Overview of the H.264/AVC video coding standard

NASA Astrophysics Data System (ADS)

Luthra, Ajay; Topiwala, Pankaj N.

2003-11-01

H.264/MPEG-4 AVC is the latest coding standard jointly developed by the Video Coding Experts Group (VCEG) of ITU-T and Moving Picture Experts Group (MPEG) of ISO/IEC. It uses state of the art coding tools and provides enhanced coding efficiency for a wide range of applications including video telephony, video conferencing, TV, storage (DVD and/or hard disk based), streaming video, digital video creation, digital cinema and others. In this paper an overview of this standard is provided. Some comparisons with the existing standards, MPEG-2 and MPEG-4 Part 2, are also provided.

Performance evaluation of MPEG internet video coding

NASA Astrophysics Data System (ADS)

Luo, Jiajia; Wang, Ronggang; Fan, Kui; Wang, Zhenyu; Li, Ge; Wang, Wenmin

2016-09-01

Internet Video Coding (IVC) has been developed in MPEG by combining well-known existing technology elements and new coding tools with royalty-free declarations. In June 2015, IVC project was approved as ISO/IEC 14496-33 (MPEG- 4 Internet Video Coding). It is believed that this standard can be highly beneficial for video services in the Internet domain. This paper evaluates the objective and subjective performances of IVC by comparing it against Web Video Coding (WVC), Video Coding for Browsers (VCB) and AVC High Profile. Experimental results show that IVC's compression performance is approximately equal to that of the AVC High Profile for typical operational settings, both for streaming and low-delay applications, and is better than WVC and VCB.

Local Muscle Metabolic Demand Induced by Neuromuscular Electrical Stimulation and Voluntary Contractions at Different Force Levels: A NIRS Study.

PubMed

Muthalib, Makii; Kerr, Graham; Nosaka, Kazunori; Perrey, Stephane

2016-06-13

Functional Muscle metabolic demand during contractions evoked by neuromuscular electrical stimulation (NMES) has been consistently documented to be greater than voluntary contractions (VOL) at the same force level (10-50% maximal voluntary contraction-MVC). However, we have shown using a near-infrared spectroscopy (NIRS) technique that local muscle metabolic demand is similar between NMES and VOL performed at MVC levels, thus controversy exists. This study therefore compared biceps brachii muscle metabolic demand (tissue oxygenation index-TOI and total hemoglobin volume-tHb) during a 10s isometric contraction of the elbow flexors between NMES (stimulation frequency of 30Hz and current level to evoke 30% MVC) and VOL at 30% MVC (VOL-30%MVC) and MVC (VOL-MVC) level in 8 healthy men (23-33-y). Greater changes in TOI and tHb induced by NMES than VOL-30%MVC confirm previous studies of a greater local metabolic demand for NMES than VOL at the same force level. The same TOI and tHb changes for NMES and VOL-MVC suggest that local muscle metabolic demand and intramuscular pressure were similar between conditions. In conclusion, these findings indicate that NMES induce a similar local muscle metabolic demand as that of maximal VOL.

Local Muscle Metabolic Demand Induced by Neuromuscular Electrical Stimulation and Voluntary Contractions at Different Force Levels: A NIRS Study

PubMed Central

Muthalib, Makii; Kerr, Graham; Nosaka, Kazunori; Perrey, Stephane

2016-01-01

Functional Muscle metabolic demand during contractions evoked by neuromuscular electrical stimulation (NMES) has been consistently documented to be greater than voluntary contractions (VOL) at the same force level (10-50% maximal voluntary contraction-MVC). However, we have shown using a near-infrared spectroscopy (NIRS) technique that local muscle metabolic demand is similar between NMES and VOL performed at MVC levels, thus controversy exists. This study therefore compared biceps brachii muscle metabolic demand (tissue oxygenation index-TOI and total hemoglobin volume-tHb) during a 10s isometric contraction of the elbow flexors between NMES (stimulation frequency of 30Hz and current level to evoke 30% MVC) and VOL at 30% MVC (VOL-30%MVC) and MVC (VOL-MVC) level in 8 healthy men (23-33-y). Greater changes in TOI and tHb induced by NMES than VOL-30%MVC confirm previous studies of a greater local metabolic demand for NMES than VOL at the same force level. The same TOI and tHb changes for NMES and VOL-MVC suggest that local muscle metabolic demand and intramuscular pressure were similar between conditions. In conclusion, these findings indicate that NMES induce a similar local muscle metabolic demand as that of maximal VOL. PMID:27478574

The link between texting and motor vehicle collision frequency in the orthopaedic trauma population

PubMed Central

Issar, Neil M.; Kadakia, Rishin J.; Tsahakis, James M.; Yoneda, Zachary T.; Sethi, Manish K.; Mir, Hassan R.; Archer, Kristin; Obremskey, William T.; Jahangir, Amir A.

2013-01-01

Abstract: Background: This study will evaluate whether or not texting frequency while driving and/or texting frequency in general are associated with an increased risk of incurring a motor vehicle collision (MVC) resulting in orthopaedic trauma injuries. Methods: All patients who presented to the Vanderbilt University Medical Center Orthopaedic Trauma Clinic were administered a questionnaire to determine background information, mean phone use, texting frequency, texting frequency while driving, and whether or not the injury was the result of an MVC in which the patient was driving. Results: 237 questionnaires were collected. 60 were excluded due to incomplete date, leaving 57 questionnaires in the MVC group and 120 from patients with non-MVC injuries. Patients who sent more than 30 texts per week (“heavy texters”) were 2.22 times more likely to be involved in an MVC than those who texted less frequently. 84% of respondents claimed to never text while driving. Dividing the sample into subsets on the basis of age (25 years of age or below considered “young adult,” and above 25 years of age considered “adult”),young, heavy texters were 6.76 times more likely to be involved in an MVC than adult non-heavy texters (p = 0.000). Similarly, young adult, non-heavy texters were 6.65 (p = 0.005) times more likely to be involved in an MVC, and adult, heavy texters were 1.72 (p = 0.186) times more likely to be involved in an MVC. Conclusions: Patients injured in an MVC sent more text messages per week than non-MVC patients. Additionally, controlling for age demonstrated that young age and heavy general texting frequency combined had the highest increase in MVC risk, with the former being the variable of greatest effect. PMID:23416747

The link between texting and motor vehicle collision frequency in the orthopaedic trauma population.

PubMed

Issar, Neil M; Kadakia, Rishin J; Tsahakis, James M; Yoneda, Zachary T; Sethi, Manish K; Mir, Hassan R; Archer, Kristin; Obremskey, William T; Jahangir, Amir A

2013-07-01

This study will evaluate whether or not texting frequency while driving and/or texting frequency in general are associated with an increased risk of incurring a motor vehicle collision (MVC) resulting in orthopaedic trauma injuries. All patients who presented to the Vanderbilt University Medical Center Orthopaedic Trauma Clinic were administered a questionnaire to determine background information, mean phone use, texting frequency, texting frequency while driving, and whether or not the injury was the result of an MVC in which the patient was driving. 237 questionnaires were collected. 60 were excluded due to incomplete date, leaving 57 questionnaires in the MVC group and 120 from patients with non-MVC injuries. Patients who sent more than 30 texts per week ("heavy texters") were 2.22 times more likely to be involved in an MVC than those who texted less frequently. 84% of respondents claimed to never text while driving. Dividing the sample into subsets on the basis of age (25 years of age or below considered "young adult," and above 25 years of age considered "adult"),young, heavy texters were 6.76 times more likely to be involved in an MVC than adult non-heavy texters (p = 0.000). Similarly, young adult, non-heavy texters were 6.65 (p = 0.005) times more likely to be involved in an MVC, and adult, heavy texters were 1.72 (p = 0.186) times more likely to be involved in an MVC. Patients injured in an MVC sent more text messages per week than non-MVC patients. Additionally, controlling for age demonstrated that young age and heavy general texting frequency combined had the highest increase in MVC risk, with the former being the variable of greatest effect.

Method for Controlled Mitochondrial Perturbation during Phosphorus MRS in Children

PubMed Central

Cree-Green, Melanie; Newcomer, Bradley R.; Brown, Mark; Hull, Amber; West, Amy D.; Singel, Debra; Reusch, Jane E.B.; McFann, Kim; Regensteiner, Judith G.; Nadeau, Kristen J.

2014-01-01

Introduction Insulin resistance (IR) is increasingly prevalent in children, and may be related to muscle mitochondrial dysfunction, necessitating development of mitochondrial assessment techniques. Recent studies used 31Phosphorus magnetic resonance spectroscopy (31P-MRS), a non-invasive technique appealing for clinical research. 31P-MRS requires exercise at a precise percentage of maximum volitional contraction (MVC). MVC measurement in children, particularly with disease, is problematic due to variability in perception of effort and motivation. We therefore developed a method to predict MVC, using maximal calf muscle cross-sectional area (MCSA) to assure controlled and reproducible muscle metabolic perturbations. Methods Data were collected from 66 sedentary 12–20 year-olds. Plantar flexion-volitional MVC was assessed using a MRI-compatible exercise treadle device. MCSA of the calf muscles were measured from MRI images. Data from the first 26 participants were utilized to model the relationship between MVC and MCSA (predicted MVC = 24.763+0.0047*MCSA). This model was then applied to the subsequent 40 participants. Results Volitional vs. model-predicted mean MVC was 43.9±0.8 kg vs. 44.2±1.81 (P=0.90). 31P-MRS results when predicted and volitional MVC were similar showed expected changes during volitional MVC-based exercise. In contrast, volitional MVC was markedly lower than predicted in 4 participants, and produced minimal metabolic perturbation. Upon repeat testing, these individuals could perform their predicted MVC with coaching, which produced expected metabolic perturbations. Conclusions Compared to using MVC testing alone, utilizing MRI to predict muscle strength allows for a more accurate and standardized 31P-MRS protocol during exercise in children. This method overcomes a major obstacle in assessing mitochondrial function in youth. These studies have importance as we seek to determine the role of mitochondrial function in youth with IR and diabetes and response to interventions. PMID:24576856

Two-terminal video coding.

PubMed

Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

2009-03-01

Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

Selective fatigue of fast motor units after electrically elicited muscle contractions.

PubMed

Hamada, Taku; Kimura, Tetsuya; Moritani, Toshio

2004-10-01

The aim of the present study was to elucidate the electrophysiological manifestations of selective fast motor unit (MU) activation by electrical stimulation (ES) of knee extensor muscles. In six male subjects, test contraction measurement at 40% maximal voluntary contraction (MVC) was performed before and at every 5 min (5, 10, 15 and 20 min) during 20-min low intensity intermittent exercise of either ES or voluntary contractions (VC) at 10% MVC (5-s isometric contraction and 5-s rest cycles). Both isolated intramuscular MU spikes obtained from three sets of bipolar fine-wire electrodes and surface electromyogram (EMG) were simultaneously recorded and were analyzed by means of a computer-aided intramuscular spike amplitude-frequency analysis and frequency power spectral analysis, respectively. Results indicated that mean MU spike amplitude, particularly those MUs with relatively large amplitude, was significantly reduced while those MUs with small spike amplitude increased their firing rate during the 40% MVC test contraction after the ES. This was accompanied by the increased amplitude of surface EMG (rmsEMG). However, no such significant changes in the intramuscular and surface EMGs were observed after VC. These findings indicated differential MU activation patterns in terms of MU recruitment and rate coding characteristics during ES and VC, respectively. Our data strongly suggest the possibility of "an inverse size principle" of MU recruitment during ES.

Layered Wyner-Ziv video coding.

PubMed

Xu, Qian; Xiong, Zixiang

2006-12-01

Following recent theoretical works on successive Wyner-Ziv coding (WZC), we propose a practical layered Wyner-Ziv video coder using the DCT, nested scalar quantization, and irregular LDPC code based Slepian-Wolf coding (or lossless source coding with side information at the decoder). Our main novelty is to use the base layer of a standard scalable video coder (e.g., MPEG-4/H.26L FGS or H.263+) as the decoder side information and perform layered WZC for quality enhancement. Similar to FGS coding, there is no performance difference between layered and monolithic WZC when the enhancement bitstream is generated in our proposed coder. Using an H.26L coded version as the base layer, experiments indicate that WZC gives slightly worse performance than FGS coding when the channel (for both the base and enhancement layers) is noiseless. However, when the channel is noisy, extensive simulations of video transmission over wireless networks conforming to the CDMA2000 1X standard show that H.26L base layer coding plus Wyner-Ziv enhancement layer coding are more robust against channel errors than H.26L FGS coding. These results demonstrate that layered Wyner-Ziv video coding is a promising new technique for video streaming over wireless networks.

Effect of mobile phone proliferation on crash notification times and fatality rates.

PubMed

Stickles, Jimmy L; Kempema, James M; Brown, Lawrence H

2018-01-01

The purpose of this study was to evaluate whether increased proliferation of mobile telephones has been associated with decreased MVC notification times and/or decreased MVC fatality rates in the United States (US). We used World Bank annual mobile phone market penetration data and US Fatality Analysis Reporting System (FARS) fatal MVC data for 1994-2014. For each year, phone proliferation was measured as mobile phones per 100 population. FARS data were used to calculate MVC notification time (time EMS notified - time MVC occurred) in minutes, and to determine the MVC fatality rate per billion vehicle miles traveled (BVMT). We used basic vector auto-regression modeling to explore relationships between changes in phone proliferation and subsequent changes in median and 90th percentile MVC notification times, as well as MVC fatality rates. From 1994 to 2014, larger year-over-year increases in phone proliferation were associated with larger decreases in 90th percentile notification times for MVCs occurring during daylight hours (p=0.004) and on the national highway system (p=0.046) two years subsequent, and crashes off the national highway system three years subsequent (p=0.023). There were no significant associations between changes in phone proliferation and subsequent changes in median crash notification times, nor with subsequent changes in MVC fatality rates. Between 1994 and 2014 increased mobile phone proliferation in the U.S. was associated with shorter 90th percentile EMS notification times for some subgroups of fatal MVCs, but not with decreases in median notification times or overall MVC fatality rates. Copyright © 2017 Elsevier Inc. All rights reserved.

Virologic and Serologic Identification of Minute Virus of Canines (Canine Parvovirus Type 1) from Dogs in Japan

PubMed Central

Mochizuki, Masami; Hashimoto, Michiru; Hajima, Takayuki; Takiguchi, Mitsuyoshi; Hashimoto, Akira; Une, Yumi; Roerink, Frank; Ohshima, Takahisa; Parrish, Colin R.; Carmichael, Leland E.

2002-01-01

Minute virus of canines (MVC), also known as canine parvovirus type 1, was initially believed to be a nonpathogenic agent, since it was first isolated from canine fecal specimens in the late 1960s. However, subsequent pathological as well as epidemiological studies suggested that MVC is a pathogen of neonatal puppies and is widely distributed among domestic dogs in the United States. The virus also has been shown to cause fetal deaths. Nevertheless, the virus was not detected in dogs outside the United States until recently, presumably because of a lack of widespread availability of the only susceptible canine cell line, WRCC/3873D, used for MVC isolation. We examined 470 clinical specimens from 346 dogs by PCR and detected MVC-specific gene fragments from four diseased puppies (positive rate, 1.2%). Viruses were recovered from three PCR-positive rectal specimens by using WRCC/3873D and MDCK cells. The isolates possessed antigenic and genomic properties similar to those of the U.S. reference strain GA3 and were identified as MVC. In addition, seroepidemiological evidence that 5.0% of dogs possessed anti-MVC antibodies also indicated the presence of MVC infection among dogs in Japan. From this study and several recent European reports describing MVC field cases, it is evident that MVC is distributed among domestic dogs worldwide. PMID:12409364

FLS tasks can be used as an ergonomic discriminator between laparoscopic and robotic surgery.

PubMed

Zihni, Ahmed M; Ohu, Ikechukwu; Cavallo, Jaime A; Ousley, Jenny; Cho, Sohyung; Awad, Michael M

2014-08-01

Robotic surgery may result in ergonomic benefits to surgeons. In this pilot study, we utilize surface electromyography (sEMG) to describe a method for identifying ergonomic differences between laparoscopic and robotic platforms using validated Fundamentals of Laparoscopic Surgery (FLS) tasks. We hypothesize that FLS task performance on laparoscopic and robotic surgical platforms will produce significant differences in mean muscle activation, as quantified by sEMG. Six right-hand-dominant subjects with varying experience performed FLS peg transfer (PT), pattern cutting (PC), and intracorporeal suturing (IS) tasks on laparoscopic and robotic platforms. sEMG measurements were obtained from each subject's bilateral bicep, tricep, deltoid, and trapezius muscles. EMG measurements were normalized to the maximum voluntary contraction (MVC) of each muscle of each subject. Subjects repeated each task three times per platform, and mean values used for pooled analysis. Average normalized muscle activation (%MVC) was calculated for each muscle group in all subjects for each FLS task. We compared mean %MVC values with paired t tests and considered differences with a p value less than 0.05 to be statistically significant. Mean activation of right bicep (2.7 %MVC lap, 1.3 %MVC robotic, p = 0.019) and right deltoid muscles (2.4 %MVC lap, 1.0 %MVC robotic, p = 0.019) were significantly elevated during the laparoscopic compared to the robotic IS task. The mean activation of the right trapezius muscle was significantly elevated during robotic compared to the laparoscopic PT (1.6 %MVC lap, 3.5 %MVC robotic, p = 0.040) and PC (1.3 %MVC lap, 3.6 %MVC robotic, p = 0.0018) tasks. FLS tasks are validated, readily available instruments that are feasible for use in demonstrating ergonomic differences between surgical platforms. In this study, we used FLS tasks to compare mean muscle activation of four muscle groups during laparoscopic and robotic task performance. FLS tasks can serve as the basis for larger studies to further describe ergonomic differences between laparoscopic and robotic surgery.

PHASE 2 SAFETY AND TOLERABILITY STUDY OF MARAVIROC-CONTAINING REGIMENS TO PREVENT HIV INFECTION IN WOMEN (HPTN 069/ACTG A5305): A RANDOMIZED TRIAL

PubMed Central

Gulick, Roy M.; Wilkin, Timothy J.; Chen, Ying Q.; Landovitz, Raphael J.; Amico, K. Rivet; Young, Alicia M.; Richardson, Paul; Marzinke, Mark A.; Hendrix, Craig W.; Eshleman, Susan H.; McGowan, Ian; Cottle, Leslie M.; Andrade, Adriana; Marcus, Cheryl; Klingman, Karin L.; Chege, Wairimu; Rinehart, Alex R.; Rooney, James F.; Andrew, Philip; Salata, Robert A.; Siegel, Marc; Manabe, Yukari C.; Frank, Ian; Ho, Ken; Santana, Jorge; Stekler, Joanne D.; Swaminathan, Shobha; McCauley, Marybeth; Hodder, Sally; Mayer, Kenneth H.

2017-01-01

BACKGROUND Maraviroc (MVC) is a candidate drug for HIV PrEP. OBJECTIVE To assess the safety/tolerability of MVC-containing PrEP in U.S. women at-risk for HIV over 48 weeks. DESIGN Phase 2 randomized, controlled, double-blinded study of four PrEP regimens (#NCT01505114). SETTING Twelve clinical research sites of the HIV Prevention Trials Network and AIDS Clinical Trials Group. PARTICIPANTS HIV-uninfected women reporting condomless vaginal or anal intercourse with ≥1 HIV-infected or unknown-serostatus man within 90 days. INTERVENTIONS MVC alone, MVC+emtricitabine (FTC), MVC+tenofovir disoproxil fumarate (TDF), and TDF+FTC (control). MEASUREMENTS At each visit, clinical and laboratory (including HIV) assessments were conducted. Primary outcomes were grade 3–4 adverse events and time to permanent regimen discontinuation. Analyses were conducted on all randomized participants, according to original regimen assignment. RESULTS Among 188 participants, 85% completed follow-up, 11% withdrew early, and 4% were lost-to-follow-up; 19% discontinued their regimen prematurely. Number discontinuing and time-to-discontinuation did not differ among regimens. Grade 3/4 adverse events occurred in 5 (MVC), 13 (MVC+FTC), 9 (MVC+TDF) and 8 (TDF+FTC) participants; rates did not differ among regimens. One death occurred (suicide; MVC+FTC), judged not regimen-related. Of available samples at week 48 (n=126), 60% demonstrated detectable drug concentrations. No new HIV infections occurred. LIMITATIONS Participants were not necessarily high-risk for HIV. Regimen was 3 pills daily. Study was not powered for efficacy. CONCLUSIONS MVC-containing PrEP regimens were safe and well-tolerated compared to the control regimen of TDF+FTC in U.S. women. No new HIV infections occurred, although whether this was due to low risk of the population or to protection from the study regimens is not certain. MVC-containing PrEP for women may warrant further study. FUNDING SOURCE U.S. National Institutes of Health PMID:28828489

Progressive video coding for noisy channels

NASA Astrophysics Data System (ADS)

Kim, Beong-Jo; Xiong, Zixiang; Pearlman, William A.

1998-10-01

We extend the work of Sherwood and Zeger to progressive video coding for noisy channels. By utilizing a 3D extension of the set partitioning in hierarchical trees (SPIHT) algorithm, we cascade the resulting 3D SPIHT video coder with a rate-compatible punctured convolutional channel coder for transmission of video over a binary symmetric channel. Progressive coding is achieved by increasing the target rate of the 3D embedded SPIHT video coder as the channel condition improves. The performance of our proposed coding system is acceptable at low transmission rate and bad channel conditions. Its low complexity makes it suitable for emerging applications such as video over wireless channels.

Electromyogram and force fluctuation during different linearly varying isometric motor tasks.

PubMed

Orizio, C; Baruzzi, E; Gaffurini, P; Diemont, B; Gobbo, M

2010-08-01

The purpose of this work was to verify if deviation from the mirror-like behaviour of the motor units activation strategy (MUAS) and de-activation strategy (MUDS) and the degree of the error of the motor control system, during consecutive linearly increasing-decreasing isometric tension tasks, depend on the maximum reached tension and/or on the rate of tension changes. In 12 male subjects the surface EMG and force produced by the first dorsal interosseus activity were recorded during two (a and b) trapezoid isometric contractions with different plateau (a: 50% maximal voluntary contraction (MVC) and b: 100% MVC) and rate of tension changes (a: 6.7% MVC/s and b: 13.3% MVC/s) during up-going (UGR) and down-going (DGR) ramps. Ten steps (ST) 6s long at 5, 10, 20, 30, 40, 50, 60, 70, 80 and 90% MVC were also recorded. The root mean square (RMS) and mean frequency (MF) from EMG and the relative error of actual force output with respect to the target (% ERR) were computed. The EMG-RMS/% MVC and EMG-MF/% MVC relationships were not overlapped when the ST and DGR as well as the UGR and DGR data were compared. The % ERR/% MVC relationships during a and b contractions differed from ST data only below 20% MVC. It can be concluded that MUAS and MUDS are not mirroring one each other because MU recruitment or de-recruitment threshold may be influenced by the maximum effort and by the % MVC/s of UGR and DGR. The role of MUs mechanical and/or central nervous system hysteresis on force decrement control is discussed. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Maraviroc modifies gut microbiota composition in a mouse model of obesity: a plausible therapeutic option to prevent metabolic disorders in HIV-infected patients.

