gene. Support vector machines (SVMs) with polynomial kernels and constrained optimization models select and utilize the most predictive effective combinations from 572 sequence, thermodynamic, accessibility and self-hairpin features over 2200 published siRNAs. This tool reaches an accuracy of 92.3% in cross-validation experiments. We fully present the underlying biophysical signature that involves free energy, accessibility and dinucleotide characteristics. We show that while complete silencing is possible at certain structured target sites, accessibility information improves the prediction of the 90% active siRNA target sites. Fast siRNA activity predictions can be performed on our web server at . PMID:17169992

  16. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

    PubMed

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

  17. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

    PubMed Central

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

  18. RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

    PubMed Central

    Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

    2016-01-01

    Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

  19. TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

    PubMed

    Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

    2006-09-08

    CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

  20. TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

    2006-09-08

    CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

  1. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    PubMed

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    PubMed

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  3. Catalase is a determinant of the colonization and transovarial transmission of Rickettsia parkeri in the Gulf Coast tick Amblyomma maculatum.

    PubMed

    Budachetri, K; Kumar, D; Karim, S

    2017-08-01

    The Gulf Coast tick (Amblyomma maculatum) has evolved as a competent vector of the spotted-fever group rickettsia, Rickettsia parkeri. In this study, the functional role of catalase, an enzyme responsible for the degradation of toxic hydrogen peroxide, in the colonization of the tick vector by R. parkeri and transovarial transmission of this pathogen to the next tick generation, was investigated. Catalase gene (CAT) expression in midgut, salivary glands and ovarian tissues exhibited a 2-11-fold increase in transcription level upon R. parkeri infection. Depletion of CAT transcripts using an RNA-interference approach significantly reduced R. parkeri infection levels in midgut and salivary gland tissues by 53-63%. The role of CAT in transovarial transmission of R. parkeri was confirmed by simultaneously blocking the transcript and the enzyme by injecting double-stranded RNA for CAT and a catalase inhibitor (3-amino-1,2,4-triazole) into gravid females. Simultaneous inhibition of the CAT transcript and the enzyme significantly reduced the egg conversion ratio with a 44% reduction of R. parkeri transovarial transmission. These data suggest that catalase is required for rickettsial colonization of the tick vector and transovarial transmission to the next generation. © 2017 The Royal Entomological Society.

  4. Electric cell-substrate impedance sensing (ECIS) based real-time measurement of titer dependent cytotoxicity induced by adenoviral vectors in an IPI-2I cell culture model.

    PubMed

    Müller, Jakob; Thirion, Christian; Pfaffl, Michael W

    2011-01-15

    Recombinant viral vectors are widespread tools for transfer of genetic material in various modern biotechnological applications like for example RNA interference (RNAi). However, an accurate and reproducible titer assignment represents the basic step for most downstream applications regarding a precise multiplicity of infection (MOI) adjustment. As necessary scaffold for the studies described in this work we introduce a quantitative real-time PCR (qPCR) based approach for viral particle measurement. Still an implicated problem concerning physiological effects is that the appliance of viral vectors is often attended by toxic effects on the individual target. To determine the critical viral dose leading to cell death we developed an electric cell-substrate impedance sensing (ECIS) based assay. With ECIS technology the impedance change of a current flow through the cell culture medium in an array plate is measured in a non-invasive manner, visualizing effects like cell attachment, cell-cell contacts or proliferation. Here we describe the potential of this online measurement technique in an in vitro model using the porcine ileal epithelial cell line IPI-2I in combination with an adenoviral transfection vector (Ad5-derivate). This approach shows a clear dose-depending toxic effect, as the amount of applied virus highly correlates (p<0.001) with the level of cell death. Thus this assay offers the possibility to discriminate the minimal non-toxic dose of the individual transfection method. In addition this work suggests that the ECIS-device bears the feasibility to transfer this assay to multiple other cytotoxicological questions. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.

    PubMed

    O'Connell, Mitchell

    2018-06-22

    Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.

  6. Using adenovirus armed short hairpin RNA targeting transforming growth factor β1 inhibits melanoma growth and metastasis in an ex vivo animal model.

    PubMed

    Tai, Kuo-Feng; Wang, Chien-Hsing

    2013-12-01

    The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.

  7. Production of SV40-derived vectors.

    PubMed

    Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

    2010-06-01

    Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

  8. In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

    PubMed

    Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

    2000-02-01

    Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

  9. Fluorescence-based high-throughput screening of dicer cleavage activity.

    PubMed

    Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr

    2014-03-01

    Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.

  10. Dual silencing of Bcl-2 and Survivin by HSV-1 vector shows better antitumor efficacy in higher PKR phosphorylation tumor cells in vitro and in vivo.

    PubMed

    Chen, X; Zhou, Y; Wang, J; Wang, J; Yang, J; Zhai, Y; Li, B

    2015-08-01

    RNA interference (RNAi) is a promising tool for cancer therapy, but its delivery strategy is a major challenge for its application. Oncolytic herpes simplex virus type 1 (HSV-1) is not only an effective antitumor drug but also an excellent vector. Herein, RNAi of oncogenes Bcl-2 and Survivin was combined with oncolytic HSV-1 (ICP34.5-/ICP6-/ICP47-/CMV-GM-CSF) and a new vector HSV010-BS was constructed. Transfected cell viability assays and animal experiments revealed that the dual silencing of Bcl-2 and Survivin improved the antitumor effect of oncolytic HSV-1 in vitro and in vivo, while the antitumor effect was correlated with the phosphorylation levels of PKR of the tumor cells. The higher the phosphorylation levels of PKR of the tumor cells, the weaker the replication ability of oncolytic HSV-1, and the more powerful HSV010-BS was than its control vectors in inhibiting the growth of the tumor cells. The results provided direct supportive proofs for a new potential cancer therapy strategy.

  11. [Expression analysis of a transformer gene in Daphnia pulex after RNAi].

    PubMed

    Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

    2016-01-01

    In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

  12. RNAi therapeutics and applications of microRNAs in cancer treatment.

    PubMed

    Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

    2013-06-01

    RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

  13. Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

    PubMed

    Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

    2017-09-29

    Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

    PubMed

    Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

    2015-03-01

    Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.

  15. miR-Sens--a retroviral dual-luciferase reporter to detect microRNA activity in primary cells.

    PubMed

    Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A; Voorhoeve, P Mathijs

    2012-05-01

    MicroRNA-mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3' UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3' UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3' UTR-mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs.

  16. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

  17. RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

    PubMed Central

    Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

    2014-01-01

    Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

  18. The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

    PubMed

    Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

    2013-06-01

    Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.

  19. Post-transcriptional gene silencing in the root system of the actinorhizal tree Allocasuarina verticillata.

    PubMed

    Gherbi, Hassen; Nambiar-Veetil, Mathish; Zhong, Chonglu; Félix, Jessy; Autran, Daphné; Girardin, Raphaël; Vaissayre, Virginie; Auguy, Florence; Bogusz, Didier; Franche, Claudine

    2008-05-01

    In recent years, RNA interference has been exploited as a tool for investigating gene function in plants. We tested the potential of double-stranded RNA interference technology for silencing a transgene in the actinorhizal tree Allocasuarina verticillata. The approach was undertaken using stably transformed shoots expressing the beta-glucuronidase (GUS) gene under the control of the constitutive promoter 35S; the shoots were further transformed with the Agrobacterium rhizogenes A4RS containing hairpin RNA (hpRNA) directed toward the GUS gene, and driven by the 35S promoter. The silencing and control vectors contained the reporter gene of the green fluorescent protein (GFP), thus allowing a screening of GUS-silenced composite plantlets for autofluorescence. With this rapid procedure, histochemical data established that the reporter gene was strongly silenced in both fluorescent roots and actinorhizal nodules. Fluorometric data further established that the level of GUS silencing was usually greater than 90% in the hairy roots containing the hairpin GUS sequences. We found that the silencing process of the reporter gene did not spread to the aerial part of the composite A. verticillata plants. Real-time quantitative polymerase chain reaction showed that GUS mRNAs were substantially reduced in roots and, thereby, confirmed the knock-down of the GUS transgene in the GFP(+) hairy roots. The approach described here will provide a versatile tool for the rapid assessment of symbiotically related host genes in actinorhizal plants of the Casuarinaceae family.

  20. Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eric Y. Chuang

    2006-08-31

    It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

  1. Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

    PubMed

    Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

    2003-10-01

    Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

  2. Beamforming design with proactive interference cancelation in MISO interference channels

    NASA Astrophysics Data System (ADS)

    Li, Yang; Tian, Yafei; Yang, Chenyang

    2015-12-01

    In this paper, we design coordinated beamforming at base stations (BSs) to facilitate interference cancelation at users in interference networks, where each BS is equipped with multiple antennas and each user is with a single antenna. By assuming that each user can select the best decoding strategy to mitigate the interference, either canceling the interference after decoding when it is strong or treating it as noise when it is weak, we optimize the beamforming vectors that maximize the sum rate for the networks under different interference scenarios and find the solutions of beamforming with closed-form expressions. The inherent design principles are then analyzed, and the performance gain over passive interference cancelation is demonstrated through simulations in heterogeneous cellular networks.

  3. miR-Sens—a retroviral dual-luciferase reporter to detect microRNA activity in primary cells

    PubMed Central

    Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A.; Voorhoeve, P. Mathijs

    2012-01-01

    MicroRNA–mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3′ UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3′ UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3′ UTR–mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs. PMID:22417692

  4. Oral Delivery of Double-Stranded RNA in Larvae of the Yellow Fever Mosquito, Aedes aegypti: Implications for Pest Mosquito Control

    PubMed Central

    Singh, Aditi D.; Wong, Sylvia; Ryan, Calen P.; Whyard, Steven

    2013-01-01

    RNA interference has already proven itself to be a highly versatile molecular biology tool for understanding gene function in a limited number of insect species, but its widespread use in other species will be dependent on the development of easier methods of double-stranded RNA (dsRNA) delivery. This study demonstrates that RNA interference can be induced in the mosquito Aedes aegypti L. (Diptera: Culicidae) simply by soaking larvae in a solution of dsRNA for two hours. The mRNA transcripts for β-tubulin, chitin synthase-1 and -2, and heat shock protein 83 were reduced between 30 and 50% three days post-dsRNA treatment. The dsRNA was mixed with a visible dye to identify those individuals that fed on the dsRNA, and based on an absence of RNA interference in those individuals that contained no dye within their guts, the primary route of entry of dsRNA is likely through the gut epithelium. RNA interference was systemic in the insects, inducing measurable knock down of gene expression in tissues beyond the gut. Silencing of the β-tubulin and chitin synthase-1 genes resulted in reduced growth and/or mortality of the larvae, demonstrating the utility of dsRNA as a potential mosquito larvicide. Silencing of chitin synthase-2 did not induce mortality in the larvae, and silencing of heat shock protein 83 only induced mortality in the insects if they were subsequently subjected to a heat stress. Drosophila melanogaster Meigen (Diptera: Drosophilidae) larvae were also soaked in dsRNA designed to specifically target either their own β-tubulin gene, or that of A. aegypti, and significant mortality was only seen in larvae treated with dsRNA targeting their own gene, which suggests that dsRNA pesticides could be designed to be species-limited. PMID:24224468

  5. On the time-dependent Aharonov-Bohm effect

    NASA Astrophysics Data System (ADS)

    Jing, Jian; Zhang, Yu-Fei; Wang, Kang; Long, Zheng-Wen; Dong, Shi-Hai

    2017-11-01

    The Aharonov-Bohm effect in the background of a time-dependent vector potential is re-examined for both non-relativistic and relativistic cases. Based on the solutions to the Schrodinger and Dirac equations which contain the time-dependent magnetic vector potential, we find that contrary to the conclusions in a recent paper (Singleton and Vagenas 2013 [4]), the interference pattern will be altered with respect to time because of the time-dependent vector potential.

  6. Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

    PubMed Central

    Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

    2013-01-01

    The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

  7. A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

    PubMed Central

    Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

    2014-01-01

    Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

  8. Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

    PubMed Central

    Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

    1995-01-01

    We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

  9. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  10. Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

    PubMed

    Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

    2016-09-01

    Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

  11. Identification of Short Hairpin RNA Targeting Foot-And-Mouth Disease Virus with Transgenic Bovine Fetal Epithelium Cells

    PubMed Central

    He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin

    2012-01-01

    Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125

  12. RNA virus interference via CRISPR/Cas13a system in plants.

    PubMed

    Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy

    2018-01-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  13. Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

    PubMed

    Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

    2013-06-01

    Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

  14. RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

    PubMed

    Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

    2017-05-01

    RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Development of apple latent spherical virus-based vaccines against three tospoviruses.

    PubMed

    Taki, Ayano; Yamagishi, Noriko; Yoshikawa, Nobuyuki

    2013-09-01

    Apple latent spherical virus (ALSV) is characterized by its relatively broad host range, latency in most host plants, and ability to induce gene silencing in host plants. Herein, we focus on the above characteristic of ALSV and describe our development of ALSV vector vaccines against three tospoviruses, namely, Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), and Tomato spotted wilt virus (TSWV). DNA fragments of 201 nt of three tospovirus S-RNAs (silencing suppressor (NSS) and nucleocapsid protein (N) coding regions for each tospovirus) were inserted into an ALSV-RNA2 vector to obtain six types of ALSV vector vaccines. Nicotiana benthamiana plants at the five-leaf stage were inoculated with each ALSV vector vaccine and challenged with the corresponding tospovirus species. Tospovirus-induced symptoms and tospovirus replication after challenge were significantly suppressed in plants preinoculated with all ALSV vector vaccines having the N region fragment, indicating that strong resistance was acquired after infection with ALSV vector vaccines. On the other hand, cross protection was not significant in plants preinoculated with ALSV vectors having the NSs region fragment. Similarly, inoculation with an ALSV-RNA1 vector having the N region fragment in the 3'-noncoding region, but not the NSs region fragment, induced cross protection, indicating that cross protection is via RNA silencing, not via the function of the protein derived from the N region fragment. Our approach, wherein ALSV vectors and selected target inserts are used, enables rapid establishment of ALSV vector vaccines against many pathogenic RNA viruses with known sequences. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A RNA Interference Screen Identifies the Protein Phosphatase 2A Subunit PR55γ as a Stress-Sensitive Inhibitor of c-SRC

    PubMed Central

    Eichhorn, Pieter J. A; Creyghton, Menno P; Wilhelmsen, Kevin; van Dam, Hans; Bernards, René

    2007-01-01

    Protein Phosphatase type 2A (PP2A) represents a family of holoenzyme complexes with diverse biological activities. Specific holoenzyme complexes are thought to be deregulated during oncogenic transformation and oncogene-induced signaling. Since most studies on the role of this phosphatase family have relied on the use of generic PP2A inhibitors, the contribution of individual PP2A holoenzyme complexes in PP2A-controlled signaling pathways is largely unclear. To gain insight into this, we have constructed a set of shRNA vectors targeting the individual PP2A regulatory subunits for suppression by RNA interference. Here, we identify PR55γ and PR55δ as inhibitors of c-Jun NH2-terminal kinase (JNK) activation by UV irradiation. We show that PR55γ binds c-SRC and modulates the phosphorylation of serine 12 of c-SRC, a residue we demonstrate to be required for JNK activation by c-SRC. We also find that the physical interaction between PR55γ and c-SRC is sensitive to UV irradiation. Our data reveal a novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55γ. PMID:18069897

  17. Ethical Perspectives on RNA Interference Therapeutics

    PubMed Central

    Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

    2008-01-01

    RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

  18. Classical reconstruction of interference patterns of position-wave-vector-entangled photon pairs by the time-reversal method

    NASA Astrophysics Data System (ADS)

    Ogawa, Kazuhisa; Kobayashi, Hirokazu; Tomita, Akihisa

    2018-02-01

    The quantum interference of entangled photons forms a key phenomenon underlying various quantum-optical technologies. It is known that the quantum interference patterns of entangled photon pairs can be reconstructed classically by the time-reversal method; however, the time-reversal method has been applied only to time-frequency-entangled two-photon systems in previous experiments. Here, we apply the time-reversal method to the position-wave-vector-entangled two-photon systems: the two-photon Young interferometer and the two-photon beam focusing system. We experimentally demonstrate that the time-reversed systems classically reconstruct the same interference patterns as the position-wave-vector-entangled two-photon systems.

  19. Improved silencing properties using small internally segmented interfering RNAs

    PubMed Central

    Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

    2007-01-01

    RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

  20. RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.

    PubMed

    Rytlewski, Julie A; Beronja, Slobodan

    2015-01-01

    The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.

  1. MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

    PubMed Central

    Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

    2012-01-01

    Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors incorporating hypoxia-responsive promoters to drive transgene expression. We therefore employed a combinatorial approach using miRT-122 elements with hypoxia-responsive transcriptional targeting to further improve the tumor specific expression of an adenoviral reporter gene. Results from this investigation reveal that miRT122 elements alone decrease off-target liver expression and improve tumor specificity of adenoviral vectors. Furthermore, increased tumor specificity can be achieved by combining miRT-122 elements with hypoxia-responsive promoters. PMID:22555510

  2. Prokaryotic Argonautes - variations on the RNA interference theme.

    PubMed

    van der Oost, John; Swarts, Daan C; Jore, Matthijs M

    2014-04-15

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

  3. Prokaryotic Argonautes - variations on the RNA interference theme

    PubMed Central

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  4. Symbiont-mediated RNA interference in insects

    PubMed Central

    Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

    2016-01-01

    RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

  5. Cationic Lipid-Nucleic Acid Complexes for Gene Delivery And Silencing: Pathways And Mechanisms for Plasmid Dna And Sirna

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ewert, K.K.; Zidovska, A.; Ahmad, A.

    2012-07-17

    Motivated by the promises of gene therapy, there is great interest in developing non-viral lipid-based vectors for therapeutic applications due to their low immunogenicity, low toxicity, ease of production, and the potential of transferring large pieces of DNA into cells. In fact, cationic liposome (CL) based vectors are among the prevalent synthetic carriers of nucleic acids (NAs) currently used in gene therapy clinical trials worldwide. These vectors are studied both for gene delivery with CL-DNA complexes and gene silencing with CL-siRNA (short interfering RNA) complexes. However, their transfection efficiencies and silencing efficiencies remain low compared to those of engineered viralmore » vectors. This reflects the currently poor understanding of transfection-related mechanisms at the molecular and self-assembled levels, including a lack of knowledge about interactions between membranes and double stranded NAs and between CL-NA complexes and cellular components. In this review we describe our recent efforts to improve the mechanistic understanding of transfection by CL-NA complexes, which will help to design optimal lipid-based carriers of DNA and siRNA for therapeutic gene delivery and gene silencing.« less

  6. Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

    PubMed

    Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

    2014-04-01

    During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Self-assembling complexes between binary mixtures of lipids with different linkers and nucleic acids promote universal mRNA, DNA and siRNA delivery.

    PubMed

    Colombani, Thibault; Peuziat, Pauline; Dallet, Laurence; Haudebourg, Thomas; Mével, Mathieu; Berchel, Mathieu; Lambert, Olivier; Habrant, Damien; Pitard, Bruno

    2017-03-10

    Protein expression and RNA interference require efficient delivery of DNA or mRNA and small double stranded RNA into cells, respectively. Although cationic lipids are the most commonly used synthetic delivery vectors, a clear need still exists for a better delivery of various types of nucleic acids molecules to improve their biological activity. To optimize the transfection efficiency, a molecular approach consisting in modifying the chemical structure of a given cationic lipid is usually performed, but an alternative strategy could rely on modulating the supramolecular assembly of lipidic lamellar phases sandwiching the nucleic acids molecules. To validate this new concept, we synthesized on one hand two paromomycin-based cationic lipids, with either an amide or a phosphoramide linker, and on the other hand two imidazole-based neutral lipids, having as well either an amide or a phosphoramide function as linker. Combinations of cationic and helper lipids containing the same amide or phosphoramide linkers led to the formation of homogeneous lamellar phases, while hybrid lamellar phases were obtained when the linkers on the cationic and helper lipids were different. Cryo-transmission electron microscopy and fluorescence experiments showed that liposomes/nucleic acids complexes resulting from the association of nucleic acids with hybrid lamellar phases led to complexes that were more stable in the extracellular compartment compared to those obtained with homogeneous systems. In addition, we observed that the most active supramolecular assemblies for the delivery of DNA, mRNA and siRNA were obtained when the cationic and helper lipids possess linkers of different natures. The results clearly show that this supramolecular strategy modulating the property of the lipidic lamellar phase constitutes a new approach for increasing the delivery of various types of nucleic acid molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

    PubMed

    Rotenberg, D; Whitfield, A E

    2010-08-01

    Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

  9. Involvement of LeMDR, an ATP-binding cassette protein gene, in shikonin transport and biosynthesis in Lithospermum erythrorhizon.

    PubMed

    Zhu, Yu; Lu, Gui-Hua; Bian, Zhuo-Wu; Wu, Feng-Yao; Pang, Yan-Jun; Wang, Xiao-Ming; Yang, Rong-Wu; Tang, Cheng-Yi; Qi, Jin-Liang; Yang, Yong-Hua

    2017-11-13

    Shikonin is a naphthoquinone secondary metabolite with important medicinal value and is found in Lithospermum erythrorhizon. Considering the limited knowledge on the membrane transport mechanism of shikonin, this study investigated such molecular mechanism. We successfully isolated an ATP-binding cassette protein gene, LeMDR, from L. erythrorhizon. LeMDR is predominantly expressed in L. erythrorhizon roots, where shikonin accumulated. Functional analysis of LeMDR by using the yeast cell expression system revealed that LeMDR is possibly involved in the shikonin efflux transport. The accumulation of shikonin is lower in yeast cells transformed with LeMDR-overexpressing vector than that with empty vector. The transgenic hairy roots of L. erythrorhizon overexpressing LeMDR (MDRO) significantly enhanced shikonin production, whereas the RNA interference of LeMDR (MDRi) displayed a reverse trend. Moreover, the mRNA expression level of LeMDR was up-regulated by treatment with shikonin and shikonin-positive regulators, methyl jasmonate and indole-3-acetic acid. There might be a relationship of mutual regulation between the expression level of LeMDR and shikonin biosynthesis. Our findings demonstrated the important role of LeMDR in transmembrane transport and biosynthesis of shikonin.