PubMed

Pérez-Matute, Patricia; Pérez-Martínez, Laura; Aguilera-Lizarraga, Javier; Blanco, José R; Oteo, José A

2015-08-01

The proportion of HIV-infected patients with overweight/obesity has increased in recent years. These patients have an increased metabolic/cardiovascular risk compared with non-obese patients. Modulation of gut microbiota composition arises as a promising tool to prevent the development of obesity and associated disorders. The aim of this study was to investigate the impacts of maraviroc (MVC), a CCR5 antagonist approved for clinical use in HIV-infected patients, on gut microbiota composition in a mouse model of obesity. Thirty two male C57BL/6 mice were assigned to:a) Control (chow diet), b) MVC (chow diet plus 300 mg/L MVC), c) High-fat diet (HFD) or d) HFD/MVC (HFD plus 300 mg/L MVC) groups. Body weight and food intake was recorded every 2-3 days. Mice were euthanized after 16 weeks of treatment and cecal contents were removed to analyse by real-time PCR four bacterial orders from the most dominant phyla in gut. Mice fed with a HFD showed a significant increase in Enterobacteriales (p<0.001 vs. control). MVC treatment induced a significant decrease in control (p<0.05) and HFD fed mice (p<0.001). Interestingly, this order was positively associated with body weight gain, insulin resistance and fatty liver. HFD induced a significant decrease in Bacteroidales and Clostridiales levels (p<0.05 and p<0.01, respectively). MVC decreased the presence of Bacteroidales (p<0.05 vs. control) while an increase was observed in HFD/MVC mice (p=0.01 vs. HFD). No direct effects of MVC were observed on Clostridiales and Lactobacillales. MVC may constitute a new therapeutic option to prevent obesity and related disorders in HIV-infected patients.

Impact of automobile restraint device utilization on facial fractures and fiscal implications for plastic surgeons.

PubMed

Adkinson, Joshua M; Murphy, Robert X

2011-05-01

In 2009, the National Highway Traffic Safety Administration projected that 33,963 people would die and millions would be injured in motor vehicle collisions (MVC). Multiple studies have evaluated the impact of restraint devices in MVCs. This study examines longitudinal changes in facial fractures after MVC as result of utilization of restraint devices. The Pennsylvania Trauma Systems Foundation-Pennsylvania Trauma Outcomes Study database was queried for MVCs from 1989 to 2009. Restraint device use was noted, and facial fractures were identified by International Classification of Diseases-ninth revision codes. Surgeon cost data were extrapolated. More than 15,000 patients sustained ≥1 facial fracture. Only orbital blowout fractures increased over 20 years. Patients were 2.1% less likely every year to have ≥1 facial fracture, which translated into decreased estimated surgeon charges. Increased use of protective devices by patients involved in MVCs resulted in a change in incidence of different facial fractures with reduced need for reconstructive surgery.

Mature Driver Laws and State Predictors of Motor Vehicle Crash Fatality Rates Among the Elderly: A Cross-sectional Ecological Study.

PubMed

Bell, Teresa M; Qiao, Nan; Zarzaur, Ben L

2015-01-01

State-level data have indicated that motor vehicle crash (MVC) fatality rates among the elderly vary widely across states. To date, the majority of states have implemented mature driver laws, which often require more frequent license renewals, in-person renewal, and vision testing for drivers above a certain age. We sought to evaluate the impact of mature driver laws on states' MVC fatality rates among the elderly while examining other state-level determinants of MVC-related deaths. We performed a cross-sectional ecological study and modeled state MVC fatality rates for the population over age 65 as a function of state transportation policies and demographic, health system, population health, travel, and climate characteristics using a general linear model. Principal component analysis was used to reduce dimensionality of the data and overcome multicollinearity of state predictor variables. Higher average temperature, higher gas prices, and a greater number of emergency medicine physicians to population size were significantly associated with lower MVC fatality rates. Positive predictors of MVC fatality rates were percentage of population overweight or obese and percentage with college degree over the age of 65. Having any restriction on elderly drivers was associated with a higher MVC fatality rate and no individual component of mature driver laws (shortened renewal cycle, in-person renewal, and vision testing) was significantly associated with lower fatality MVC rates for adults over 65. Mature driver laws are not associated with lower state MVC fatality rates among the elderly.

Video Monitoring a Simulation-Based Quality Improvement Program in Bihar, India.

PubMed

Dyer, Jessica; Spindler, Hilary; Christmas, Amelia; Shah, Malay Bharat; Morgan, Melissa; Cohen, Susanna R; Sterne, Jason; Mahapatra, Tanmay; Walker, Dilys

2018-04-01

Simulation-based training has become an accepted clinical training andragogy in high-resource settings with its use increasing in low-resource settings. Video recordings of simulated scenarios are commonly used by facilitators. Beyond using the videos during debrief sessions, researchers can also analyze the simulation videos to quantify technical and nontechnical skills during simulated scenarios over time. Little is known about the feasibility and use of large-scale systems to video record and analyze simulation and debriefing data for monitoring and evaluation in low-resource settings. This manuscript describes the process of designing and implementing a large-scale video monitoring system. Mentees and Mentors were consented and all simulations and debriefs conducted at 320 Primary Health Centers (PHCs) were video recorded. The system design, number of video recordings, and inter-rater reliability of the coded videos were assessed. The final dataset included a total of 11,278 videos. Overall, a total of 2,124 simulation videos were coded and 183 (12%) were blindly double-coded. For the double-coded sample, the average inter-rater reliability (IRR) scores were 80% for nontechnical skills, and 94% for clinical technical skills. Among 4,450 long debrief videos received, 216 were selected for coding and all were double-coded. Data quality of simulation videos was found to be very good in terms of recorded instances of "unable to see" and "unable to hear" in Phases 1 and 2. This study demonstrates that video monitoring systems can be effectively implemented at scale in resource limited settings. Further, video monitoring systems can play several vital roles within program implementation, including monitoring and evaluation, provision of actionable feedback to program implementers, and assurance of program fidelity.

Design and implementation of H.264 based embedded video coding technology

NASA Astrophysics Data System (ADS)

Mao, Jian; Liu, Jinming; Zhang, Jiemin

2016-03-01

In this paper, an embedded system for remote online video monitoring was designed and developed to capture and record the real-time circumstances in elevator. For the purpose of improving the efficiency of video acquisition and processing, the system selected Samsung S5PV210 chip as the core processor which Integrated graphics processing unit. And the video was encoded with H.264 format for storage and transmission efficiently. Based on S5PV210 chip, the hardware video coding technology was researched, which was more efficient than software coding. After running test, it had been proved that the hardware video coding technology could obviously reduce the cost of system and obtain the more smooth video display. It can be widely applied for the security supervision [1].

Inter-view prediction of intra mode decision for high-efficiency video coding-based multiview video coding

NASA Astrophysics Data System (ADS)

da Silva, Thaísa Leal; Agostini, Luciano Volcan; da Silva Cruz, Luis A.

2014-05-01

Intra prediction is a very important tool in current video coding standards. High-efficiency video coding (HEVC) intra prediction presents relevant gains in encoding efficiency when compared to previous standards, but with a very important increase in the computational complexity since 33 directional angular modes must be evaluated. Motivated by this high complexity, this article presents a complexity reduction algorithm developed to reduce the HEVC intra mode decision complexity targeting multiview videos. The proposed algorithm presents an efficient fast intra prediction compliant with singleview and multiview video encoding. This fast solution defines a reduced subset of intra directions according to the video texture and it exploits the relationship between prediction units (PUs) of neighbor depth levels of the coding tree. This fast intra coding procedure is used to develop an inter-view prediction method, which exploits the relationship between the intra mode directions of adjacent views to further accelerate the intra prediction process in multiview video encoding applications. When compared to HEVC simulcast, our method achieves a complexity reduction of up to 47.77%, at the cost of an average BD-PSNR loss of 0.08 dB.

Gear Shifting of Quadriceps during Isometric Knee Extension Disclosed Using Ultrasonography.

PubMed

Zhang, Shu; Huang, Weijian; Zeng, Yu; Shi, Wenxiu; Diao, Xianfen; Wei, Xiguang; Ling, Shan

2018-01-01

Ultrasonography has been widely employed to estimate the morphological changes of muscle during contraction. To further investigate the motion pattern of quadriceps during isometric knee extensions, we studied the relative motion pattern between femur and quadriceps under ultrasonography. An interesting observation is that although the force of isometric knee extension can be controlled to change almost linearly, femur in the simultaneously captured ultrasound video sequences has several different piecewise moving patterns. This phenomenon is like quadriceps having several forward gear ratios like a car starting from rest towards maximal voluntary contraction (MVC) and then returning to rest. Therefore, to verify this assumption, we captured several ultrasound video sequences of isometric knee extension and collected the torque/force signal simultaneously. Then we extract the shapes of femur from these ultrasound video sequences using video processing techniques and study the motion pattern both qualitatively and quantitatively. The phenomenon can be seen easier via a comparison between the torque signal and relative spatial distance between femur and quadriceps. Furthermore, we use cluster analysis techniques to study the process and the clustering results also provided preliminary support to the conclusion that, during both ramp increasing and decreasing phases, quadriceps contraction may have several forward gear ratios relative to femur.

Distributed video coding for wireless video sensor networks: a review of the state-of-the-art architectures.

PubMed

Imran, Noreen; Seet, Boon-Chong; Fong, A C M

2015-01-01

Distributed video coding (DVC) is a relatively new video coding architecture originated from two fundamental theorems namely, Slepian-Wolf and Wyner-Ziv. Recent research developments have made DVC attractive for applications in the emerging domain of wireless video sensor networks (WVSNs). This paper reviews the state-of-the-art DVC architectures with a focus on understanding their opportunities and gaps in addressing the operational requirements and application needs of WVSNs.

Susceptibility to Exercise-Induced Muscle Damage: a Cluster Analysis with a Large Sample.

PubMed

Damas, F; Nosaka, K; Libardi, C A; Chen, T C; Ugrinowitsch, C

2016-07-01

We investigated the responses of indirect markers of exercise-induced muscle damage (EIMD) among a large number of young men (N=286) stratified in clusters based on the largest decrease in maximal voluntary contraction torque (MVC) after an unaccustomed maximal eccentric exercise bout of the elbow flexors. Changes in MVC, muscle soreness (SOR), creatine kinase (CK) activity, range of motion (ROM) and upper-arm circumference (CIR) before and for several days after exercise were compared between 3 clusters established based on MVC decrease (low, moderate, and high responders; LR, MR and HR). Participants were allocated to LR (n=61), MR (n=152) and HR (n=73) clusters, which depicted significantly different cluster centers of 82%, 61% and 42% of baseline MVC, respectively. Once stratified by MVC decrease, all muscle damage markers were significantly different between clusters following the same pattern: small changes for LR, larger changes for MR, and the largest changes for HR. Stratification of individuals based on the magnitude of MVC decrease post-exercise greatly increases the precision in estimating changes in EIMD by proxy markers such as SOR, CK activity, ROM and CIR. This indicates that the most commonly used markers are valid and MVC orchestrates their responses, consolidating the role of MVC as the best EIMD indirect marker. © Georg Thieme Verlag KG Stuttgart · New York.

Background-Modeling-Based Adaptive Prediction for Surveillance Video Coding.

PubMed

Zhang, Xianguo; Huang, Tiejun; Tian, Yonghong; Gao, Wen

2014-02-01

The exponential growth of surveillance videos presents an unprecedented challenge for high-efficiency surveillance video coding technology. Compared with the existing coding standards that were basically developed for generic videos, surveillance video coding should be designed to make the best use of the special characteristics of surveillance videos (e.g., relative static background). To do so, this paper first conducts two analyses on how to improve the background and foreground prediction efficiencies in surveillance video coding. Following the analysis results, we propose a background-modeling-based adaptive prediction (BMAP) method. In this method, all blocks to be encoded are firstly classified into three categories. Then, according to the category of each block, two novel inter predictions are selectively utilized, namely, the background reference prediction (BRP) that uses the background modeled from the original input frames as the long-term reference and the background difference prediction (BDP) that predicts the current data in the background difference domain. For background blocks, the BRP can effectively improve the prediction efficiency using the higher quality background as the reference; whereas for foreground-background-hybrid blocks, the BDP can provide a better reference after subtracting its background pixels. Experimental results show that the BMAP can achieve at least twice the compression ratio on surveillance videos as AVC (MPEG-4 Advanced Video Coding) high profile, yet with a slightly additional encoding complexity. Moreover, for the foreground coding performance, which is crucial to the subjective quality of moving objects in surveillance videos, BMAP also obtains remarkable gains over several state-of-the-art methods.

The H.264/AVC advanced video coding standard: overview and introduction to the fidelity range extensions

NASA Astrophysics Data System (ADS)

Sullivan, Gary J.; Topiwala, Pankaj N.; Luthra, Ajay

2004-11-01

H.264/MPEG-4 AVC is the latest international video coding standard. It was jointly developed by the Video Coding Experts Group (VCEG) of the ITU-T and the Moving Picture Experts Group (MPEG) of ISO/IEC. It uses state-of-the-art coding tools and provides enhanced coding efficiency for a wide range of applications, including video telephony, video conferencing, TV, storage (DVD and/or hard disk based, especially high-definition DVD), streaming video, digital video authoring, digital cinema, and many others. The work on a new set of extensions to this standard has recently been completed. These extensions, known as the Fidelity Range Extensions (FRExt), provide a number of enhanced capabilities relative to the base specification as approved in the Spring of 2003. In this paper, an overview of this standard is provided, including the highlights of the capabilities of the new FRExt features. Some comparisons with the existing MPEG-2 and MPEG-4 Part 2 standards are also provided.

Adaptive format conversion for scalable video coding

NASA Astrophysics Data System (ADS)

Wan, Wade K.; Lim, Jae S.

2001-12-01

The enhancement layer in many scalable coding algorithms is composed of residual coding information. There is another type of information that can be transmitted instead of (or in addition to) residual coding. Since the encoder has access to the original sequence, it can utilize adaptive format conversion (AFC) to generate the enhancement layer and transmit the different format conversion methods as enhancement data. This paper investigates the use of adaptive format conversion information as enhancement data in scalable video coding. Experimental results are shown for a wide range of base layer qualities and enhancement bitrates to determine when AFC can improve video scalability. Since the parameters needed for AFC are small compared to residual coding, AFC can provide video scalability at low enhancement layer bitrates that are not possible with residual coding. In addition, AFC can also be used in addition to residual coding to improve video scalability at higher enhancement layer bitrates. Adaptive format conversion has not been studied in detail, but many scalable applications may benefit from it. An example of an application that AFC is well-suited for is the migration path for digital television where AFC can provide immediate video scalability as well as assist future migrations.

Protection of rhesus macaques from vaginal infection by vaginally delivered maraviroc, an inhibitor of HIV-1 entry via the CCR5 co-receptor.

PubMed

Veazey, Ronald S; Ketas, Thomas J; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C; Klasse, P J; Moore, John P

2010-09-01

An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small-molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected individuals, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide with use of a stringent model that involves challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/mL). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (half life of approximately 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated postinfection viremia. These findings validate MVC development as a vaginal microbicide for women and should guide clinical programs.

Protection of rhesus macaques from vaginal infection by vaginally delivered Maraviroc, an inhibitor of HIV-1 entry via the CCR5 co-receptor

PubMed Central

Veazey, Ronald S.; Ketas, Thomas J.; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C.; Klasse, P.J.; Moore, John P.

2010-01-01

An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected people, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide, using a stringent model involving challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/ml). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (T1/2 ~ 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated post-infection viremia. These findings validate MVC development as a vaginal microbicide for women, and should guide clinical programs. PMID:20629537

Transcoding method from H.264/AVC to high efficiency video coding based on similarity of intraprediction, interprediction, and motion vector

NASA Astrophysics Data System (ADS)

Liu, Mei-Feng; Zhong, Guo-Yun; He, Xiao-Hai; Qing, Lin-Bo

2016-09-01

Currently, most video resources on line are encoded in the H.264/AVC format. More fluent video transmission can be obtained if these resources are encoded in the newest international video coding standard: high efficiency video coding (HEVC). In order to improve the video transmission and storage on line, a transcoding method from H.264/AVC to HEVC is proposed. In this transcoding algorithm, the coding information of intraprediction, interprediction, and motion vector (MV) in H.264/AVC video stream are used to accelerate the coding in HEVC. It is found through experiments that the region of interprediction in HEVC overlaps that in H.264/AVC. Therefore, the intraprediction for the region in HEVC, which is interpredicted in H.264/AVC, can be skipped to reduce coding complexity. Several macroblocks in H.264/AVC are combined into one PU in HEVC when the MV difference between two of the macroblocks in H.264/AVC is lower than a threshold. This method selects only one coding unit depth and one prediction unit (PU) mode to reduce the coding complexity. An MV interpolation method of combined PU in HEVC is proposed according to the areas and distances between the center of one macroblock in H.264/AVC and that of the PU in HEVC. The predicted MV accelerates the motion estimation for HEVC coding. The simulation results show that our proposed algorithm achieves significant coding time reduction with a little loss in bitrates distortion rate, compared to the existing transcoding algorithms and normal HEVC coding.

Reliability of surface electromyography activity of gluteal and hamstring muscles during sub-maximal and maximal voluntary isometric contractions.

PubMed

Bussey, Melanie D; Aldabe, Daniela; Adhia, Divya; Mani, Ramakrishnan

2018-04-01

Normalizing to a reference signal is essential when analysing and comparing electromyography signals across or within individuals. However, studies have shown that MVC testing may not be as reliable in persons with acute and chronic pain. The purpose of this study was to compare the test-retest reliability of the muscle activity in the biceps femoris and gluteus maximus between a novel sub-MVC and standard MVC protocols. This study utilized a single individual repeated measures design with 12 participants performing multiple trials of both the sub-MVC and MVC tasks on two separate days. The participant position in the prone leg raise task was standardised with an ultrasonic sensor to improve task precession between trials/days. Day-to-day and trial-to-trial reliability of the maximal muscle activity was examined using ICC and SEM. Day-to-day and trial-to-trial reliability of the EMG activity in the BF and GM were high (0.70-0.89) to very high (≥0.90) for both test procedures. %SEM was <5-10% for both tests on a given day but higher in the day-to-day comparisons. The lower amplitude of the sub-MVC is a likely contributor to increased %SEM (8-13%) in the day-to-day comparison. The findings show that the sub-MVC modified prone double leg raise results in GM and BF EMG measures similar in reliability and precision to the standard MVC tasks. Therefore, the modified prone double leg raise may be a useful substitute for traditional MVC testing for normalizing EMG signals of the BF and GM. Copyright © 2017 Elsevier Ltd. All rights reserved.

Floral Scent Mimicry and Vector-Pathogen Associations in a Pseudoflower-Inducing Plant Pathogen System

PubMed Central

McArt, Scott H.; Miles, Timothy D.; Rodriguez-Saona, Cesar; Schilder, Annemiek; Adler, Lynn S.; Grieshop, Matthew J.

2016-01-01

Several fungal plant pathogens induce ‘pseudoflowers’ on their hosts to facilitate insect-mediated transmission of gametes and spores. When spores must be transmitted to host flowers to complete the fungal life cycle, we predict that pseudoflowers should evolve traits that mimic flowers and attract the most effective vectors in the flower-visiting community. We quantified insect visitation to flowers, healthy leaves and leaves infected with Monilinia vaccinii-corymbosi (Mvc), the causative agent of mummy berry disease of blueberry. We developed a nested PCR assay for detecting Mvc spores on bees, flies and other potential insect vectors. We also collected volatiles from blueberry flowers, healthy leaves and leaves infected with Mvc, and experimentally manipulated specific pathogen-induced volatiles to assess attractiveness to potential vectors. Bees and flies accounted for the majority of contacts with flowers, leaves infected with Mvc and healthy leaves. Flowers were contacted most often, while there was no difference between bee or fly contacts with healthy and infected leaves. While bees contacted flowers more often than flies, flies contacted infected leaves more often than bees. Bees were more likely to have Mvc spores on their bodies than flies, suggesting that bees may be more effective vectors than flies for transmitting Mvc spores to flowers. Leaves infected with Mvc had volatile profiles distinct from healthy leaves but similar to flowers. Two volatiles produced by flowers and infected leaves, cinnamyl alcohol and cinnamic aldehyde, were attractive to bees, while no volatiles manipulated were attractive to flies or any other insects. These results suggest that Mvc infection of leaves induces mimicry of floral volatiles, and that transmission occurs primarily via bees, which had the highest likelihood of carrying Mvc spores and visited flowers most frequently. PMID:27851747

Floral Scent Mimicry and Vector-Pathogen Associations in a Pseudoflower-Inducing Plant Pathogen System.

PubMed

McArt, Scott H; Miles, Timothy D; Rodriguez-Saona, Cesar; Schilder, Annemiek; Adler, Lynn S; Grieshop, Matthew J

2016-01-01

Several fungal plant pathogens induce 'pseudoflowers' on their hosts to facilitate insect-mediated transmission of gametes and spores. When spores must be transmitted to host flowers to complete the fungal life cycle, we predict that pseudoflowers should evolve traits that mimic flowers and attract the most effective vectors in the flower-visiting community. We quantified insect visitation to flowers, healthy leaves and leaves infected with Monilinia vaccinii-corymbosi (Mvc), the causative agent of mummy berry disease of blueberry. We developed a nested PCR assay for detecting Mvc spores on bees, flies and other potential insect vectors. We also collected volatiles from blueberry flowers, healthy leaves and leaves infected with Mvc, and experimentally manipulated specific pathogen-induced volatiles to assess attractiveness to potential vectors. Bees and flies accounted for the majority of contacts with flowers, leaves infected with Mvc and healthy leaves. Flowers were contacted most often, while there was no difference between bee or fly contacts with healthy and infected leaves. While bees contacted flowers more often than flies, flies contacted infected leaves more often than bees. Bees were more likely to have Mvc spores on their bodies than flies, suggesting that bees may be more effective vectors than flies for transmitting Mvc spores to flowers. Leaves infected with Mvc had volatile profiles distinct from healthy leaves but similar to flowers. Two volatiles produced by flowers and infected leaves, cinnamyl alcohol and cinnamic aldehyde, were attractive to bees, while no volatiles manipulated were attractive to flies or any other insects. These results suggest that Mvc infection of leaves induces mimicry of floral volatiles, and that transmission occurs primarily via bees, which had the highest likelihood of carrying Mvc spores and visited flowers most frequently.