  10. Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

    PubMed Central

    Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

    2004-01-01

    Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

  11. Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

    PubMed

    Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

    2008-03-17

    RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

  12. Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

    PubMed

    Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

    2014-01-01

    Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. RNA interference in the clinic: challenges and future directions

    PubMed Central

    Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

    2011-01-01

    Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

  14. RNA interference against stromal interacting molecule-1 (STIM1) ameliorates ethanol-induced hepatotoxicity.

    PubMed

    Cui, Ruibing; Li, Rong; Guo, Xiaolan; Jia, Xiaoqing; Yan, Ming

    2018-06-01

    Previously we have demonstrated that stromal interacting molecule-1 (STIM1) was involved in ethanol induced liver injury. However, the exact pathogenic mechanism of STIM1 in alcoholic liver disease (ALD) is still unknown. We constructed plasmid vectors encoding short-hairpin RNA against STIM1 to investigate its role in ALD in the rat liver cell line BRL and in Sprague-Dawley rats. The results showed that STIM1 targeted sh-RNA (Sh-STIM1) significantly ameliorated ethanol-induced BRL cells injury and liver injury in rats with 20 weeks-induced alcoholic liver disease. Inhibition of STIM1 also reduced intracellular calcium ion concentration, reactive oxygen species (ROS) production, lipid peroxidation, NF-kappa B activation and TNF-α production under ethanol exposure. STIM1 may play an important role in the pathogenesis of alcoholic liver disease. Silencing STIM1 may be effective in preventing alcoholic liver disease. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. New support vector machine-based method for microRNA target prediction.

    PubMed

    Li, L; Gao, Q; Mao, X; Cao, Y

    2014-06-09

    MicroRNA (miRNA) plays important roles in cell differentiation, proliferation, growth, mobility, and apoptosis. An accurate list of precise target genes is necessary in order to fully understand the importance of miRNAs in animal development and disease. Several computational methods have been proposed for miRNA target-gene identification. However, these methods still have limitations with respect to their sensitivity and accuracy. Thus, we developed a new miRNA target-prediction method based on the support vector machine (SVM) model. The model supplies information of two binding sites (primary and secondary) for a radial basis function kernel as a similarity measure for SVM features. The information is categorized based on structural, thermodynamic, and sequence conservation. Using high-confidence datasets selected from public miRNA target databases, we obtained a human miRNA target SVM classifier model with high performance and provided an efficient tool for human miRNA target gene identification. Experiments have shown that our method is a reliable tool for miRNA target-gene prediction, and a successful application of an SVM classifier. Compared with other methods, the method proposed here improves the sensitivity and accuracy of miRNA prediction. Its performance can be further improved by providing more training examples.

  16. Delivery of RNA interference therapeutics using polycation-based nanoparticles.

    PubMed

    Howard, Kenneth Alan

    2009-07-25

    RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

  17. Abasic pivot substitution harnesses target specificity of RNA interference

    PubMed Central

    Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

    2015-01-01

    Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

  18. RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells

    PubMed Central

    Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V

    2006-01-01

    Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456

  19. Innate Immune Control of West Nile Virus Infection

    PubMed Central

    Arjona, Alvaro; Wang, Penghua; Montgomery, Ruth R.; Fikrig, Erol

    2011-01-01

    West Nile virus (WNV), from the Flaviviridae family, is a re-emerging zoonotic pathogen of medical importance. In humans, WNV infection may cause life-threatening meningoencephalitis or long-term neurologic sequelae. WNV is transmitted by Culex spp mosquitoes and both the arthropod vector and the mammalian host are equipped with antiviral innate immune mechanisms sharing a common phylogeny. As far as the current evidence is able to demonstrate, mosquitoes primarily rely on RNA interference, Toll, Imd and JAK-STAT signaling pathways for limiting viral infection, while mammals are provided with these and other more complex antiviral mechanisms involving antiviral effectors, inflammatory mediators, and cellular responses triggered by highly specialized pathogen detection mechanisms that often resemble their invertebrate ancestry. This mini-review summarizes our current understanding of how the innate immune systems of the vector and the mammalian host react to WNV infection and shape its pathogenesis. PMID:21790942

  20. Identification of germline transcriptional regulatory elements in Aedes aegypti.

    PubMed

    Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

    2014-02-04

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  1. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  2. Genome characterization of Sugarcane Yellow Leaf Virus with special reference to RNAi based molecular breeding.

    PubMed

    Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen

    2018-05-04

    Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

    PubMed

    Israni, B; Rajam, M V

    2017-04-01

    RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

  4. Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

    PubMed

    Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

    2017-10-01

    This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

  5. First comparative transcriptomic analysis of wild adult male and female Lutzomyia longipalpis, vector of visceral leishmaniasis.

    PubMed

    McCarthy, Christina B; Santini, María Soledad; Pimenta, Paulo F P; Diambra, Luis A

    2013-01-01

    Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi).

  6. First Comparative Transcriptomic Analysis of Wild Adult Male and Female Lutzomyia longipalpis, Vector of Visceral Leishmaniasis

    PubMed Central

    McCarthy, Christina B.; Santini, María Soledad; Pimenta, Paulo F. P.; Diambra, Luis A.

    2013-01-01

    Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi). PMID:23554910

  7. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    PubMed

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  8. E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

    PubMed Central

    Horn, Thomas; Boutros, Michael

    2010-01-01

    The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

  9. An enzyme free electrochemical biosensor for sensitive detection of miRNA with a high discrimination factor by coupling the strand displacement reaction and catalytic hairpin assembly recycling.

    PubMed

    Yao, Juan; Zhang, Zhang; Deng, Zhenghua; Wang, Youqiang; Guo, Yongcan

    2017-10-23

    An isothermal, enzyme free, ultra-specific and ultra-sensitive protocol for electrochemical detection of miRNAs is proposed based on the toehold-mediated strand displacement reaction (SDR) and non-enzymatic catalytic hairpin reaction (CHA) recycling. The SDR was first triggered only in the presence of target miRNA and this process also affects other miRNA interferences having similar target sequences, thus guaranteeing a high discrimination factor and could be used in rare content miRNA detection with various amounts of interferences having similar target sequences. The output protector strand then triggered enzyme free CHA amplification and generates plenty of hairpin self-assembly products. This process in turn influences SDR equilibrium to move to the right and generates large amounts of protector output to ensure analysis sensitivity. Compared with traditional CHA, our proposed method greatly improved the signal to noise ratio and shows excellent performance in rare miRNA detection with miRNA analogue interference. Under the optimal experimental conditions and using square wave voltammetry, the established biosensor could detect target miRNA-21 down to 30 fM (S/N = 3) with a dynamic range from 100 fM to 2 nM, and discriminate rare target miRNA-21 from mismatched miRNA with high selectivity. This method holds great promise in miRNA detection from human cancer cell lines and would be a versatile and powerful tool for clinical molecular diagnostics.

  10. Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

    PubMed

    DeVincenzo, John P

    2009-10-01

    A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.

  11. Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

    PubMed

    Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

    2015-09-01

    Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

  12. Armored long non-coding RNA MEG3 targeting EGFR based on recombinant MS2 bacteriophage virus-like particles against hepatocellular carcinoma.

    PubMed

    Chang, Le; Wang, Guojing; Jia, Tingting; Zhang, Lei; Li, Yulong; Han, Yanxi; Zhang, Kuo; Lin, Guigao; Zhang, Rui; Li, Jinming; Wang, Lunan

    2016-04-26

    Hepatocellular carcinoma (HCC) is one of the most frequently diagnosed cancers worldwide. However, the treatment of patients with HCC is particularly challenging. Long non-coding RNA maternally expressed gene 3 (MEG3) has been identified as a potential suppressor of several types of tumors, but the delivery of long RNA remains problematic, limiting its applications. In the present study, we designed a novel delivery system based on MS2 virus-like particles (VLPs) crosslinked with GE11 polypeptide. This vector was found to be fast, effective and safe for the targeted delivery of lncRNA MEG3 RNA to the epidermal growth factor receptor (EGFR)-positive HCC cell lines without the activation of EGFR downstream pathways, and significantly attenuated both in vitro and in vivo tumor cell growth. Our study also revealed that the targeted delivery was mainly dependent on clathrin-mediated endocytosis and MEG3 RNA suppresses tumor growth mainly via increasing the expression of p53 and its downstream gene GDF15, but decreasing the expression of MDM2. Thus, this vector is promising as a novel delivery system and may facilitate a new approach to lncRNA based cancer therapy.

  13. RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

    PubMed Central

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

    2012-01-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

  14. RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

    PubMed

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

    2012-05-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

  15. Renewing the Assault on mRNA

    PubMed Central

    McCAIN, JACK

    2004-01-01

    Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488

  16. Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

    PubMed

    Abe, Hiroshi; Kimura, Yasuaki

    2018-01-01

    Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

  17. RNA interference-based nanosystems for inflammatory bowel disease therapy

    PubMed Central

    Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

    2016-01-01

    Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

  18. Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

    PubMed Central

    Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

    2013-01-01

    Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

  19. Research Area 14.3 Microbiology and Biodegradation: Development of RNA-based Vectors for in vivo Delivery of siRNAs

    DTIC Science & Technology

    2014-09-08

    P.O. Box 12211 Research Triangle Park, NC 27709-2211 Vector, RNAi, delivery REPORT DOCUMENTATION PAGE 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 10...suggesstions for reducing this burden, to Washington Headquarters Services , Directorate for Information Operations and Reports, 1215 Jefferson Davis...Shapiro, Alissa M Pham, Benjamin R tenOever. In Vivo Delivery of Cytoplasmic RNA Virus-derived miRNAs, Molecular Therapy, (11 2011): 0. doi

  20. Highly specific gene silencing in a monocot species by artificial microRNAs derived from chimeric miRNA precursors

    DOE PAGES

    Carbonell, Alberto; Fahlgren, Noah; Mitchell, Skyler; ...

    2015-05-20

    Artificial microRNAs (amiRNAs) are used for selective gene silencing in plants. However, current methods to produce amiRNA constructs for silencing transcripts in monocot species are not suitable for simple, cost-effective and large-scale synthesis. Here, a series of expression vectors based on Oryza sativa MIR390 (OsMIR390) precursor was developed for high-throughput cloning and high expression of amiRNAs in monocots. Four different amiRNA sequences designed to target specifically endogenous genes and expressed from OsMIR390-based vectors were validated in transgenic Brachypodium distachyon plants. Surprisingly, amiRNAs accumulated to higher levels and were processed more accurately when expressed from chimeric OsMIR390-based precursors that include distalmore » stem-loop sequences from Arabidopsis thaliana MIR390a (AtMIR390a). In all cases, transgenic plants displayed the predicted phenotypes induced by target gene repression, and accumulated high levels of amiRNAs and low levels of the corresponding target transcripts. Genome-wide transcriptome profiling combined with 5-RLM-RACE analysis in transgenic plants confirmed that amiRNAs were highly specific. Finally, significance Statement A series of amiRNA vectors based on Oryza sativa MIR390 (OsMIR390) precursor were developed for simple, cost-effective and large-scale synthesis of amiRNA constructs to silence genes in monocots. Unexpectedly, amiRNAs produced from chimeric OsMIR390-based precursors including Arabidopsis thaliana MIR390a distal stem-loop sequences accumulated elevated levels of highly effective and specific amiRNAs in transgenic Brachypodium distachyon plants.« less

  1. repRNA: a web server for generating various feature vectors of RNA sequences.

    PubMed

    Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

    2016-02-01

    With the rapid growth of RNA sequences generated in the postgenomic age, it is highly desired to develop a flexible method that can generate various kinds of vectors to represent these sequences by focusing on their different features. This is because nearly all the existing machine-learning methods, such as SVM (support vector machine) and KNN (k-nearest neighbor), can only handle vectors but not sequences. To meet the increasing demands and speed up the genome analyses, we have developed a new web server, called "representations of RNA sequences" (repRNA). Compared with the existing methods, repRNA is much more comprehensive, flexible and powerful, as reflected by the following facts: (1) it can generate 11 different modes of feature vectors for users to choose according to their investigation purposes; (2) it allows users to select the features from 22 built-in physicochemical properties and even those defined by users' own; (3) the resultant feature vectors and the secondary structures of the corresponding RNA sequences can be visualized. The repRNA web server is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repRNA/ .

  2. RNA-TVcurve: a Web server for RNA secondary structure comparison based on a multi-scale similarity of its triple vector curve representation.

    PubMed

    Li, Ying; Shi, Xiaohu; Liang, Yanchun; Xie, Juan; Zhang, Yu; Ma, Qin

    2017-01-21

    RNAs have been found to carry diverse functionalities in nature. Inferring the similarity between two given RNAs is a fundamental step to understand and interpret their functional relationship. The majority of functional RNAs show conserved secondary structures, rather than sequence conservation. Those algorithms relying on sequence-based features usually have limitations in their prediction performance. Hence, integrating RNA structure features is very critical for RNA analysis. Existing algorithms mainly fall into two categories: alignment-based and alignment-free. The alignment-free algorithms of RNA comparison usually have lower time complexity than alignment-based algorithms. An alignment-free RNA comparison algorithm was proposed, in which novel numerical representations RNA-TVcurve (triple vector curve representation) of RNA sequence and corresponding secondary structure features are provided. Then a multi-scale similarity score of two given RNAs was designed based on wavelet decomposition of their numerical representation. In support of RNA mutation and phylogenetic analysis, a web server (RNA-TVcurve) was designed based on this alignment-free RNA comparison algorithm. It provides three functional modules: 1) visualization of numerical representation of RNA secondary structure; 2) detection of single-point mutation based on secondary structure; and 3) comparison of pairwise and multiple RNA secondary structures. The inputs of the web server require RNA primary sequences, while corresponding secondary structures are optional. For the primary sequences alone, the web server can compute the secondary structures using free energy minimization algorithm in terms of RNAfold tool from Vienna RNA package. RNA-TVcurve is the first integrated web server, based on an alignment-free method, to deliver a suite of RNA analysis functions, including visualization, mutation analysis and multiple RNAs structure comparison. The comparison results with two popular RNA comparison tools, RNApdist and RNAdistance, showcased that RNA-TVcurve can efficiently capture subtle relationships among RNAs for mutation detection and non-coding RNA classification. All the relevant results were shown in an intuitive graphical manner, and can be freely downloaded from this server. RNA-TVcurve, along with test examples and detailed documents, are available at: http://ml.jlu.edu.cn/tvcurve/ .

  3. Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

    PubMed

    Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

    2014-03-01

    A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

  4. Virus induced gene silencing (VIGS) for functional analysis of wheat genes involved in Zymoseptoria tritici susceptibility and resistance.

    PubMed

    Lee, Wing-Sham; Rudd, Jason J; Kanyuka, Kostya

    2015-06-01

    Virus-induced gene silencing (VIGS) has emerged as a powerful reverse genetic technology in plants supplementary to stable transgenic RNAi and, in certain species, as a viable alternative approach for gene functional analysis. The RNA virus Barley stripe mosaic virus (BSMV) was developed as a VIGS vector in the early 2000s and since then it has been used to study the function of wheat genes. Several variants of BSMV vectors are available, with some requiring in vitro transcription of infectious viral RNA, while others rely on in planta production of viral RNA from DNA-based vectors delivered to plant cells either by particle bombardment or Agrobacterium tumefaciens. We adapted the latest generation of binary BSMV VIGS vectors for the identification and study of wheat genes of interest involved in interactions with Zymoseptoria tritici and here present detailed and the most up-to-date protocols. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

    PubMed Central

    Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

    2011-01-01

    Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

  6. Guanosine 2-NH2 groups of Escherichia coli RNase P RNA involved in intramolecular tertiary contacts and direct interactions with tRNA.

    PubMed Central

    Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K

    1999-01-01

    We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070

  7. In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

    PubMed

    Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

    2018-05-18

    Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

  8. In cell mutational interference mapping experiment (in cell MIME) identifies the 5′ polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging

    PubMed Central

    Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe

    2018-01-01

    Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260

  9. A simple method for construction of artificial microRNA vector in plant.

    PubMed

    Li, Yang; Li, Yang; Zhao, Sunping; Zhong, Sheng; Wang, Zhaohai; Ding, Bo; Li, Yangsheng

    2014-10-01

    Artificial microRNA (amiRNA) is a powerful tool for silencing genes in many plant species. Here we provide an easy method to construct amiRNA vectors that reinvents the Golden Gate cloning approach and features a novel system called top speed amiRNA construction (TAC). This speedy approach accomplishes one restriction-ligation step in only 5 min, allowing easy and high-throughput vector construction. Three primers were annealed to be a specific adaptor, then digested and ligated on our novel vector pTAC. Importantly, this method allows the recombined amiRNA constructs to maintain the precursor of osa-miR528 with exception of the desired amiRNA/amiRNA* sequences. Using this method, our results showed the expected decrease of targeted genes in Nicotiana benthamiana and Oryza sativa.

  10. In vivo reduction or blockade of interleukin-1β in primary osteoarthritis influences expression of mediators implicated in pathogenesis

    PubMed Central

    Santangelo, K. S.; Nuovo, G. J.; Bertone, A. L.

    2012-01-01

    Summary Objective Diminish interleukin-1β (IL-1β) signaling in a model of primary osteoarthritis by RNA interference-based transcript reduction or receptor blockade, and quantify changes incurred on transcript expression of additional mediators. Methods Knees of Hartley guinea pigs were collected at 120 and 180 days of age following injection with viral vectors (N=4/treatment group/date) at 60 days. Two groups received either adeno-associated viral serotype 5 vector containing a knockdown sequence (TV), or adenoviral vector encoding for IL-1 receptor antagonist protein (Ad-IRAP); treatments were contrasted with opposite knees administered corresponding vector controls. A third group evaluated TV relative to saline-only injected knees. Chondropathy and immunohistochemistry findings were compared to untreated guinea pigs. Transcript expression levels in cartilage were calculated using the comparative CT (2−ΔΔCT) method and analyzed by one-way ANOVA with pairwise comparisons using Tukey 95% confidence intervals. Results Vector transduction was confirmed at both harvest dates. TV and Ad-IRAP, relative to vector controls, significantly decreased IL-1β. Inflammatory mediators [tumor necrosis factor-α (TNF-α), interleukin-8 (IL-8), interferon-γ (IFN-γ)], and catabolic matrix metalloproteinase 13 (MMP13) were also decreased, while anabolic transforming growth factor-β1 (TGF-β1) was increased. IL-1β was also decreased by TV versus saline, with a decrease in MMP13 and increase TGF-β1; TNF-α, IL-8, and IFN-γ were transiently increased. Conclusions This work confirmed that a reduction in IL-1β signaling was accomplished by either method, resulting in decreased expression of three inflammatory mediators and one catabolic agent, and increased expression of an anabolic molecule. Thus, evidence is provided that IL-1β serves a role in vivo in spontaneous osteoarthritis and that these translational tools may provide beneficial disease modification. PMID:22935786

  11. Stable Dispersions of Covalently Tethered Polymer Improved Graphene Oxide Nanoconjugates as an Effective Vector for siRNA Delivery.

    PubMed

    Yadav, Nisha; Kumar, Naveen; Prasad, Peeyush; Shirbhate, Shivani; Sehrawat, Seema; Lochab, Bimlesh

    2018-05-02

    Conjugates of poly(amidoamine) (PAMAM) with modified graphene oxide (GO) are attractive nonviral vectors for gene-based cancer therapeutics. GO protects siRNA from enzymatic cleavage and showed reasonable transfection efficiency along with simultaneous benefits of low cost and large scale production. PAMAM is highly effective in siRNA delivery but suffers from high toxicity with poor in vivo efficacy. Co-reaction of GO and PAMAM led to aggregation and more importantly, have detrimental effect on stability of dispersion at physiological pH preventing their exploration at clinical level. In the current work, we have designed, synthesized, characterized and explored a new type of hybrid vector (GPD), using GO synthesized via improved method which was covalently tethered with poly(ethylene glycol) (PEG) and PAMAM. The existence of covalent linkage, relative structural changes and properties of GPD is well supported by Fourier transform infrared (FTIR), UV-visible (UV-vis), Raman, X-ray photoelectron (XPS), elemental analysis, powder X-ray diffraction (XRD), thermogravimetry analysis (TGA), dynamic light scattering (DLS), and zeta potential. Scanning electron microscopy (SEM), and transmission electron microscopy (TEM) of GPD showed longitudinally aligned columnar self-assembled ∼10 nm thick polymeric nanoarchitectures onto the GO surface accounting to an average size reduction to ∼20 nm. GPD revealed an outstanding stability in both phosphate buffer saline (PBS) and serum containing cell medium. The binding efficiency of EPAC1 siRNA to GPD was supported by gel retardation assay, DLS, zeta potential and photoluminescence (PL) studies. A lower cytotoxicity with enhanced cellular uptake and homogeneous intracellular distribution of GPD/siRNA complex is confirmed by imaging studies. GPD exhibited a higher transfection efficiency with remarkable inhibition of cell migration and lower invasion than PAMAM and Lipofectamine 2000 suggesting its role in prevention of breast cancer progression and metastasis. A significant reduction in the expression of the specific protein against which siRNA was delivered is revealed by Western blot assay. Furthermore, a pH-triggered release of siRNA from the GPD/siRNA complex was studied to provide a mechanistic insight toward unloading of siRNA from the vector. Current strategy is a way forward for designing effective therapeutic vectors for gene-based antitumor therapy.

  12. Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

    PubMed

    Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

    2013-08-16

    Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

  13. A novel tyrosine-modified low molecular weight polyethylenimine (P10Y) for efficient siRNA delivery in vitro and in vivo.

    PubMed

    Ewe, Alexander; Przybylski, Susanne; Burkhardt, Jana; Janke, Andreas; Appelhans, Dietmar; Aigner, Achim

    2016-05-28

    The delivery of nucleic acids, particularly of small RNA molecules like siRNAs for the induction of RNA interference (RNAi), still represents a major hurdle with regard to their application in vivo. Possible therapeutic applications thus rely on the development of efficient non-viral gene delivery vectors. While low molecular weight polyethylenimines (PEIs) have been successfully explored, the introduction of chemical modifications offers an avenue towards the development of more efficient vectors. In this paper, we describe the synthesis of a novel tyrosine-modified low-molecular weight polyethylenimine (P10Y) for efficient siRNA complexation and delivery. The comparison with the respective parent PEI reveals that knockdown efficacies are considerably enhanced by the tyrosine modification, as determined in different reporter cell lines, without appreciable cytotoxicity. We furthermore identify optimal conditions for complex preparation as well as for storing or lyophilization of the complexes without loss of biological activity. Beyond reporter cell lines, P10Y/siRNA complexes mediate the efficient knockdown of endogenous target genes and, upon knockdown of the anti-apoptotic oncogene survivin, tumor cell inhibitory effects in different carcinoma cell lines. Pushing the system further towards its therapeutic in vivo application, we demonstrate in mice the delivery of intact siRNAs and distinct biodistribution profiles upon systemic (intravenous or intraperitoneal) injection. No adverse effects (hepatotoxicity, immunostimulation/alterations in immunophenotype, weight loss) are observed. More importantly, profound tumor-inhibitory effects in a melanoma xenograft mouse model are observed upon systemic application of P10Y/siRNA complexes for survivin knockdown, indicating the therapeutic efficacy of P10Y/siRNA complexes. Taken together, we (i) establish tyrosine-modified PEI (P10Y) as efficient platform for siRNA delivery in vitro and in vivo, (ii) identify optimal preparation and storage conditions as well as (iii) physicochemical and biological properties of P10Y complexes, and (iv) demonstrate their applicability as siRNA therapeutic in vivo (v) in the absence of adverse effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

    PubMed

    Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

    2010-12-01

    The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

  15. Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

    Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

  16. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    PubMed

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  17. Differentiating RNA from DNA by a molecular fluorescent probe based on the "door-bolt" mechanism biomaterials.

    PubMed

    Yao, Qichao; Li, Haidong; Xian, Liman; Xu, Feng; Xia, Jing; Fan, Jiangli; Du, Jianjun; Wang, Jingyun; Peng, Xiaojun

    2018-09-01

    Although excellent florescent probes have been developed for DNA, good probes for RNA remain lacking. The shortage of reported and commercial RNA probes is attributable to their severe interference from DNA. As DNA and RNA have similar structures but different functions, it has been an imperative challenge to develop RNA probes that differentiate from DNA. In this study, an NIR fluorescent probe, NBE, is described, which contains a bulky julolidine group that can fit in a spacious RNA pocket and emit intense fluorescence. However, NBE has no response to DNA, as it cannot intercalate into the double strands or even in the DNA minor groove. The sensing mechanism is similar to the effect of a door-bolt. NBE shows excellent performance in RNA sensing (outstanding photostability, high selectivity and fast response), whether in aqueous buffers, fixed cells or living cells. These findings might provide not only a potential imaging tool but also a new design strategy for the recognition of RNA while avoiding interference from DNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Polarization splitter based on interference effects in all-solid photonic crystal fibers.

    PubMed

    Mao, Dong; Guan, Chunying; Yuan, Libo

    2010-07-01

    We propose a novel kind of polarization splitter in all-solid photonic crystal fibers based on the mode interference effects. Both the full-vector finite-element method and the semi-vector three-dimensional beam propagation method are employed to design and analyze the characteristics of the splitter. Numerical simulations show that x-polarized and y-polarized modes are split entirely along with 6.8 mm long propagation. An extinction ratio of more than 20 dB and a crosstalk of less than -20 dB are obtained within the wavelength range of 1.541-1.556 microm. The extinction ratio and the crosstalk at 1.55 microm are 28.9 and -29.0 dB for x polarization, while the extinction ratio and the crosstalk at 1.55 microm are 29.9 and -29.8 dB for y polarization, respectively.

  19. Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

    PubMed

    Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

    2017-04-01

    Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

  20. Induction of interferon lambda in influenza a virus infected cells treated with shRNAs against M1 transcript.

    PubMed

    Švančarová, P; Svetlíková, D; Betáková, T

    2015-06-01

    RNA interference (RNAi) represents a form of post-transcriptional gene silencing mediated by small interfering RNAs (siRNA) and provides a powerful tool to specifically inhibit viral infection. To investigate therapeutic capacity of siRNAs targeting M gene, six vectors with U1-short hairpin RNA (shRNA) expression system were prepared and tested in infected cells and animals. In infected cells, three of six shRNAs targeting M1 gene significantly (P <0,01) reduced the virus titer to 66%, 45% or 21%, respectively. Replication of IAV and levels of M1 RNAs were significantly reduced in the cells transfected with shRNAs, which decreased the virus titer. IFN-α/β altered in shRNAs-treated cells. The level of IFN-λ (type III interferon) mRNA was significantly increased in the infected cells treated with shM22, shM349, shM522, and (type I interferon) as well as IP-10 (type II interferon) mRNAs were not significantly their mixtures. The increased level of IFN-λ mRNA corresponded to significantly increased level of RIG-1 mRNA. shRNAs inhibited influenza virus infection in a gene-specific manner in co-operation with IFN-λ. Some constructs targeting the M1 transcript prolonged the survival of infected mice.

  1. Folate-targeted amphiphilic cyclodextrin nanoparticles incorporating a fusogenic peptide deliver therapeutic siRNA and inhibit the invasive capacity of 3D prostate cancer tumours.

    PubMed

    Evans, James C; Malhotra, Meenakshi; Sweeney, Katrina; Darcy, Raphael; Nelson, Colleen C; Hollier, Brett G; O'Driscoll, Caitriona M

    2017-10-30

    The main barrier to the development of an effective RNA interference (RNAi) therapy is the lack of a suitable delivery vector. Modified cyclodextrins have emerged in recent years for the delivery of siRNA. In the present study, a folate-targeted amphiphilic cyclodextrin was formulated using DSPE-PEG 5000 -folate to target prostate cancer cells. The fusogenic peptide GALA was included in the formulation to aid in the endosomal release of siRNA. Targeted nanoparticles were less than 200nm in size with a neutral surface charge. The complexes were able to bind siRNA and protect it from serum nucleases. Incubation with excess free folate resulted in a significant decrease in the uptake of targeted nanoparticles in LNCaP and PC3 cells, both of which have been reported to have differing pathways of folate uptake. There was a significant reduction in the therapeutic targets, ZEB1 and NRP1 at mRNA and protein level following treatment with targeted complexes. In preliminary functional assays using 3D spheroids, treatment of PC3 tumours with targeted complexes with ZEB1 and NRP1 siRNA resulted in more compact colonies relative to the untargeted controls and inhibited infiltration into the Matrigel™ layer. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

    PubMed

    Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

    2014-01-01

    There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

  3. Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

    PubMed

    Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

    2010-01-01

    In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

  4. Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

    PubMed Central

    Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

    2013-01-01

    Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

  5. Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

    PubMed

    Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

    2017-08-01

    Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  6. GNSS Space-Time Interference Mitigation and Attitude Determination in the Presence of Interference Signals

    PubMed Central

    Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

    2015-01-01

    The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios. PMID:26016909

  7. GNSS space-time interference mitigation and attitude determination in the presence of interference signals.

    PubMed

    Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

    2015-05-26

    The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios.

  8. Intelligent Therapeutics and Metabolic Programming Through Tailormade, Ligand-Controlled RNA Switches

    DTIC Science & Technology

    2007-02-05

    lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme

  9. An RNA isolation system for plant tissues rich in secondary metabolites

    PubMed Central

    2011-01-01

    Background Secondary metabolites are reported to interfere with the isolation of RNA particularly with the recipes that use guanidinium-based salt. Such interference was observed in isolation of RNA with medicinal plants rheum (Rheum australe) and arnebia (Arnebia euchroma). A rapid and less cumbersome system for isolation of RNA was essential to facilitate any study related to gene expression. Findings An RNA isolation system free of guanidinium salt was developed that successfully isolated RNA from rheum and arnebia. The method took about 45 min and was successfully evaluated on twenty one tissues with varied secondary metabolites. The A260/280 ratio ranged between 1.8 - 2.0 with distinct 28 S and 18 S rRNA bands visible on a formaldehyde-agarose gel. Conclusions The present manuscript describes a rapid protocol for isolation of RNA, which works well with all the tissues examined so far. The remarkable feature was the success in isolation of RNA with those tissues, wherein the most commonly used methods failed. Isolated RNA was amenable to downstream applications such as reverse transcription-polymerase chain reaction (RT-PCR), differential display (DD), suppression subtractive hybridization (SSH) library construction, and northern hybridization. PMID:21443767

  10. RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

    PubMed Central

    Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

    1999-01-01

    In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

  11. Possible superconductivity in Sr₂IrO₄ probed by quasiparticle interference.

    PubMed

    Gao, Yi; Zhou, Tao; Huang, Huaixiang; Wang, Qiang-Hua

    2015-03-18

    Based on the possible superconducting (SC) pairing symmetries recently proposed, the quasiparticle interference (QPI) patterns in electron- and hole-doped Sr₂IrO₄ are theoretically investigated. In the electron-doped case, the QPI spectra can be explained based on a model similar to the octet model of the cuprates while in the hole-doped case, both the Fermi surface topology and the sign of the SC order parameter resemble those of the iron pnictides and there exists a QPI vector resulting from the interpocket scattering between the electron and hole pockets. In both cases, the evolution of the QPI vectors with energy and their behaviors in the nonmagnetic and magnetic impurity scattering cases can well be explained based on the evolution of the constant-energy contours and the sign structure of the SC order parameter. The QPI spectra presented in this paper can be compared with future scanning tunneling microscopy experiments to test whether there are SC phases in electron- and hole-doped Sr₂IrO₄ and what the pairing symmetry is.

  12. Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae

    USDA-ARS?s Scientific Manuscript database

    The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...

  13. RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

    PubMed Central

    2011-01-01

    Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

  14. Molecular mechanisms influencing efficiency of RNA interference in insects.

    PubMed

    Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

    2018-06-21

    RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. Manipulation and Biological Applications of Gold Nanorods

    NASA Astrophysics Data System (ADS)

    Rostro-Kohanloo, Betty Catalina

    This thesis compared anionic polyelectrolyte wrapping stabilization with poly(sodium 4-stryene-sulfonate), (PSS), polyelectrolyte and methoxy (polyethylene glycol)-thiol (mPEG(5000)-SH) strategies. From this data the critical gold nanorod (GNR) and cetyl-trimethylammonium bromide (CTAB) concentration ratio needed for GNR stabilization was determined using optical and chemical extraction methods. This was followed by functionalization with a heterobifunctional Polyethylene glycol (PEG) linker, such as a-thio-w-carboxy poly(ethylene glycol) termed t-PEG-c and carbodiimide chemistries for antibody linkage with Immunoglobulin G (IgG), and epidermal growth factor receptor (EGFR) based Human Epidermal growth factor Receptor 2 (Her2), and Cetuximab (C225) antibodies, for in vitro cancer cell targeting. Confocal, two-photon luminescence (TPL), and dark scattering microscopy, and fluorescence, zeta potential, and Nanoparticle Enzyme-linked immunosorbent assay (ELISA) were used to monitor changes to the GNR surface. An untreatable form of bladder cancer was then studied using the t-GNR-PEG-c-Ab bioconjugates with C225 antibody, which housed a glyceraldehyde-3-phosphate (GAPDH), Fluorescein isothiocyanate (FITC) labeled siRNA, termed GAPDH-siRNA-FITC, which was included within a Luciferase based plasmid. A salt based electrostatic heating method was used to trap the GAPDH-siRNA-FITC from the PEG layer by activating the PEG polymer pour point, while a laser based heating system was used for in vitro release inside cancer cells. The down regulation of the GAPDH gene was targeted by the siRNA. as GAPDH has been shown to be up-regulated in many cancers and down-regulated by chemotherapeutic drugs. Cell culture, and subsequent imaging by transmission electron microscopy (TEM), TPL and confocal microscopy were used to view the internalized conjugates, and reverse transcriptase polymerase chain reaction (RT-PCR) were used to determine if the release of the GAPDH-siRNA caused a reduction in the expression of GAPDH-mRNA. Plasmonic gene silencing of the gene by the GAPDH-siRNA was then compared to a lipid based Dharmafect control in terms of transfection ability. RT-PCR results evidenced gene silencing of the plasmonic-GAPDH-siRNA vector when compared to the Dharmafect control. Silencing likely resulted from the zwitterionic charges of the plasmonic vector and the encapsulated GAPDH-siRNA, which yielded near neutral charge tendencies. This differs significantly from the Dharmafect lipid vector, which is cationic in nature. Endosomal release of the plasmonic vector is further enhanced by the laser excitation of the GNR at the longitudinal surface plasmon resonance (LSPR), which allows for the endosomal release of the GAPDH-siRNA through pore formation leading to cytoplasmic transport and subsequent gene silencing. Near neutral charges were welcomed in this plasmonic gene therapy study as they tend to favor endosomal release, pore formation, and transport.

  16. Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

    PubMed Central

    Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

    2011-01-01

    Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

  17. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    PubMed

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.

  18. Aeromagnetic gradient compensation method for helicopter based on ɛ-support vector regression algorithm

    NASA Astrophysics Data System (ADS)

    Wu, Peilin; Zhang, Qunying; Fei, Chunjiao; Fang, Guangyou

    2017-04-01

    Aeromagnetic gradients are typically measured by optically pumped magnetometers mounted on an aircraft. Any aircraft, particularly helicopters, produces significant levels of magnetic interference. Therefore, aeromagnetic compensation is essential, and least square (LS) is the conventional method used for reducing interference levels. However, the LSs approach to solving the aeromagnetic interference model has a few difficulties, one of which is in handling multicollinearity. Therefore, we propose an aeromagnetic gradient compensation method, specifically targeted for helicopter use but applicable on any airborne platform, which is based on the ɛ-support vector regression algorithm. The structural risk minimization criterion intrinsic to the method avoids multicollinearity altogether. Local aeromagnetic anomalies can be retained, and platform-generated fields are suppressed simultaneously by constructing an appropriate loss function and kernel function. The method was tested using an unmanned helicopter and obtained improvement ratios of 12.7 and 3.5 in the vertical and horizontal gradient data, respectively. Both of these values are probably better than those that would have been obtained from the conventional method applied to the same data, had it been possible to do so in a suitable comparative context. The validity of the proposed method is demonstrated by the experimental result.

  19. Minimum Variance Distortionless Response Beamformer with Enhanced Nulling Level Control via Dynamic Mutated Artificial Immune System

    PubMed Central

    Kiong, Tiong Sieh; Salem, S. Balasem; Paw, Johnny Koh Siaw; Sankar, K. Prajindra

    2014-01-01

    In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals. PMID:25003136

  20. Minimum variance distortionless response beamformer with enhanced nulling level control via dynamic mutated artificial immune system.

    PubMed

    Kiong, Tiong Sieh; Salem, S Balasem; Paw, Johnny Koh Siaw; Sankar, K Prajindra; Darzi, Soodabeh

    2014-01-01

    In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals.

  1. An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

    PubMed

    Cui, Hongguang; Wang, Aiming

    2017-03-01

    RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

    DTIC Science & Technology

    2006-12-01

    Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

  3. [MicroRNA Target Prediction Based on Support Vector Machine Ensemble Classification Algorithm of Under-sampling Technique].

    PubMed

    Chen, Zhiru; Hong, Wenxue

    2016-02-01

    Considering the low accuracy of prediction in the positive samples and poor overall classification effects caused by unbalanced sample data of MicroRNA (miRNA) target, we proposes a support vector machine (SVM)-integration of under-sampling and weight (IUSM) algorithm in this paper, an under-sampling based on the ensemble learning algorithm. The algorithm adopts SVM as learning algorithm and AdaBoost as integration framework, and embeds clustering-based under-sampling into the iterative process, aiming at reducing the degree of unbalanced distribution of positive and negative samples. Meanwhile, in the process of adaptive weight adjustment of the samples, the SVM-IUSM algorithm eliminates the abnormal ones in negative samples with robust sample weights smoothing mechanism so as to avoid over-learning. Finally, the prediction of miRNA target integrated classifier is achieved with the combination of multiple weak classifiers through the voting mechanism. The experiment revealed that the SVM-IUSW, compared with other algorithms on unbalanced dataset collection, could not only improve the accuracy of positive targets and the overall effect of classification, but also enhance the generalization ability of miRNA target classifier.

  4. Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

  5. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    PubMed Central

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  6. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

    PubMed

    Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

    2006-05-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

  7. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

    PubMed Central

    Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

    2006-01-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

  8. Exosomes from iPSCs Delivering siRNA Attenuate Intracellular Adhesion Molecule-1 Expression and Neutrophils Adhesion in Pulmonary Microvascular Endothelial Cells.

    PubMed

    Ju, Zhihai; Ma, Jinhui; Wang, Chen; Yu, Jie; Qiao, Yeru; Hei, Feilong

    2017-04-01

    The pro-inflammatory activation of pulmonary microvascular endothelial cells resulting in continuous expression of cellular adhesion molecules, and subsequently recruiting primed neutrophils to form a firm neutrophils-endothelium (PMN-EC) adhesion, has been examined and found to play a vital role in acute lung injury (ALI). RNA interference (RNAi) is a cellular process through harnessing a natural pathway silencing target gene based on recognition and subsequent degradation of specific mRNA sequences. It opens a promising approach for precision medicine. However, this application was hampered by many obstacles, such as immunogenicity, instability, toxicity problems, and difficulty in across the biological membrane. In this study, we reprogrammed urine exfoliated renal epithelial cells into human induced pluripotent stem cells (huiPSCs) and purified the exosomes (Exo) from huiPSCs as RNAi delivery system. Through choosing the episomal system to deliver transcription factors, we obtained a non-integrating huiPSCs. Experiments in both vitro and vivo demonstrated that these huiPSCs possess the pluripotent properties. The exosomes of huiPSCs isolated by differential centrifugation were visualized by transmission electron microscopy (TEM) showing a typical exosomal appearance with an average diameter of 122 nm. Immunoblotting confirmed the presence of the typical exosomal markers, including CD63, TSG 101, and Alix. Co-cultured PKH26-labeled exosomes with human primary pulmonary microvascular endothelial cells (HMVECs) confirmed that they could be internalized by recipient cells at a time-dependent manner. Then, electroporation was used to introduce siRNA against intercellular adhesion molecule-1 (ICAM-1) into exosomes to form an Exo/siRNA compound. The Exo/siRNA compound efficiently delivered the target siRNA into HMVECs causing selective gene silencing, inhibiting the ICAM-1 protein expression, and PMN-EC adhesion induced by lipopolysaccharide (LPS). These data suggest that huiPSCs exosomes could be used as a natural gene delivery vector to transport therapeutic siRNAs for alleviating inflammatory responses in recipient cells.

  9. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    PubMed

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  10. Engineering Molecular Immunity Against Plant Viruses.

    PubMed

    Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M

    2017-01-01

    Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.

  11. The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector.

    PubMed

    Akbari, Omar S; Antoshechkin, Igor; Amrhein, Henry; Williams, Brian; Diloreto, Race; Sandler, Jeremy; Hay, Bruce A

    2013-09-04

    Mosquitoes are vectors of a number of important human and animal diseases. The development of novel vector control strategies requires a thorough understanding of mosquito biology. To facilitate this, we used RNA-seq to identify novel genes and provide the first high-resolution view of the transcriptome throughout development and in response to blood feeding in a mosquito vector of human disease, Aedes aegypti, the primary vector for Dengue and yellow fever. We characterized mRNA expression at 34 distinct time points throughout Aedes development, including adult somatic and germline tissues, by using polyA+ RNA-seq. We identify a total of 14,238 novel new transcribed regions corresponding to 12,597 new loci, as well as many novel transcript isoforms of previously annotated genes. Altogether these results increase the annotated fraction of the transcribed genome into long polyA+ RNAs by more than twofold. We also identified a number of patterns of shared gene expression, as well as genes and/or exons expressed sex-specifically or sex-differentially. Expression profiles of small RNAs in ovaries, early embryos, testes, and adult male and female somatic tissues also were determined, resulting in the identification of 38 new Aedes-specific miRNAs, and ~291,000 small RNA new transcribed regions, many of which are likely to be endogenous small-interfering RNAs and Piwi-interacting RNAs. Genes of potential interest for transgene-based vector control strategies also are highlighted. Our data have been incorporated into a user-friendly genome browser located at www.Aedes.caltech.edu, with relevant links to Vectorbase (www.vectorbase.org).

  12. Crystal structure of the Csm3-Csm4 subcomplex in the type III-A CRISPR-Cas interference complex.

    PubMed

    Numata, Tomoyuki; Inanaga, Hideko; Sato, Chikara; Osawa, Takuo

    2015-01-30

    Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci play a pivotal role in the prokaryotic host defense system against invading genetic materials. The CRISPR loci are transcribed to produce CRISPR RNAs (crRNAs), which form interference complexes with CRISPR-associated (Cas) proteins to target the invading nucleic acid for degradation. The interference complex of the type III-A CRISPR-Cas system is composed of five Cas proteins (Csm1-Csm5) and a crRNA, and targets invading DNA. Here, we show that the Csm1, Csm3, and Csm4 proteins from Methanocaldococcus jannaschii form a stable subcomplex. We also report the crystal structure of the M. jannaschii Csm3-Csm4 subcomplex at 3.1Å resolution. The complex structure revealed the presence of a basic concave surface around their interface, suggesting the RNA and/or DNA binding ability of the complex. A gel retardation analysis showed that the Csm3-Csm4 complex binds single-stranded RNA in a non-sequence-specific manner. Csm4 structurally resembles Cmr3, a component of the type III-B CRISPR-Cas interference complex. Based on bioinformatics, we constructed a model structure of the Csm1-Csm4-Csm3 ternary complex, which provides insights into its role in the Csm interference complex. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

    PubMed Central

    Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

    2014-01-01

    The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

  14. Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

    PubMed Central

    Tomoyasu, Yoshinori

    2014-01-01

    The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

  15. On the efficient bio-incorporation of 5-hydroxy-tryptophan in recombinant proteins expressed in Escherichia coli with T7 RNA polymerase-based vectors.