Influence of audio triggered emotional attention on video perception

NASA Astrophysics Data System (ADS)

Torres, Freddy; Kalva, Hari

2014-02-01

Perceptual video coding methods attempt to improve compression efficiency by discarding visual information not perceived by end users. Most of the current approaches for perceptual video coding only use visual features ignoring the auditory component. Many psychophysical studies have demonstrated that auditory stimuli affects our visual perception. In this paper we present our study of audio triggered emotional attention and it's applicability to perceptual video coding. Experiments with movie clips show that the reaction time to detect video compression artifacts was longer when video was presented with the audio information. The results reported are statistically significant with p=0.024.

System Synchronizes Recordings from Separated Video Cameras

NASA Technical Reports Server (NTRS)

Nail, William; Nail, William L.; Nail, Jasper M.; Le, Doung T.

2009-01-01

A system of electronic hardware and software for synchronizing recordings from multiple, physically separated video cameras is being developed, primarily for use in multiple-look-angle video production. The system, the time code used in the system, and the underlying method of synchronization upon which the design of the system is based are denoted generally by the term "Geo-TimeCode(TradeMark)." The system is embodied mostly in compact, lightweight, portable units (see figure) denoted video time-code units (VTUs) - one VTU for each video camera. The system is scalable in that any number of camera recordings can be synchronized. The estimated retail price per unit would be about $350 (in 2006 dollars). The need for this or another synchronization system external to video cameras arises because most video cameras do not include internal means for maintaining synchronization with other video cameras. Unlike prior video-camera-synchronization systems, this system does not depend on continuous cable or radio links between cameras (however, it does depend on occasional cable links lasting a few seconds). Also, whereas the time codes used in prior video-camera-synchronization systems typically repeat after 24 hours, the time code used in this system does not repeat for slightly more than 136 years; hence, this system is much better suited for long-term deployment of multiple cameras.

Self-Supervised Video Hashing With Hierarchical Binary Auto-Encoder.

PubMed

Song, Jingkuan; Zhang, Hanwang; Li, Xiangpeng; Gao, Lianli; Wang, Meng; Hong, Richang

2018-07-01

Existing video hash functions are built on three isolated stages: frame pooling, relaxed learning, and binarization, which have not adequately explored the temporal order of video frames in a joint binary optimization model, resulting in severe information loss. In this paper, we propose a novel unsupervised video hashing framework dubbed self-supervised video hashing (SSVH), which is able to capture the temporal nature of videos in an end-to-end learning to hash fashion. We specifically address two central problems: 1) how to design an encoder-decoder architecture to generate binary codes for videos and 2) how to equip the binary codes with the ability of accurate video retrieval. We design a hierarchical binary auto-encoder to model the temporal dependencies in videos with multiple granularities, and embed the videos into binary codes with less computations than the stacked architecture. Then, we encourage the binary codes to simultaneously reconstruct the visual content and neighborhood structure of the videos. Experiments on two real-world data sets show that our SSVH method can significantly outperform the state-of-the-art methods and achieve the current best performance on the task of unsupervised video retrieval.

Self-Supervised Video Hashing With Hierarchical Binary Auto-Encoder

NASA Astrophysics Data System (ADS)

Song, Jingkuan; Zhang, Hanwang; Li, Xiangpeng; Gao, Lianli; Wang, Meng; Hong, Richang

2018-07-01

Existing video hash functions are built on three isolated stages: frame pooling, relaxed learning, and binarization, which have not adequately explored the temporal order of video frames in a joint binary optimization model, resulting in severe information loss. In this paper, we propose a novel unsupervised video hashing framework dubbed Self-Supervised Video Hashing (SSVH), that is able to capture the temporal nature of videos in an end-to-end learning-to-hash fashion. We specifically address two central problems: 1) how to design an encoder-decoder architecture to generate binary codes for videos; and 2) how to equip the binary codes with the ability of accurate video retrieval. We design a hierarchical binary autoencoder to model the temporal dependencies in videos with multiple granularities, and embed the videos into binary codes with less computations than the stacked architecture. Then, we encourage the binary codes to simultaneously reconstruct the visual content and neighborhood structure of the videos. Experiments on two real-world datasets (FCVID and YFCC) show that our SSVH method can significantly outperform the state-of-the-art methods and achieve the currently best performance on the task of unsupervised video retrieval.

Subjective evaluation of next-generation video compression algorithms: a case study

NASA Astrophysics Data System (ADS)

De Simone, Francesca; Goldmann, Lutz; Lee, Jong-Seok; Ebrahimi, Touradj; Baroncini, Vittorio

2010-08-01

This paper describes the details and the results of the subjective quality evaluation performed at EPFL, as a contribution to the effort of the Joint Collaborative Team on Video Coding (JCT-VC) for the definition of the next-generation video coding standard. The performance of 27 coding technologies have been evaluated with respect to two H.264/MPEG-4 AVC anchors, considering high definition (HD) test material. The test campaign involved a total of 494 naive observers and took place over a period of four weeks. While similar tests have been conducted as part of the standardization process of previous video coding technologies, the test campaign described in this paper is by far the most extensive in the history of video coding standardization. The obtained subjective quality scores show high consistency and support an accurate comparison of the performance of the different coding solutions.

A novel multiple description scalable coding scheme for mobile wireless video transmission

NASA Astrophysics Data System (ADS)

Zheng, Haifeng; Yu, Lun; Chen, Chang Wen

2005-03-01

We proposed in this paper a novel multiple description scalable coding (MDSC) scheme based on in-band motion compensation temporal filtering (IBMCTF) technique in order to achieve high video coding performance and robust video transmission. The input video sequence is first split into equal-sized groups of frames (GOFs). Within a GOF, each frame is hierarchically decomposed by discrete wavelet transform. Since there is a direct relationship between wavelet coefficients and what they represent in the image content after wavelet decomposition, we are able to reorganize the spatial orientation trees to generate multiple bit-streams and employed SPIHT algorithm to achieve high coding efficiency. We have shown that multiple bit-stream transmission is very effective in combating error propagation in both Internet video streaming and mobile wireless video. Furthermore, we adopt the IBMCTF scheme to remove the redundancy for inter-frames along the temporal direction using motion compensated temporal filtering, thus high coding performance and flexible scalability can be provided in this scheme. In order to make compressed video resilient to channel error and to guarantee robust video transmission over mobile wireless channels, we add redundancy to each bit-stream and apply error concealment strategy for lost motion vectors. Unlike traditional multiple description schemes, the integration of these techniques enable us to generate more than two bit-streams that may be more appropriate for multiple antenna transmission of compressed video. Simulate results on standard video sequences have shown that the proposed scheme provides flexible tradeoff between coding efficiency and error resilience.

Prediction of HIV-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach.

PubMed

Sierra, Saleta; Kaiser, Rolf; Lübke, Nadine; Thielen, Alexander; Schuelter, Eugen; Heger, Eva; Däumer, Martin; Reuter, Stefan; Esser, Stefan; Fätkenheuer, Gerd; Pfister, Herbert; Oette, Mark; Lengauer, Thomas

2011-12-01

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by the majority of HIV strains in order to infect the human immune cells (Fig. 1). Other HIV isolates use a different coreceptor, the CXCR4. Which receptor is used, is determined in the virus by the Env protein (Fig. 2). Depending on the coreceptor used, the viruses are classified as R5 or X4, respectively. MVC binds to the CCR5 receptor inhibiting the entry of R5 viruses into the target cell. During the course of disease, X4 viruses may emerge and outgrow the R5 viruses. Determination of coreceptor usage (also called tropism) is therefore mandatory prior to administration of MVC, as demanded by EMA and FDA. The studies for MVC efficiency MOTIVATE, MERIT and 1029 have been performed with the Trofile assay from Monogram, San Francisco, U.S.A. This is a high quality assay based on sophisticated recombinant tests. The acceptance for this test for daily routine is rather low outside of the U.S.A., since the European physicians rather tend to work with decentralized expert laboratories, which also provide concomitant resistance testing. These laboratories have undergone several quality assurance evaluations, the last one being presented in 2011. For several years now, we have performed tropism determinations based on sequence analysis from the HIV env-V3 gene region (V3). This region carries enough information to perform a reliable prediction. The genotypic determination of coreceptor usage presents advantages such as: shorter turnover time (equivalent to resistance testing), lower costs, possibility to adapt the results to the patients' needs and possibility of analysing clinical samples with very low or even undetectable viral load (VL), particularly since the number of samples analysed with VL < 1000 copies/μl roughly increased in the last years (Fig. 3). The main steps for tropism testing (Fig. 4) demonstrated in this video: Collection of a blood sample Isolation of the HIV RNA from the plasma and/or HIV proviral DNA from blood mononuclear cells Amplification of the env region Amplification of the V3 region Sequence reaction of the V3 amplicon Purification of the sequencing samples Sequencing the purified samples Sequence editing Sequencing data interpretation and tropism prediction.

Relationship between strength qualities and short track speed skating performance in young athletes.

PubMed

Felser, S; Behrens, M; Fischer, S; Heise, S; Bäumler, M; Salomon, R; Bruhn, S

2016-02-01

This study analyzed the relationships between isometric as well as concentric maximum voluntary contraction (MVC) strength of the leg muscles and the times as well as speeds over different distances in 17 young short track speed skaters. Isometric as well as concentric single-joint MVC strength and multi-joint MVC strength in a stable (without skates) and unstable (with skates) condition were tested. Furthermore, time during maximum skating performances on ice was measured. Results indicate that maximum torques during eversion and dorsal flexion have a significant influence on skating speed. Concentric MVC strength of the knee extensors was higher correlated with times as well as speeds over the different distances than isometric MVC strength. Multi-joint MVC testing revealed that the force loss between measurements without and with skates amounts to 25%, while biceps femoris and soleus showed decreased muscle activity and peroneus longus, tibialis anterior, as well as rectus femoris exhibited increased muscle activity. The results of this study depict evidence that the skating times and speeds are primarily influenced by concentric MVC strength of the leg extensors. To be able to transfer the strength onto ice in an optimal way, it is necessary to stabilize the knee and ankle joints. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Expressing Youth Voice through Video Games and Coding

ERIC Educational Resources Information Center

Martin, Crystle

2017-01-01

A growing body of research focuses on the impact of video games and coding on learning. The research often elevates learning the technical skills associated with video games and coding or the importance of problem solving and computational thinking, which are, of course, necessary and relevant. However, the literature less often explores how young…

Medical Ultrasound Video Coding with H.265/HEVC Based on ROI Extraction

PubMed Central

Wu, Yueying; Liu, Pengyu; Gao, Yuan; Jia, Kebin

2016-01-01

High-efficiency video compression technology is of primary importance to the storage and transmission of digital medical video in modern medical communication systems. To further improve the compression performance of medical ultrasound video, two innovative technologies based on diagnostic region-of-interest (ROI) extraction using the high efficiency video coding (H.265/HEVC) standard are presented in this paper. First, an effective ROI extraction algorithm based on image textural features is proposed to strengthen the applicability of ROI detection results in the H.265/HEVC quad-tree coding structure. Second, a hierarchical coding method based on transform coefficient adjustment and a quantization parameter (QP) selection process is designed to implement the otherness encoding for ROIs and non-ROIs. Experimental results demonstrate that the proposed optimization strategy significantly improves the coding performance by achieving a BD-BR reduction of 13.52% and a BD-PSNR gain of 1.16 dB on average compared to H.265/HEVC (HM15.0). The proposed medical video coding algorithm is expected to satisfy low bit-rate compression requirements for modern medical communication systems. PMID:27814367

Medical Ultrasound Video Coding with H.265/HEVC Based on ROI Extraction.

PubMed

Wu, Yueying; Liu, Pengyu; Gao, Yuan; Jia, Kebin

2016-01-01

High-efficiency video compression technology is of primary importance to the storage and transmission of digital medical video in modern medical communication systems. To further improve the compression performance of medical ultrasound video, two innovative technologies based on diagnostic region-of-interest (ROI) extraction using the high efficiency video coding (H.265/HEVC) standard are presented in this paper. First, an effective ROI extraction algorithm based on image textural features is proposed to strengthen the applicability of ROI detection results in the H.265/HEVC quad-tree coding structure. Second, a hierarchical coding method based on transform coefficient adjustment and a quantization parameter (QP) selection process is designed to implement the otherness encoding for ROIs and non-ROIs. Experimental results demonstrate that the proposed optimization strategy significantly improves the coding performance by achieving a BD-BR reduction of 13.52% and a BD-PSNR gain of 1.16 dB on average compared to H.265/HEVC (HM15.0). The proposed medical video coding algorithm is expected to satisfy low bit-rate compression requirements for modern medical communication systems.

Application discussion of source coding standard in voyage data recorder

NASA Astrophysics Data System (ADS)

Zong, Yonggang; Zhao, Xiandong

2018-04-01

This paper analyzes the disadvantages of the audio and video compression coding technology used by Voyage Data Recorder, and combines the improvement of performance of audio and video acquisition equipment. The thinking of improving the audio and video compression coding technology of the voyage data recorder is proposed, and the feasibility of adopting the new compression coding technology is analyzed from economy and technology two aspects.

Chroma sampling and modulation techniques in high dynamic range video coding

NASA Astrophysics Data System (ADS)

Dai, Wei; Krishnan, Madhu; Topiwala, Pankaj

2015-09-01

High Dynamic Range and Wide Color Gamut (HDR/WCG) Video Coding is an area of intense research interest in the engineering community, for potential near-term deployment in the marketplace. HDR greatly enhances the dynamic range of video content (up to 10,000 nits), as well as broadens the chroma representation (BT.2020). The resulting content offers new challenges in its coding and transmission. The Moving Picture Experts Group (MPEG) of the International Standards Organization (ISO) is currently exploring coding efficiency and/or the functionality enhancements of the recently developed HEVC video standard for HDR and WCG content. FastVDO has developed an advanced approach to coding HDR video, based on splitting the HDR signal into a smoothed luminance (SL) signal, and an associated base signal (B). Both signals are then chroma downsampled to YFbFr 4:2:0 signals, using advanced resampling filters, and coded using the Main10 High Efficiency Video Coding (HEVC) standard, which has been developed jointly by ISO/IEC MPEG and ITU-T WP3/16 (VCEG). Our proposal offers both efficient coding, and backwards compatibility with the existing HEVC Main10 Profile. That is, an existing Main10 decoder can produce a viewable standard dynamic range video, suitable for existing screens. Subjective tests show visible improvement over the anchors. Objective tests show a sizable gain of over 25% in PSNR (RGB domain) on average, for a key set of test clips selected by the ISO/MPEG committee.

Impact of Connecticut's graduated driver licensing system on teenage motor vehicle crash rates.

PubMed

Rogers, Steven C; Bentley, George C; Campbell, Brendan; Borrup, Kevin; Saleheen, Hassan; Wang, Zhu; Lapidus, Garry

2011-11-01

In response to high rates of teen motor vehicle crashes (MVCs) many states have enacted graduated driver licensing (GDL) systems. GDL delays full licensure and allows beginners to obtain experience under lower risk conditions. The purpose of this study is to evaluate the impact over the past 10 years to determine its effect on teen MVCs. Connecticut MVC data from 1999 to 2008 were analyzed. Percent change (1999 vs. 2008) in MVC rates per 10,000 registered drivers was calculated by age, gender, during the night restriction (11:00 pm and 5:00 am), and MVCs with passengers. Linear regression analysis estimated the decrease of MVC rates each year. The MVC rate decreased by 40% for 16-year-old and 30% for 17-year-old drivers. In comparison, rates among 18-year-old, 19-year-old, 25- to 29-year-old, and 30- to 59-year-old drivers were reduced by 16%, 7%, 8%, and 11%, respectively. The MVC rate for 20- to 24-year-old drivers increased by 1%. During nighttime restricted driving times, MVC rates decreased by 54% among 16-year-old and 49% among 17-year-old drivers. The MVC rate with passengers decreased by 65% for 16-year-old and 53% for 17-year-old drivers. In comparison, rates of nighttime and with passenger MVCs among older drivers were significantly less. Implementation of Connecticut's GDL system has resulted in significant reductions in MVC rates among novice drivers. This analysis provides a method for other states to examine the impact of their GDL system.

Wavelet-based audio embedding and audio/video compression

NASA Astrophysics Data System (ADS)

Mendenhall, Michael J.; Claypoole, Roger L., Jr.

2001-12-01

Watermarking, traditionally used for copyright protection, is used in a new and exciting way. An efficient wavelet-based watermarking technique embeds audio information into a video signal. Several effective compression techniques are applied to compress the resulting audio/video signal in an embedded fashion. This wavelet-based compression algorithm incorporates bit-plane coding, index coding, and Huffman coding. To demonstrate the potential of this audio embedding and audio/video compression algorithm, we embed an audio signal into a video signal and then compress. Results show that overall compression rates of 15:1 can be achieved. The video signal is reconstructed with a median PSNR of nearly 33 dB. Finally, the audio signal is extracted from the compressed audio/video signal without error.

Relationship of Aortic Wall Distensibility to Mitral and Aortic Valve Calcification: The Multi-Ethnic Study of Atherosclerosis.

PubMed

Cohoon, Kevin P; Criqui, Michael H; Budoff, Matthew J; Lima, Joao A; Blaha, Michael J; Decker, Paul A; Durazo, Ramon; Liu, Kiang; Kramer, Holly

2018-05-01

Data are limited on whether valvular calcification is associated with aortic wall stiffness. We tested whether aortic valve calcification (AVC) and/or mitral valve calcification (MVC) is inversely associated with aortic distensibility (AD). Cross-sectional study conducted in a subset of the Multi-Ethnic Study of Atherosclerosis (MESA) included 3676 MESA participants aged 44 to 84 years with AD measured with magnetic resonance imaging and with AVC and MVC measured with noncontrast cardiac computed tomography scans. Both AVC and MVC were divided into 3 categories: zero, < median values (low), and ≥ median values (high) for patients with nonzero values. Overall, 88% (n = 3256) and 92% (n = 3365) of participants had zero AVC and MVC, while 6% (n = 211) and 4% (n = 156) had low, and 6% (n = 209) and 4% (n = 155) had high values of AVC and MVC, respectively. The AVC was independently associated with AD after adjusting for age, gender, and ethnicity ( P = .035). No association was noted between AVC groups and AD after adjustment for all covariates or MVC groups and AD in any model.

Mixture block coding with progressive transmission in packet video. Appendix 1: Item 2. M.S. Thesis

NASA Technical Reports Server (NTRS)

Chen, Yun-Chung

1989-01-01

Video transmission will become an important part of future multimedia communication because of dramatically increasing user demand for video, and rapid evolution of coding algorithm and VLSI technology. Video transmission will be part of the broadband-integrated services digital network (B-ISDN). Asynchronous transfer mode (ATM) is a viable candidate for implementation of B-ISDN due to its inherent flexibility, service independency, and high performance. According to the characteristics of ATM, the information has to be coded into discrete cells which travel independently in the packet switching network. A practical realization of an ATM video codec called Mixture Block Coding with Progressive Transmission (MBCPT) is presented. This variable bit rate coding algorithm shows how a constant quality performance can be obtained according to user demand. Interactions between codec and network are emphasized including packetization, service synchronization, flow control, and error recovery. Finally, some simulation results based on MBCPT coding with error recovery are presented.

Predicting Risk of Motor Vehicle Collisions in Patients with Glaucoma: A Longitudinal Study.

PubMed

Gracitelli, Carolina P B; Tatham, Andrew J; Boer, Erwin R; Abe, Ricardo Y; Diniz-Filho, Alberto; Rosen, Peter N; Medeiros, Felipe A

2015-01-01

To evaluate the ability of longitudinal Useful Field of View (UFOV) and simulated driving measurements to predict future occurrence of motor vehicle collision (MVC) in drivers with glaucoma. Prospective observational cohort study. 117 drivers with glaucoma followed for an average of 2.1 ± 0.5 years. All subjects had standard automated perimetry (SAP), UFOV, driving simulator, and cognitive assessment obtained at baseline and every 6 months during follow-up. The driving simulator evaluated reaction times to high and low contrast peripheral divided attention stimuli presented while negotiating a winding country road, with central driving task performance assessed as "curve coherence". Drivers with MVC during follow-up were identified from Department of Motor Vehicle records. Survival models were used to evaluate the ability of driving simulator and UFOV to predict MVC over time, adjusting for potential confounding factors. Mean age at baseline was 64.5 ± 12.6 years. 11 of 117 (9.4%) drivers had a MVC during follow-up. In the multivariable models, low contrast reaction time was significantly predictive of MVC, with a hazard ratio (HR) of 2.19 per 1 SD slower reaction time (95% CI, 1.30 to 3.69; P = 0.003). UFOV divided attention was also significantly predictive of MVC with a HR of 1.98 per 1 SD worse (95% CI, 1.10 to 3.57; P = 0.022). Global SAP visual field indices in the better or worse eye were not predictive of MVC. The longitudinal model including driving simulator performance was a better predictor of MVC compared to UFOV (R2 = 0.41 vs R2 = 0.18). Longitudinal divided attention metrics on the UFOV test and during simulated driving were significantly predictive of risk of MVC in glaucoma patients. These findings may help improve the understanding of factors associated with driving impairment related to glaucoma.