    PubMed

    Oliveira-Souza, Wellington P; Bronze, Fellipe; Broos, Jaap; Marcondes, Marcelo F M; Oliveira, Vitor

    2017-10-21

    Biosynthetic incorporation of non-canonic amino acids is an attractive strategy to introduce new properties in recombinant proteins. Trp analogs can be incorporated in recombinant proteins replacing regular Trp during protein translation into a Trp-auxotrophic cell host. This straightforward method however, is limited to few analogs recognized and accepted by the cellular protein production machinery. 5-hydroxy-tryptophan (5OH-Trp) can be bio-incorporated using E. coli as expression host however; we have experienced very low incorporation yields - amount of protein containing regular Trp/amount of protein containing the Trp analog - during expressions of 5OH-Trp labeled proteins. Furthermore, this low incorporation yield were verified especially when the widely-used vectors based on the T7 RNA polymerase were used. Testing different 5OH-Trp incorporation protocols we verified that in these T7-based systems, the production of the T7 RNA polymerase is driven by the same elements - lac promoter/IPTG - as the target protein. Consequently, the bio-incorporation of the 5OH-Trp residues also occurs in this crucial enzyme, but, the produced T7 RNA polymerase labeled with 5OH-Trp is inactive or much less active. In the present work, we describe an efficient method to overcome this mentioned problem and bio-incorporate 5OH-Trp in proteins expressed in E. coli., using vectors based on the T7 RNA polymerase-T7 promoter. The two-step induction protocol here described showed incorporation efficiencies of 5OH-Trp higher than 90%. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Viral and Synthetic RNA Vector Technologies and Applications

    PubMed Central

    Schott, Juliane W; Morgan, Michael; Galla, Melanie; Schambach, Axel

    2016-01-01

    Use of RNA is an increasingly popular method to transiently deliver genetic information for cell manipulation in basic research and clinical therapy. In these settings, viral and nonviral RNA platforms are employed for delivery of small interfering RNA and protein-coding mRNA. Technological advances allowing RNA modification for increased stability, improved translation and reduced immunogenicity have led to increased use of nonviral synthetic RNA, which is delivered in naked form or upon formulation. Alternatively, highly efficient viral entry pathways are exploited to transfer genes of interest as RNA incorporated into viral particles. Current viral RNA transfer technologies are derived from Retroviruses, nonsegmented negative-strand RNA viruses or positive-stranded Alpha- and Flaviviruses. In retroviral particles, the genes of interest can either be incorporated directly into the viral RNA genome or as nonviral RNA. Nonsegmented negative-strand virus-, Alpha- and Flavivirus-derived vectors support prolonged expression windows through replication of viral RNA encoding genes of interest. Mixed technologies combining viral and nonviral components are also available. RNA transfer is ideal for all settings that do not require permanent transgene expression and excludes potentially detrimental DNA integration into the target cell genome. Thus, RNA-based technologies are successfully applied for reprogramming, transdifferentiation, gene editing, vaccination, tumor therapy, and gene therapy. PMID:27377044

  17. In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

    PubMed

    Kandeel, Mahmoud; Kitade, Yukio

    2013-07-01

    RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

  18. Subspace-based interference removal methods for a multichannel biomagnetic sensor array.

    PubMed

    Sekihara, Kensuke; Nagarajan, Srikantan S

    2017-10-01

    In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

  19. Subspace-based interference removal methods for a multichannel biomagnetic sensor array

    NASA Astrophysics Data System (ADS)

    Sekihara, Kensuke; Nagarajan, Srikantan S.

    2017-10-01

    Objective. In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. Approach. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

  20. Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

    PubMed

    Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

    2011-08-23

    Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

  1. Polarization of the interference field during reflection of electromagnetic waves from an intermedia boundary

    NASA Astrophysics Data System (ADS)

    Bulakhov, M. G.; Buyanov, Yu. I.; Yakubov, V. P.

    1996-10-01

    It has been shown that a full vector measurement of the total field allows one to uniquely distinguish the incident and reflected waves at each observation point without the use of a spatial difference based on an analysis of the polarization structure of the interference pattern which arises during reflection of electromagnetic waves from an intermedia boundary. We have investigated the stability of these procedures with respect to measurement noise by means of numerical modeling.

  2. Long non-coding RNA discovery across the genus anopheles reveals conserved secondary structures within and beyond the Gambiae complex.

    PubMed

    Jenkins, Adam M; Waterhouse, Robert M; Muskavitch, Marc A T

    2015-04-23

    Long non-coding RNAs (lncRNAs) have been defined as mRNA-like transcripts longer than 200 nucleotides that lack significant protein-coding potential, and many of them constitute scaffolds for ribonucleoprotein complexes with critical roles in epigenetic regulation. Various lncRNAs have been implicated in the modulation of chromatin structure, transcriptional and post-transcriptional gene regulation, and regulation of genomic stability in mammals, Caenorhabditis elegans, and Drosophila melanogaster. The purpose of this study is to identify the lncRNA landscape in the malaria vector An. gambiae and assess the evolutionary conservation of lncRNAs and their secondary structures across the Anopheles genus. Using deep RNA sequencing of multiple Anopheles gambiae life stages, we have identified 2,949 lncRNAs and more than 300 previously unannotated putative protein-coding genes. The lncRNAs exhibit differential expression profiles across life stages and adult genders. We find that across the genus Anopheles, lncRNAs display much lower sequence conservation than protein-coding genes. Additionally, we find that lncRNA secondary structure is highly conserved within the Gambiae complex, but diverges rapidly across the rest of the genus Anopheles. This study offers one of the first lncRNA secondary structure analyses in vector insects. Our description of lncRNAs in An. gambiae offers the most comprehensive genome-wide insights to date into lncRNAs in this vector mosquito, and defines a set of potential targets for the development of vector-based interventions that may further curb the human malaria burden in disease-endemic countries.

  3. Adenovirus-vectored shRNAs targeted to the highly conserved regions of VP1 and 2B in tandem inhibits replication of foot-and-mouth disease virus both in vitro and in vivo.

    PubMed

    Xu, Yan-Fang; Shen, Hai-Yan; Zhao, Ming-Qiu; Chen, Li-Jun; Li, Yin-Guang; Liao, Ming; Jia, Jun-Tao; Lv, Ying-Ran; Yi, Lin; Chen, Jin-Ding

    2012-04-01

    Foot-and-mouth disease is a highly contagious and economically important disease of cloven-hoofed animals. RNA interference (RNAi) can be used as a rapid and specific antiviral approach. It was shown that treatment with recombinant adenovirus (Ad(VP1-2B)) carrying shRNAs targeted to the VP1 and 2B genes of FMDV expressed in tandem had marked antiviral effects against FMDV both in IBRS-2 cells and guinea pigs. Treatment with Ad(VP1-2B) both before and after FMDV infection was most effective in IBRS-2 cells, as the FMDV RNA transcripts could not be detected within 48 h post-challenge (hpc), and the viral RNA copy number at 72 hpc was only 0.02% of that in the positive control group. Delivery of Ad(VP1-2B) reduced significantly the susceptibility of guinea pigs to FMDV infection. All guinea pigs were protected within 3 days post challenge (dpc) when they were injected twice with the same dose of Ad(VP1-2B), and a third treatment with the same dose of Ad(VP1-2B) at 3 dpc was necessary to confer longer lasting protection (up to 6 dpc). In conclusion, application of such a adenovirus vector to inhibit more than one viral gene may be an advantageous method for prevention and therapy of FMDV infection. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

    PubMed

    Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

    2010-05-31

    Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

  5. RNA interference of acetylcholinesterase in the Asian citrus psyllid, Diaphorina citri, increases its susceptibility to carbamate and organophosphate insecticides.

    PubMed

    Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil

    2017-11-01

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin, which indicated that AChE could be involved in the metabolism of fenpropathrin. Our results indicated that silencing of AChE and ChE genes in D. citri to increase its susceptibility to insecticides could be a promising tool for the control of this important vector. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2 H – NbSe 2

    DOE PAGES

    Arguello, C. J.; Rosenthal, E. P.; Andrade, E. F.; ...

    2015-01-21

    We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe₂ that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe₂. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiologymore » and the interactions. In 2H-NbSe₂, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.« less

  7. Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2H-NbSe2.

    PubMed

    Arguello, C J; Rosenthal, E P; Andrade, E F; Jin, W; Yeh, P C; Zaki, N; Jia, S; Cava, R J; Fernandes, R M; Millis, A J; Valla, T; Osgood, R M; Pasupathy, A N

    2015-01-23

    We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe2 that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe2. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiology and the interactions. In 2H-NbSe2, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.

  8. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.

    PubMed

    Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.

  9. RNA replicons - a new approach for influenza virus immunoprophylaxis.

    PubMed

    Zimmer, Gert

    2010-02-01

    RNA replicons are derived from either positive- or negative-strand RNA viruses. They represent disabled virus vectors that are not only avirulent, but also unable to revert to virulence. Due to autonomous RNA replication, RNA replicons are able to drive high level, cytosolic expression of recombinant antigens stimulating both the humoral and the cellular branch of the immune system. This review provides an update on the available literature covering influenza virus vaccines based on RNA replicons. The pros and cons of these vaccine strategies will be discussed and future perspectives disclosed.

  10. The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

    PubMed

    Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

    2014-08-01

    Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Advance of RNA interference technique in Hemipteran insects.

    PubMed

    Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

    2012-07-24

    RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  12. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  13. The role of Cas8 in type I CRISPR interference.

    PubMed

    Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

    2015-05-05

    CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

  14. Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

    PubMed Central

    2014-01-01

    Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

  15. Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

    PubMed Central

    Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

    2004-01-01

    Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

  16. Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

    Cancer.gov

    The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

  17. Bringing RNA Interference (RNAi) into the High School Classroom

    ERIC Educational Resources Information Center

    Sengupta, Sibani

    2013-01-01

    RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

  18. Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

    PubMed Central

    Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

    2015-01-01

    Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

  19. Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

    PubMed

    Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

    2015-05-14

    Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

  20. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    NASA Astrophysics Data System (ADS)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers. Electronic supplementary information (ESI) available: Non-fusogenic liposomes; cytotoxicity of naked siRNA and the empty vector; immunogenicity; low-magnification images; DOPE/DPPC liposomes. See DOI: 10.1039/c5nr04807a

  1. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors.

    PubMed

    Kutner, Robert H; Zhang, Xian-Yang; Reiser, Jakob

    2009-01-01

    Over the past decade, lentiviral vectors have emerged as powerful tools for transgene delivery. The use of lentiviral vectors has become commonplace and applications in the fields of neuroscience, hematology, developmental biology, stem cell biology and transgenesis are rapidly emerging. Also, lentiviral vectors are at present being explored in the context of human clinical trials. Here we describe improved protocols to generate highly concentrated lentiviral vector pseudotypes involving different envelope glycoproteins. In this protocol, vector stocks are prepared by transient transfection using standard cell culture media or serum-free media. Such stocks are then concentrated by ultracentrifugation and/or ion exchange chromatography, or by precipitation using polyethylene glycol 6000, resulting in vector titers of up to 10(10) transducing units per milliliter and above. We also provide reliable real-time PCR protocols to titrate lentiviral vectors based on proviral DNA copies present in genomic DNA extracted from transduced cells or on vector RNA. These production/concentration methods result in high-titer vector preparations that show reduced toxicity compared with lentiviral vectors produced using standard protocols involving ultracentrifugation-based methods. The vector production and titration protocol described here can be completed within 8 d.

  2. Possible superconductivity in Sr2IrO4 probed by quasiparticle interference

    PubMed Central

    Gao, Yi; Zhou, Tao; Huang, Huaixiang; Wang, Qiang-Hua

    2015-01-01

    Based on the possible superconducting (SC) pairing symmetries recently proposed, the quasiparticle interference (QPI) patterns in electron- and hole-doped Sr2IrO4 are theoretically investigated. In the electron-doped case, the QPI spectra can be explained based on a model similar to the octet model of the cuprates while in the hole-doped case, both the Fermi surface topology and the sign of the SC order parameter resemble those of the iron pnictides and there exists a QPI vector resulting from the interpocket scattering between the electron and hole pockets. In both cases, the evolution of the QPI vectors with energy and their behaviors in the nonmagnetic and magnetic impurity scattering cases can well be explained based on the evolution of the constant-energy contours and the sign structure of the SC order parameter. The QPI spectra presented in this paper can be compared with future scanning tunneling microscopy experiments to test whether there are SC phases in electron- and hole-doped Sr2IrO4 and what the pairing symmetry is. PMID:25783417

  3. Summary of bi-shRNA/GM-CSF augmented autologous tumor cell immunotherapy (FANG™) in advanced cancer of the liver.

    PubMed

    Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil

    2014-01-01

    Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.

  4. Silencing of Endogenous IL-10 in Human Dendritic Cells Leads to the Generation of an Improved CTL Response Against Human Melanoma Associated Antigenic Epitope, MART-127−35

    PubMed Central

    Chhabra, Arvind; Chakraborty, Nityo G.; Mukherji, Bijay

    2008-01-01

    Dendritic cells (DC) present antigenic epitopes to and activate T cells. They also polarize the ensuing T cell response to Th1 or Th2 type response, depending on their cytokine production profile. For example, IL-12 producing DC generate Th1 type T cell response whereas IL-10 producing DC is usually tolerogenic. Different strategies -- such as the use of cytokines and anti-cytokine antibodies, dominant negative forms of protein, anti-sense RNA etc. -- have been employed to influence the cytokine synthetic profile of DC as well as to make DC more immunogenic. Utilizing GFP expressing recombinant adenoviruses in association with lipid-mediated transfection of siRNA, we have silenced the endogenous IL-10 gene in DC. We show that IL-10 gene silenced DC produce more IL-12 and also generates a better cytolytic T cell response against the human melanoma associated epitope, MART-127−35, in-vitro. We also show that the GFP expressing adenoviral vector can be used to optimize the parameters for siRNA delivery in primary cells and show that RNA interference methodology can efficiently knock-down virus encoded genes transcribed at very high multiplicity of infection in DC. PMID:18249038

  5. RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-01

    Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

  6. Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

    PubMed

    Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

    2017-01-01

    Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

  7. Development of recombinant adeno-associated virus vectors carrying small interfering RNA (shHec1)-mediated depletion of kinetochore Hec1 protein in tumor cells.

    PubMed

    Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M

    2007-05-01

    Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.

  8. RNA Interference Therapies for an HIV-1 Functional Cure.

    PubMed

    Scarborough, Robert J; Gatignol, Anne

    2017-12-27

    HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

  9. Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

    PubMed

    Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

    2018-05-01

    Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

  10. Proteomics for understanding miRNA biology

    PubMed Central

    Huang, Tai-Chung; Pinto, Sneha M.; Pandey, Akhilesh

    2013-01-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. PMID:23125164

  11. RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

    PubMed

    Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

    2018-06-12

    Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

  12. Non-invasive delivery of dsGST is lethal to the sweet potato whitefly, Bemisia tabaci (G.) (Hemiptera: Aleyrodidae).

    PubMed

    Asokan, R; Rebijith, K B; Roopa, H K; Kumar, N K Krishna

    2015-02-01

    The sweet potato whitefly, Bemisia tabaci (G.) biotype B (Hemiptera: Aleyrodidae), is one of the most economically important pest, by being a dreaded vector of Geminiviruses, and also causes direct damage to the crops by sucking phloem sap. Glutathione S-transferase (GST) is a large family of multifunctional enzymes that play pivotal roles in the detoxification of secondary allelochemical produced by the host plants and in insecticide resistance, thus regulates insect growth and development. The objective of this study is to show the potential of RNA interference (RNAi) in the management of B. tabaci. RNAi is a sequence-specific gene silencing mechanism induced by double-stranded RNA (dsRNA) which holds tremendous potential in pest management. In this regard, we sequenced the GST from B. tabaci and synthesized approximately 500-bp dsRNA from the above and delivered through diet to B. tabaci. Real-time quantitative PCR (RT-qPCR) showed that continuous application of dsGST at 1.0, 0.5, and 0.25 μg/μl reduced mRNA expression levels for BtGST by 77.43, 64.86, and 52.95 % which resulted in mortality by 77, 59, and 40 %, respectively, after 72 h of application. Disruption of BtGST expression will enable the development of novel strategies in pest management and functional analysis of vital genes in B. tabaci.

  13. Generation of siRNA Nanosheets for Efficient RNA Interference

    NASA Astrophysics Data System (ADS)

    Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

    2016-04-01

    After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

  14. A quantitative framework for the forward design of synthetic miRNA circuits.

    PubMed

    Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D

    2014-11-01

    Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.

  15. Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

    EPA Science Inventory

    The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

  16. The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

    PubMed Central

    Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

    2004-01-01

    Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

  17. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

    PubMed Central

    Cooper, Lauren A.; Stringer, Anne M.

    2018-01-01

    ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

  18. Rootstock-to-scion transfer of transgene-derived small interfering RNAs and their effect on virus resistance in nontransgenic sweet cherry.

    PubMed

    Zhao, Dongyan; Song, Guo-qing

    2014-12-01

    Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound

    PubMed Central

    McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.

    2016-01-01

    RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848

  20. Short hairpin RNA interference therapy for ischemic heart disease.

    PubMed

    Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C

    2008-09-30

    During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future.

  1. Short hairpin RNA interference therapy for ischemic heart disease

    PubMed Central

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future. PMID:18824759

  2. A novel dendritic nanocarrier of polyamidoamine-polyethylene glycol-cyclic RGD for “smart” small interfering RNA delivery and in vitro antitumor effects by human ether-à-go-go-related gene silencing in anaplastic thyroid carcinoma cells

    PubMed Central

    Li, Guanhua; Hu, Zuojun; Yin, Henghui; Zhang, Yunjian; Huang, Xueling; Wang, Shenming; Li, Wen

    2013-01-01

    The application of RNA interference techniques is promising in gene therapeutic approaches, especially for cancers. To improve safety and efficiency of small interfering RNA (siRNA) delivery, a triblock dendritic nanocarrier, polyamidoamine-polyethylene glycol-cyclic RGD (PAMAM-PEG-cRGD), was developed and studied as an siRNA vector targeting the human ether-à-go-go-related gene (hERG) in human anaplastic thyroid carcinoma cells. Structure characterization, particle size, zeta potential, and gel retardation assay confirmed that complete triblock components were successfully synthesized with effective binding capacity of siRNA in this triblock nanocarrier. Cytotoxicity data indicated that conjugation of PEG significantly alleviated cytotoxicity when compared with unmodified PAMAM. PAMAM-PEG-cRGD exerted potent siRNA cellular internalization in which transfection efficiency measured by flow cytometry was up to 68% when the charge ratio (N/P ratio) was 3.5. Ligand-receptor affinity together with electrostatic interaction should be involved in the nano-siRNA endocytosis mechanism and we then proved that attachment of cRGD enhanced cellular uptake via RGD-integrin recognition. Gene silencing was evaluated by reverse transcription polymerase chain reaction and PAMAM-PEG-cRGD-siRNA complex downregulated the expression of hERG to 26.3% of the control value. Furthermore, gene knockdown of hERG elicited growth suppression as well as activated apoptosis by means of abolishing vascular endothelial growth factor secretion and triggering caspase-3 cascade in anaplastic thyroid carcinoma cells. Our study demonstrates that this novel triblock polymer, PAMAM-PEG-cRGD, exhibits negligible cytotoxicity, effective transfection, “smart” cancer targeting, and therefore is a promising siRNA nanocarrier. PMID:23569377

  3. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    PubMed

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  4. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  5. Development of leafhopper cell culture to trace the early infection process of a nucleorhabdovirus, rice yellow stunt virus, in insect vector cells.

    PubMed

    Wang, Haitao; Wang, Juan; Xie, Yunjie; Fu, Zhijun; Wei, Taiyun; Zhang, Xiao-Feng

    2018-04-20

    In China, the rice pathogen Rice yellow stunt virus (RYSV), a member of the genus Nucleorhabdovirus in the family Rhabdoviridae, was a severe threat to rice production during the1960s and1970s. Fundamental aspects of the biology of this virus such as protein localization and formation of the RYSV viroplasm during infection of insect vector cells are largely unexplored. The specific role(s) of the structural proteins nucleoprotein (N) and phosphoprotein (P) in the assembly of the viroplasm during RYSV infection in insect vector is also unclear. In present study, we used continuous leafhopper cell culture, immunocytochemical techniques, and transmission electron microscopy to investigate the subcellular distributions of N and P during RYSV infection. Both GST pull-down assay and yeast two-hybrid assay were used to assess the in vitro interaction of N and P. The dsRNA interference assay was performed to study the functional roles of N and P in the assembly of RYSV viroplasm. Here we demonstrated that N and P colocalized in the nucleus of RYSV-infected Nephotettix cincticeps cell and formed viroplasm-like structures (VpLSs). The transiently expressed N and P are sufficient to form VpLSs in the Sf9 cells. In addition, the interactions of N/P, N/N and P/P were confirmed in vitro. More interestingly, the accumulation of RYSV was significantly reduced when the transcription of N gene or P gene was knocked down by dsRNA treatment. In summary, our results suggest that N and P are the main viral factors responsible for the formation of viroplasm in RYSV-infected insect cells. Early during RYSV infection in the insect vector, N and P interacted with each other in the nucleus to form viroplasm-like structures, which are essential for the infection of RYSV.

  6. Induced antiviral innate immunity in Drosophila.

    PubMed

    Lamiable, Olivier; Imler, Jean-Luc

    2014-08-01

    Immunity to viral infections in the model organism Drosophila melanogaster involves both RNA interference and additional induced responses. The latter include not only cellular mechanisms such as programmed cell death and autophagy, but also the induction of a large set of genes, some of which contribute to the control of viral replication and resistance to infection. This induced response to infection is complex and involves both virus-specific and cell-type specific mechanisms. We review here recent developments, from the sensing of viral infection to the induction of signaling pathways and production of antiviral effector molecules. Our current understanding, although still partial, validates the Drosophila model of antiviral induced immunity for insect pests and disease vectors, as well as for mammals. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Efficacy of a Novel Class of RNA Interference Therapeutic Agents

    PubMed Central

    Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

    2012-01-01

    RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

  8. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  9. Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

    PubMed Central

    Dang, Que; Hu, Wei-Shau

    2001-01-01

    Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

  10. RNA interference: ready to silence cancer?

    PubMed

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  11. RNA targeting with CRISPR-Cas13.

    PubMed

    Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng

    2017-10-12

    RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.

  12. Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-04

    The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

  13. Larval application of sodium channel homologous dsRNA restores pyrethroid insecticide susceptibility in a resistant adult mosquito population.

    PubMed

    Bona, Ana Caroline Dalla; Chitolina, Rodrigo Faitta; Fermino, Marise Lopes; de Castro Poncio, Lisiane; Weiss, Avital; Lima, José Bento Pereira; Paldi, Nitzan; Bernardes, Emerson Soares; Henen, Jonathan; Maori, Eyal

    2016-07-14

    Mosquitoes host and pass on to humans a variety of disease-causing pathogens such as infectious viruses and other parasitic microorganisms. The emergence and spread of insecticide resistance is threatening the effectiveness of current control measures for common mosquito vector borne diseases, such as malaria, dengue and Zika. Therefore, the emerging resistance to the widely used pyrethroid insecticides is an alarming problem for public health. Herein we demonstrated the use of RNA interference (RNAi) to increase susceptibility of adult mosquitoes to a widely used pyrethroid insecticide. Experiments were performed on a field-collected pyrethroid resistant strain of Ae. aegypti (Rio de Janeiro; RJ). Larvae from the resistant Ae. aegypti population were soaked with double-stranded RNAs (dsRNAs) that correspond either to voltage-gate sodium channel (VGSC), P-glycoprotein, or P450 detoxification genes and reared to adulthood. Adult mortality rates in the presence of various Deltamethrin pyrethroid concentrations were used to assess mosquito insecticide susceptibility. We characterized the RJ Ae. aegypti strain with regard to its level of resistance to a pyrethroid insecticide and found that it was approximately 6 times more resistant to Deltamethrin compared to the laboratory Rockefeller strain. The RJ strain displayed a higher frequency of Val1016Ile and Phe1534Cys substitutions of the VGSC gene. The resistant strain also displayed a higher basal expression level of VGSC compared to the Rockefeller strain. When dsRNA-treated mosquitoes were subjected to a standard pyrethroid contact bioassay, only dsRNA targeting VGSC increased the adult mortality of the pyrethroid resistant strain. The dsRNA treatment proved effective in increasing adult mosquito susceptibility over a range of pyrethroid concentrations and these results were associated with dsRNA-specific small interfering RNAs in treated adults, and the corresponding specific down regulation of VGSC gene expression level. Finally, we demonstrated that the efficiency of our approach was further improved by 'tiling' along the VGSC gene in order to identify the most potent dsRNA sequences. These results demonstrate that dsRNA applied to mosquito larvae retains its biological activity into adulthood. Thus, the RNAi system reported here could be a useful approach to control the widespread insecticide resistance in mosquitoes and other insect vectors of human diseases.

  14. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

    PubMed Central

    Marraffini, Luciano A.; Sontheimer, Erik J.

    2010-01-01

    Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

  15. User's guide to PANCOR: A panel method program for interference assessment in slotted-wall wind tunnels

    NASA Technical Reports Server (NTRS)

    Kemp, William B., Jr.

    1990-01-01

    Guidelines are presented for use of the computer program PANCOR to assess the interference due to tunnel walls and model support in a slotted wind tunnel test section at subsonic speeds. Input data requirements are described in detail and program output and general program usage are described. The program is written for effective automatic vectorization on a CDC CYBER 200 class vector processing system.

  16. Adenovirus Delivered Short Hairpin RNA Targeting a Conserved Site in the 5′ Non-Translated Region Inhibits All Four Serotypes of Dengue Viruses

    PubMed Central

    Korrapati, Anil Babu; Swaminathan, Gokul; Singh, Aarti; Khanna, Navin; Swaminathan, Sathyamangalam

    2012-01-01

    Background Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs). This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi) to attenuate DENV replication may offer one approach to dengue therapy. Methodology/Principal Findings We screened the non-translated regions (NTRs) of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5′ NTR that maps to the 5′ upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5) vector to deliver a short-hairpin RNA (shRNA) targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. Conclusion/Significance The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection. PMID:22848770

  17. Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

    PubMed

    Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

    2018-01-01

    Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

  18. Cell-penetrating cationic siRNA and lipophilic derivatives efficient at nanomolar concentrations in the presence of serum and albumin.

    PubMed

    Perche, Phanélie; Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Kotera, Mitsuharu; Remy, Jean-Serge

    2013-08-28

    Despite its considerable interest in human therapy, in vivo siRNA delivery is still suffering from hurdles of vectorization. We have shown recently efficient gene silencing by non-vectorized cationic siRNA. Here, we describe the synthesis and in vitro evaluation of new amphiphilic cationic siRNA. C₁₂-, (C₁₂)₂- and cholesteryl-spermine(x)-siRNA were capable of luciferase knockdown at nanomolar concentrations without vectorization (i.e. one to two orders of magnitude more potent than commercially available cholesteryl siRNA). Moreover, incubation in the presence of serum did not impair their efficiency. Finally, amphiphilic cationic siRNA was pre-loaded on albumin. In A549Luc cells in the presence of serum, these siRNA conjugates were highly effective and had low toxicity. Copyright © 2013. Published by Elsevier B.V.

  19. Analysis of the resistance-breaking ability of different beet necrotic yellow vein virus isolates loaded into a single Polymyxa betae population in soil.

    PubMed

    Bornemann, Kathrin; Varrelmann, Mark

    2011-06-01

    The genome of most Beet necrotic yellow vein virus (BNYVV) isolates is comprised of four RNAs. The ability of certain isolates to overcome Rz1-mediated resistance in sugar beet grown in the United States and Europe is associated with point mutations in the pathogenicity factor P25. When the virus is inoculated mechanically into sugar beet roots at high density, the ability depends on an alanine to valine substitution at P25 position 67. Increased aggressiveness is shown by BNYVV P type isolates, which carry an additional RNA species that encodes a second pathogenicity factor, P26. Direct comparison of aggressive isolates transmitted by the vector, Polymyxa betae, has been impossible due to varying population densities of the vector and other soilborne pathogens that interfere with BNYVV infection. Mechanical root inoculation and subsequent cultivation in soil that carried a virus-free P. betae population was used to load P. betae with three BNYVV isolates: a European A type isolate, an American A type isolate, and a P type isolate. Resistance tests demonstrated that changes in viral aggressiveness towards Rz1 cultivars were independent of the vector population. This method can be applied to the study of the synergism of BNYVV with other P. betae-transmitted viruses.

  20. The fourfold way of the genetic code.

    PubMed

    Jiménez-Montaño, Miguel Angel

    2009-11-01

    We describe a compact representation of the genetic code that factorizes the table in quartets. It represents a "least grammar" for the genetic language. It is justified by the Klein-4 group structure of RNA bases and codon doublets. The matrix of the outer product between the column-vector of bases and the corresponding row-vector V(T)=(C G U A), considered as signal vectors, has a block structure consisting of the four cosets of the KxK group of base transformations acting on doublet AA. This matrix, translated into weak/strong (W/S) and purine/pyrimidine (R/Y) nucleotide classes, leads to a code table with mixed and unmixed families in separate regions. A basic difference between them is the non-commuting (R/Y) doublets: AC/CA, GU/UG. We describe the degeneracy in the canonical code and the systematic changes in deviant codes in terms of the divisors of 24, employing modulo multiplication groups. We illustrate binary sub-codes characterizing mutations in the quartets. We introduce a decision-tree to predict the mode of tRNA recognition corresponding to each codon, and compare our result with related findings by Jestin and Soulé [Jestin, J.-L., Soulé, C., 2007. Symmetries by base substitutions in the genetic code predict 2' or 3' aminoacylation of tRNAs. J. Theor. Biol. 247, 391-394], and the rearrangements of the table by Delarue [Delarue, M., 2007. An asymmetric underlying rule in the assignment of codons: possible clue to a quick early evolution of the genetic code via successive binary choices. RNA 13, 161-169] and Rodin and Rodin [Rodin, S.N., Rodin, A.S., 2008. On the origin of the genetic code: signatures of its primordial complementarity in tRNAs and aminoacyl-tRNA synthetases. Heredity 100, 341-355], respectively.

  1. RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells.

    PubMed

    Burgess, Kyle A; Workman, Victoria L; Elsawy, Mohamed A; Miller, Aline F; Oceandy, Delvac; Saiani, Alberto

    2018-01-01

    Self-assembling peptide hydrogels offer a novel 3-dimensional platform for many applications in cell culture and tissue engineering but are not compatible with current methods of RNA isolation; owing to interactions between RNA and the biomaterial. This study investigates the use of two techniques based on two different basic extraction principles: solution-based extraction and direct solid-state binding of RNA respectively, to extract RNA from cells encapsulated in four β-sheet forming self-assembling peptide hydrogels with varying net positive charge. RNA-peptide fibril interactions, rather than RNA-peptide molecular complexing, were found to interfere with the extraction process resulting in low yields. A column-based approach relying on RNA-specific binding was shown to be more suited to extracting RNA with higher purity from these peptide hydrogels owing to its reliance on strong specific RNA binding interactions which compete directly with RNA-peptide fibril interactions. In order to reduce the amount of fibrils present and improve RNA yields a broad spectrum enzyme solution-pronase-was used to partially digest the hydrogels before RNA extraction. This pre-treatment was shown to significantly increase the yield of RNA extracted, allowing downstream RT-qPCR to be performed.

  2. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    PubMed

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  4. Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

    PubMed Central

    Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

    2012-01-01

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

  5. How resonance-continuum interference changes 750 GeV diphoton excess: Signal enhancement and peak shift

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jung, Sunghoon; Song, Jeonghyeon; Yoon, Yeo Woong

    2016-05-02

    A hypothetical new scalar resonance, a candidate explanation for the recently observed 750 GeV diphoton excess at the LHC 13 TeV, necessarily interferes with the continuum background gg → γγ. The interference has two considerable effects: (1) enhancing or suppressing diphoton signal rate due to the imaginary-part interference and (2) distorting resonance shape due to the real-part interference. We study them based on the best-fit analysis of two benchmark models: two Higgs doublets with ~50 GeV width (exhibiting the imaginary-part interference effect) and a singlet scalar with 5 GeV width (exhibiting the real-part one), both extended with vector-like fermions. Furthermore,more » we find that the resonance contribution can be enhanced by a factor of 2 (1.6) for 3 (6) fb signal rate, or the 68% CL allowed mass region is shifted by O (1) GeV. If the best-fit excess rate decreases in the future data, the interference effects will become more significant.« less

  6. A galactose-functionalized dendritic siRNA-nanovector to potentiate hepatitis C inhibition in liver cells

    NASA Astrophysics Data System (ADS)

    Lakshminarayanan, Abirami; Reddy, B. Uma; Raghav, Nallani; Ravi, Vijay Kumar; Kumar, Anuj; Maiti, Prabal K.; Sood, A. K.; Jayaraman, N.; Das, Saumitra

    2015-10-01

    A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector.A RNAi based antiviral strategy holds the promise to impede hepatitis C viral (HCV) infection overcoming the problem of emergence of drug resistant variants, usually encountered in the interferon free direct-acting antiviral therapy. Targeted delivery of siRNA helps minimize adverse `off-target' effects and maximize the efficacy of therapeutic response. Herein, we report the delivery of siRNA against the conserved 5'-untranslated region (UTR) of HCV RNA using a liver-targeted dendritic nano-vector functionalized with a galactopyranoside ligand (DG). Physico-chemical characterization revealed finer details of complexation of DG with siRNA, whereas molecular dynamic simulations demonstrated sugar moieties projecting ``out'' in the complex. Preferential delivery of siRNA to the liver was achieved through a highly specific ligand-receptor interaction between dendritic galactose and the asialoglycoprotein receptor. The siRNA-DG complex exhibited perinuclear localization in liver cells and co-localization with viral proteins. The histopathological studies showed the systemic tolerance and biocompatibility of DG. Further, whole body imaging and immunohistochemistry studies confirmed the preferential delivery of the nucleic acid to mice liver. Significant decrease in HCV RNA levels (up to 75%) was achieved in HCV subgenomic replicon and full length HCV-JFH1 infectious cell culture systems. The multidisciplinary approach provides the `proof of concept' for restricted delivery of therapeutic siRNAs using a target oriented dendritic nano-vector. Electronic supplementary information (ESI) available: Spectral data and experimental details. See DOI: 10.1039/c5nr02898a

  7. A surface transporter family conveys the trypanosome differentiation signal.

    PubMed

    Dean, Samuel; Marchetti, Rosa; Kirk, Kiaran; Matthews, Keith R

    2009-05-14

    Microbial pathogens use environmental cues to trigger the developmental events needed to infect mammalian hosts or transmit to disease vectors. The parasites causing African sleeping sickness respond to citrate or cis-aconitate (CCA) to initiate life-cycle development when transmitted to their tsetse fly vector. This requires hypersensitization of the parasites to CCA by exposure to low temperature, conditions encountered after tsetse fly feeding at dusk or dawn. Here we identify a carboxylate-transporter family, PAD (proteins associated with differentiation), required for perception of this differentiation signal. Consistent with predictions for the response of trypanosomes to CCA, PAD proteins are expressed on the surface of the transmission-competent 'stumpy-form' parasites in the bloodstream, and at least one member is thermoregulated, showing elevated expression and surface access at low temperature. Moreover, RNA-interference-mediated ablation of PAD expression diminishes CCA-induced differentiation and eliminates CCA hypersensitivity under cold-shock conditions. As well as being molecular transducers of the differentiation signal in these parasites, PAD proteins provide the first example of a surface marker able to discriminate the transmission stage of trypanosomes in their mammalian host.

  8. Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

    PubMed

    Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

    2018-06-21

    Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

  9. Improving Small Interfering RNA Delivery In Vivo Through Lipid Conjugation.

    PubMed

    Osborn, Maire F; Khvorova, Anastasia

    2018-05-10

    RNA interference (RNAi)-based therapeutics are approaching clinical approval for genetically defined diseases. Current clinical success is a result of significant innovations in the development of chemical architectures that support sustained, multi-month efficacy in vivo following a single administration. Conjugate-mediated delivery has established itself as the most promising platform for safe and targeted small interfering RNA (siRNA) delivery. Lipophilic conjugates represent a major class of modifications that improve siRNA pharmacokinetics and enable efficacy in a broad range of tissues. Here, we review current literature and define key features and limitations of this approach for in vivo modulation of gene expression.

  10. Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

    PubMed

    Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

    2015-01-01

    Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

  11. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

    PubMed Central

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

  12. Retrovirus-based vectors for transient and permanent cell modification.

    PubMed

    Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

    2015-10-01

    Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Extraction of Total Nucleic Acids From Ticks for the Detection of Bacterial and Viral Pathogens

    PubMed Central

    Crowder, Chris D.; Rounds, Megan A.; Phillipson, Curtis A.; Picuri, John M.; Matthews, Heather E.; Halverson, Justina; Schutzer, Steven E.; Ecker, David J.; Eshoo, Mark W.

    2010-01-01

    Ticks harbor numerous bacterial, protozoal, and viral pathogens that can cause serious infections in humans and domestic animals. Active surveillance of the tick vector can provide insight into the frequency and distribution of important pathogens in the environment. Nucleic-acid based detection of tick-borne bacterial, protozoan, and viral pathogens requires the extraction of both DNA and RNA (total nucleic acids) from ticks. Traditional methods for nucleic acid extraction are limited to extraction of either DNA or the RNA from a sample. Here we present a simple bead-beating based protocol for extraction of DNA and RNA from a single tick and show detection of Borrelia burgdorferi and Powassan virus from individual, infected Ixodes scapularis ticks. We determined expected yields for total nucleic acids by this protocol for a variety of adult tick species. The method is applicable to a variety of arthropod vectors, including fleas and mosquitoes, and was partially automated on a liquid handling robot. PMID:20180313

  14. [RNA interference library research progress and its application in cancer research].

    PubMed

    Zhao, Ning; Cai, Li

    2013-02-01

    RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

  15. Characterization of genetic elements required for site-specific integration of Lactobacillus delbrueckii subsp. bulgaricus bacteriophage mv4 and construction of an integration-proficient vector for Lactobacillus plantarum.

    PubMed Central

    Dupont, L; Boizet-Bonhoure, B; Coddeville, M; Auvray, F; Ritzenthaler, P

    1995-01-01

    Temperate phage mv4 integrates its DNA into the chromosome of Lactobacillus delbrueckii subsp. bulgaricus strains via site-specific recombination. Nucleotide sequencing of a 2.2-kb attP-containing phage fragment revealed the presence of four open reading frames. The larger open reading frame, close to the attP site, encoded a 427-amino-acid polypeptide with similarity in its C-terminal domain to site-specific recombinases of the integrase family. Comparison of the sequences of attP, bacterial attachment site attB, and host-phage junctions attL and attR identified a 17-bp common core sequence, where strand exchange occurs during recombination. Analysis of the attB sequence indicated that the core region overlaps the 3' end of a tRNA(Ser) gene. Phage mv4 DNA integration into the tRNA(Ser) gene preserved an intact tRNA(Ser) gene at the attL site. An integration vector based on the mv4 attP site and int gene was constructed. This vector transforms a heterologous host, L. plantarum, through site-specific integration into the tRNA(Ser) gene of the genome and will be useful for development of an efficient integration system for a number of additional bacterial species in which an identical tRNA gene is present. PMID:7836291

  16. [Sendai virus vector: vector development and its application to health care and biotechnology].

    PubMed

    Iida, Akihiro

    2007-06-01

    Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

  17. RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.

    PubMed

    Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu

    2017-04-01

    Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.

  18. Knock down of Whitefly Gut Gene Expression and Mortality by Orally Delivered Gut Gene-Specific dsRNAs.

    PubMed

    Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K

    2017-01-01

    Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can be applied to functional genomics analyses to facilitate, species-specific dsRNA-mediated control of other non-model hemipterans.

  19. A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer.

    PubMed

    Torrent, C; Gabus, C; Darlix, J L

    1994-02-01

    Retroviral genomes consist of two identical RNA molecules associated at their 5' ends by the dimer linkage structure located in the packaging element (Psi or E) necessary for RNA dimerization in vitro and packaging in vivo. In murine leukemia virus (MLV)-derived vectors designed for gene transfer, the Psi + sequence of 600 nucleotides directs the packaging of recombinant RNAs into MLV virions produced by helper cells. By using in vitro RNA dimerization as a screening system, a sequence of rat VL30 RNA located next to the 5' end of the Harvey mouse sarcoma virus genome and as small as 67 nucleotides was found to form stable dimeric RNA. In addition, a purine-rich sequence located at the 5' end of this VL30 RNA seems to be critical for RNA dimerization. When this VL30 element was extended by 107 nucleotides at its 3' end and inserted into an MLV-derived vector lacking MLV Psi +, it directed the efficient encapsidation of recombinant RNAs into MLV virions. Because this VL30 packaging signal is smaller and more efficient in packaging recombinant RNAs than the MLV Psi + and does not contain gag or glyco-gag coding sequences, its use in MLV-derived vectors should render even more unlikely recombinations which could generate replication-competent viruses. Therefore, utilization of the rat VL30 packaging sequence should improve the biological safety of MLV vectors for human gene transfer.

  20. Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

    PubMed Central

    Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

    2015-01-01

    Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

  1. Exploring Fusarium head blight disease control by RNA interference

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

  2. Compositions and Methods for Inhibiting Gene Expressions

    NASA Technical Reports Server (NTRS)

    Williams, Loren D. (Inventor); Hsiao, Chiaolong (Inventor); Fang, Po-Yu (Inventor); Williams, Justin (Inventor)

    2018-01-01

    A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

  3. Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

    PubMed

    Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

    2004-10-27

    Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

  4. Identification of microRNA precursor with the degenerate K-tuple or Kmer strategy.

    PubMed

    Liu, Bin; Fang, Longyun; Wang, Shanyi; Wang, Xiaolong; Li, Hongtao; Chou, Kuo-Chen

    2015-11-21

    The microRNA (miRNA), a small non-coding RNA molecule, plays an important role in transcriptional and post-transcriptional regulation of gene expression. Its abnormal expression, however, has been observed in many cancers and other disease states, implying that the miRNA molecules are also deeply involved in these diseases, particularly in carcinogenesis. Therefore, it is important for both basic research and miRNA-based therapy to discriminate the real pre-miRNAs from the false ones (such as hairpin sequences with similar stem-loops). Most existing methods in this regard were based on the strategy in which RNA samples were formulated by a vector formed by their Kmer components. But the length of Kmers must be very short; otherwise, the vector's dimension would be extremely large, leading to the "high-dimension disaster" or overfitting problem. Inspired by the concept of "degenerate energy levels" in quantum mechanics, we introduced the "degenerate Kmer" (deKmer) to represent RNA samples. By doing so, not only we can accommodate long-range coupling effects but also we can avoid the high-dimension problem. Rigorous jackknife tests and cross-species experiments indicated that our approach is very promising. It has not escaped our notice that the deKmer approach can also be applied to many other areas of computational biology. A user-friendly web-server for the new predictor has been established at http://bioinformatics.hitsz.edu.cn/miRNA-deKmer/, by which users can easily get their desired results. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.

    PubMed

    Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli

    2017-02-01

    RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.

  6. Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

    DOE PAGES

    Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

    2016-10-13

    The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

  7. Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

    The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

  8. [Progress in application of targeting viral vector regulated by microRNA in gene therapy: a review].