Apply network coding for H.264/SVC multicasting

NASA Astrophysics Data System (ADS)

Wang, Hui; Kuo, C.-C. Jay

2008-08-01

In a packet erasure network environment, video streaming benefits from error control in two ways to achieve graceful degradation. The first approach is application-level (or the link-level) forward error-correction (FEC) to provide erasure protection. The second error control approach is error concealment at the decoder end to compensate lost packets. A large amount of research work has been done in the above two areas. More recently, network coding (NC) techniques have been proposed for efficient data multicast over networks. It was shown in our previous work that multicast video streaming benefits from NC for its throughput improvement. An algebraic model is given to analyze the performance in this work. By exploiting the linear combination of video packets along nodes in a network and the SVC video format, the system achieves path diversity automatically and enables efficient video delivery to heterogeneous receivers in packet erasure channels. The application of network coding can protect video packets against the erasure network environment. However, the rank defficiency problem of random linear network coding makes the error concealment inefficiently. It is shown by computer simulation that the proposed NC video multicast scheme enables heterogenous receiving according to their capacity constraints. But it needs special designing to improve the video transmission performance when applying network coding.

Quality of experience enhancement of high efficiency video coding video streaming in wireless packet networks using multiple description coding

NASA Astrophysics Data System (ADS)

Boumehrez, Farouk; Brai, Radhia; Doghmane, Noureddine; Mansouri, Khaled

2018-01-01

Recently, video streaming has attracted much attention and interest due to its capability to process and transmit large data. We propose a quality of experience (QoE) model relying on high efficiency video coding (HEVC) encoder adaptation scheme, in turn based on the multiple description coding (MDC) for video streaming. The main contributions of the paper are (1) a performance evaluation of the new and emerging video coding standard HEVC/H.265, which is based on the variation of quantization parameter (QP) values depending on different video contents to deduce their influence on the sequence to be transmitted, (2) QoE support multimedia applications in wireless networks are investigated, so we inspect the packet loss impact on the QoE of transmitted video sequences, (3) HEVC encoder parameter adaptation scheme based on MDC is modeled with the encoder parameter and objective QoE model. A comparative study revealed that the proposed MDC approach is effective for improving the transmission with a peak signal-to-noise ratio (PSNR) gain of about 2 to 3 dB. Results show that a good choice of QP value can compensate for transmission channel effects and improve received video quality, although HEVC/H.265 is also sensitive to packet loss. The obtained results show the efficiency of our proposed method in terms of PSNR and mean-opinion-score.

Interactive Video Coding and Transmission over Heterogeneous Wired-to-Wireless IP Networks Using an Edge Proxy

NASA Astrophysics Data System (ADS)

Pei, Yong; Modestino, James W.

2004-12-01

Digital video delivered over wired-to-wireless networks is expected to suffer quality degradation from both packet loss and bit errors in the payload. In this paper, the quality degradation due to packet loss and bit errors in the payload are quantitatively evaluated and their effects are assessed. We propose the use of a concatenated forward error correction (FEC) coding scheme employing Reed-Solomon (RS) codes and rate-compatible punctured convolutional (RCPC) codes to protect the video data from packet loss and bit errors, respectively. Furthermore, the performance of a joint source-channel coding (JSCC) approach employing this concatenated FEC coding scheme for video transmission is studied. Finally, we describe an improved end-to-end architecture using an edge proxy in a mobile support station to implement differential error protection for the corresponding channel impairments expected on the two networks. Results indicate that with an appropriate JSCC approach and the use of an edge proxy, FEC-based error-control techniques together with passive error-recovery techniques can significantly improve the effective video throughput and lead to acceptable video delivery quality over time-varying heterogeneous wired-to-wireless IP networks.

A unified framework of unsupervised subjective optimized bit allocation for multiple video object coding

NASA Astrophysics Data System (ADS)

Chen, Zhenzhong; Han, Junwei; Ngan, King Ngi

2005-10-01

MPEG-4 treats a scene as a composition of several objects or so-called video object planes (VOPs) that are separately encoded and decoded. Such a flexible video coding framework makes it possible to code different video object with different distortion scale. It is necessary to analyze the priority of the video objects according to its semantic importance, intrinsic properties and psycho-visual characteristics such that the bit budget can be distributed properly to video objects to improve the perceptual quality of the compressed video. This paper aims to provide an automatic video object priority definition method based on object-level visual attention model and further propose an optimization framework for video object bit allocation. One significant contribution of this work is that the human visual system characteristics are incorporated into the video coding optimization process. Another advantage is that the priority of the video object can be obtained automatically instead of fixing weighting factors before encoding or relying on the user interactivity. To evaluate the performance of the proposed approach, we compare it with traditional verification model bit allocation and the optimal multiple video object bit allocation algorithms. Comparing with traditional bit allocation algorithms, the objective quality of the object with higher priority is significantly improved under this framework. These results demonstrate the usefulness of this unsupervised subjective quality lifting framework.

Reliability of a Novel High Intensity One Leg Dynamic Exercise Protocol to Measure Muscle Endurance

PubMed Central

Lepers, Romuald; Marcora, Samuele M.

2016-01-01

We recently developed a high intensity one leg dynamic exercise (OLDE) protocol to measure muscle endurance and investigate the central and peripheral mechanisms of muscle fatigue. The aims of the present study were to establish the reliability of this novel protocol and describe the isokinetic muscle fatigue induced by high intensity OLDE and its recovery. Eight subjects performed the OLDE protocol (time to exhaustion test of the right leg at 85% of peak power output) three times over a week period. Isokinetic maximal voluntary contraction torque at 60 (MVC60), 100 (MVC100) and 140 (MVC140) deg/s was measured pre-exercise, shortly after exhaustion (13 ± 4 s), 20 s (P20) and 40 s (P40) post-exercise. Electromyographic (EMG) signal was analyzed via the root mean square (RMS) for all three superficial knee extensors. Mean time to exhaustion was 5.96 ± 1.40 min, coefficient of variation was 8.42 ± 6.24%, typical error of measurement was 0.30 min and intraclass correlation was 0.795. MVC torque decreased shortly after exhaustion for all angular velocities (all P < 0.001). MVC60 and MVC100 recovered between P20 (P < 0.05) and exhaustion and then plateaued. MVC140 recovered only at P40 (P < 0.05). High intensity OLDE did not alter maximal EMG RMS of the three superficial knee extensors during MVC. The results of this study demonstrate that this novel high intensity OLDE protocol could be reliably used to measure muscle endurance, and that muscle fatigue induced by high intensity OLDE should be examined within ~ 30 s following exhaustion. PMID:27706196

Phase 1 Safety, Pharmacokinetics, and Pharmacodynamics of Dapivirine and Maraviroc Vaginal Rings: A Double-Blind Randomized Trial.

PubMed

Chen, Beatrice A; Panther, Lori; Marzinke, Mark A; Hendrix, Craig W; Hoesley, Craig J; van der Straten, Ariane; Husnik, Marla J; Soto-Torres, Lydia; Nel, Annalene; Johnson, Sherri; Richardson-Harman, Nicola; Rabe, Lorna K; Dezzutti, Charlene S

2015-11-01

Variable adherence limits effectiveness of daily oral and intravaginal tenofovir-containing pre-exposure prophylaxis. Monthly vaginal antiretroviral rings are one approach to improve adherence and drug delivery. MTN-013/IPM 026, a multisite, double-blind, randomized, placebo-controlled trial in 48 HIV-negative US women, evaluated vaginal rings containing dapivirine (DPV) (25 mg) and maraviroc (MVC) (100 mg), DPV only, MVC only, and placebo used continuously for 28 days. Safety was assessed by adverse events. Drug concentrations were quantified in plasma, cervicovaginal fluid (CVF), and cervical tissue. Cervical biopsy explants were challenged with HIV ex vivo to evaluate pharmacodynamics. There was no difference in related genitourinary adverse events between treatment arms compared with placebo. DPV and MVC concentrations rose higher initially before falling more rapidly with the combination ring compared with relatively stable concentrations with the single-drug rings. DPV concentrations in CVF were 1 and 5 log10 greater than cervical tissue and plasma for both rings. MVC was consistently detected only in CVF. DPV and MVC CVF and DPV tissue concentrations dropped rapidly after ring removal. Cervical tissue showed a significant inverse linear relationship between HIV replication and DPV levels. In this first study of a combination microbicide vaginal ring, all 4 rings were safe and well tolerated. Tissue DPV concentrations were 1000 times greater than plasma concentrations and single drug rings had more stable pharmacokinetics. DPV, but not MVC, demonstrated concentration-dependent inhibition of HIV-1 infection in cervical tissue. Because MVC concentrations were consistently detectable only in CVF and not in plasma, improved drug release of MVC rings is needed.

Real-time transmission of digital video using variable-length coding

NASA Technical Reports Server (NTRS)

Bizon, Thomas P.; Shalkhauser, Mary JO; Whyte, Wayne A., Jr.

1993-01-01

Huffman coding is a variable-length lossless compression technique where data with a high probability of occurrence is represented with short codewords, while 'not-so-likely' data is assigned longer codewords. Compression is achieved when the high-probability levels occur so frequently that their benefit outweighs any penalty paid when a less likely input occurs. One instance where Huffman coding is extremely effective occurs when data is highly predictable and differential coding can be applied (as with a digital video signal). For that reason, it is desirable to apply this compression technique to digital video transmission; however, special care must be taken in order to implement a communication protocol utilizing Huffman coding. This paper addresses several of the issues relating to the real-time transmission of Huffman-coded digital video over a constant-rate serial channel. Topics discussed include data rate conversion (from variable to a fixed rate), efficient data buffering, channel coding, recovery from communication errors, decoder synchronization, and decoder architectures. A description of the hardware developed to execute Huffman coding and serial transmission is also included. Although this paper focuses on matters relating to Huffman-coded digital video, the techniques discussed can easily be generalized for a variety of applications which require transmission of variable-length data.

Motor Vehicle Crash Brain Injury in Infants and Toddlers: A Suitable Model for Inflicted Head Injury?

ERIC Educational Resources Information Center

Shah, Mahim; Vavilala, Monica S.; Feldman, Kenneth W.; Hallam, Daniel K.

2005-01-01

Objective: Children involved in motor vehicle crash (MVC) events might experience angular accelerations similar to those experienced by children with inflicted traumatic brain injury (iTBI). This is a pilot study to determine whether the progression of signs and symptoms and radiographic findings of MVC brain injury (mvcTBI) in children of the age…

Effects of Blood-Flow Restriction Combined With Postactivation Potentiation Stimuli on Jump Performance in Recreationally Active Men.

PubMed

Miller, Ryan M; Keeter, Victoria M; Freitas, Eduardo D S; Heishman, Aaron D; Knehans, Allen W; Bemben, Debra A; Bemben, Michael G

2018-07-01

Miller, RM, Keeter, VM, Freitas, EDS, Heishman, AD, Knehans, AW, Bemben, DA, and Bemben, MG. Effects of blood-flow restriction combined with postactivation potentiation stimuli on jump performance in recreationally active men. J Strength Cond Res 32(7): 1869-1874, 2018-Whole-body vibration (WBV) and maximum voluntary contractions (MVCs) combined with blood-flow restriction (BFR) to augment postactivation potentiation have yet to be examined. Therefore, the purpose of this investigation was to examine the augmented effects of postactivation potentiation when WBV and MVC are combined with BFR. Twenty men (21.8 ± 2.6 years, 180.5 ± 6.2 cm and 84.5 ± 12.1 kg) completed the study. Participants completed 3 testing sessions in a randomized design that included one of the following: (a) control (CON), (b) WBV and WBV combined with BFR (WBV + BFR), or (c) MVC and MVC combined with BFR (MVC + BFR). Jump height and power were recorded for 3 trials, PRE and POST jump height (cm) mean ± SD for each were as follows: CON 58.9 ± 8.6 and 57.9 ± 8.6, WBV 58.2 ± 8.1 and 59.9 ± 8.1, WBV + BFR 58.7 ± 7.6 and 60.2 ± 8.1, MVC 59.7 ± 7.4 and 60.2 ± 8.6, and MVC + BFR 57.7 ± 7.9 and 59.4 ± 8.1. PRE and POST jump power (W) mean ± SD for each were as follows: CON 1,224.3 ± 221.5 and 1,234.3 ± 189.2, WBV 1,251.1 ± 230.4 and 1,266.1 ± 215.7, WBV + BFR 1,265.8 ± 207.9 and 1,259 ± 223.3, MVC 1,264.7 ± 211.9 and 1,263.5 ± 236.5, and MVC + BFR 1,252.3 ± 222.0 and 1,294.6 ± 256.6. Significant differences were revealed in jump height between the 5 interventions (p < 0.01), WBV (p < 0.01), WBV + BFR (p < 0.01), and MVC + BFR (p < 0.01) revealed significant differences in time but no differences in jump power. In conclusion, the results of this study indicate that WBV, WBV + BFR, and MVC + BFR significantly improve jump height and time in air but not jump power.

The emerging High Efficiency Video Coding standard (HEVC)

NASA Astrophysics Data System (ADS)

Raja, Gulistan; Khan, Awais

2013-12-01

High definition video (HDV) is becoming popular day by day. This paper describes the performance analysis of latest upcoming video standard known as High Efficiency Video Coding (HEVC). HEVC is designed to fulfil all the requirements for future high definition videos. In this paper, three configurations (intra only, low delay and random access) of HEVC are analyzed using various 480p, 720p and 1080p high definition test video sequences. Simulation results show the superior objective and subjective quality of HEVC.

Spatial resampling of IDR frames for low bitrate video coding with HEVC

NASA Astrophysics Data System (ADS)

Hosking, Brett; Agrafiotis, Dimitris; Bull, David; Easton, Nick

2015-03-01

As the demand for higher quality and higher resolution video increases, many applications fail to meet this demand due to low bandwidth restrictions. One factor contributing to this problem is the high bitrate requirement of the intra-coded Instantaneous Decoding Refresh (IDR) frames featuring in all video coding standards. Frequent coding of IDR frames is essential for error resilience in order to prevent the occurrence of error propagation. However, as each one consumes a huge portion of the available bitrate, the quality of future coded frames is hindered by high levels of compression. This work presents a new technique, known as Spatial Resampling of IDR Frames (SRIF), and shows how it can increase the rate distortion performance by providing a higher and more consistent level of video quality at low bitrates.

Resource allocation for error resilient video coding over AWGN using optimization approach.

PubMed

An, Cheolhong; Nguyen, Truong Q

2008-12-01

The number of slices for error resilient video coding is jointly optimized with 802.11a-like media access control and the physical layers with automatic repeat request and rate compatible punctured convolutional code over additive white gaussian noise channel as well as channel times allocation for time division multiple access. For error resilient video coding, the relation between the number of slices and coding efficiency is analyzed and formulated as a mathematical model. It is applied for the joint optimization problem, and the problem is solved by a convex optimization method such as the primal-dual decomposition method. We compare the performance of a video communication system which uses the optimal number of slices with one that codes a picture as one slice. From numerical examples, end-to-end distortion of utility functions can be significantly reduced with the optimal slices of a picture especially at low signal-to-noise ratio.

H.264 Layered Coded Video over Wireless Networks: Channel Coding and Modulation Constraints

NASA Astrophysics Data System (ADS)

Ghandi, M. M.; Barmada, B.; Jones, E. V.; Ghanbari, M.

2006-12-01

This paper considers the prioritised transmission of H.264 layered coded video over wireless channels. For appropriate protection of video data, methods such as prioritised forward error correction coding (FEC) or hierarchical quadrature amplitude modulation (HQAM) can be employed, but each imposes system constraints. FEC provides good protection but at the price of a high overhead and complexity. HQAM is less complex and does not introduce any overhead, but permits only fixed data ratios between the priority layers. Such constraints are analysed and practical solutions are proposed for layered transmission of data-partitioned and SNR-scalable coded video where combinations of HQAM and FEC are used to exploit the advantages of both coding methods. Simulation results show that the flexibility of SNR scalability and absence of picture drift imply that SNR scalability as modelled is superior to data partitioning in such applications.

Longitudinal Study of Mental Health and Pain-Related Functioning Following a Motor Vehicle Collision.

PubMed

Valentine, Sarah E; Gerber, Monica W; Nobles, Carrie J; Shtasel, Derri L; Marques, Luana

2016-03-21

Relations between mental and physical health symptoms are well-established in the literature on recovery following motor vehicle collisions (MVCs). To understand the temporal sequencing and evolution of these relations, we examined the bidirectional association between mental and physical health symptoms at 4 and 16 weeks following a MVC. The sample consisted of 103 participants recruited through public MVC police reports. The study included self-report assessments for posttraumatic stress symptoms, depressive symptoms, bodily pain, and role limitations attributable to physical health. A series of multivariable linear regression analyses were conducted to estimate the associations between these mental and physical health outcomes. The analysis revealed that mental health symptoms at 4 weeks post-MVC were associated with higher bodily pain at 16 weeks post-MVC (PTSD symptoms: β = -0.74, 95% CI: -1.06, -0.42; depressive symptoms: β = -1.34, 95% CI: -1.90, -0.78), but not higher health-related role limitations. Physical health symptoms at 4 weeks post-MVC were not associated with PTSD or depressive symptoms at 16 weeks post-MVC. The results indicate the predictive strength of mental health symptoms at 4 weeks post-MVC in identifying individuals at risk for bodily pain at 16 weeks and shed light on the temporal sequencing of how relations between physical and mental health symptoms emerge over time. This suggests that early assessment of mental health symptoms may have significant implications for the treatment of these patients. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

M-wave, H- and V-reflex recruitment curves during maximal voluntary contraction.

PubMed

Racinais, Sebastien; Maffiuletti, Nicola A; Girard, Olivier

2013-08-01

To investigate whether the H reflex-M wave recruitment curves obtained during maximal voluntary contraction (MVC) differ from rest and to determine the stimulation intensities allowing to record stable reflex responses. Full recruitment curves (precision, 2 mA) were obtained from the soleus muscle in 14 volunteers at rest and during plantar flexion MVCs. Maximal M-wave reached significantly larger amplitude during MVC (+2.2 [0.4; 3.9] mV) for a higher stimulation intensity (+7.9 [-0.4; 16] mA). Similarly, maximal H-reflex reached significantly larger amplitude during MVC than at rest (+3.2 [0.9; 5.5] mV) for a much higher stimulation intensity (+17.7 [9.7; 25.7] mA). V-wave amplitude plateaued only when M-wave during MVC plateaued, that is, at higher intensity than M-wave at rest. V-wave was correlated to the maximal H-reflex during MVC (r = 0.79, P < 0.05). Electrically evoked potentials showed a specific recruitment curve during MVC with higher maximal values attained for higher stimulation intensities. Thus, recording reflex responses during MVC based on intensities determined at rest or as a percentage of M-wave may yield inaccurate results. V-wave presented a plateau for stimulation intensity of 1.5 times the onset of the resting M-wave plateau. Evoked potentials obtained during actual contractions should be normalized to M-waves obtained during contractions of the same force level.

Compression of stereoscopic video using MPEG-2

NASA Astrophysics Data System (ADS)

Puri, A.; Kollarits, Richard V.; Haskell, Barry G.

1995-10-01

Many current as well as emerging applications in areas of entertainment, remote operations, manufacturing industry and medicine can benefit from the depth perception offered by stereoscopic video systems which employ two views of a scene imaged under the constraints imposed by human visual system. Among the many challenges to be overcome for practical realization and widespread use of 3D/stereoscopic systems are good 3D displays and efficient techniques for digital compression of enormous amounts of data while maintaining compatibility with normal video decoding and display systems. After a brief introduction to the basics of 3D/stereo including issues of depth perception, stereoscopic 3D displays and terminology in stereoscopic imaging and display, we present an overview of tools in the MPEG-2 video standard that are relevant to our discussion on compression of stereoscopic video, which is the main topic of this paper. Next, we outilne the various approaches for compression of stereoscopic video and then focus on compatible stereoscopic video coding using MPEG-2 Temporal scalability concepts. Compatible coding employing two different types of prediction structures become potentially possible, disparity compensated prediction and combined disparity and motion compensated predictions. To further improve coding performance and display quality, preprocessing for reducing mismatch between the two views forming stereoscopic video is considered. Results of simulations performed on stereoscopic video of normal TV resolution are then reported comparing the performance of two prediction structures with the simulcast solution. It is found that combined disparity and motion compensated prediction offers the best performance. Results indicate that compression of both views of stereoscopic video of normal TV resolution appears feasible in a total of 6 to 8 Mbit/s. We then discuss regarding multi-viewpoint video, a generalization of stereoscopic video. Finally, we describe ongoing efforts within MPEG-2 to define a profile for stereoscopic video coding, as well as, the promise of MPEG-4 in addressing coding of multi-viewpoint video.

Compression of stereoscopic video using MPEG-2

NASA Astrophysics Data System (ADS)

Puri, Atul; Kollarits, Richard V.; Haskell, Barry G.

1995-12-01

Many current as well as emerging applications in areas of entertainment, remote operations, manufacturing industry and medicine can benefit from the depth perception offered by stereoscopic video systems which employ two views of a scene imaged under the constraints imposed by human visual system. Among the many challenges to be overcome for practical realization and widespread use of 3D/stereoscopic systems are good 3D displays and efficient techniques for digital compression of enormous amounts of data while maintaining compatibility with normal video decoding and display systems. After a brief introduction to the basics of 3D/stereo including issues of depth perception, stereoscopic 3D displays and terminology in stereoscopic imaging and display, we present an overview of tools in the MPEG-2 video standard that are relevant to our discussion on compression of stereoscopic video, which is the main topic of this paper. Next, we outline the various approaches for compression of stereoscopic video and then focus on compatible stereoscopic video coding using MPEG-2 Temporal scalability concepts. Compatible coding employing two different types of prediction structures become potentially possible, disparity compensated prediction and combined disparity and motion compensated predictions. To further improve coding performance and display quality, preprocessing for reducing mismatch between the two views forming stereoscopic video is considered. Results of simulations performed on stereoscopic video of normal TV resolution are then reported comparing the performance of two prediction structures with the simulcast solution. It is found that combined disparity and motion compensated prediction offers the best performance. Results indicate that compression of both views of stereoscopic video of normal TV resolution appears feasible in a total of 6 to 8 Mbit/s. We then discuss regarding multi-viewpoint video, a generalization of stereoscopic video. Finally, we describe ongoing efforts within MPEG-2 to define a profile for stereoscopic video coding, as well as, the promise of MPEG-4 in addressing coding of multi-viewpoint video.

Video coding for 3D-HEVC based on saliency information

NASA Astrophysics Data System (ADS)

Yu, Fang; An, Ping; Yang, Chao; You, Zhixiang; Shen, Liquan

2016-11-01

As an extension of High Efficiency Video Coding ( HEVC), 3D-HEVC has been widely researched under the impetus of the new generation coding standard in recent years. Compared with H.264/AVC, its compression efficiency is doubled while keeping the same video quality. However, its higher encoding complexity and longer encoding time are not negligible. To reduce the computational complexity and guarantee the subjective quality of virtual views, this paper presents a novel video coding method for 3D-HEVC based on the saliency informat ion which is an important part of Human Visual System (HVS). First of all, the relationship between the current coding unit and its adjacent units is used to adjust the maximum depth of each largest coding unit (LCU) and determine the SKIP mode reasonably. Then, according to the saliency informat ion of each frame image, the texture and its corresponding depth map will be divided into three regions, that is, salient area, middle area and non-salient area. Afterwards, d ifferent quantization parameters will be assigned to different regions to conduct low complexity coding. Finally, the compressed video will generate new view point videos through the renderer tool. As shown in our experiments, the proposed method saves more bit rate than other approaches and achieves up to highest 38% encoding time reduction without subjective quality loss in compression or rendering.

Layer-based buffer aware rate adaptation design for SHVC video streaming

NASA Astrophysics Data System (ADS)

Gudumasu, Srinivas; Hamza, Ahmed; Asbun, Eduardo; He, Yong; Ye, Yan

2016-09-01

This paper proposes a layer based buffer aware rate adaptation design which is able to avoid abrupt video quality fluctuation, reduce re-buffering latency and improve bandwidth utilization when compared to a conventional simulcast based adaptive streaming system. The proposed adaptation design schedules DASH segment requests based on the estimated bandwidth, dependencies among video layers and layer buffer fullness. Scalable HEVC video coding is the latest state-of-art video coding technique that can alleviate various issues caused by simulcast based adaptive video streaming. With scalable coded video streams, the video is encoded once into a number of layers representing different qualities and/or resolutions: a base layer (BL) and one or more enhancement layers (EL), each incrementally enhancing the quality of the lower layers. Such layer based coding structure allows fine granularity rate adaptation for the video streaming applications. Two video streaming use cases are presented in this paper. The first use case is to stream HD SHVC video over a wireless network where available bandwidth varies, and the performance comparison between proposed layer-based streaming approach and conventional simulcast streaming approach is provided. The second use case is to stream 4K/UHD SHVC video over a hybrid access network that consists of a 5G millimeter wave high-speed wireless link and a conventional wired or WiFi network. The simulation results verify that the proposed layer based rate adaptation approach is able to utilize the bandwidth more efficiently. As a result, a more consistent viewing experience with higher quality video content and minimal video quality fluctuations can be presented to the user.

Patient-Physician Communication About Code Status Preferences: A Randomized Controlled Trial

PubMed Central

Rhondali, Wadih; Perez-Cruz, Pedro; Hui, David; Chisholm, Gary B.; Dalal, Shalini; Baile, Walter; Chittenden, Eva; Bruera, Eduardo

2013-01-01

Purpose Code status discussions are important in cancer care. The best modality for such discussions has not been established. Our objective was to determine the impact of a physician ending a code status discussion with a question (autonomy approach) versus a recommendation (beneficence approach) on patients' do-not-resuscitate (DNR) preference. Methods Patients in a supportive care clinic watched two videos showing a physician-patient discussion regarding code status. Both videos were identical except for the ending: one ended with the physician asking for the patient's code status preference and the other with the physician recommending DNR. Patients were randomly assigned to watch the videos in different sequences. The main outcome was the proportion of patients choosing DNR for the video patient. Results 78 patients completed the study. 74% chose DNR after the question video, 73% after the recommendation video. Median physician compassion score was very high and not different for both videos. 30/30 patients who had chosen DNR for themselves and 30/48 patients who had not chosen DNR for themselves chose DNR for the video patient (100% v/s 62%). Age (OR=1.1/year) and white ethnicity (OR=9.43) predicted DNR choice for the video patient. Conclusion Ending DNR discussions with a question or a recommendation did not impact DNR choice or perception of physician compassion. Therefore, both approaches are clinically appropriate. All patients who chose DNR for themselves and most patients who did not choose DNR for themselves chose DNR for the video patient. Age and race predicted DNR choice. PMID:23564395

Integer-Linear-Programing Optimization in Scalable Video Multicast with Adaptive Modulation and Coding in Wireless Networks

PubMed Central

Lee, Chaewoo

2014-01-01

The advancement in wideband wireless network supports real time services such as IPTV and live video streaming. However, because of the sharing nature of the wireless medium, efficient resource allocation has been studied to achieve a high level of acceptability and proliferation of wireless multimedia. Scalable video coding (SVC) with adaptive modulation and coding (AMC) provides an excellent solution for wireless video streaming. By assigning different modulation and coding schemes (MCSs) to video layers, SVC can provide good video quality to users in good channel conditions and also basic video quality to users in bad channel conditions. For optimal resource allocation, a key issue in applying SVC in the wireless multicast service is how to assign MCSs and the time resources to each SVC layer in the heterogeneous channel condition. We formulate this problem with integer linear programming (ILP) and provide numerical results to show the performance under 802.16 m environment. The result shows that our methodology enhances the overall system throughput compared to an existing algorithm. PMID:25276862

Methodology of AA CRASH: a prospective observational study evaluating the incidence and pathogenesis of adverse post-traumatic sequelae in African-Americans experiencing motor vehicle collision.

PubMed

Linnstaedt, Sarah D; Hu, JunMei; Liu, Andrea Y; Soward, April C; Bollen, Kenneth A; Wang, Henry E; Hendry, Phyllis L; Zimny, Erin; Lewandowski, Christopher; Velilla, Marc-Anthony; Damiron, Kathia; Pearson, Claire; Domeier, Robert; Kaushik, Sangeeta; Feldman, James; Rosenberg, Mark; Jones, Jeffrey; Swor, Robert; Rathlev, Niels; McLean, Samuel A

2016-09-06

A motor vehicle collision (MVC) is one of the most common life-threatening events experienced by individuals living in the USA. While most individuals recover following MVC, a significant proportion of individuals develop adverse post-traumatic sequelae such as post-traumatic stress disorder or persistent musculoskeletal pain. Adverse post-traumatic sequelae are common, morbid and costly public health problems in the USA and other industrialised countries. The pathogenesis of these disorders following MVC remains poorly understood. In the USA, available data suggest that African-Americans experience an increased burden of adverse post-traumatic sequelae after MVC compared to European Americans, but to date no studies examining the pathogenesis of these disorders among African-Americans experiencing MVC have been performed. The African-American CRASH (AA CRASH) study is an NIH-funded, multicentre, prospective study that enrols African-Americans (n=900) who present to the emergency department (ED) within 24 hours of MVC. Participants are enrolled at 13 ED sites in the USA. Individuals who are admitted to the hospital or who report a fracture or tissue injury are excluded. Participants complete a detailed ED interview that includes an assessment of crash history, current post-traumatic symptoms and health status prior to the MVC. Blood samples are also collected in the ED using PAXgene DNA and PAXgene RNA tubes. Serial mixed-mode assessments 6 weeks, 6 months and 1 year after MVC include an assessment of adverse sequelae, general health status and health service utilisation. The results from this study will provide insights into the incidence and pathogenesis of persistent pain and other post-traumatic sequelae in African-Americans experiencing MVC. AA CRASH has ethics approval in the USA, and the results will be published in a peer-reviewed journal. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Electromyographic analyses of the erector spinae muscles during golf swings using four different clubs.

PubMed

Sorbie, Graeme G; Grace, Fergal M; Gu, Yaodong; Baker, Julien S; Ugbolue, Ukadike C

2018-04-01

The purpose of this study was to compare the electromyography (EMG) patterns of the thoracic and lumbar regions of the erector spinae (ES) muscle during the golf swing whilst using four different golf clubs. Fifteen right-handed male golfers performed a total of twenty swings in random order using the driver, 4-iron, 7-iron and pitching-wedge. Surface EMG was recorded from the lead and trail sides of the thoracic and lumbar regions of the ES muscle (T8, L1 and L5 lateral to the spinous-process). Three-dimensional high-speed video analysis was used to identify the backswing, forward swing, acceleration, early and late follow-through phases of the golf swing. No significant differences in muscle-activation levels from the lead and trail sides of the thoracic and lumbar regions of the ES muscle were displayed between the driver, 4-iron, 7-iron and pitching-wedge (P > 0.05). The highest mean thoracic and lumbar ES muscle-activation levels were displayed in the forward swing (67-99% MVC) and acceleration (83-106% MVC) phases of the swing for all clubs tested. The findings from this study show that there were no significant statistical differences between the driver, 4-iron, 7-iron and pitching-wedge when examining muscle activity from the thoracic and lumbar regions of the ES muscle.

Learning-Based Just-Noticeable-Quantization- Distortion Modeling for Perceptual Video Coding.

PubMed

Ki, Sehwan; Bae, Sung-Ho; Kim, Munchurl; Ko, Hyunsuk

2018-07-01

Conventional predictive video coding-based approaches are reaching the limit of their potential coding efficiency improvements, because of severely increasing computation complexity. As an alternative approach, perceptual video coding (PVC) has attempted to achieve high coding efficiency by eliminating perceptual redundancy, using just-noticeable-distortion (JND) directed PVC. The previous JNDs were modeled by adding white Gaussian noise or specific signal patterns into the original images, which were not appropriate in finding JND thresholds due to distortion with energy reduction. In this paper, we present a novel discrete cosine transform-based energy-reduced JND model, called ERJND, that is more suitable for JND-based PVC schemes. Then, the proposed ERJND model is extended to two learning-based just-noticeable-quantization-distortion (JNQD) models as preprocessing that can be applied for perceptual video coding. The two JNQD models can automatically adjust JND levels based on given quantization step sizes. One of the two JNQD models, called LR-JNQD, is based on linear regression and determines the model parameter for JNQD based on extracted handcraft features. The other JNQD model is based on a convolution neural network (CNN), called CNN-JNQD. To our best knowledge, our paper is the first approach to automatically adjust JND levels according to quantization step sizes for preprocessing the input to video encoders. In experiments, both the LR-JNQD and CNN-JNQD models were applied to high efficiency video coding (HEVC) and yielded maximum (average) bitrate reductions of 38.51% (10.38%) and 67.88% (24.91%), respectively, with little subjective video quality degradation, compared with the input without preprocessing applied.

A Randomized Controlled Trial of a CPR Decision Support Video for Patients Admitted to the General Medicine Service.

PubMed

Merino, Aimee M; Greiner, Ryan; Hartwig, Kristopher

2017-09-01

Patient preferences regarding cardiopulmonary resuscitation (CPR) are important, especially during hospitalization when a patient's health is changing. Yet many patients are not adequately informed or involved in the decision-making process. We examined the effect of an informational video about CPR on hospitalized patients' code status choices. This was a prospective, randomized trial conducted at the Minneapolis Veterans Affairs Health Care System in Minnesota. We enrolled 119 patients, hospitalized on the general medicine service, and at least 65 years old. The majority were men (97%) with a mean age of 75. A video described code status choices: full code (CPR and intubation if required), do not resuscitate (DNR), and do not resuscitate/do not intubate (DNR/DNI). Participants were randomized to watch the video (n = 59) or usual care (n = 60). The primary outcome was participants' code status preferences. Secondary outcomes included a questionnaire designed to evaluate participants' trust in their healthcare team and knowledge and perceptions about CPR. Participants who viewed the video were less likely to choose full code (37%) compared to participants in the usual care group (71%) and more likely to choose DNR/DNI (56% in the video group vs. 17% in the control group) ( < 0.00001). We did not see a difference in trust in their healthcare team or knowledge and perceptions about CPR as assessed by our questionnaire. Hospitalized patients who watched a video about CPR and code status choices were less likely to choose full code and more likely to choose DNR/DNI. © 2017 Society of Hospital Medicine

Toward enhancing the distributed video coder under a multiview video codec framework

NASA Astrophysics Data System (ADS)

Lee, Shih-Chieh; Chen, Jiann-Jone; Tsai, Yao-Hong; Chen, Chin-Hua

2016-11-01

The advance of video coding technology enables multiview video (MVV) or three-dimensional television (3-D TV) display for users with or without glasses. For mobile devices or wireless applications, a distributed video coder (DVC) can be utilized to shift the encoder complexity to decoder under the MVV coding framework, denoted as multiview distributed video coding (MDVC). We proposed to exploit both inter- and intraview video correlations to enhance side information (SI) and improve the MDVC performance: (1) based on the multiview motion estimation (MVME) framework, a categorized block matching prediction with fidelity weights (COMPETE) was proposed to yield a high quality SI frame for better DVC reconstructed images. (2) The block transform coefficient properties, i.e., DCs and ACs, were exploited to design the priority rate control for the turbo code, such that the DVC decoding can be carried out with fewest parity bits. In comparison, the proposed COMPETE method demonstrated lower time complexity, while presenting better reconstructed video quality. Simulations show that the proposed COMPETE can reduce the time complexity of MVME to 1.29 to 2.56 times smaller, as compared to previous hybrid MVME methods, while the image peak signal to noise ratios (PSNRs) of a decoded video can be improved 0.2 to 3.5 dB, as compared to H.264/AVC intracoding.

Sensorimotor adaptations to microgravity in humans.

PubMed

Edgerton, V R; McCall, G E; Hodgson, J A; Gotto, J; Goulet, C; Fleischmann, K; Roy, R R

2001-09-01

Motor function is altered by microgravity, but little detail is available as to what these changes are and how changes in the individual components of the sensorimotor system affect the control of movement. Further, there is little information on whether the changes in motor performance reflect immediate or chronic adaptations to changing gravitational environments. To determine the effects of microgravity on the neural control properties of selected motor pools, four male astronauts from the NASA STS-78 mission performed motor tasks requiring the maintenance of either ankle dorsiflexor or plantarflexor torque. Torques of 10 or 50% of a maximal voluntary contraction (MVC) were requested of the subjects during 10 degrees peak-to-peak sinusoidal movements at 0.5 Hz. When 10% MVC of the plantarflexors was requested, the actual torques generated in-flight were similar to pre-flight values. Post-flight torques were higher than pre- and in-flight torques. The actual torques when 50% MVC was requested were higher in- and post-flight than pre-flight. Soleus (Sol) electromyographic (EMG) amplitudes during plantarflexion were higher in-flight than pre- or post-flight for both the 10 and 50% MVC tasks. No differences in medial gastrocnemius (MG) EMG amplitudes were observed for either the 10 or 50% MVC tasks. The EMG amplitudes of the tibialis anterior (TA), an antagonist to plantarflexion, were higher in- and post-flight than pre-flight for the 50% MVC task. During the dorsiflexion tasks, the torques generated in both the 10 and 50% MVC tasks did not differ pre-, in- and post-flight. TA EMG amplitudes were significantly higher in- than pre-flight for both the 10 or 50% MVC tasks, and remained elevated post-flight for the 50% MVC test. Both the Sol and MG EMG amplitudes were significantly higher in-flight than either pre- or post-flight for both the 10 and 50% MVC tests. These data suggest that the most consistent response to space flight was an elevation in the level of contractions of agonists and antagonists when attempting to maintain constant torques at a given level of MVC. Also, the chronic levels of EMG activity in selected ankle flexor and extensor muscles during space flight and during routine activities on Earth were recorded. Compared with pre- and post-flight values, there was a marked increase in the total EMG activity of the TA and the Sol and no change in the MG EMG activity in-flight. These data indicate that space flight, as occurs on shuttle missions, is a model of elevated activation of both flexor and extensor muscles, probably reflecting the effects of programmed work schedules in flight rather than a direct effect of microgravity.

Sensorimotor adaptations to microgravity in humans

NASA Technical Reports Server (NTRS)

Edgerton, V. R.; McCall, G. E.; Hodgson, J. A.; Gotto, J.; Goulet, C.; Fleischmann, K.; Roy, R. R.

2001-01-01

Motor function is altered by microgravity, but little detail is available as to what these changes are and how changes in the individual components of the sensorimotor system affect the control of movement. Further, there is little information on whether the changes in motor performance reflect immediate or chronic adaptations to changing gravitational environments. To determine the effects of microgravity on the neural control properties of selected motor pools, four male astronauts from the NASA STS-78 mission performed motor tasks requiring the maintenance of either ankle dorsiflexor or plantarflexor torque. Torques of 10 or 50% of a maximal voluntary contraction (MVC) were requested of the subjects during 10 degrees peak-to-peak sinusoidal movements at 0.5 Hz. When 10% MVC of the plantarflexors was requested, the actual torques generated in-flight were similar to pre-flight values. Post-flight torques were higher than pre- and in-flight torques. The actual torques when 50% MVC was requested were higher in- and post-flight than pre-flight. Soleus (Sol) electromyographic (EMG) amplitudes during plantarflexion were higher in-flight than pre- or post-flight for both the 10 and 50% MVC tasks. No differences in medial gastrocnemius (MG) EMG amplitudes were observed for either the 10 or 50% MVC tasks. The EMG amplitudes of the tibialis anterior (TA), an antagonist to plantarflexion, were higher in- and post-flight than pre-flight for the 50% MVC task. During the dorsiflexion tasks, the torques generated in both the 10 and 50% MVC tasks did not differ pre-, in- and post-flight. TA EMG amplitudes were significantly higher in- than pre-flight for both the 10 or 50% MVC tasks, and remained elevated post-flight for the 50% MVC test. Both the Sol and MG EMG amplitudes were significantly higher in-flight than either pre- or post-flight for both the 10 and 50% MVC tests. These data suggest that the most consistent response to space flight was an elevation in the level of contractions of agonists and antagonists when attempting to maintain constant torques at a given level of MVC. Also, the chronic levels of EMG activity in selected ankle flexor and extensor muscles during space flight and during routine activities on Earth were recorded. Compared with pre- and post-flight values, there was a marked increase in the total EMG activity of the TA and the Sol and no change in the MG EMG activity in-flight. These data indicate that space flight, as occurs on shuttle missions, is a model of elevated activation of both flexor and extensor muscles, probably reflecting the effects of programmed work schedules in flight rather than a direct effect of microgravity.

Film grain noise modeling in advanced video coding

NASA Astrophysics Data System (ADS)

Oh, Byung Tae; Kuo, C.-C. Jay; Sun, Shijun; Lei, Shawmin

2007-01-01

A new technique for film grain noise extraction, modeling and synthesis is proposed and applied to the coding of high definition video in this work. The film grain noise is viewed as a part of artistic presentation by people in the movie industry. On one hand, since the film grain noise can boost the natural appearance of pictures in high definition video, it should be preserved in high-fidelity video processing systems. On the other hand, video coding with film grain noise is expensive. It is desirable to extract film grain noise from the input video as a pre-processing step at the encoder and re-synthesize the film grain noise and add it back to the decoded video as a post-processing step at the decoder. Under this framework, the coding gain of the denoised video is higher while the quality of the final reconstructed video can still be well preserved. Following this idea, we present a method to remove film grain noise from image/video without distorting its original content. Besides, we describe a parametric model containing a small set of parameters to represent the extracted film grain noise. The proposed model generates the film grain noise that is close to the real one in terms of power spectral density and cross-channel spectral correlation. Experimental results are shown to demonstrate the efficiency of the proposed scheme.

Comparing the occlusal contact area of individual teeth during low-level clenching.

PubMed

Nishimori, Hideta; Iida, Takashi; Kamiyama, Hirona; Komoda, Yoshihiro; Obara, Ryoko; Uchida, Takashi; Kawara, Misao; Komiyama, Osamu

2017-09-14

The aim of this study was to investigate the occlusal contact area (OCA) in individual teeth during low-level tooth clenching in 24 healthy participants. Before measurements were made, the 100% maximum voluntary contraction (MVC) was determined. At baseline, all subjects were instructed to close their mouth and touch the opposing teeth with minimal force. Occlusal contact was recorded during three jaw motor tasks (baseline, 20% MVC, and 40% MVC) using a blue silicone material. OCA thickness was determined from images and defined on five levels: level 1 (0-149 µm), level 2 (0-89 µm), level 3 (0-49 µm), level 4 (0-29 µm), and level 5 (0-4 µm). Premolar and molar OCAs increased significantly from baseline to 20% MVC and 40% MVC. The OCA of each anterior tooth did not change significantly with increasing clenching intensity at all levels. Our findings suggest that premolar and molar OCAs may be altered by low-intensity clenching, affecting the teeth and periodontal tissues.

Fatal motor vehicle crashes among veterans of the 1991 Gulf War and exposure to munitions demolitions at Khamisiyah: a nested case-control study.

PubMed

Gackstetter, Gary D; Hooper, Tomoko I; DeBakey, Samar F; Johnson, Amy; Nagaraj, Barbara E; Heller, Jack M; Kang, Han K

2006-04-01

A proposed explanation for the observed higher risk of fatal motor vehicle crashes (MVC) among 1991 Gulf War-deployed veterans is neurocognitive deficits resulting from nerve agent exposure at Khamisiyah, Iraq. Our objective was to assess any association between postwar fatal MVC and possible nerve agent exposure based on 2000 modeled plume data. Cases were defined as MVC deaths with a record in the Department of Transportation Fatality Analysis Reporting System through 1995. Cases (n = 282) and controls (n = 3,131) were derived from a larger nested case-control study of Gulf War-era veterans and limited to Army, male, deployed personnel. Exposure and cumulative dose by case-control status were analyzed using multivariate techniques. Exposure status was not associated with fatal MVC (OR 0.96, 95% CI 0.72-1.26), nor were tertiles of cumulative dose. Findings do not support an association between possible exposures at Khamisiyah and postwar fatal MVC among Gulf War veterans.

The Simple Video Coder: A free tool for efficiently coding social video data.

PubMed

Barto, Daniel; Bird, Clark W; Hamilton, Derek A; Fink, Brandi C

2017-08-01

Videotaping of experimental sessions is a common practice across many disciplines of psychology, ranging from clinical therapy, to developmental science, to animal research. Audio-visual data are a rich source of information that can be easily recorded; however, analysis of the recordings presents a major obstacle to project completion. Coding behavior is time-consuming and often requires ad-hoc training of a student coder. In addition, existing software is either prohibitively expensive or cumbersome, which leaves researchers with inadequate tools to quickly process video data. We offer the Simple Video Coder-free, open-source software for behavior coding that is flexible in accommodating different experimental designs, is intuitive for students to use, and produces outcome measures of event timing, frequency, and duration. Finally, the software also offers extraction tools to splice video into coded segments suitable for training future human coders or for use as input for pattern classification algorithms.