    PubMed

    Zhang, Guohai; Wang, Qizhao; Zhang, Jinghong; Xu, Ruian

    2010-06-01

    A safe and effective targeting viral vector is the key factor for successful clinical gene therapy. microRNA, a class of small, single-stranded endogenous RNAs, act as post-transcriptional regulators of gene expression. The discovery of these kind regulatory elements provides a new approach to regulate gene expression more accurately. In this review, we elucidated the principle of microRNA in regulation of targeting viral vector. The applications of microRNA in the fields of elimination contamination from replication competent virus, reduction of transgene-specific immunity, promotion of cancer-targeted gene therapy and development of live attenuated vaccines were also discussed.

  9. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Modeling RNA interference in mammalian cells

    PubMed Central

    2011-01-01

    Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352

  11. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

    PubMed

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

    2013-12-01

    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  12. RNA interference: from biology to drugs and therapeutics.

    PubMed

    Appasani, Krishnarao

    2004-07-01

    RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

  13. Respiratory viral diseases: access to RNA interference therapy

    PubMed Central

    Bitko, Vira; Barik, Sailen

    2008-01-01

    This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

  14. Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations.

    PubMed

    Pfaller, Christian K; Mastorakos, George M; Matchett, William E; Ma, Xiao; Samuel, Charles E; Cattaneo, Roberto

    2015-08-01

    Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and other infectious diseases. The efficacy of MV-based vectors depends on their replication proficiency and immune activation capacity. Here we document that copy-back defective interfering RNAs (DI-RNAs) are generated by recombinant vaccine and wild-type MVs immediately after rescue. The MV C protein interferes with DI-RNA generation and may enhance the processivity of the viral polymerase. We frequently detected clusters of A-to-G or U-to-C transitions and noted that sequences flanking individual mutations contain motifs favoring recognition by the adenosine deaminase acting on RNA-1 (ADAR1). The consistent type of transitions on the DI-RNAs indicates that these are direct substrates for editing by ADAR1. The ADAR1-mediated biased hypermutation events are consistent with the protein kinase R (PKR)-ADAR1 balancing model of innate immunity activation. We show by coinfection that the C-defective phenotype is dominant. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Measles Virus Defective Interfering RNAs Are Generated Frequently and Early in the Absence of C Protein and Can Be Destabilized by Adenosine Deaminase Acting on RNA-1-Like Hypermutations

    PubMed Central

    Pfaller, Christian K.; Mastorakos, George M.; Matchett, William E.; Ma, Xiao; Samuel, Charles E.

    2015-01-01

    ABSTRACT Defective interfering RNAs (DI-RNAs) of the viral genome can form during infections of negative-strand RNA viruses and outgrow full-length viral genomes, thereby modulating the severity and duration of infection. Here we document the frequent de novo generation of copy-back DI-RNAs from independent rescue events both for a vaccine measles virus (vac2) and for a wild-type measles virus (IC323) as early as passage 1 after virus rescue. Moreover, vaccine and wild-type C-protein-deficient (C-protein-knockout [CKO]) measles viruses generated about 10 times more DI-RNAs than parental virus, suggesting that C enhances the processivity of the viral polymerase. We obtained the nucleotide sequences of 65 individual DI-RNAs, identified breakpoints and reinitiation sites, and predicted their structural features. Several DI-RNAs possessed clusters of A-to-G or U-to-C transitions. Sequences flanking these mutation sites were characteristic of those favored by adenosine deaminase acting on RNA-1 (ADAR1), which catalyzes in double-stranded RNA the C-6 deamination of adenosine to produce inosine, which is recognized as guanosine, a process known as A-to-I RNA editing. In individual DI-RNAs the transitions were of the same type and occurred on both sides of the breakpoint. These patterns of mutations suggest that ADAR1 edits unencapsidated DI-RNAs that form double-strand RNA structures. Encapsidated DI-RNAs were incorporated into virus particles, which reduced the infectivity of virus stocks. The CKO phenotype was dominant: DI-RNAs derived from vac2 with a CKO suppressed the replication of vac2, as shown by coinfections of interferon-incompetent lymphatic cells with viruses expressing different fluorescent reporter proteins. In contrast, coinfection with a C-protein-expressing virus did not counteract the suppressive phenotype of DI-RNAs. IMPORTANCE Recombinant measles viruses (MVs) are in clinical trials as cancer therapeutics and as vectored vaccines for HIV-AIDS and other infectious diseases. The efficacy of MV-based vectors depends on their replication proficiency and immune activation capacity. Here we document that copy-back defective interfering RNAs (DI-RNAs) are generated by recombinant vaccine and wild-type MVs immediately after rescue. The MV C protein interferes with DI-RNA generation and may enhance the processivity of the viral polymerase. We frequently detected clusters of A-to-G or U-to-C transitions and noted that sequences flanking individual mutations contain motifs favoring recognition by the adenosine deaminase acting on RNA-1 (ADAR1). The consistent type of transitions on the DI-RNAs indicates that these are direct substrates for editing by ADAR1. The ADAR1-mediated biased hypermutation events are consistent with the protein kinase R (PKR)-ADAR1 balancing model of innate immunity activation. We show by coinfection that the C-defective phenotype is dominant. PMID:25972541

  16. LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

    PubMed

    Shao, Yongfu; Ye, Meng; Li, Qier; Sun, Weiliang; Ye, Guoliang; Zhang, Xinjun; Yang, Yunben; Xiao, Bingxiu; Guo, Junming

    2016-06-21

    Long noncoding RNAs (lncRNAs) play crucial roles in tumorigenesis. However, the mechanisms of most lncRNAs in cancers are largely unknown. Because the RNA component of mitochondrial RNA processing endoribonuclease (RMRP) is one of the dysregulated lncRNAs in gastric cancer, this study explored its molecular mechanisms in carcinogenesis. RMRP levels in 792 tissues, plasma and gastric juices from patients with various stages of gastric tumorigenesis were analyzed by quantitative reverse transcription-polymerase chain reaction. Overexpression and RNA interference were used to manipulate RMRP expression by RMRP expression vector and small interfering RNAs, respectively. Its mechanisms were evaluated by flow cytometry, real-time cell analysis, plate colony formation assays, and xenograft models. RMRP levels in tissue, plasma and gastric juices from patients with gastric cancer were significantly different from those from controls. Its levels were significantly associated with Borrmann type and metastasis. Plasma and gastric juice RMRP had higher sensitivity and specificity than commonly used markers (such as carcinoembryonic antigen and carbohydrate antigen 19-9). Knockdown of RMRP significantly inhibited cell proliferation in vitro and in vivo, whereas overexpression of RMRP promoted cell growth. Acting as a miR-206 sponge, RMRP modulated cell cycle by regulating Cyclin D2 expression. RMRP plays a crucial role in gastric cancer occurrence and can be used as a novel biomarker for gastric cancer.

  17. Proteomics for understanding miRNA biology.

    PubMed

    Huang, Tai-Chung; Pinto, Sneha M; Pandey, Akhilesh

    2013-02-01

    MicroRNAs (miRNAs) are small noncoding RNAs that play important roles in posttranscriptional regulation of gene expression. Mature miRNAs associate with the RNA interference silencing complex to repress mRNA translation and/or degrade mRNA transcripts. Mass spectrometry-based proteomics has enabled identification of several core components of the canonical miRNA processing pathway and their posttranslational modifications which are pivotal in miRNA regulatory mechanisms. The use of quantitative proteomic strategies has also emerged as a key technique for experimental identification of miRNA targets by allowing direct determination of proteins whose levels are altered because of translational suppression. This review focuses on the role of proteomics and labeling strategies to understand miRNA biology. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. 27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

    PubMed

    Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

    2018-06-12

    During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

  19. Incommensurate smectic order at the free surface in the nematic phase of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2)

    NASA Astrophysics Data System (ADS)

    Ocko, B. M.; Pershan, P. S.; Safinya, C. R.; Chiang, L. Y.

    1987-02-01

    We report x-ray reflectivity measurements on the free surface of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2) at the nematic to smectic-A phase transition, TNA=99.9 °C. The free surface in the nematic phase exhibits smecticlike ordering at two q vectors, one which is commensurate with the smectic-A monolayer q vector q2. The other q vector is incommensurate corresponding to ordering at ~0.59q2. The commensurate peak constructively interferes with the air-liquid interface while the incommensurate peak destructively interferes. These results are compared with bulk-phase x-ray scattering measurements.

  20. Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

    PubMed Central

    Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

    2014-01-01

    Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for critical limb ischemia. PMID:24090375

  1. An efficient protocol for the production of tRNA-free recombinant Selenocysteine Synthase (SELA) from Escherichia coli and its biophysical characterization.

    PubMed

    Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique

    2013-03-01

    Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    PubMed

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  3. RNA interference for functional genomics and improvement of cotton (Gossypium species)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  4. Bioengineered Nanoparticles for siRNA delivery

    PubMed Central

    Kozielski, Kristen L.; Tzeng, Stephany Y.; Green, Jordan J.

    2014-01-01

    Short interfering RNA (siRNA) has been an important laboratory tool in the last two decades and has allowed researchers to better understand the functions of non-protein-coding genes through RNA interference (RNAi). Although RNAi holds great promise for this purpose as well as for treatment of many diseases, efforts at using siRNA have been hampered by the difficulty of safely and effectively introducing it into cells of interest, both in vitro and in vivo. To overcome this challenge, many biomaterials and nanoparticles (NPs) have been developed and optimized for siRNA delivery, often taking cues from the DNA delivery field, although different barriers exist for these two types of molecules. In this review, we discuss general properties of biomaterials and nanoparticles that are necessary for effective nucleic acid delivery. We also discuss specific examples of bioengineered materials, including lipid-based NPs, polymeric NPs, inorganic NPs, and RNA-based NPs, which clearly illustrate the problems and successes in siRNA delivery. PMID:23821336

  5. Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes.

    PubMed

    Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

    2017-10-03

    Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes.

  6. Chromosome preference of disease genes and vectorization for the prediction of non-coding disease genes

    PubMed Central

    Peng, Hui; Lan, Chaowang; Liu, Yuansheng; Liu, Tao; Blumenstein, Michael; Li, Jinyan

    2017-01-01

    Disease-related protein-coding genes have been widely studied, but disease-related non-coding genes remain largely unknown. This work introduces a new vector to represent diseases, and applies the newly vectorized data for a positive-unlabeled learning algorithm to predict and rank disease-related long non-coding RNA (lncRNA) genes. This novel vector representation for diseases consists of two sub-vectors, one is composed of 45 elements, characterizing the information entropies of the disease genes distribution over 45 chromosome substructures. This idea is supported by our observation that some substructures (e.g., the chromosome 6 p-arm) are highly preferred by disease-related protein coding genes, while some (e.g., the 21 p-arm) are not favored at all. The second sub-vector is 30-dimensional, characterizing the distribution of disease gene enriched KEGG pathways in comparison with our manually created pathway groups. The second sub-vector complements with the first one to differentiate between various diseases. Our prediction method outperforms the state-of-the-art methods on benchmark datasets for prioritizing disease related lncRNA genes. The method also works well when only the sequence information of an lncRNA gene is known, or even when a given disease has no currently recognized long non-coding genes. PMID:29108274

  7. Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

    PubMed

    Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

    2015-01-01

    We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

  8. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

    PubMed

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  9. RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

    PubMed

    Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

    2018-06-01

    Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Silence of the transcripts: RNA interference in medicine.

    PubMed

    Barik, Sailen

    2005-10-01

    Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

  11. A small and efficient dimerization/packaging signal of rat VL30 RNA and its use in murine leukemia virus-VL30-derived vectors for gene transfer.

    PubMed Central

    Torrent, C; Gabus, C; Darlix, J L

    1994-01-01

    Retroviral genomes consist of two identical RNA molecules associated at their 5' ends by the dimer linkage structure located in the packaging element (Psi or E) necessary for RNA dimerization in vitro and packaging in vivo. In murine leukemia virus (MLV)-derived vectors designed for gene transfer, the Psi + sequence of 600 nucleotides directs the packaging of recombinant RNAs into MLV virions produced by helper cells. By using in vitro RNA dimerization as a screening system, a sequence of rat VL30 RNA located next to the 5' end of the Harvey mouse sarcoma virus genome and as small as 67 nucleotides was found to form stable dimeric RNA. In addition, a purine-rich sequence located at the 5' end of this VL30 RNA seems to be critical for RNA dimerization. When this VL30 element was extended by 107 nucleotides at its 3' end and inserted into an MLV-derived vector lacking MLV Psi +, it directed the efficient encapsidation of recombinant RNAs into MLV virions. Because this VL30 packaging signal is smaller and more efficient in packaging recombinant RNAs than the MLV Psi + and does not contain gag or glyco-gag coding sequences, its use in MLV-derived vectors should render even more unlikely recombinations which could generate replication-competent viruses. Therefore, utilization of the rat VL30 packaging sequence should improve the biological safety of MLV vectors for human gene transfer. Images PMID:8289369

  12. Comprehensive proteome profiling in Aedes albopictus to decipher Wolbachia-arbovirus interference phenomenon.

    PubMed

    Saucereau, Yoann; Valiente Moro, Claire; Dieryckx, Cindy; Dupuy, Jean-William; Tran, Florence-Hélène; Girard, Vincent; Potier, Patrick; Mavingui, Patrick

    2017-08-18

    Aedes albopictus is a vector of arboviruses that cause severe diseases in humans such as Chikungunya, Dengue and Zika fevers. The vector competence of Ae. albopictus varies depending on the mosquito population involved and the virus transmitted. Wolbachia infection status in believed to be among key elements that determine viral transmission efficiency. Little is known about the cellular functions mobilized in Ae. albopictus during co-infection by Wolbachia and a given arbovirus. To decipher this tripartite interaction at the molecular level, we performed a proteome analysis in Ae. albopictus C6/36 cells mono-infected by Wolbachia wAlbB strain or Chikungunya virus (CHIKV), and bi-infected. We first confirmed significant inhibition of CHIKV by Wolbachia. Using two-dimensional gel electrophoresis followed by nano liquid chromatography coupled with tandem mass spectrometry, we identified 600 unique differentially expressed proteins mostly related to glycolysis, translation and protein metabolism. Wolbachia infection had greater impact on cellular functions than CHIKV infection, inducing either up or down-regulation of proteins associated with metabolic processes such as glycolysis and ATP metabolism, or structural glycoproteins and capsid proteins in the case of bi-infection with CHIKV. CHIKV infection inhibited expression of proteins linked with the processes of transcription, translation, lipid storage and miRNA pathways. The results of our proteome profiling have provided new insights into the molecular pathways involved in tripartite Ae. albopictus-Wolbachia-CHIKV interaction and may help defining targets for the better implementation of Wolbachia-based strategies for disease transmission control.

  13. Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells.

    PubMed

    Tay, Felix Chang; Lim, Jia Kai; Zhu, Haibao; Hin, Lau Cia; Wang, Shu

    2015-01-01

    Widely observed dysregulation of microRNAs (miRNAs) in human cancer has led to substantial speculation regarding possible functions of these short, non-coding RNAs in cancer development and manipulation of miRNA expression to treat cancer. To achieve miRNA loss-of-function, miRNA sponge technology has been developed to use plasmid or viral vectors for intracellular expression of tandemly arrayed, bulged miRNA binding sites complementary to a miRNA target to saturate its ability to regulate natural mRNAs. A strong viral promoter can be used in miRNA sponge vectors to generate high-level expression of the competitive inhibitor transcripts for either transient or long-term inhibition of miRNA function. Taking the advantage of sharing a common seed sequence by members of a miRNA family, this technology is especially useful in knocking down the expression of a family of miRNAs, providing a powerful means for simultaneous inhibition of multiple miRNAs of interest with a single inhibitor. Knockdown of overexpressed oncogenic miRNAs with the technology can be a rational therapeutic strategy for cancer, whereas inhibition of tumor-suppressive miRNAs by the sponges will be useful in deciphering functions of miRNAs in oncogenesis. Herein, we discuss the design of miRNA sponge expression vectors and the use of the vectors to gain better understanding of miRNA's roles in cancer biology and as an alternative tool for anticancer gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. PIWIs Go Viral: Arbovirus-Derived piRNAs in Vector Mosquitoes

    PubMed Central

    2016-01-01

    Vector mosquitoes are responsible for transmission of the majority of arthropod-borne (arbo-) viruses. Virus replication in these vectors needs to be sufficiently high to permit efficient virus transfer to vertebrate hosts. The mosquito immune response therefore is a key determinant for arbovirus transmission. Mosquito antiviral immunity is primarily mediated by the small interfering RNA pathway. Besides this well-established antiviral machinery, the PIWI-interacting RNA (piRNA) pathway processes viral RNA into piRNAs. In recent years, significant progress has been made in characterizing the biogenesis and function of these viral piRNAs. In this review, we discuss these developments, identify knowledge gaps, and suggest directions for future research. PMID:28033427

  15. A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

    PubMed Central

    Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

    2017-01-01

    We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

  16. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE PAGES

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

    2017-05-18

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  17. A multi-purpose toolkit to enable advanced genome engineering in plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

    Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

  18. A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

    PubMed Central

    Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

    2013-01-01

    Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

  19. Superconducting Quantum Interference Device Array Based High Frequency Direction Finding on an Airborne Platform

    DTIC Science & Technology

    is performed using the MUSIC algorithm on the signals received on the non-uniform phased array, and the ESPRIT algorithm is used on the signals...received on the non-colocated vector sensor. The simulation results show that the MUSIC algorithm using 2D Bi-SQUIDs is able to differentiate two signals

  20. Artificial MicroRNA-Based Specific Gene Silencing of Grain Hardness Genes in Polyploid Cereals Appeared to Be Not Stable Over Transgenic Plant Generations

    PubMed Central

    Gasparis, Sebastian; Kała, Maciej; Przyborowski, Mateusz; Orczyk, Waclaw; Nadolska-Orczyk, Anna

    2017-01-01

    Gene silencing by RNA interference is a particularly important tool in the study of gene function in polyploid cereal species for which the collections of natural or induced mutants are very limited. Previously we have been testing small interfering RNA-based approach of gene silencing in wheat and triticale. In this research, artificial microRNAs (amiRs) were studied in the same species and the same target genes to compare effectiveness of both gene silencing pathways. amiR cassettes were designed to silence Puroindoline a (Pina) and Puroindoline b (Pinb) hardness genes in wheat and their orthologues Secaloindoline a (Sina) and Secaloindoline b (Sinb) genes in triticale. Each of the two cassettes contained 21 nt microRNA (miR) precursor derived from conserved regions of Pina/Sina or Pinb/Sinb genes, respectively. Transgenic plants were obtained with high efficiency in two cultivars of wheat and one cultivar of triticale after using the Pinb-derived amiR vector for silencing of Pinb or Sinb, respectively. Lack of transgenic plants in wheat or very low transformation efficiency in triticale was observed using the Pina-derived amiR cassette, despite large numbers of embryos attempted. Silencing of Pinb in wheat and Sinb in triticale was highly efficient in the T1 generation. The transcript level of Pinb in wheat was reduced up to 92% and Sinb in triticale was reduced up to 98%. Moreover, intended silencing of Pinb/Sinb with Pinb-derived amiR cassette was highly correlated with simultaneous silencing of Pina/Sina in the same transgenic plants. High downregulation of Pinb/Pina genes in T1 plants of wheat and Sinb/Sina genes in T1 plants of triticale was associated with strong expression of Pinb-derived amiR. Silencing of the target genes correlated with increased grain hardness in both species. Total protein content in the grains of transgenic wheat was significantly lower. Although, the Pinb-derived amiR cassette was stably inherited in the T2 generation of wheat and triticale the silencing effect including strongly decreased expression of silenced genes as well as strong expression of Pinb-derived amiR was not transmitted. Advantages and disadvantages of posttranscriptional silencing of target genes by means of amiR and siRNA-based approaches in polyploid cereals are discussed. PMID:28119710

  1. Small Molecules Targeting the miRNA-Binding Domain of Argonaute 2: From Computer-Aided Molecular Design to RNA Immunoprecipitation.

    PubMed

    Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco

    2017-01-01

    The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.

  2. Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

    PubMed

    Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

    2018-04-30

    Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. A reverse transcriptase-dependent mechanism plays central roles in fundamental biological processes.

    PubMed

    Spadafora, Corrado

    2008-01-01

    This review summarizes emerging evidence that LINE-1 (Long Interspersed Nuclear Elements) -encoded reverse transcriptase (RT) regulates fundamental biological processes. Earlier studies showed that sperm cells can be used as vectors of both exogenous DNA and RNA molecules in sperm-mediated gene transfer assays. During these studies, a sperm endogenous RT activity was identified, which can reverse-transcribe exogenous RNA directly, or DNA molecules through sequential transcription and reverse transcription. Resulting cDNA copies generated in sperm cells can be delivered to embryos at fertilization, further propagated in tissues as low-copy extrachromosomal structures and transmitted to the progeny in a non-mendelian fashion. Being transcriptionally competent, they can induce phenotypic variations in positive tissues. An RT activity is also present in preimplantation embryos, and its inhibition causes developmental arrest in early preimplantation stages, paralleled by an extensive reprogramming of gene expression. In analogy with this, drug-mediated inhibition of RT activity, or RNA interference-mediated silencing of human LINE-1, reduce cell proliferation and induce differentiation in a variety of cancer cell lines. Furthermore, RT inhibition in vivo antagonizes the growth of human tumors in animal models. As a whole, these data implicate a RT-dependent machinery in the genesis of new genetic information in spermatozoa and in normal and pathological developmental processes.