Variable disparity-motion estimation based fast three-view video coding

NASA Astrophysics Data System (ADS)

Bae, Kyung-Hoon; Kim, Seung-Cheol; Hwang, Yong Seok; Kim, Eun-Soo

2009-02-01

In this paper, variable disparity-motion estimation (VDME) based 3-view video coding is proposed. In the encoding, key-frame coding (KFC) based motion estimation and variable disparity estimation (VDE) for effectively fast three-view video encoding are processed. These proposed algorithms enhance the performance of 3-D video encoding/decoding system in terms of accuracy of disparity estimation and computational overhead. From some experiments, stereo sequences of 'Pot Plant' and 'IVO', it is shown that the proposed algorithm's PSNRs is 37.66 and 40.55 dB, and the processing time is 0.139 and 0.124 sec/frame, respectively.

Stress-related psychological symptoms contribute to axial pain persistence after motor vehicle collision: path analysis results from a prospective longitudinal study.

PubMed

Feinberg, Rose K; Hu, JunMei; Weaver, Mark A; Fillingim, Roger B; Swor, Robert A; Peak, David A; Jones, Jeffrey S; Rathlev, Niels K; Lee, David C; Domeier, Robert M; Hendry, Phyllis L; Liberzon, Israel; McLean, Samuel A

2017-04-01

Posttraumatic stress disorder (PTSD) symptoms and pain after traumatic events such as motor vehicle collision (MVC) have been proposed to be mutually promoting. We performed a prospective multicenter study that enrolled 948 individuals who presented to the emergency department within 24 hours of MVC and were discharged home after evaluation. Follow-up evaluations were completed 6 weeks, 6 months, and 1 year after MVC. Path analysis results supported the hypothesis that axial pain after MVC consistently promotes the maintenance of hyperarousal and intrusive symptoms, from the early weeks after injury through 1 year. In addition, path analysis results supported the hypothesis that one or more PTSD symptom clusters had an influence on axial pain outcomes throughout the year after MVC, with hyperarousal symptoms most influencing axial pain persistence in the initial months after MVC. The influence of hyperarousal symptoms on pain persistence was only present among individuals with genetic vulnerability to stress-induced pain, suggesting specific mechanisms by which hyperarousal symptoms may lead to hyperalgesia and allodynia. Further studies are needed to better understand the specific mechanisms by which pain and PTSD symptoms enhance one another after trauma, and how such mechanisms vary among specific patient subgroups, to better inform the development of secondary preventive interventions.

Joint source-channel coding for motion-compensated DCT-based SNR scalable video.

PubMed

Kondi, Lisimachos P; Ishtiaq, Faisal; Katsaggelos, Aggelos K

2002-01-01

In this paper, we develop an approach toward joint source-channel coding for motion-compensated DCT-based scalable video coding and transmission. A framework for the optimal selection of the source and channel coding rates over all scalable layers is presented such that the overall distortion is minimized. The algorithm utilizes universal rate distortion characteristics which are obtained experimentally and show the sensitivity of the source encoder and decoder to channel errors. The proposed algorithm allocates the available bit rate between scalable layers and, within each layer, between source and channel coding. We present the results of this rate allocation algorithm for video transmission over a wireless channel using the H.263 Version 2 signal-to-noise ratio (SNR) scalable codec for source coding and rate-compatible punctured convolutional (RCPC) codes for channel coding. We discuss the performance of the algorithm with respect to the channel conditions, coding methodologies, layer rates, and number of layers.

Mode-dependent templates and scan order for H.264/AVC-based intra lossless coding.

PubMed

Gu, Zhouye; Lin, Weisi; Lee, Bu-Sung; Lau, Chiew Tong; Sun, Ming-Ting

2012-09-01

In H.264/advanced video coding (AVC), lossless coding and lossy coding share the same entropy coding module. However, the entropy coders in the H.264/AVC standard were original designed for lossy video coding and do not yield adequate performance for lossless video coding. In this paper, we analyze the problem with the current lossless coding scheme and propose a mode-dependent template (MD-template) based method for intra lossless coding. By exploring the statistical redundancy of the prediction residual in the H.264/AVC intra prediction modes, more zero coefficients are generated. By designing a new scan order for each MD-template, the scanned coefficients sequence fits the H.264/AVC entropy coders better. A fast implementation algorithm is also designed. With little computation increase, experimental results confirm that the proposed fast algorithm achieves about 7.2% bit saving compared with the current H.264/AVC fidelity range extensions high profile.

Low-delay predictive audio coding for the HIVITS HDTV codec

NASA Astrophysics Data System (ADS)

McParland, A. K.; Gilchrist, N. H. C.

1995-01-01

The status of work relating to predictive audio coding, as part of the European project on High Quality Video Telephone and HD(TV) Systems (HIVITS), is reported. The predictive coding algorithm is developed, along with six-channel audio coding and decoding hardware. Demonstrations of the audio codec operating in conjunction with the video codec, are given.

Efficient temporal and interlayer parameter prediction for weighted prediction in scalable high efficiency video coding

NASA Astrophysics Data System (ADS)

Tsang, Sik-Ho; Chan, Yui-Lam; Siu, Wan-Chi

2017-01-01

Weighted prediction (WP) is an efficient video coding tool that was introduced since the establishment of the H.264/AVC video coding standard, for compensating the temporal illumination change in motion estimation and compensation. WP parameters, including a multiplicative weight and an additive offset for each reference frame, are required to be estimated and transmitted to the decoder by slice header. These parameters cause extra bits in the coded video bitstream. High efficiency video coding (HEVC) provides WP parameter prediction to reduce the overhead. Therefore, WP parameter prediction is crucial to research works or applications, which are related to WP. Prior art has been suggested to further improve the WP parameter prediction by implicit prediction of image characteristics and derivation of parameters. By exploiting both temporal and interlayer redundancies, we propose three WP parameter prediction algorithms, enhanced implicit WP parameter, enhanced direct WP parameter derivation, and interlayer WP parameter, to further improve the coding efficiency of HEVC. Results show that our proposed algorithms can achieve up to 5.83% and 5.23% bitrate reduction compared to the conventional scalable HEVC in the base layer for SNR scalability and 2× spatial scalability, respectively.

Multivariate Cryptography Based on Clipped Hopfield Neural Network.

PubMed

Wang, Jia; Cheng, Lee-Ming; Su, Tong

2018-02-01

Designing secure and efficient multivariate public key cryptosystems [multivariate cryptography (MVC)] to strengthen the security of RSA and ECC in conventional and quantum computational environment continues to be a challenging research in recent years. In this paper, we will describe multivariate public key cryptosystems based on extended Clipped Hopfield Neural Network (CHNN) and implement it using the MVC (CHNN-MVC) framework operated in space. The Diffie-Hellman key exchange algorithm is extended into the matrix field, which illustrates the feasibility of its new applications in both classic and postquantum cryptography. The efficiency and security of our proposed new public key cryptosystem CHNN-MVC are simulated and found to be NP-hard. The proposed algorithm will strengthen multivariate public key cryptosystems and allows hardware realization practicality.

Video transmission on ATM networks. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Chen, Yun-Chung

1993-01-01

The broadband integrated services digital network (B-ISDN) is expected to provide high-speed and flexible multimedia applications. Multimedia includes data, graphics, image, voice, and video. Asynchronous transfer mode (ATM) is the adopted transport techniques for B-ISDN and has the potential for providing a more efficient and integrated environment for multimedia. It is believed that most broadband applications will make heavy use of visual information. The prospect of wide spread use of image and video communication has led to interest in coding algorithms for reducing bandwidth requirements and improving image quality. The major results of a study on the bridging of network transmission performance and video coding are: Using two representative video sequences, several video source models are developed. The fitness of these models are validated through the use of statistical tests and network queuing performance. A dual leaky bucket algorithm is proposed as an effective network policing function. The concept of the dual leaky bucket algorithm can be applied to a prioritized coding approach to achieve transmission efficiency. A mapping of the performance/control parameters at the network level into equivalent parameters at the video coding level is developed. Based on that, a complete set of principles for the design of video codecs for network transmission is proposed.

Comparative assessment of H.265/MPEG-HEVC, VP9, and H.264/MPEG-AVC encoders for low-delay video applications

NASA Astrophysics Data System (ADS)

Grois, Dan; Marpe, Detlev; Nguyen, Tung; Hadar, Ofer

2014-09-01

The popularity of low-delay video applications dramatically increased over the last years due to a rising demand for realtime video content (such as video conferencing or video surveillance), and also due to the increasing availability of relatively inexpensive heterogeneous devices (such as smartphones and tablets). To this end, this work presents a comparative assessment of the two latest video coding standards: H.265/MPEG-HEVC (High-Efficiency Video Coding), H.264/MPEG-AVC (Advanced Video Coding), and also of the VP9 proprietary video coding scheme. For evaluating H.264/MPEG-AVC, an open-source x264 encoder was selected, which has a multi-pass encoding mode, similarly to VP9. According to experimental results, which were obtained by using similar low-delay configurations for all three examined representative encoders, it was observed that H.265/MPEG-HEVC provides significant average bit-rate savings of 32.5%, and 40.8%, relative to VP9 and x264 for the 1-pass encoding, and average bit-rate savings of 32.6%, and 42.2% for the 2-pass encoding, respectively. On the other hand, compared to the x264 encoder, typical low-delay encoding times of the VP9 encoder, are about 2,000 times higher for the 1-pass encoding, and are about 400 times higher for the 2-pass encoding.

Study and simulation of low rate video coding schemes

NASA Technical Reports Server (NTRS)

Sayood, Khalid; Chen, Yun-Chung; Kipp, G.

1992-01-01

The semiannual report is included. Topics covered include communication, information science, data compression, remote sensing, color mapped images, robust coding scheme for packet video, recursively indexed differential pulse code modulation, image compression technique for use on token ring networks, and joint source/channel coder design.

Are repeated single-limb heel raises and manual muscle testing associated with peak plantar-flexor force in people with inclusion body myositis?

PubMed

Harris-Love, Michael O; Shrader, Joseph A; Davenport, Todd E; Joe, Galen; Rakocevic, Goran; McElroy, Beverly; Dalakas, Marinos

2014-04-01

Repeated heel raises have been proposed as a method of ankle plantar-flexor strength testing that circumvents the limitations of manual muscle testing (MMT). The study objective was to examine the relationships among ankle plantar-flexion isometric maximum voluntary contraction (MVC), repeated single-limb heel raises (SLHRs), and MMT in people with myositis. This was a cross-sectional study with a between-group design. The ability to complete 1 SLHR determined group assignment (SLHR group, n=24; no-SLHR group, n=19). Forty-three participants with myositis (13 women; median age=64.9 years) participated. Outcome measures included MVC, predicted MVC, Kendall MMT, and Daniels-Worthingham MMT. The Kendall MMT was unable to detect significant ankle plantar-flexor weakness established by quantitative methods and was unable to discriminate between participants who could and those who could not perform the SLHR task. Ankle plantar-flexion MVC was not associated with the number of heel-raise repetitions in the SLHR group (pseudo R(2)=.13). No significant relationship was observed between MVC values and MMT grades in the SLHR and no-SLHR groups. However, a moderate relationship between MVC values and MMT grades was evident in a combined-group analysis (ρ=.50-.67). The lower half of both MMT grading scales was not represented in the study despite the profound weakness of the participants. Both Kendall MMT and Daniels-Worthingham MMT had limited utility in the assessment of ankle plantar-flexor strength. Repeated SLHRs should not be used as a proxy measure of ankle plantar-flexion MVC in people with myositis.

Differences in Pelvic Morphology Between Women With and Without Provoked Vestibulodynia.

PubMed

McLean, Linda; Thibault-Gagnon, Stephanie; Brooks, Kaylee; Goldfinger, Corrie; Pukall, Caroline; Chamberlain, Susan

2016-06-01

Pelvic morphology has been suggested to reflect increased tone and reduced strength of the pelvic floor muscles (PFMs) in women with provoked vestibulodynia (PVD) compared to healthy controls. We aimed to determine whether there are differences in pelvic morphology in the resting state, on maximum voluntary contraction (MVC), or on maximum effort Valsalva maneuver (MVM) between women with and without PVD. While imaged using ultrasound, 38 women with PVD and 39 controls relaxed their PFMs, performed 3 MVCs and performed 3 MVMs. Levator plate length (LPL), levator plate angle (LPA), and anorectal angle (ARA) were determined at rest, at MVC and at MVM. The displacement of the bladder neck (BN) on MVC and on MVM was also determined. Two-way ANCOVAs were used to evaluate the main effects of group and task, the interaction between group and task, and the effect of resting morphology on LPL, LPA, and ARA. A 2-way repeated-measures ANOVA was used to determine whether the groups differed in terms of BN displacement during the tasks. Women with PVD had smaller LPLs and LPAs than controls across all tasks. The significant group differences in LPL and LPA at MVC and MVM were no longer significant once the resting values were included as covariates in the models. Bladder neck displacement differed between the groups at MVM but not at MVC. Women with PVD display shorter LPL sand smaller LPAs than controls but their behavior does not differ when MVC and MVMs are performed. Our results do not support the hypothesis that women with PVD demonstrate abnormalities in PFM contractility on MVC or compliance on MVM. Copyright © 2016. Published by Elsevier Inc.

Post-Traumatic Stress Disorder among Older Adults Experiencing Motor Vehicle Collision: A Multicenter Prospective Cohort Study.

PubMed

Platts-Mills, Timothy F; Nebolisa, Bo C; Flannigan, Sean A; Richmond, Natalie L; Domeier, Robert M; Swor, Robert A; Hendry, Phyllis L; Peak, David A; Rathlev, Niels K; Jones, Jeffrey S; Lee, David C; Jones, Christopher W; McLean, Samuel A

2017-09-01

To characterize risk factors for and consequences of post-traumatic stress disorder (PTSD) among older adults evaluated in the emergency department (ED) following motor vehicle collision (MVC). Prospective multicenter longitudinal study (2011-2015). 9 EDs across the United States. Adults aged 65 years and older who presented to an ED after MVC without severe injuries. PTSD symptoms were assessed 6 months after the ED visit using the Impact of Event Scale-Revised. Of 223 patients, clinically significant PTSD symptoms at 6 months were observed in 21% (95% CI 16%-26%). PTSD symptoms were more common in patients who did not have a college degree, had depressive symptoms prior to the MVC, perceived the MVC as life-threatening, had severe ED pain, and expected their physical or emotional recovery time to be greater than 30 days. Three factors (ED pain severity [0-10 scale], perceived life-threatening MVC [0-10 scale], and pre-MVC depressive symptoms [yes to either of two questions]), predicted 6-month PTSD symptoms with an area under the curve of 0.76. Compared to patients without PTSD symptoms, those with PTSD symptoms were at higher risk for persistent pain (72% versus 30%), functional decline (67% versus 42%), and new disability (49% versus 18%). Among older adults treated in the ED following MVC, clinically significant PTSD symptoms at 6 months were present in 21% of patients and were associated with adverse health outcomes. Increased risk for PTSD development can be identified with moderate accuracy using information readily available in the ED. Copyright © 2017 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

The direct and indirect effects of corruption on motor vehicle crash deaths.

PubMed

Hua, Law Teik; Noland, Robert B; Evans, Andrew W

2010-11-01

Recent empirical research has found that there is an inverted U-shaped or Kuznets relationship between income and motor vehicle crash (MVC) deaths, such that MVC deaths increase as national income increases and decrease after reaching a critical level. Corruption has been identified as one of the underlying factors that could affect this relationship, primarily by undermining institutional development and effective enforcement schemes. The total effect of corruption can be decomposed into two components, a direct and an indirect effect. The direct effect measures the immediate impact of corruption on MVC deaths by undermining effective enforcement and regulations, while the indirect effect captures the impact of corruption on hindering increases in per capita income and the consequent impact of reduced income on MVC deaths. By influencing economic growth, corruption can lead to an increase or decrease in MVC deaths depending on the income level. Using data from 60 countries between 1982 and 2003, these effects are estimated using linear panel and fixed effects negative binomial models. The estimation results suggest that corruption has different direct effects for less developed and highly developed countries. It has a negative (decreasing) effect on MVC deaths for less developed countries and a positive (increasing) effect on MVC deaths for highly developed countries. For highly developed countries, the total effect is positive at lower per capita income levels, but decreases with per capita income and becomes negative at per capita income levels of about US$ 38,248. For less developed countries, the total effect is negative within the sample range and decreases with increased per capita income. In summary, the results of this study suggest that reduction of corruption is likely a necessary condition to effectively tackle road safety problems. 2010 Elsevier Ltd. All rights reserved.

Results of coil closure of patent ductus arteriosus using a tapered tip catheter for enhanced control.

PubMed

Devanagondi, Rajiv; Latson, Larry; Bradley-Skelton, Sharon; Prieto, Lourdes

2016-08-01

This article describes the efficacy and embolization rates of coil delivery via modified vertebral catheter (MVC) for patent ductus arteriosus (PDA) closure. Various techniques have been devised to enhance coil control and prevent embolization during PDA closure. Since 1995, they have delivered coils via tapered vertebral catheters for improved coil control. Catheterization reports, angiograms, and echocardiograms were reviewed for patients with PDA occlusion via MVC from 2001 to 2014. Residual shunting was determined by angiography and echocardiogram within 24 hr post-procedure. Procedural success was defined as ≤ trivial angiographic and echocardiographic shunt, and no aortic nor LPA obstruction, after final coil delivery. About 125 coil occlusions were attempted in 103 patients. Minimal PDA diameter was 2 (0.6-6) mm. Four coils were removed with a snare/bioptome due to aortic/LPA obstruction following release. Seven were malpositioned while still held by the MVC of which three embolized while attempting withdrawal. Five embolized after full release from the MVC. The embolization rate was 6.4%. Embolizations were more likely in PDAs ≥ 2.5 mm (P < 0.05). Ultimately, 98/103 PDAs were occluded using the MVC. No patient had greater trivial residual shunt or aortic/LPA obstruction for an overall success rate of 95%. For PDAs < 2.5 mm the success rate was 97%. Coil delivery via MVC was safe and effective for small PDAs. While fully controlled release and retrieval devices are now available for PDA closure with lower embolization rates, coil occlusion by MVC should still be considered for small PDAs, especially in resource limited regions. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Incidence and predictors of neck and widespread pain after motor vehicle collision among US litigants and nonlitigants.

PubMed

McLean, Samuel A; Ulirsch, Jacob C; Slade, Gary D; Soward, April C; Swor, Robert A; Peak, David A; Jones, Jeffrey S; Rathlev, Niels K; Lee, David C; Domeier, Robert M; Hendry, Phyllis L; Bortsov, Andrey V; Bair, Eric

2014-02-01

Debate continues regarding the influence of litigation on pain outcomes after motor vehicle collision (MVC). In this study we enrolled European Americans presenting to the emergency department (ED) in the hours after MVC (n=948). Six weeks later, participants were interviewed regarding pain symptoms and asked about their participation in MVC-related litigation. The incidence and predictors of neck pain and widespread pain 6weeks after MVC were compared among those engaged in litigation (litigants) and those not engaged in litigation (nonlitigants). Among the 859 of 948 (91%) participants completing 6-week follow-up, 711 of 849 (83%) were nonlitigants. Compared to nonlitigants, litigants were less educated and had more severe neck pain and overall pain, and a greater extent of pain at the time of ED evaluation. Among individuals not engaged in litigation, persistent pain 6weeks after MVC was common: 199 of 711 (28%) had moderate or severe neck pain, 92 of 711 (13%) had widespread pain, and 29 of 711 (4%) had fibromyalgia-like symptoms. Incidence of all 3 outcomes was significantly higher among litigants. Initial pain severity in the ED predicted pain outcomes among both litigants and nonlitigants. Markers of socioeconomic disadvantage predicted worse pain outcomes in litigants but not nonlitigants, and individual pain and psychological symptoms were less predictive of pain outcomes among those engaged in litigation. These data demonstrate that persistent pain after MVC is common among those not engaged in litigation, and provide evidence for bidirectional influences between pain outcomes and litigation after MVC. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

Maraviroc Observational Study: The Impact of Expanded Resistance Testing and Clinical Considerations for Antiretroviral Regimen Selection in Treatment-Experienced Patients

PubMed Central

Wilkins, Sara-Anne; Tamhane, Ashutosh; Nevin, Christa R.; Mugavero, Michael J.; Raper, James L.; Napolitano, Laura A.; Saag, Michael S.

2013-01-01

Abstract Maraviroc (MVC) use has trailed that of other post-2006 antiretroviral therapy (ART) options for treatment-experienced patients. We explored the impact of free tropism testing on MVC utilization in our cohort and explored barriers to MVC utilization. The Maraviroc Outcomes Study (MOS) is an investigator-initiated industry-sponsored trial where consecutive ART-experienced patients receiving routine care with viral loads ≥1,000 copies/ml, and whose provider requested resistance testing and received standardized resistance testing (SRT; phenotype, genotype, coreceptor/tropism). Sociodemographic, clinical, and ART characteristics of those receiving SRT were compared to a historical cohort (HC). Subsequently, providers were surveyed regarding factors influencing selection of salvage ART therapy. The HC (n=165) had resistance testing 7/08–9/09, while prospective SRT (n=83) patients were enrolled 9/09–8/10. In the HC, 92% had genotypes, 2% had tropism assays, and 62% (n=102) changed ART after resistance testing (raltegravir 37%, etravirine 25%, darunavir 24%, MVC 1%). In the SRT cohort, 57% (n=48) changed regimens after standardized resistance testing (darunavir 48%, raltegravir 40%, and etravirine 19%). CCR5-tropic virus was identified in 43% of the SRT group, and MVC was used in 10% [or 20% of R5 tropic patients who underwent a subsequent regimen change (n=25)], a statistically significant (p=0.01) increase in utilization. The factors most strongly influencing utilization were unique patient circumstances (60%), clinical experience (55%), and potential side effects (40%). The addition of routine tropism testing to genotypic/phenotypic testing was associated with increased MVC utilization, raising the possibility that tropism testing may present a barrier to MVC use; however, additional barriers exist, and merit further evaluation. PMID:22881368

Digital television system design study

NASA Technical Reports Server (NTRS)

Huth, G. K.

1976-01-01

The use of digital techniques for transmission of pictorial data is discussed for multi-frame images (television). Video signals are processed in a manner which includes quantization and coding such that they are separable from the noise introduced into the channel. The performance of digital television systems is determined by the nature of the processing techniques (i.e., whether the video signal itself or, instead, something related to the video signal is quantized and coded) and to the quantization and coding schemes employed.

Test-retest reliability of muscle fiber conduction velocity and fractal dimension of surface EMG during isometric contractions.

PubMed

Beretta-Piccoli, Matteo; D'Antona, Giuseppe; Zampella, Cristian; Barbero, Marco; Clijsen, Ron; Cescon, Corrado

2017-04-01

The aim of this study was to determine the test-retest reliability of muscle fiber conduction velocity (CV) and fractal dimension (FD) obtained from multichannel surface electromyographic (sEMG) recordings. Forty healthy recreationally active subjects (20 men and 20 women) performed two elbow flexions on two trials with a 1 week interval. The first was a 20% maximal voluntary contraction (MVC) of 120 s, and the second at 60% MVC held until exhaustion. sEMG signals were detected from the biceps brachii, using bi-dimensional arrays. Initial values and slope of CV and FD were used for the reliability analysis. The intraclass correlation coefficient (ICC) values for the isometric contraction at 20% MVC were (-0.09) and 0.67 for CV and FD respectively; whereas the ICC values at 60% MVC were 0.78 and 0.82 for CV and FD respectively. The Bland Altman plots for the two isometric contractions showed a mean difference close to zero, with no evident outliers between the repeated measurements: at 20% MVC 0.001 53 for FD and  -0.0277 for CV, and at 60% MVC 0.006 66 for FD and 0.009 07 for CV. Overall, our findings suggest that during isometric fatiguing contractions, CV and FD slopes are reliable variables, with potential application in clinical populations.

Driver seat belt use indicates decreased risk for child passengers in a motor vehicle crash.

PubMed

Olsen, Cody S; Cook, Lawrence J; Keenan, Heather T; Olson, Lenora M

2010-03-01

We examined the association between driver restraint use and child emergency department (ED) evaluation following a motor vehicle crash (MVC). This cohort study included child passengers aged 0-12 years riding with an adult driver aged 21 years or older involved in a MVC in Utah from 1999 to 2004. The 6 years of Utah MVC records were probabilistically linked to statewide Utah ED records. We estimated the relative risk of ED evaluation following a MVC for children riding with restrained versus unrestrained drivers. Generalized estimating equations were used to calculate relative risks adjusted for child, driver, and crash characteristics. Six percent (6%) of children riding with restrained adult drivers were evaluated in the ED compared to twenty-two percent (22%) of children riding with unrestrained adult drivers following a MVC (relative risk 0.29, 95% confidence interval 0.26-0.32). After adjusting for child, vehicle, and crash characteristics, the relative risk of child ED evaluation associated with driver restraint remained significant (relative risk 0.82, 95% confidence interval 0.72-0.94). Driver restraint use was associated with child restraint use, less alcohol/drug involvement, and lower relative risk of severe collision types (head-on, rollover). Driver seat belt use is associated with decreased risk of ED evaluation for child passengers in the event of a MVC. Copyright 2009 Elsevier Ltd. All rights reserved.

Pharmacodynamic Activity of Dapivirine and Maraviroc Single Entity and Combination Topical Gels for HIV-1 Prevention.

PubMed

Dezzutti, Charlene S; Yandura, Sarah; Wang, Lin; Moncla, Bernard; Teeple, Elizabeth A; Devlin, Brid; Nuttall, Jeremy; Brown, Elizabeth R; Rohan, Lisa C

2015-11-01

Dapivirine (DPV), a non-nucleoside reverse transcriptase inhibitor, and maraviroc (MVC), a CCR5 antagonist, were formulated into aqueous gels designed to prevent mucosal HIV transmission. 0.05% DPV, 0.1% MVC, 0.05% DPV/0.1% MVC and placebo gels were evaluated for pH, viscosity, osmolality, and in vitro release. In vitro assays and mucosal tissues were used to evaluate anti-HIV activity. Viability (Lactobacilli only) and epithelial integrity in cell lines and mucosal tissues defined safety. The gels were acidic and viscous. DPV gel had an osmolality of 893 mOsm/kg while the other gels had an osmolality of <100 mOsm/kg. MVC release was similar from the single and combination gels (~5 μg/cm(2)/min(1/2)), while DPV release was 10-fold less from the single as compared to the combination gel (0.4331 μg/cm(2)/min(1/2)). Titrations of the gels showed 10-fold more drug was needed to protect ectocervical than colonic tissue. The combination gel showed ~10- and 100-fold improved activity as compared to DPV and MVC gel, respectively. All gels were safe. The DPV/MVC gel showed a benefit blocking HIV infection of mucosal tissue compared to the single entity gels. Combination products with drugs affecting unique steps in the viral replication cycle would be advantageous for HIV prevention.

Selective encryption for H.264/AVC video coding

NASA Astrophysics Data System (ADS)

Shi, Tuo; King, Brian; Salama, Paul

2006-02-01

Due to the ease with which digital data can be manipulated and due to the ongoing advancements that have brought us closer to pervasive computing, the secure delivery of video and images has become a challenging problem. Despite the advantages and opportunities that digital video provide, illegal copying and distribution as well as plagiarism of digital audio, images, and video is still ongoing. In this paper we describe two techniques for securing H.264 coded video streams. The first technique, SEH264Algorithm1, groups the data into the following blocks of data: (1) a block that contains the sequence parameter set and the picture parameter set, (2) a block containing a compressed intra coded frame, (3) a block containing the slice header of a P slice, all the headers of the macroblock within the same P slice, and all the luma and chroma DC coefficients belonging to the all the macroblocks within the same slice, (4) a block containing all the ac coefficients, and (5) a block containing all the motion vectors. The first three are encrypted whereas the last two are not. The second method, SEH264Algorithm2, relies on the use of multiple slices per coded frame. The algorithm searches the compressed video sequence for start codes (0x000001) and then encrypts the next N bits of data.

Spatial Pyramid Covariance based Compact Video Code for Robust Face Retrieval in TV-series.

PubMed

Li, Yan; Wang, Ruiping; Cui, Zhen; Shan, Shiguang; Chen, Xilin

2016-10-10

We address the problem of face video retrieval in TV-series which searches video clips based on the presence of specific character, given one face track of his/her. This is tremendously challenging because on one hand, faces in TV-series are captured in largely uncontrolled conditions with complex appearance variations, and on the other hand retrieval task typically needs efficient representation with low time and space complexity. To handle this problem, we propose a compact and discriminative representation for the huge body of video data, named Compact Video Code (CVC). Our method first models the face track by its sample (i.e., frame) covariance matrix to capture the video data variations in a statistical manner. To incorporate discriminative information and obtain more compact video signature suitable for retrieval, the high-dimensional covariance representation is further encoded as a much lower-dimensional binary vector, which finally yields the proposed CVC. Specifically, each bit of the code, i.e., each dimension of the binary vector, is produced via supervised learning in a max margin framework, which aims to make a balance between the discriminability and stability of the code. Besides, we further extend the descriptive granularity of covariance matrix from traditional pixel-level to more general patchlevel, and proceed to propose a novel hierarchical video representation named Spatial Pyramid Covariance (SPC) along with a fast calculation method. Face retrieval experiments on two challenging TV-series video databases, i.e., the Big Bang Theory and Prison Break, demonstrate the competitiveness of the proposed CVC over state-of-the-art retrieval methods. In addition, as a general video matching algorithm, CVC is also evaluated in traditional video face recognition task on a standard Internet database, i.e., YouTube Celebrities, showing its quite promising performance by using an extremely compact code with only 128 bits.

Cross-Layer Design for Video Transmission over Wireless Rician Slow-Fading Channels Using an Adaptive Multiresolution Modulation and Coding Scheme

NASA Astrophysics Data System (ADS)

Pei, Yong; Modestino, James W.

2007-12-01

We describe a multilayered video transport scheme for wireless channels capable of adapting to channel conditions in order to maximize end-to-end quality of service (QoS). This scheme combines a scalable H.263+ video source coder with unequal error protection (UEP) across layers. The UEP is achieved by employing different channel codes together with a multiresolution modulation approach to transport the different priority layers. Adaptivity to channel conditions is provided through a joint source-channel coding (JSCC) approach which attempts to jointly optimize the source and channel coding rates together with the modulation parameters to obtain the maximum achievable end-to-end QoS for the prevailing channel conditions. In this work, we model the wireless links as slow-fading Rician channel where the channel conditions can be described in terms of the channel signal-to-noise ratio (SNR) and the ratio of specular-to-diffuse energy[InlineEquation not available: see fulltext.]. The multiresolution modulation/coding scheme consists of binary rate-compatible punctured convolutional (RCPC) codes used together with nonuniform phase-shift keyed (PSK) signaling constellations. Results indicate that this adaptive JSCC scheme employing scalable video encoding together with a multiresolution modulation/coding approach leads to significant improvements in delivered video quality for specified channel conditions. In particular, the approach results in considerably improved graceful degradation properties for decreasing channel SNR.

Real-time data compression of broadcast video signals

NASA Technical Reports Server (NTRS)

Shalkauser, Mary Jo W. (Inventor); Whyte, Wayne A., Jr. (Inventor); Barnes, Scott P. (Inventor)

1991-01-01

A non-adaptive predictor, a nonuniform quantizer, and a multi-level Huffman coder are incorporated into a differential pulse code modulation system for coding and decoding broadcast video signals in real time.

Optimal bit allocation for hybrid scalable/multiple-description video transmission over wireless channels

NASA Astrophysics Data System (ADS)

Jubran, Mohammad K.; Bansal, Manu; Kondi, Lisimachos P.

2006-01-01

In this paper, we consider the problem of optimal bit allocation for wireless video transmission over fading channels. We use a newly developed hybrid scalable/multiple-description codec that combines the functionality of both scalable and multiple-description codecs. It produces a base layer and multiple-description enhancement layers. Any of the enhancement layers can be decoded (in a non-hierarchical manner) with the base layer to improve the reconstructed video quality. Two different channel coding schemes (Rate-Compatible Punctured Convolutional (RCPC)/Cyclic Redundancy Check (CRC) coding and, product code Reed Solomon (RS)+RCPC/CRC coding) are used for unequal error protection of the layered bitstream. Optimal allocation of the bitrate between source and channel coding is performed for discrete sets of source coding rates and channel coding rates. Experimental results are presented for a wide range of channel conditions. Also, comparisons with classical scalable coding show the effectiveness of using hybrid scalable/multiple-description coding for wireless transmission.

Differences in the Biometry of the Levator Hiatus at Rest, During Contraction, and During Valsalva Maneuver Between Women With and Without Provoked Vestibulodynia Assessed by Transperineal Ultrasound Imaging.

PubMed

Thibault-Gagnon, Stéphanie; McLean, Linda; Goldfinger, Corrie; Pukall, Caroline; Chamberlain, Susan

2016-02-01

Pelvic floor muscle (PFM) involvement is suspected in the pathophysiology of provoked vestibulodynia (PVD); however, the underlying mechanisms are unclear. PFM morphology can be inferred from the biometry of the levator hiatus determined through dynamic ultrasound imaging. The aim of this study was to determine the nature of PFM involvement in women with PVD via an evaluation of the biometry of the levator hiatus at rest, upon maximal voluntary contraction (MVC) of the PFMs, and upon maximal Valsalva maneuver (MVM). Thirty-eight women with PVD and 39 asymptomatic controls were imaged using 3D transperineal ultrasound. Levator hiatal dimensions (area; left-right [LR] and anteroposterior [AP] diameters) were measured at rest, on MVC, and on MVM. Differences in hiatal dimensions and in relative changes in dimensions from rest to MVC and from rest to MVM were compared between groups using separate 1-way analyses of variance for each measure and task. Analysis of covariance models were used to investigate the impact of levator hiatal dimensions at rest on the relative changes in the levator hiatal dimensions during MVC and MVM. Levator hiatal area, LR, and AP diameters, at rest, on MVC, and on MVM were the main outcome measures. Relative changes in hiatal dimensions were assessed as the percent change in hiatal area, LR diameter, and AP diameter. In comparison with controls, women with PVD had smaller hiatal areas at rest, on MVC, and on MVM, concurrent with smaller LR diameters on MVM. Women with PVD had a significantly smaller change in hiatal area on MVM than controls, but no differences were evident on MVC. In both groups, smaller levator hiatal dimensions at rest were associated with smaller relative decreases in dimensions on MVC and larger relative increases in dimensions on MVM. In comparison to controls, women with PVD appear to have narrower levator hiatus' and less capacity to distend their hiatus on Valsalva. The state of the PFMs at rest appears to significantly influence biometric changes in the PFMs during contraction and Valsalva. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

Carotid artery dissection and motor vehicle trauma: patient demographics, associated injuries and impact of treatment on cost and length of stay.

PubMed

Kray, Jared E; Dombrovskiy, Viktor Y; Vogel, Todd R

2016-07-08

Blunt carotid arterial injury (BCI) is a rare injury associated with motor vehicle collision (MVC). There are few population based analyses evaluating carotid injury associated with blunt trauma and their associated injuries as well as outcomes. The Nationwide Inpatient Sample (NIS) 2003-2010 data was queried to identify patients after MVC who had documented BCI during their hospitalizations utilizing ICD-9-CM codes. Demographics, associated injuries, interventions performed, length of stay, and cost were evaluated. 1,686,867 patients were estimated having sustained MVC; 1,168 BCI were estimated. No patients with BCI had open repair, 4.24 % had a carotid artery stent (CAS), and 95.76 % of patients had no operative intervention. Age groups associated with BCI were: 18-24 (27.8 %), 47-60 (22.3 %), 35-46 (20.6 %), 25-34 (19.1 %), >61 (10.2 %). Associated injuries included long bone fractures (28.5 %), stroke and intracranial hemorrhage (28.5 %), cranial injuries (25.6 %), thoracic injuries (23.6 %), cervical fractures (21.8 %), facial fractures (19.9 %), skull fractures (18.8 %), pelvic fractures (18.5 %), hepatic (13.3 %) and splenic (9.2 %) injuries. Complications included respiratory (44.2 %), bleeding (16.1 %), urinary tract infections (8.9 %), and sepsis (4.9 %). Overall mortality was 14.1 % without differences with regard to intervention (18.5 % vs. 13.9 %; P = 0.36). Stroke and intracranial hemorrhage was associated with a 2.7 times greater risk of mortality. Mean length of stay for patients with BCI undergoing stenting compared to no intervention were similar (13.1 days vs. 15.9 days) but had a greater mean cost ($83,030 vs. $63,200, p = 0.3). BCI is a rare injury associated with MVC, most frequently reported in younger patients. Frequently associated injuries were long bone fractures, stroke and intracranial hemorrhage, thoracic injuries, and pelvic fractures which are likely associated with the force/mechanism of injury. The majority of patients were treated without intervention, but when CAS was utilized, it did not impact mortality and trended toward increased costs.

High efficiency video coding for ultrasound video communication in m-health systems.

PubMed

Panayides, A; Antoniou, Z; Pattichis, M S; Pattichis, C S; Constantinides, A G

2012-01-01

Emerging high efficiency video compression methods and wider availability of wireless network infrastructure will significantly advance existing m-health applications. For medical video communications, the emerging video compression and network standards support low-delay and high-resolution video transmission, at the clinically acquired resolution and frame rates. Such advances are expected to further promote the adoption of m-health systems for remote diagnosis and emergency incidents in daily clinical practice. This paper compares the performance of the emerging high efficiency video coding (HEVC) standard to the current state-of-the-art H.264/AVC standard. The experimental evaluation, based on five atherosclerotic plaque ultrasound videos encoded at QCIF, CIF, and 4CIF resolutions demonstrates that 50% reductions in bitrate requirements is possible for equivalent clinical quality.

Picture data compression coder using subband/transform coding with a Lempel-Ziv-based coder

NASA Technical Reports Server (NTRS)

Glover, Daniel R. (Inventor)

1995-01-01

Digital data coders/decoders are used extensively in video transmission. A digitally encoded video signal is separated into subbands. Separating the video into subbands allows transmission at low data rates. Once the data is separated into these subbands it can be coded and then decoded by statistical coders such as the Lempel-Ziv based coder.

Experimental design and analysis of JND test on coded image/video

NASA Astrophysics Data System (ADS)

Lin, Joe Yuchieh; Jin, Lina; Hu, Sudeng; Katsavounidis, Ioannis; Li, Zhi; Aaron, Anne; Kuo, C.-C. Jay

2015-09-01

The visual Just-Noticeable-Difference (JND) metric is characterized by the detectable minimum amount of two visual stimuli. Conducting the subjective JND test is a labor-intensive task. In this work, we present a novel interactive method in performing the visual JND test on compressed image/video. JND has been used to enhance perceptual visual quality in the context of image/video compression. Given a set of coding parameters, a JND test is designed to determine the distinguishable quality level against a reference image/video, which is called the anchor. The JND metric can be used to save coding bitrates by exploiting the special characteristics of the human visual system. The proposed JND test is conducted using a binary-forced choice, which is often adopted to discriminate the difference in perception in a psychophysical experiment. The assessors are asked to compare coded image/video pairs and determine whether they are of the same quality or not. A bisection procedure is designed to find the JND locations so as to reduce the required number of comparisons over a wide range of bitrates. We will demonstrate the efficiency of the proposed JND test, report experimental results on the image and video JND tests.

Blackcurrant Alters Physiological Responses and Femoral Artery Diameter during Sustained Isometric Contraction

PubMed Central

Cook, Matthew David; Myers, Stephen David; Gault, Mandy Lucinda; Willems, Mark Elisabeth Theodorus

2017-01-01

Blackcurrant is rich in anthocyanins that may affect exercise-induced physiological responses. We examined tissue oxygen saturation, muscle activity, cardiovascular responses and femoral artery diameter during a submaximal sustained isometric contraction. In a randomised, double-blind, crossover design, healthy men (n = 13, age: 25 ± 4 years, BMI: 25 ± 3 kg·m−2, mean ± SD) ingested New Zealand blackcurrant (NZBC) extract (600 mg∙day−1 CurraNZ™) or placebo (PL) for 7-days separated by 14-days washout. Participants produced isometric maximal voluntary contractions (iMVC) and a 120-s 30%iMVC of the quadriceps with electromyography (EMG), near-infrared spectroscopy, hemodynamic and ultrasound recordings. There was no effect of NZBC extract on iMVC (NZBC: 654 ± 73, PL: 650 ± 78 N). During the 30%iMVC with NZBC extract, total peripheral resistance, systolic, diastolic, and mean arterial pressure were lower with increased cardiac output and stroke volume. With NZBC extract, EMG root mean square of the vastus medialis and muscle oxygen saturation were lower with higher total haemoglobin. During the 30%iMVC, femoral artery diameter was increased with NZBC extract at 30 (6.9%), 60 (8.2%), 90 (7.7%) and 120 s (6.0%). Intake of NZBC extract for 7-days altered cardiovascular responses, muscle oxygen saturation, muscle activity and femoral artery diameter during a 120-s 30%iMVC of the quadriceps. The present study provides insight into the potential mechanisms for enhanced exercise performance with intake of blackcurrant. PMID:28555052

Decreased muscle endurance associated with diabetic neuropathy may be attributed partially to neuromuscular transmission failure

PubMed Central

Kimpinski, Kurt; Doherty, Timothy J.; Rice, Charles L.

2015-01-01

Diabetic polyneuropathy (DPN) can cause muscle atrophy, weakness, contractile slowing, and neuromuscular transmission instability. Our objective was to assess the response of the impaired neuromuscular system of DPN in humans when stressed with a sustained maximal voluntary contraction (MVC). Baseline MVC and evoked dorsiflexor contractile properties were assessed in DPN patients (n = 10) and controls (n = 10). Surface electromyography was used to record tibialis anterior evoked maximal compound muscle action potentials (CMAPs) and neuromuscular activity during MVCs. Participants performed a sustained isometric dorsiflexion MVC for which task termination was determined by the inability to sustain ≥60% MVC torque. The fatigue protocol was immediately followed by a maximal twitch, with additional maximal twitches and MVCs assessed at 30 s and 2 min postfatigue. DPN patients fatigued ∼21% more quickly than controls (P < 0.05) and featured less relative electromyographic activity during the first one-third of the fatigue protocol compared with controls (P < 0.05). Immediately following fatigue, maximal twitch torque was reduced similarly (∼20%) in both groups, and concurrently CMAPs were reduced (∼12%) in DPN patients, whereas they were unaffected in controls (P > 0.05). Twitch torque and CMAP amplitude recovered to baseline 30 s postfatigue. Additionally, at 30 s postfatigue, both groups had similar (∼10%) reductions in MVC torque relative to baseline, and MVC strength recovered by 2 min postfatigue. We conclude DPN patients possess less endurance than controls, and neuromuscular transmission failure may contribute to this greater fatigability. PMID:25663671

SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication

PubMed Central

Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi

2013-01-01

Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434

Effect of high-intensity intermittent cycling sprints on neuromuscular activity.

PubMed

Billaut, F; Basset, F A; Giacomoni, M; Lemaître, F; Tricot, V; Falgairette, G

2006-01-01

High-intensity intermittent sprints induce changes in metabolic and mechanical parameters. However, very few data are available about electrical manifestations of muscle fatigue following such sprints. In this study, quadriceps electromyographic (EMG) responses to repeated all-out exercise bouts of short duration were assessed from maximal voluntary isometric contractions (MVC) performed before and after sprints. Twelve men performed ten 6-s maximal cycling sprints, separated by 30-s rest. The MVC were performed pre-sprints ( pre), post-sprints ( post), and 5 min post-sprints ( post5). Values of root-mean-square (RMS) and median frequency (MF) of vastus lateralis (VL) and vastus medialis (VM) were recorded during each MVC. During sprints, PPO decreased significantly in sprints 8, 9, and 10, compared to sprint 1 (- 8 %, - 10 %, and - 11 %, respectively, p < 0.05). Significant decrements were found in MVC post (- 13 %, p < 0.05) and MVC post5 (- 10.5 %, p < 0.05) compared to MVC pre. The RMS value of VL muscle increased significantly after sprints (RMS pre vs. RMS post: + 15 %, p < 0.05). Values of MF decreased significantly in both VL and VM after sprints. In conclusion, our results indicate that the increase in quadriceps EMG amplitude following high-intensity intermittent short sprints was not sufficient to maintain the required force output. The concomitant decrease in frequency components would suggest a modification in the pattern of muscle fiber recruitment, and a decrease in conduction velocity of active fibers.

Pharmacodynamic activity of Dapivirine and Maraviroc single entity and combination topical gels for HIV-1 prevention

PubMed Central

Dezzutti, Charlene S.; Yandura, Sarah; Wang, Lin; Moncla, Bernard; Teeple, Elizabeth A.; Devlin, Brid; Nuttall, Jeremy; Brown, Elizabeth R.; Rohan, Lisa C.