  4. Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

    PubMed Central

    Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

    2013-01-01

    Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

  5. Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

    PubMed

    Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

    2018-04-17

    In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

  6. Fiber-based three-dimensional multi-mode interference device as efficient power divider and vector curvature sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Ziyang; Fiebrandt, Julia; Haynes, Dionne; Sun, Kai; Madhav, Kalaga; Stoll, Andreas; Makan, Kirill; Makan, Vadim; Roth, Martin

    2018-03-01

    Three-dimensional multi-mode interference devices are demonstrated using a single-mode fiber (SMF) center-spliced to a section of polygon-shaped core multimode fiber (MMF). This simple structure can effectively generate well-localized self-focusing spots that match to the layout of a chosen multi-core fiber (MCF) as a launcher device. An optimized hexagon-core MMF can provide efficient coupling from a SMF to a 7-core MCF with an insertion loss of 0.6 dB and a power imbalance of 0.5 dB, while a square-core MMF can form a self-imaging pattern with symmetrically distributed 2 × 2, 3 × 3 or 4 × 4 spots. These spots can be directly received by a two-dimensional detector array. The device can work as a vector curvature sensor by comparing the relative power among the spots with a resolution of ∼0.1° over a 1.8 mm-long MMF.

  7. RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

    USDA-ARS?s Scientific Manuscript database

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

  8. Virus-Based RNA Silencing Agents and Virus-Derived Expression Vectors as Gene Therapy Vehicles.

    PubMed

    Venkataraman, Srividhya; Ahmad, Tauqeer; AbouHaidar, Mounir G; Hefferon, Kathleen L

    2017-01-01

    In consideration of recent developments in understanding the genomics and proteomics of viruses, the use of viral DNA / RNA sequences as well as their gene expression schemes, have found new in-roads towards the prognosis and therapy of diseases. Correspondingly, the sphere of the patenting scenario has expanded significantly. The current review addresses patented inventions concerning the use of virus sequences as gene silencing machineries and inventions concerning the generation and application of viral sequences as expression vectors. Furthermore, this review also discusses the employment of these patents for clinical, agricultural and biotechnological applications. Considering these objectives, the Delphion Research Intellectual Property Network database was searched using keywords such as "gene silencing", "engineered viruses" and "expression vectors" and descriptions of recent patents on the said topics were discussed. Despite several recent advances in the use of viruses as disease therapy vehicles and biotechnological vectors, these developments have yet to be proven effective in practice, in clinical and field trials. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  9. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    PubMed Central

    Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

    2011-01-01

    RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

  10. RNAi revised--target mRNA-dependent enhancement of gene silencing.

    PubMed

    Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias

    2015-12-15

    The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery.

    PubMed

    Gaj, Thomas; Staahl, Brett T; Rodrigues, Gonçalo M C; Limsirichai, Prajit; Ekman, Freja K; Doudna, Jennifer A; Schaffer, David V

    2017-06-20

    Realizing the full potential of genome editing requires the development of efficient and broadly applicable methods for delivering programmable nucleases and donor templates for homology-directed repair (HDR). The RNA-guided Cas9 endonuclease can be introduced into cells as a purified protein in complex with a single guide RNA (sgRNA). Such ribonucleoproteins (RNPs) can facilitate the high-fidelity introduction of single-base substitutions via HDR following co-delivery with a single-stranded DNA oligonucleotide. However, combining RNPs with transgene-containing donor templates for targeted gene addition has proven challenging, which in turn has limited the capabilities of the RNP-mediated genome editing toolbox. Here, we demonstrate that combining RNP delivery with naturally recombinogenic adeno-associated virus (AAV) donor vectors enables site-specific gene insertion by homology-directed genome editing. Compared to conventional plasmid-based expression vectors and donor templates, we show that combining RNP and AAV donor delivery increases the efficiency of gene addition by up to 12-fold, enabling the creation of lineage reporters that can be used to track the conversion of striatal neurons from human fibroblasts in real time. These results thus illustrate the potential for unifying nuclease protein delivery with AAV donor vectors for homology-directed genome editing. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

    PubMed

    Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

    2013-03-05

    A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

  13. Domain motions of Argonaute, the catalytic engine of RNA interference

    PubMed Central

    Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

    2007-01-01

    Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

  14. Domain motions of Argonaute, the catalytic engine of RNA interference.

    PubMed

    Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

    2007-11-30

    The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

  15. Exploiting CRISPR/Cas: Interference Mechanisms and Applications

    PubMed Central

    Richter, Hagen; Randau, Lennart; Plagens, André

    2013-01-01

    The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries. PMID:23857052

  16. Exploiting CRISPR/Cas: interference mechanisms and applications.

    PubMed

    Richter, Hagen; Randau, Lennart; Plagens, André

    2013-07-12

    The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries.

  17. 16D10 siRNAs inhibit root-knot nematode infection in transgenic grape hairy roots

    USDA-ARS?s Scientific Manuscript database

    To develop a biotech-based solution for controlling Root-knot nematodes (RKNs) in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constru...

  18. RNA interference-based therapeutics for inherited long QT syndrome.

    PubMed

    Li, Guoliang; Ma, Shuting; Sun, Chaofeng

    2015-08-01

    Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

  19. RNA interference-based therapeutics for inherited long QT syndrome

    PubMed Central

    LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

    2015-01-01

    Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

  20. A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

    PubMed

    Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

    2017-08-31

    The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

  1. Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

    PubMed

    Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

    2015-10-15

    Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.

    PubMed

    Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon

    2017-05-01

    Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.

  3. Allele-Specific Silencing of Mutant mRNA Rescues Ultrastructural and Arrhythmic Phenotype in Mice Carriers of the R4496C Mutation in the Ryanodine Receptor Gene (RYR2).

    PubMed

    Bongianino, Rossana; Denegri, Marco; Mazzanti, Andrea; Lodola, Francesco; Vollero, Alessandra; Boncompagni, Simona; Fasciano, Silvia; Rizzo, Giulia; Mangione, Damiano; Barbaro, Serena; Di Fonso, Alessia; Napolitano, Carlo; Auricchio, Alberto; Protasi, Feliciano; Priori, Silvia G

    2017-08-18

    Mutations in the cardiac Ryanodine Receptor gene ( RYR2 ) cause dominant catecholaminergic polymorphic ventricular tachycardia (CPVT), a leading cause of sudden death in apparently healthy individuals exposed to emotions or physical exercise. We investigated the efficacy of allele-specific silencing by RNA interference to prevent CPVT phenotypic manifestations in our dominant CPVT mice model carriers of the heterozygous mutation R4496C in RYR2 . We developed an in vitro mRNA and protein-based assays to screen multiple siRNAs for their ability to selectively silence mutant RYR2 -R4496C mRNA over the corresponding wild-type allele. For the most performant of these siRNAs (siRYR2-U10), we evaluated the efficacy of an adeno-associated serotype 9 viral vector (AAV9) expressing miRYR2-U10 in correcting RyR2 (Ryanodine Receptor type 2 protein) function after in vivo delivery by intraperitoneal injection in neonatal and adult RyR2 R4496C/+ (mice heterozygous for the R4496C mutation in the RyR2) heterozygous CPVT mice. Transcriptional analysis showed that after treatment with miRYR2-U10, the ratio between wild-type and mutant RYR2 mRNA was doubled (from 1:1 to 2:1) confirming the ability of miRYR2-U10 to selectively inhibit RYR2 -R4496C mRNA, whereas protein quantification showed that total RyR2 was reduced by 15% in the heart of treated mice. Furthermore, AAV9-miRYR2-U10 effectively (1) reduced isoproterenol-induced delayed afterdepolarizations and triggered activity in infected cells, (2) reduced adrenergically mediated ventricular tachycardia in treated mice, (3) reverted ultrastructural abnormalities of junctional sarcoplasmic reticulum and transverse tubules, and (4) attenuated mitochondrial abnormalities. The study demonstrates that allele-specific silencing with miRYR2-U10 prevents life-threatening arrhythmias in CPVT mice, suggesting that the reduction of mutant RyR2 may be a novel therapeutic approach for CPVT. © 2017 American Heart Association, Inc.

  4. Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection

    PubMed Central

    Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara

    2014-01-01

    Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726

  5. Effect of radiofrequency energy emitted from monopolar "Bovie" instruments on cardiac implantable electronic devices.

    PubMed

    Robinson, Thomas N; Varosy, Paul D; Guillaume, Girard; Dunning, James E; Townsend, Nicole T; Jones, Edward L; Paniccia, Alessandro; Stiegmann, Greg V; Weyer, Christopher; Rozner, Marc A

    2014-09-01

    The monopolar "Bovie" instrument emits radiofrequency energy that can disrupt the function of other implanted electronic devices through a phenomenon termed electromagnetic interference. The purpose of this study was to quantify the electromagnetic interference occurring on cardiac implantable devices (CIEDs) resulting from monopolar instrument use in common, modifiable clinical scenarios. Three anesthetized pigs underwent CIED placement (1 pacemaker and 2 defibrillators). Electromagnetic interference was quantified when changing the monopolar instrument parameters of generator power, generator mode, surgical technique, orientation of active electrode cord, pathway of current vector, and proximity of active electrode to the CIED. Monopolar instrument parameters that decreased the electromagnetic interference occurring on the CIED included decreasing generator power from 60 W to 30 W (p < 0.001), using cut mode rather than coag mode (p < 0.001), using desiccation technique rather than fulguration technique (p < 0.001), orienting the active electrode cord from the feet rather than across the chest wall (p < 0.001), and avoiding the current vector from crossing the CIED system (p < 0.001). Increasing the distance between the active electrode tool and the CIED system decreased electromagnetic interference occurring on the CIED in a dose-response fashion up to a distance of 10 cm (ANOVA, p < 0.001), after which the magnitude of electromagnetic interference remained constant. Electromagnetic interference occurring on CIEDs resulting from monopolar instruments is minimized by decreasing generator power, using cut mode, using desiccation technique, orienting the active electrode cord from the feet, avoiding the current vector for crossing the CIED system, and increasing the distance between the active electrode and the CIED. Surgeons and operating room staff can minimize electromagnetic interference on CIEDs during monopolar instrument use by accounting for these modifiable clinical factors. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  6. Development of an endogenous virus-free line of chickens susceptible to all subgroups of avian leukosis virus.

    PubMed

    Zhang, Huanmin; Bacon, Larry D; Fadly, Aly M

    2008-09-01

    Primary chicken embryo fibroblasts (CEF) from special specific pathogen-free chicken lines are used for detection of contamination of adult or embryonic tissues, meconium, or tissue culture fluids with avian leukosis viruses (ALV). The suitability and efficiency of such tests depend on the susceptibility of CEF to the various subgroups of exogenous as well as endogenous ALV. The ideal CEF for such tests should be not only susceptible to all retroviruses, but also free of endogenous viruses so that such tests are immune to any interference that may occur between the endogenous and the tested (exogenous) viruses. CEF and/or chickens free of endogenous viruses are also desirable for gene transfer studies using retroviral vectors, such as RNA interference (RNAi) experiments and transgenic work. The absence of ev genes in CEF or chickens can empower clean detection of successful RNAi construct delivery or gene transfer. CEF free of ev genes are also essential reagents routinely used in growing and detecting unknown retroviruses in varied viral assays. This report documents the development of a new line of chickens, 0.TVB*S1, that is free of endogenous viruses and susceptible to all subgroups of ALV identified in chickens.

  7. Development of RNAi technology for targeted therapy--a track of siRNA based agents to RNAi therapeutics.

    PubMed

    Zhou, Yinjian; Zhang, Chunling; Liang, Wei

    2014-11-10

    RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Biosafety research for non-target organism risk assessment of RNAi-based GE plants

    PubMed Central

    Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo

    2015-01-01

    RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220

  9. Lipopolysaccharide promotes pulmonary fibrosis in acute respiratory distress syndrome (ARDS) via lincRNA-p21 induced inhibition of Thy-1 expression.

    PubMed

    Zhou, Wen-Qin; Wang, Peng; Shao, Qiu-Ping; Wang, Jian

    2016-08-01

    Acute respiratory distress syndrome (ARDS) is a common clinical disorder characterized by pulmonary edema leading to acute lung damage and arterial hypoxemia. Pulmonary fibrosis is a progressive, fibrotic lung disorder, whose pathogenesis in ARDS remains speculative. LincRNA-p21 was a novel regulator of cell proliferation, apoptosis and DNA damage response. This study aims to investigate the effects and mechanism of lincRNA-p21 on pulmonary fibrosis in ARDS. Purified 10 mg/kg LPS was dropped into airways of C57BL/6 mice. Expression levels of lincRNA-p21 and Thy-1 were measured by real-time PCR or western blotting. Proliferation of lung fibroblasts was analyzed by BrdU incorporation assay. Lung and BAL collagen contents were estimated using colorimetric Sircol assay. LincRNA-p21 expression was time-dependently increased and Thy-1 expression was time-dependently reduced in a mouse model of ARDS and in LPS-treated lung fibroblasts. Meanwhile, lung fibroblast proliferation was also time-dependently elevated in LPS-treated lung fibroblasts. In addition, lung fibroblast proliferation could be promoted by lincRNA-p21 overexpression and LPS treatment, however, the elevated lung fibroblast proliferation was further abrogated by Thy-1 overexpression or lincRNA-p21 interference. And Thy-1 interference could elevate cell viability of lung fibroblasts and rescue the reduction of lung fibroblast proliferation induced by lincRNA-p21 interference. Moreover, lincRNA-p21 overexpression dramatically inhibited acetylation of H3 and H4 at the Thy-1 promoter and Thy-1 expression levels in HLF1 cells. Finally, lincRNA-p21 interference rescued LPS-induced increase of lung and BAL collagen contents. LincRNA-p21 could lead to pulmonary fibrosis in ARDS by inhibition of the expression of Thy-1.

  10. Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

    PubMed Central

    Korde, Asawari; Rosselot, Jessica M.; Donze, David

    2014-01-01

    The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

  11. Reduction of voltage gated sodium channel protein in DRG by vector mediated miRNA reduces pain in rats with painful diabetic neuropathy.

    PubMed

    Chattopadhyay, Munmun; Zhou, Zhigang; Hao, Shuanglin; Mata, Marina; Fink, David J

    2012-03-22

    Painful neuropathy is a common complication of diabetes. Previous studies have identified significant increases in the amount of voltage gated sodium channel isoforms Na(V)1.7 and Na(V)1.3 protein in the dorsal root ganglia (DRG) of rats with streptozotocin (STZ)-induced diabetes. We found that gene transfer-mediated release of the inhibitory neurotransmitters enkephalin or gamma amino butyric acid (GABA) from DRG neurons in diabetic animals reduced pain-related behaviors coincident with a reduction in Na(V)1.7 protein levels in DRG in vivo. To further evaluate the role of Na(V)α subunit levels in DRG in the pathogenesis of pain in diabetic neuropathy, we constructed a non-replicating herpes simplex virus (HSV)-based vector expressing a microRNA (miRNA) against Na(V)α subunits. Subcutaneous inoculation of the miRNA-expressing HSV vector into the feet of diabetic rats to transduce DRG resulted in a reduction in Na(V)α subunit levels in DRG neurons, coincident with a reduction in cold allodynia, thermal hyperalgesia and mechanical hyperalgesia. These data support the role of increased Na(V)α protein in DRG in the pathogenesis of pain in diabetic neuropathy, and provide a proof-of-principle demonstration for the development of a novel therapy that could be used to treat intractable pain in patients with diabetic neuropathy.

  12. A Cellular High-Throughput Screening Approach for Therapeutic trans-Cleaving Ribozymes and RNAi against Arbitrary mRNA Disease Targets

    PubMed Central

    Yau, Edwin H.; Butler, Mark C.; Sullivan, Jack M.

    2016-01-01

    Major bottlenecks in development of therapeutic post transcriptional gene silencing (PTGS) agents (e.g. ribozymes, RNA interference, antisense) include the challenge of mapping rare accessible regions of the mRNA target that are open for annealing and cleavage, testing and optimization of agents in human cells to identify lead agents, testing for cellular toxicity, and preclinical evaluation in appropriate animal models of disease. Methods for rapid and reliable cellular testing of PTGS agents are needed to identify potent lead candidates for optimization. Our goal was to develop a means of rapid assessment of many RNA agents to identify a lead candidate for a given mRNA associated with a disease state. We developed a rapid human cell-based screening platform to test efficacy of hammerhead ribozyme (hhRz) or RNA interference (RNAi) constructs, using a model retinal degeneration target, human rod opsin (RHO) mRNA. The focus is on RNA Drug Discovery for diverse retinal degeneration targets. To validate the approach, candidate hhRzs were tested against NUH↓ cleavage sites (N=G,C,A,U; H=C,A,U) within the target mRNA of secreted alkaline phosphatase (SEAP), a model gene expression reporter, based upon in silico predictions of mRNA accessibility. HhRzs were embedded in a larger stable adenoviral VAI RNA scaffold for high cellular expression, cytoplasmic trafficking, and stability. Most hhRz expression plasmids exerted statistically significant knockdown of extracellular SEAP enzyme activity when readily assayed by a fluorescence enzyme assay intended for high throughput screening (HTS). Kinetics of PTGS knockdown of cellular targets is measureable in live cells with the SEAP reporter. The validated SEAP HTS platform was transposed to identify lead PTGS agents against a model hereditary retinal degeneration target, RHO mRNA. Two approaches were used to physically fuse the model retinal gene target mRNA to the SEAP reporter mRNA. The most expedient way to evaluate a large set of potential VAI-hhRz expression plasmids against diverse NUH↓ cleavage sites uses cultured human HEK293S cells stably expressing a dicistronic Target-IRES-SEAP target fusion mRNA. Broad utility of this rational RNA drug discovery approach is feasible for any ophthalmological disease-relevant mRNA targets and any disease mRNA targets in general. The approach will permit rank ordering of PTGS agents based on potency to identify a lead therapeutic compound for further optimization. PMID:27233447

  13. RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

  14. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    ERIC Educational Resources Information Center

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  15. How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

    ERIC Educational Resources Information Center

    Kuldell, Natalie H.

    2006-01-01

    It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

  16. RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

  17. Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering.

    PubMed

    Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko

    2017-06-01

    Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

  18. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    PubMed

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. A Simple Retroelement Based Knock-Down System in Dictyostelium: Further Insights into RNA Interference Mechanisms.

    PubMed

    Friedrich, Michael; Meier, Doreen; Schuster, Isabelle; Nellen, Wolfgang

    2015-01-01

    We have previously shown that the most abundant Dictyostelium discoideum retroelement DIRS-1 is suppressed by RNAi mechanisms. Here we provide evidence that both inverted terminal repeats have strong promoter activity and that bidirectional expression apparently generates a substrate for Dicer. A cassette containing the inverted terminal repeats and a fragment of a gene of interest was sufficient to activate the RNAi response, resulting in the generation of ~21 nt siRNAs, a reduction of mRNA and protein expression of the respective endogene. Surprisingly, no transitivity was observed on the endogene. This was in contrast to previous observations, where endogenous siRNAs caused spreading on an artificial transgene. Knock-down was successful on seven target genes that we examined. In three cases a phenotypic analysis proved the efficiency of the approach. One of the target genes was apparently essential because no knock-out could be obtained; the RNAi mediated knock-down, however, resulted in a very slow growing culture indicating a still viable reduction of gene expression. ADVANTAGES OF THE DIRS-1–RNAI SYSTEM: The knock-down system required a short DNA fragment (~400 bp) of the target gene as an initial trigger. Further siRNAs were generated by RdRPs since we have shown some siRNAs with a 5'-triphosphate group. Extrachromosomal vectors facilitate the procedure and allowed for molecular and phenotypic analysis within one week. The system provides an efficient and rapid method to reduce protein levels including those of essential genes.

  20. Efficient HIV-1 inhibition by a 16 nt-long RNA aptamer designed by combining in vitro selection and in silico optimisation strategies

    PubMed Central

    Sánchez-Luque, Francisco J.; Stich, Michael; Manrubia, Susanna; Briones, Carlos; Berzal-Herranz, Alfredo

    2014-01-01

    The human immunodeficiency virus type-1 (HIV-1) genome contains multiple, highly conserved structural RNA domains that play key roles in essential viral processes. Interference with the function of these RNA domains either by disrupting their structures or by blocking their interaction with viral or cellular factors may seriously compromise HIV-1 viability. RNA aptamers are amongst the most promising synthetic molecules able to interact with structural domains of viral genomes. However, aptamer shortening up to their minimal active domain is usually necessary for scaling up production, what requires very time-consuming, trial-and-error approaches. Here we report on the in vitro selection of 64 nt-long specific aptamers against the complete 5′-untranslated region of HIV-1 genome, which inhibit more than 75% of HIV-1 production in a human cell line. The analysis of the selected sequences and structures allowed for the identification of a highly conserved 16 nt-long stem-loop motif containing a common 8 nt-long apical loop. Based on this result, an in silico designed 16 nt-long RNA aptamer, termed RNApt16, was synthesized, with sequence 5′-CCCCGGCAAGGAGGGG-3′. The HIV-1 inhibition efficiency of such an aptamer was close to 85%, thus constituting the shortest RNA molecule so far described that efficiently interferes with HIV-1 replication. PMID:25175101

  1. Inhibition of X-linked inhibitor of apoptosis protein enhances anti-tumor potency of pure total flavonoids on the growth of leukemic cells

    PubMed Central

    Wu, Liqiang; Zhang, Xiuxia; Lin, Xiaojie; Wang, Bo; Huang, Chang; Qin, Yao; Lin, Shengyun

    2018-01-01

    Flavonoids, a vast group of polyphenols widely distributed in plants, are known to possess a range of biological activities and potential anti-tumor effects. X-linked inhibitor of apoptosis protein (XIAP) promotes the progression of leukemia by preventing tumor cells undergoing apoptosis. The present study investigated the potential effects and underlying mechanisms of pure total flavonoids from Citrus paradisi Macfad (PTFC) on human U937 cells, and explored the effects of short hairpin (sh)RNA-mediated XIAP knockdown on the anti-cancer effects of PTFC. Western blotting was used to determine level of apoptosis-associated effectors following PTFC treatment. A lentiviral vector of RNA interference of XIAP gene was constructed to downregulate XIAP expression. MTT assay and flow cytometry were used to determine the effects of PTFC separately or combined with XIAP-shRNA on inhibition and apoptosis of U937 cells, respectively. Treatment with PTFC effectively inhibited leukemic cell proliferation in a dose- and time-dependent manner. PTFC induced apoptosis of U937 cells in a dose-dependent manner, at a particular concentration range, by decreasing XIAP expression levels and activating caspases-3, −7 and −9. PTFC treatment combined with XIAP-shRNA additionally demonstrated a marked increase in cell apoptosis, compared with PTFC or XIAP-shRNA alone (P<0.05). Therefore, these findings suggest that PTFC inhibits growth and induces apoptosis in U937 cells in vitro. Furthermore, suppression of XIAP expression enhances these effects. PMID:29434799

  2. Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

    PubMed Central

    Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

    2014-01-01

    In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

  3. Packaging of HCV-RNA into lentiviral vector

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caval, Vincent; Piver, Eric; Service de Biochimie et Biologie Moleculaire, CHRU de Tours

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Description of HCV-RNA Core-D1 interactions. Black-Right-Pointing-Pointer In vivo evaluation of the packaging of HCV genome. Black-Right-Pointing-Pointer Determination of the role of the three basic sub-domains of D1. Black-Right-Pointing-Pointer Heterologous system involving HIV-1 vector particles to mobilise HCV genome. Black-Right-Pointing-Pointer Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein andmore » HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.« less

  4. Transcriptome of the plant virus vector Graminella nigrifrons, and the molecular interactions of maize fine streak rhabdovirus transmission.

    PubMed

    Chen, Yuting; Cassone, Bryan J; Bai, Xiaodong; Redinbaugh, Margaret G; Michel, Andrew P

    2012-01-01

    Leafhoppers (HEmiptera: Cicadellidae) are plant-phloem feeders that are known for their ability to vector plant pathogens. The black-faced leafhopper (Graminella nigrifrons) has been identified as the only known vector for the Maize fine streak virus (MFSV), an emerging plant pathogen in the Rhabdoviridae. Within G. nigrifrons populations, individuals can be experimentally separated into three classes based on their capacity for viral transmission: transmitters, acquirers and non-acquirers. Understanding the molecular interactions between vector and virus can reveal important insights in virus immune defense and vector transmission. RNA sequencing (RNA-Seq) was performed to characterize the transcriptome of G. nigrifrons. A total of 38,240 ESTs of a minimum 100 bp were generated from two separate cDNA libraries consisting of virus transmitters and acquirers. More than 60% of known D. melanogaster, A. gambiae, T. castaneum immune response genes mapped to our G. nigrifrons EST database. Real time quantitative PCR (RT-qPCR) showed significant down-regulation of three genes for peptidoglycan recognition proteins (PGRP - SB1, SD, and LC) in G. nigrifrons transmitters versus control leafhoppers. Our study is the first to characterize the transcriptome of a leafhopper vector species. Significant sequence similarity in immune defense genes existed between G. nigrifrons and other well characterized insects. The down-regulation of PGRPs in MFSV transmitters suggested a possible role in rhabdovirus transmission. The results provide a framework for future studies aimed at elucidating the molecular mechanisms of plant virus vector competence.

  5. Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

    PubMed Central

    Duan, L; Pomerantz, R J

    1994-01-01

    The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

  6. The 3D protein of duck hepatitis A virus type 1 binds to a viral genomic 3' UTR and shows RNA-dependent RNA polymerase activity.

    PubMed

    Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun

    2017-12-01

    To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.

  7. A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

    PubMed

    Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

    2012-04-01

    Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitatedmore » lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.« less

  9. Silver nanoparticles-quercetin conjugation to siRNA against drug-resistant Bacillus subtilis for effective gene silencing: in vitro and in vivo.

    PubMed

    Sun, Dongdong; Zhang, Weiwei; Li, Nuan; Zhao, Zhiwei; Mou, Zhipeng; Yang, Endong; Wang, Weiyun

    2016-06-01

    Quercetin (Qe) exhibited extremely low water solubility, and thus, it was modified using silver nanoparticles (AgNPs). We fabricated AgNPs combined with Qe (AgNPs-Qe). The modification suggested that the synergistic properties of Qe enhanced the antibacterial activity of AgNPs. However, AgNPs-Qe exerted no effect on many kinds of drug-resistant bacteria, including Pseudomonas aeruginosa and Bacillus subtilis. RNA interference has considerable therapeutic potential because of its high specificity and potential capability to evade drug resistance. Therefore, we stabilized AgNPs-Qe with a layer of molecules (siRNA). The newly fabricated nanoparticles exerted improved effect on many kinds of bacteria, including the most prominent drug-resistant species B. subtilis. Agarose gel electrophoresis showed that the highest critical nitrogen-to-phosphorus (N/P) ratio occurred at a vector/siRNA with a w/w ratio of 7:1. Characterization experiment indicated that the diameter of siRNA/AgNPs-Qe was approximately 40 nm (40 ± 10 nm). Moreover, AgNPs-Qe were stabilized with a layer of siRNA that was approximately 10nm thick. Results of the in vitro study suggested that siRNA/AgNPs-Qe could destroy the cell wall and inhibit bacterial propagation. Meanwhile, the in vivo experiment on the animal bacteremia model, as well as the optical imaging of nude mice and their isolated organs, demonstrated that bacteria accumulated in the blood, heart, liver, spleen, lungs, and kidneys after the intravenous injection of B. subtilis. The bacteria in the blood and organs, as well as the inflamed cells in the tissues, gradually decreased after the mice received intravenous tail injection of siRNA/AgNPs-Qe for treatment. Both the in vitro and the in vivo studies exhibit that siRNA/AgNPs-Qe can be a potential nanoscale drug delivery system for B. subtilis targeting bacterimia. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

    PubMed

    Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-04-01

    Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

  11. RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

    PubMed

    Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

    2017-01-01

    Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

  12. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

    PubMed Central

    Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-01-01

    Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

  13. Capsule-Like Safe Genetic Vectors - Cell-Penetrating Core-Shell Particles Selectively Release Functional Small RNA and Entrap its Encoding DNA.

    PubMed

    Yu, Han; Pan, Houwen Matthew; Evalin, Fnu; Trau, Dieter Wilhelm; Patzel, Volker

    2018-06-05

    The breakthrough of genetic therapy is set back by the lack of suitable genetic vector systems. We present the development of permeability-tunable, capsule-like, polymeric, micron-sized, core-shell particles for delivery of recombinant nucleic acids into target cells. These particles were demonstrated to effectively release rod-shaped small hairpin RNA and to selectively retain the RNA-encoding DNA template which was designed to form a bulky tripartite structure. Thus, they can serve as delivery vectors preloaded with cargo RNA or alternatively as RNA producing micro-bioreactors. The internalization of particles by human tissue culture cells inversely correlated with particle size and with the cell to particle ratio, though at a higher than stoichiometric excess of particles over cells, cell viability was impaired. Among primary human peripheral blood mononuclear cells, up to 50% of the monocytes displayed positive uptake of particles. Finally, these particles efficiently delivered siRNA into HEK293T cells triggering functional knockdown of the target gene lamin A/C. Particle-mediated knockdown was superior to that observed after conventional siRNA delivery via lipofection. Core-shell particles protect encapsulated nucleic acids from degradation and target cell genomes from direct contact with recombinant DNA, thus representing a promising delivery vector system that can be explored for genetic therapy and vaccination.

  14. [RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

    PubMed

    Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

    2010-01-01

    RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

  15. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  16. Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier

    PubMed Central

    Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan

    2015-01-01

    Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653

  17. Vertical amplitude phase structure of a low-frequency acoustic field in shallow water

    NASA Astrophysics Data System (ADS)

    Kuznetsov, G. N.; Lebedev, O. V.; Stepanov, A. N.

    2016-11-01

    We obtain in integral and analytic form the relations for calculating the amplitude and phase characteristics of an interference structure of orthogonal projections of the oscillation velocity vector in shallow water. For different frequencies and receiver depths, we numerically study the source depth dependences of the effective phase velocities of an equivalent plane wave, the orthogonal projections of the sound pressure phase gradient, and the projections of the oscillation velocity vector. We establish that at low frequencies in zones of interference maxima, independently of source depth, weakly varying effective phase velocity values are observed, which exceed the sound velocity in water by 5-12%. We show that the angles of arrival of the equivalent plane wave and the oscillation velocity vector in the general case differ; however, they virtually coincide in the zone of the interference maximum of the sound pressure under the condition that the horizontal projections of the oscillation velocity appreciably exceed the value of the vertical projection. We give recommendations on using the sound field characteristics in zones with maximum values for solving rangefinding and signal-detection problems.

  18. Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

    NASA Astrophysics Data System (ADS)

    Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

    2013-12-01

    First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

  19. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    PubMed

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  20. Transgenic strategies to confer resistance against viruses in rice plants

    PubMed Central

    Sasaya, Takahide; Nakazono-Nagaoka, Eiko; Saika, Hiroaki; Aoki, Hideyuki; Hiraguri, Akihiro; Netsu, Osamu; Uehara-Ichiki, Tamaki; Onuki, Masatoshi; Toki, Seichi; Saito, Koji; Yatou, Osamu

    2014-01-01

    Rice (Oryza sativa L.) is cultivated in more than 100 countries and supports nearly half of the world’s population. Developing efficient methods to control rice viruses is thus an urgent necessity because viruses cause serious losses in rice yield. Most rice viruses are transmitted by insect vectors, notably planthoppers and leafhoppers. Viruliferous insect vectors can disperse their viruses over relatively long distances, and eradication of the viruses is very difficult once they become widespread. Exploitation of natural genetic sources of resistance is one of the most effective approaches to protect crops from virus infection; however, only a few naturally occurring rice genes confer resistance against rice viruses. Many investigators are using genetic engineering of rice plants as a potential strategy to control viral diseases. Using viral genes to confer pathogen-derived resistance against crops is a well-established procedure, and the expression of various viral gene products has proved to be effective in preventing or reducing infection by various plant viruses since the 1990s. RNA interference (RNAi), also known as RNA silencing, is one of the most efficient methods to confer resistance against plant viruses on their respective crops. In this article, we review the recent progress, mainly conducted by our research group, in transgenic strategies to confer resistance against tenuiviruses and reoviruses in rice plants. Our findings also illustrate that not all RNAi constructs against viral RNAs are equally effective in preventing virus infection and that it is important to identify the viral “Achilles’ heel” gene to target for RNAi attack when engineering plants. PMID:24454308

  1. Recent Advances in Nanomaterials for Gene Delivery—A Review

    DOE PAGES

    Riley, Michael; Vermerris, Wilfred

    2017-04-28

    With the rapid development of nanotechnology in the recent decade, novel DNA and RNA delivery systems for gene therapy have become available that can be used instead of viral vectors. These non-viral vectors can be made of a variety of materials, including inorganic nanoparticles, carbon nanotubes, liposomes, protein and peptide-based nanoparticles, as well as nanoscale polymeric materials. They have as advantages over viral vectors a decreased immune response, and additionally offer flexibility in design, allowing them to be functionalized and targeted to specific sites in a biological system with low cytotoxicity. The focus of this review is to provide anmore » overview of novel nanotechnology-based methods to deliver DNA and small interfering RNAs into biological systems.« less

  2. Polymers in Small-Interfering RNA Delivery

    PubMed Central

    Singha, Kaushik; Namgung, Ran

    2011-01-01

    This review will cover the current strategies that are being adopted to efficiently deliver small interfering RNA using nonviral vectors, including the use of polymers such as polyethylenimine, poly(lactic-co-glycolic acid), polypeptides, chitosan, cyclodextrin, dendrimers, and polymers-containing different nanoparticles. The article will provide a brief and concise account of underlying principle of these polymeric vectors and their structural and functional modifications which were intended to serve different purposes to affect efficient therapeutic outcome of small-interfering RNA delivery. The modifications of these polymeric vectors will be discussed with reference to stimuli-responsiveness, target specific delivery, and incorporation of nanoconstructs such as carbon nanotubes, gold nanoparticles, and silica nanoparticles. The emergence of small-interfering RNA as the potential therapeutic agent and its mode of action will also be mentioned in a nutshell. PMID:21749290

  3. Mg2+ Effect on Argonaute and RNA Duplex by Molecular Dynamics and Bioinformatics Implications

    PubMed Central

    Nam, Seungyoon; Ryu, Hyojung; Son, Won-joon; Kim, Yon Hui; Kim, Kyung Tae; Balch, Curt; Nephew, Kenneth P.; Lee, Jinhyuk

    2014-01-01

    RNA interference (RNAi), mediated by small non-coding RNAs (e.g., miRNAs, siRNAs), influences diverse cellular functions. Highly complementary miRNA-target RNA (or siRNA-target RNA) duplexes are recognized by an Argonaute family protein (Ago2), and recent observations indicate that the concentration of Mg2+ ions influences miRNA targeting of specific mRNAs, thereby modulating miRNA-mRNA networks. In the present report, we studied the thermodynamic effects of differential [Mg2+] on slicing (RNA silencing cycle) through molecular dynamics simulation analysis, and its subsequent statistical analysis. Those analyses revealed different structural conformations of the RNA duplex in Ago2, depending on Mg2+ concentration. We also demonstrate that cation effects on Ago2 structural flexibility are critical to its catalytic/functional activity, with low [Mg2+] favoring greater Ago2 flexibility (e.g., greater entropy) and less miRNA/mRNA duplex stability, thus favoring slicing. The latter finding was supported by a negative correlation between expression of an Mg2+ influx channel, TRPM7, and one miRNA’s (miR-378) ability to downregulate its mRNA target, TMEM245. These results imply that thermodynamics could be applied to siRNA-based therapeutic strategies, using highly complementary binding targets, because Ago2 is also involved in RNAi slicing by exogenous siRNAs. However, the efficacy of a siRNA-based approach will differ, to some extent, based on the Mg2+ concentration even within the same disease type; therefore, different siRNA-based approaches might be considered for patient-to-patient needs. PMID:25330448

  4. An adenovirus prime/plasmid boost strategy for induction of equipotent immune responses to two dengue virus serotypes.

    PubMed

    Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam

    2007-02-15

    Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.

  5. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    USDA-ARS?s Scientific Manuscript database

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  6. Identifying 5-methylcytosine sites in RNA sequence using composite encoding feature into Chou's PseKNC.

    PubMed

    Sabooh, M Fazli; Iqbal, Nadeem; Khan, Mukhtaj; Khan, Muslim; Maqbool, H F

    2018-05-01

    This study examines accurate and efficient computational method for identification of 5-methylcytosine sites in RNA modification. The occurrence of 5-methylcytosine (m 5 C) plays a vital role in a number of biological processes. For better comprehension of the biological functions and mechanism it is necessary to recognize m 5 C sites in RNA precisely. The laboratory techniques and procedures are available to identify m 5 C sites in RNA, but these procedures require a lot of time and resources. This study develops a new computational method for extracting the features of RNA sequence. In this method, first the RNA sequence is encoded via composite feature vector, then, for the selection of discriminate features, the minimum-redundancy-maximum-relevance algorithm was used. Secondly, the classification method used has been based on a support vector machine by using jackknife cross validation test. The suggested method efficiently identifies m 5 C sites from non- m 5 C sites and the outcome of the suggested algorithm is 93.33% with sensitivity of 90.0 and specificity of 96.66 on bench mark datasets. The result exhibits that proposed algorithm shown significant identification performance compared to the existing computational techniques. This study extends the knowledge about the occurrence sites of RNA modification which paves the way for better comprehension of the biological uses and mechanism. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Using RNA interference to knock down the adhesion protein TES.

    PubMed

    Griffith, Elen

    2007-01-01

    RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

  8. The RNA-induced silencing complex: a versatile gene-silencing machine.

    PubMed

    Pratt, Ashley J; MacRae, Ian J

    2009-07-03

    RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.

  9. Structural insights into RNA processing by the human RISC-loading complex.

    PubMed

    Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

    2009-11-01

    Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

  10. Discovery of novel bacterial RNA polymerase inhibitors: pharmacophore-based virtual screening and hit optimization.

    PubMed

    Hinsberger, Stefan; Hüsecken, Kristina; Groh, Matthias; Negri, Matthias; Haupenthal, Jörg; Hartmann, Rolf W

    2013-11-14

    The bacterial RNA polymerase (RNAP) is a validated target for broad spectrum antibiotics. However, the efficiency of drugs is reduced by resistance. To discover novel RNAP inhibitors, a pharmacophore based on the alignment of described inhibitors was used for virtual screening. In an optimization process of hit compounds, novel derivatives with improved in vitro potency were discovered. Investigations concerning the molecular mechanism of RNAP inhibition reveal that they prevent the protein-protein interaction (PPI) between σ(70) and the RNAP core enzyme. Besides of reducing RNA formation, the inhibitors were shown to interfere with bacterial lipid biosynthesis. The compounds were active against Gram-positive pathogens and revealed significantly lower resistance frequencies compared to clinically used rifampicin.

  11. dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

    PubMed

    Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

    2008-12-26

    Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

  12. Engineering RNA for Targeted siRNA Delivery and Medical Application

    PubMed Central

    Guo, Peixuan; Coban, Oana; Snead, Nick; Trebley, Joe; Hoeprich, Steve; Guo, Songchuan; Shu, Yi

    2010-01-01

    RNA engineering for nanotechnology and medical applications is an exciting emerging research field. RNA has intrinsically defined features on the nanometer scale and is a particularly interesting candidate for such applications due to its amazing diversity, flexibility and versatility in structure and function. Specifically, the current use of siRNA to silence target genes involved in disease has generated much excitement in the scientific community. The intrinsic ability to sequence-specifically down-regulate gene expression in a temporally- and spatially-controlled fashion has led to heightened interest and rapid development of siRNA-based therapeutics. Though methods for gene silencing with high efficacy and specificity have been achieved in vitro, the effective delivery of nucleic acids to specific cells in vivo has been a hurdle for RNA therapeutics. This review covers different RNA-based approaches for diagnosis, prevention and treatment of human disease, with a focus on the latest developments of nonviral carriers of siRNA for delivery in vivo. The applications and challenges of siRNA therapy, as well as potential solutions to these problems, the approaches for using phi29 pRNA-based vectors as polyvalent vehicles for specific delivery of siRNA, ribozymes, drugs or other therapeutic agents to specific cells for therapy will also be addressed. PMID:20230868

  13. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki

    2014-01-01

    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  14. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  15. Flavivirus Infection of Ixodes scapularis (Black-Legged Tick) Ex Vivo Organotypic Cultures and Applications for Disease Control.

    PubMed

    Grabowski, Jeffrey M; Tsetsarkin, Konstantin A; Long, Dan; Scott, Dana P; Rosenke, Rebecca; Schwan, Tom G; Mlera, Luwanika; Offerdahl, Danielle K; Pletnev, Alexander G; Bloom, Marshall E

    2017-08-22

    Ixodes scapularis ticks transmit many infectious agents that cause disease, including tick-borne flaviviruses (TBFVs). TBFV infections cause thousands of human encephalitis cases worldwide annually. In the United States, human TBFV infections with Powassan virus (POWV) are increasing and have a fatality rate of 10 to 30%. Additionally, Langat virus (LGTV) is a TBFV of low neurovirulence and is used as a model TBFV. TBFV replication and dissemination within I. scapularis organs are poorly characterized, and a deeper understanding of virus biology in this vector may inform effective countermeasures to reduce TBFV transmission. Here, we describe short-term, I. scapularis organ culture models of TBFV infection. Ex vivo organs were metabolically active for 9 to 10 days and were permissive to LGTV and POWV replication. Imaging and videography demonstrated replication and spread of green fluorescent protein-expressing LGTV in the organs. Immunohistochemical staining confirmed LGTV envelope and POWV protein synthesis within the infected organs. LGTV- and POWV-infected organs produced infectious LGTV and POWV; thus, the ex vivo cultures were suitable for study of virus replication in individual organs. LGTV- and POWV-infected midgut and salivary glands were subjected to double-stranded RNA (dsRNA) transfection with dsRNA to the LGTV 3' untranslated region (UTR), which reduced infectious LGTV and POWV replication, providing a proof-of-concept use of RNA interference in I. scapularis organ cultures to study the effects on TBFV replication. The results contribute important information on TBFV localization within ex vivo I. scapularis organs and provide a significant translational tool for evaluating recombinant, live vaccine candidates and potential tick transcripts and proteins for possible therapeutic use and vaccine development to reduce TBFV transmission. IMPORTANCE Tick-borne flavivirus (TBFV) infections cause neurological and/or hemorrhagic disease in humans worldwide. There are currently no licensed therapeutics or vaccines against Powassan virus (POWV), the only TBFV known to circulate in North America. Evaluating tick vector targets for antitick vaccines directed at reducing TBFV infection within the arthropod vector is a critical step in identifying efficient approaches to controlling TBFV transmission. This study characterized infection of female Ixodes scapularis tick organ cultures of midgut, salivary glands, and synganglion with the low-neurovirulence Langat virus (LGTV) and the more pathogenic POWV. Cell types of specific organs were susceptible to TBFV infection, and a difference in LGTV and POWV replication was noted in TBFV-infected organs. This tick organ culture model of TBFV infection will be useful for various applications, such as screening of tick endogenous dsRNA corresponding to potential control targets within midgut and salivary glands to confirm restriction of TBFV infection.

  16. Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines

    PubMed Central

    2017-01-01

    Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. PMID:28775971

  17. Contributions of hydrology to Vesicular Stomatitis Virus emergence in the Western United States

    USDA-ARS?s Scientific Manuscript database

    Relationships between environmental variables associated with the spread of vector-borne pathogens, such as RNA viruses transmitted to humans and animals, remain poorly understood. Vesicular stomatitis (VS) is caused by a vector-borne, zoonotic RNA virus (VSV), and is the most common vesicular dise...

  18. RNA therapeutics targeting osteoclast-mediated excessive bone resorption

    PubMed Central

    Wang, Yuwei; Grainger, David W

    2011-01-01

    RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356

  19. Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

    PubMed

    Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

    2017-10-01

    Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

  20. Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes

    PubMed Central

    Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

    2017-01-01

    A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials. PMID:28594388

Top