2015-01-01

Purpose Dapivirine (DPV), a non-nucleoside reverse transcriptase inhibitor, and maraviroc (MVC), a CCR5 antagonist, were formulated into aqueous gels designed to prevent mucosal HIV transmission. Methods 0.05% DPV, 0.1% MVC, 0.05% DPV/0.1% MVC and placebo gels were evaluated for pH, viscosity, osmolality, and in vitro release. In vitro assays and mucosal tissues were used to evaluate anti-HIV activity. Viability (Lactobacilli only) and epithelial integrity in cell lines and mucosal tissues defined safety. Results The gels were acidic and viscous. DPV gel had an osmolality of 893 mOsm/kg while the other gels had an osmolality of <100 mOsm/kg. MVC release was similar from the single and combination gels (~5 μg/cm2/min1/2), while DPV release was 10-fold less from the single as compared to the combination gel (0.4331 μg/cm2/min1/2). Titrations of the gels showed 10-fold more drug was needed to protect ectocervical than colonic tissue. The combination gel showed ~10- and 100-fold improved activity as compared to DPV and MVC gel, respectively. All gels were safe. Conclusions The DPV/MVC gel showed a benefit blocking HIV infection of mucosal tissue compared to the single entity gels. Combination products with drugs affecting unique steps in the viral replication cycle would be advantageous for HIV prevention. PMID:26078001

Radial pulse waveform and parameters in different types of athletes

PubMed Central

Wang, An-Ran; Su, Jun; Zhang, Song; Yang, Lin

2016-01-01

Objective: To classify the sports events by the maximal oxygen uptake (MaxO2) and the maximal muscular voluntary contraction (MVC) and to collect the radial pulse wave of different sports events and discuss the pulse waveform and characteristic parameters. Patients or other participants: 304 professional athletes were enrolled from Beijing Muxiyuan Sports Technical School. Main outcome measure(s): Normalize each radial pulse waveform and let the waveform cycle and amplitude distribute in the range of 0-100. Analyze the relative time of the maximum point Tm, the abscissa X and ordinate Y of dicrotic notch, the pulse waveform area K and the pulse wave age index SDPTG. Results: According to the different degree of MaxO2 and MVC, the radial descending curves have the distinctive downtrend. The characteristic parameters of MaxO2 and MVC groups, such as Tm, X, Y, K and SDPTG are as well as different. Conclusions: The pulse waveform changing trend of MVC (< 50%) group and MVC (> 50%) group are different while the sports have the same MaxO2. And the pulse waveform changing trend of MaxO2 (< 40%) group, MaxO2 (40-70%) group and MaxO2 (> 70%) group are as well as different while the sports have the same MVC. The various parameters of the most specific group F are the smallest suggests the sports in group F are the most benefit for the cardiovascular. PMID:27158404

Scalable video transmission over Rayleigh fading channels using LDPC codes

NASA Astrophysics Data System (ADS)

Bansal, Manu; Kondi, Lisimachos P.

2005-03-01

In this paper, we investigate an important problem of efficiently utilizing the available resources for video transmission over wireless channels while maintaining a good decoded video quality and resilience to channel impairments. Our system consists of the video codec based on 3-D set partitioning in hierarchical trees (3-D SPIHT) algorithm and employs two different schemes using low-density parity check (LDPC) codes for channel error protection. The first method uses the serial concatenation of the constant-rate LDPC code and rate-compatible punctured convolutional (RCPC) codes. Cyclic redundancy check (CRC) is used to detect transmission errors. In the other scheme, we use the product code structure consisting of a constant rate LDPC/CRC code across the rows of the `blocks' of source data and an erasure-correction systematic Reed-Solomon (RS) code as the column code. In both the schemes introduced here, we use fixed-length source packets protected with unequal forward error correction coding ensuring a strictly decreasing protection across the bitstream. A Rayleigh flat-fading channel with additive white Gaussian noise (AWGN) is modeled for the transmission. The rate-distortion optimization algorithm is developed and carried out for the selection of source coding and channel coding rates using Lagrangian optimization. The experimental results demonstrate the effectiveness of this system under different wireless channel conditions and both the proposed methods (LDPC+RCPC/CRC and RS+LDPC/CRC) outperform the more conventional schemes such as those employing RCPC/CRC.

Maraviroc, as a Switch Option, in HIV-1–infected Individuals With Stable, Well-controlled HIV Replication and R5-tropic Virus on Their First Nucleoside/Nucleotide Reverse Transcriptase Inhibitor Plus Ritonavir-boosted Protease Inhibitor Regimen: Week 48 Results of the Randomized, Multicenter MARCH Study

PubMed Central

Pett, Sarah Lilian; Amin, Janaki; Horban, Andrejz; Andrade-Villanueva, Jaime; Losso, Marcelo; Porteiro, Norma; Sierra Madero, Juan; Belloso, Waldo; Tu, Elise; Silk, David; Kelleher, Anthony; Harrigan, Richard; Clark, Andrew; Sugiura, Wataru; Wolff, Marcelo; Gill, John; Gatell, Jose; Fisher, Martin; Clarke, Amanda; Ruxrungtham, Kiat; Prazuck, Thierry; Kaiser, Rolf; Woolley, Ian; Arnaiz, Juan Alberto; Cooper, David; Rockstroh, Jürgen K.; Mallon, Patrick; Emery, Sean; Kelleher, Anthony; Merlin, Kate; Yeung, Julie; Fsadni, Bertha; Marks, Kat; Suzuki, Kazuo; Rismanto, Nick; Salomon, Horacio; Rubio, Andrea E.; Chibo, Doris; Birch, Chris; Harrigan, Richard; Swenson, Luke; Chan, Dennison; Berg, Thomas; Obermeier, Martin; Kaiser, Rolf; Schuelter, Eugen; Sierra Aragon, Saleta; Luebke, Nadine; Coughlan, Suzie; Dean, Jonathan; Sugiura, Wataru; Iwatani, Yasumasa; Reyes Teran, Gustavo; Avila, Santiago; Ruxrungtham, Kiat; Sirivichayakul, Sunee; Naphassanant, May; Ubolyam, Sasiwimol; Kaye, Steve; Land, Sally; Walker, Sarah; Haubrich, Richard; DeJesus, Edwin; Emery, Sean; Pett, Sarah L.; Tu, Elise; Silk, David; Berthon-Jones, Nisha; Amin, Janaki; Espinosa, Natalie; Courtney-Vega, Kymme; Absar, Noorul; Haskelberg, Hila; Robson, Rose; Donaldson, Anna; Losso, Marcelo; Belloso, Waldo; Guelman, Daniel; Gambardella, Luciana; Valdovinos, Mariana; Gatell, Jose; Arnaiz, Juan; Beleta, Helena; Ramos, Nuria; Targa, Marta; Rockstroh, Jurgen; Späth, Brigitta; Boesecke, Christoph; Engelhardt, Angelika; Fisher, Martin; Perry, Nicky; Clarke, Amanda; Gill, John; Beckthold, Brenda; Clark, Andrew; Drummond, Fraser; Lefevre, Eric; Corr, Sharon; Grant, Carol; Lupo, Sergio; Peroni, Luciana; Italiano, Hospital; Sanchez, Marisa; De Paz Sierra, Mariana; Mejia, Ramos; Losso, Marcelo; Viloria, Guillermo; Parlante, Angel; Bissio, Emiliano; Luchetti, Pablo; Warley, Eduardo; Vieni, Ines; Porteiro, Norma; Vilas, Cecilia; Zarate, Abel; Mayer, Gabriela; Elliot, Julian; Hagenauer, Michelle; Kelley, Mark; Rowling, Diane; Gibson, Abby; Latch, Ngaire; Tabrett, Chantal; Warzywoda, Elizabeth; Cooper, David; Pett, Sarah; MacRae, Karen; Sinclair, Brett; Sinn, Kate; Bloch, Mark; Franic, Teo; Vincent, Trina; Stewart, Natasha; Jayewardene, Avindra; Dwyer, Dominic; Kok, Jennifer; Assam, Delene; Taylor, Janette; King, Patricia; Orth, David; Youds, David; Sowden, David; Johnston, Colleen; Murray, Suzanne; Hehir, Jennifer; Wadham, Samantha; Donohue, William; Thompson, Jill; Garsia, Roger; Turnham, Geoffrey; Madden, Tracey; Woolley, Ian; Gillies, Ainsley; Bryant, Mellissa; Gill, John; Beckthold, Brenda; Walmsley, Sharon; Chan, Warmond; LeBlanc, Roger; Lanteigne, Francois; Mouawad, Rima; Rahal, Ines; Guber, Sergio; Ozturk, Sefika; Smith, Graham; Halpenny, Roberta; Reko, Tatjana; Robinette Hills, Jennifer; Wolff, Marcelo; Prazuck, Thierry; Laurent Hocqueloux, Francois; Wolfgang, Johann; Stephan, Christoph; Ebeling, Franziska; Rockstroh, Juergen; Boesecke, Christoph; Spath, Brigitta; Engelhardt, Angelika; Ole Jensen, Bjorn-Erik; Feind, Cecilie; Meyer-Olson, Dirk; Stoll, Matthias; Hoeper, Kirsten; Beider, Renata; Faetkenheur, Gerd; Thomas Baumgarten, Ellen; Baumgarten, Axel; Ingiliz, Patrick; Wienbreyer, Andreas; Behrendt, Daniela; Nienkarken, Tanja; Stein, Jessen; Jessen, Heiko; Zedlack, Carmen; Mallon, Paddy; Simelane, Sibongile; Assmann, Jennifer; Ghavami-Kia, Bijan; Sugiura, Wataru; Imahashi, Mayumi; Tanabe, Kazue; Yokomaku, Yoshiyuki; Imamura, Junji; Andrade-Villanueva, Jaime; Montes de Oca, Melva; Gonzalez, Lucero; Ponce, David; Mendoza, Andrea; Sierra-Madero, Juan; Sanchez Hernandez, Jesus Eduardo; Jaime Ruiz Ballesteros, Eduardo; del Moral Ponce, Sergio; Mosqueda, Luis; Lopez, Monica; Horban, Andrzej; Ignatowska, Anna; Bakowska, Elzbieta; Pulik, Piotr; Sanz-Moreno, Jose; Paredes, Roger; Puig, Jordi; Domingo, Pere; Gutierrez, Mar; Gatell, Jose; González-Cordón, Ana; Callau, Pili; Lopez Aldeguer, Jose; Cuellar Tovar, Sandra; Leal Noval, Manuel; Rivas, Inmaculada; Delgado-Fernandez, Marcial; Ramon Arribas, Jose; Miguel Castro, Juan; Ruxrungtham, Kiat; Avihingsanon, Anchalee; Maek-a-nantawat, Wirach; Intasan, Jintana; Charoenporn, Walairat; Cuprasitrut, Thidarat; Jaisomkom, Pachuen; Pruksakaew, Kanchana; Winston, Alan; Mullaney, Scott; Fisher, Martin; Clarke, Amanda; Barbour, Lisa; Perry, Nicky; Richardson, Celia; Fox, Julie; Murray, Tammy; Leen, Clifford; Morris, Shelia; Satyajit, Das; Sandhu, Rumun; Tucker, James

2016-01-01

Abstract Background. Alternative combination antiretroviral therapies in virologically suppressed human immunodeficiency virus (HIV)–infected patients experiencing side effects and/or at ongoing risk of important comorbidities from current therapy are needed. Maraviroc (MVC), a chemokine receptor 5 antagonist, is a potential alternative component of therapy in those with R5-tropic virus. Methods. The Maraviroc Switch Study is a randomized, multicenter, 96-week, open-label switch study in HIV type 1–infected adults with R5-tropic virus, virologically suppressed on a ritonavir-boosted protease inhibitor (PI/r) plus double nucleoside/nucleotide reverse transcriptase inhibitor (2 N(t)RTI) backbone. Participants were randomized 1:2:2 to current combination antiretroviral therapy (control), or replacing the protease inhibitor (MVC + 2 N(t)RTI arm) or the nucleoside reverse transcriptase inhibitor backbone (MVC + PI/r arm) with twice-daily MVC. The primary endpoint was the difference (switch minus control) in proportion with plasma viral load (VL) <200 copies/mL at 48 weeks. The switch arms were judged noninferior if the lower limit of the 95% confidence interval (CI) for the difference in the primary endpoint was < −12% in the intention-to-treat (ITT) population. Results. The ITT population comprised 395 participants (control, n = 82; MVC + 2 N(t)RTI, n = 156; MVC + PI/r, n = 157). Baseline characteristics were well matched. At week 48, noninferior rates of virological suppression were observed in those switching away from a PI/r (93.6% [95% CI, −9.0% to 2.2%] and 91.7% [95% CI, −9.6% to 3.8%] with VL <200 and <50 copies/mL, respectively) compared to the control arm (97.6% and 95.1% with VL <200 and <50 copies/mL, respectively). In contrast, MVC + PI/r did not meet noninferiority bounds and was significantly inferior (84.1% [95% CI, −19.8% to −5.8%] and 77.7% [95% CI, −24.9% to −8.4%] with VL <200 and <50 copies/mL, respectively) to the control arm in the ITT analysis. Conclusions. These data support MVC as a switch option for ritonavir-boosted PIs when partnered with a 2-N(t)RTI backbone, but not as part of N(t)RTI-sparing regimens comprising MVC with PI/r. Clinical Trials Registration. NCT01384682. PMID:27048747

Digging navigable waterways through lagoon tidal flats: which short and long-term impacts on groundwater dynamics and quality?

NASA Astrophysics Data System (ADS)

Teatini, Pietro; Isotton, Giovanni; Nardean, Stefano; Ferronato, Massimiliano; Tosi, Luigi; Da Lio, Cristina; Zaggia, Luca; Bellafiore, Debora; Zecchin, Massimo; Baradello, Luca; Corami, Fabiana; Libralato, Giovanni; Morabito, Elisa; Broglia, Riccardo; Zaghi, Stefano

2017-04-01

Coastal lagoons are highly valued ephemeral habitats that have experienced in many cases the pressure of human activities since the development of urbanisation and economic activities within or around their boundaries. One typical intervention is dredging of canals to increase the exchange of water with the sea or for navigation purposes. In order to divert the route of large cruise liners from the historic center of Venice, Italy, the Venice Port Authority has recently proposed a project for the dredging of a new 3-km long and 10-m deep navigation canal (called Marghera-Venice Canal, MVC, in the sequel) through the shallows of the Venice Lagoon. The MVC will connect the passenger terminal located in the southwestern part of the historic center to a main channel that reaches the industrial area on the western lagoon margin. Can the new MVC facilitate saltwater intrusion below the lagoon bottom? Can the release into the lagoon of the chemicals detected in the groundwater around the industrial site be favoured by the MVC excavation? Can the depression waves generated by the ship transit (known as ship-wakes) along the MVC affect the flow and contaminant exchange between the subsurface and surficial systems? A response to these questions has been provided by the use of uncoupled and coupled density-dependent groundwater flow and transport simulators. The hydrogeological modelling has been supported by an in-depth characterization of the Venice lagoon subsurface along the MVC. Geophysical surveys, laboratory analyses on groundwater and sediment samples, in-situ measurements through piezometers and pressure sensors, and the outcome of 3D hydrodynamic and computational fluid dynamic (CFD) models have been used to set-up and calibrate the subsurface multi-model approach. The modelling results can be summarized as follows: i) the MVC has a negligible effect in relation to the propagation of the tidal regime into the subsoil; ii) the depression caused by the ship transit along the MVC is responsible of a groundwater efflux from the canal bottom into the lagoon ranging up to 100 m3 per ship; iii) ship-wakes enhance the release of anthropogenic contaminants (As, Se, Cd, Hg, Pb, Cu, Cr) from the subsoil into the lagoon over few years after the canal excavation; iv) the MVC excavation cut the over-consolidated clay layer marking the Holocene-Pleistocene limit, thus favouring a localized salt contamination of the almost fresh-water aquifers located in the uppermost part of the Pleistocene series.

3D scene reconstruction based on multi-view distributed video coding in the Zernike domain for mobile applications

NASA Astrophysics Data System (ADS)

Palma, V.; Carli, M.; Neri, A.

2011-02-01

In this paper a Multi-view Distributed Video Coding scheme for mobile applications is presented. Specifically a new fusion technique between temporal and spatial side information in Zernike Moments domain is proposed. Distributed video coding introduces a flexible architecture that enables the design of very low complex video encoders compared to its traditional counterparts. The main goal of our work is to generate at the decoder the side information that optimally blends temporal and interview data. Multi-view distributed coding performance strongly depends on the side information quality built at the decoder. At this aim for improving its quality a spatial view compensation/prediction in Zernike moments domain is applied. Spatial and temporal motion activity have been fused together to obtain the overall side-information. The proposed method has been evaluated by rate-distortion performances for different inter-view and temporal estimation quality conditions.

Scalable Video Transmission Over Multi-Rate Multiple Access Channels

DTIC Science & Technology

2007-06-01

Rate - compatible punctured convolutional codes (RCPC codes ) and their ap- plications,” IEEE...source encoded using the MPEG-4 video codec. The source encoded bitstream is then channel encoded with Rate Compatible Punctured Convolutional (RCPC...Clark, and J. M. Geist, “ Punctured convolutional codes or rate (n-1)/n and simplified maximum likelihood decoding,” IEEE Transactions on

Investigating the structure preserving encryption of high efficiency video coding (HEVC)

NASA Astrophysics Data System (ADS)

Shahid, Zafar; Puech, William

2013-02-01

This paper presents a novel method for the real-time protection of new emerging High Efficiency Video Coding (HEVC) standard. Structure preserving selective encryption is being performed in CABAC entropy coding module of HEVC, which is significantly different from CABAC entropy coding of H.264/AVC. In CABAC of HEVC, exponential Golomb coding is replaced by truncated Rice (TR) up to a specific value for binarization of transform coefficients. Selective encryption is performed using AES cipher in cipher feedback mode on a plaintext of binstrings in a context aware manner. The encrypted bitstream has exactly the same bit-rate and is format complaint. Experimental evaluation and security analysis of the proposed algorithm is performed on several benchmark video sequences containing different combinations of motion, texture and objects.

Digital video technologies and their network requirements

DOE Office of Scientific and Technical Information (OSTI.GOV)

R. P. Tsang; H. Y. Chen; J. M. Brandt

1999-11-01

Coded digital video signals are considered to be one of the most difficult data types to transport due to their real-time requirements and high bit rate variability. In this study, the authors discuss the coding mechanisms incorporated by the major compression standards bodies, i.e., JPEG and MPEG, as well as more advanced coding mechanisms such as wavelet and fractal techniques. The relationship between the applications which use these coding schemes and their network requirements are the major focus of this study. Specifically, the authors relate network latency, channel transmission reliability, random access speed, buffering and network bandwidth with the variousmore » coding techniques as a function of the applications which use them. Such applications include High-Definition Television, Video Conferencing, Computer-Supported Collaborative Work (CSCW), and Medical Imaging.« less

A reaction-diffusion-based coding rate control mechanism for camera sensor networks.

PubMed

Yamamoto, Hiroshi; Hyodo, Katsuya; Wakamiya, Naoki; Murata, Masayuki

2010-01-01

A wireless camera sensor network is useful for surveillance and monitoring for its visibility and easy deployment. However, it suffers from the limited capacity of wireless communication and a network is easily overflown with a considerable amount of video traffic. In this paper, we propose an autonomous video coding rate control mechanism where each camera sensor node can autonomously determine its coding rate in accordance with the location and velocity of target objects. For this purpose, we adopted a biological model, i.e., reaction-diffusion model, inspired by the similarity of biological spatial patterns and the spatial distribution of video coding rate. Through simulation and practical experiments, we verify the effectiveness of our proposal.

Research on compression performance of ultrahigh-definition videos

NASA Astrophysics Data System (ADS)

Li, Xiangqun; He, Xiaohai; Qing, Linbo; Tao, Qingchuan; Wu, Di

2017-11-01

With the popularization of high-definition (HD) images and videos (1920×1080 pixels and above), there are even 4K (3840×2160) television signals and 8 K (8192×4320) ultrahigh-definition videos. The demand for HD images and videos is increasing continuously, along with the increasing data volume. The storage and transmission cannot be properly solved only by virtue of the expansion capacity of hard disks and the update and improvement of transmission devices. Based on the full use of the coding standard high-efficiency video coding (HEVC), super-resolution reconstruction technology, and the correlation between the intra- and the interprediction, we first put forward a "division-compensation"-based strategy to further improve the compression performance of a single image and frame I. Then, by making use of the above thought and HEVC encoder and decoder, a video compression coding frame is designed. HEVC is used inside the frame. Last, with the super-resolution reconstruction technology, the reconstructed video quality is further improved. The experiment shows that by the proposed compression method for a single image (frame I) and video sequence here, the performance is superior to that of HEVC in a low bit rate environment.

Parametric optimization of the MVC desalination plant with thermomechanical compressor

NASA Astrophysics Data System (ADS)

Blagin, E. V.; Biryuk, V. V.; Anisimov, M. Y.; Shimanov, A. A.; Gorshkalev, A. A.

2018-03-01

This article deals with parametric optimization of the Mechanical Vapour Compression (MVC) desalination plant with thermomechanical compressor. In this plants thermocompressor is used instead of commonly used centrifugal compressor. Influence of two main parameters was studied. These parameters are: inlet pressure and number of stages. Analysis shows that it is possible to achieve better plant performance in comparison with traditional MVC plant. But is required reducing the number of stages and utilization of low or high initial pressure with power consumption maximum at approximately 20-30 kPa.

Performance comparison of AV1, HEVC, and JVET video codecs on 360 (spherical) video

NASA Astrophysics Data System (ADS)

Topiwala, Pankaj; Dai, Wei; Krishnan, Madhu; Abbas, Adeel; Doshi, Sandeep; Newman, David

2017-09-01

This paper compares the coding efficiency performance on 360 videos, of three software codecs: (a) AV1 video codec from the Alliance for Open Media (AOM); (b) the HEVC Reference Software HM; and (c) the JVET JEM Reference SW. Note that 360 video is especially challenging content, in that one codes full res globally, but typically looks locally (in a viewport), which magnifies errors. These are tested in two different projection formats ERP and RSP, to check consistency. Performance is tabulated for 1-pass encoding on two fronts: (1) objective performance based on end-to-end (E2E) metrics such as SPSNR-NN, and WS-PSNR, currently developed in the JVET committee; and (2) informal subjective assessment of static viewports. Constant quality encoding is performed with all the three codecs for an unbiased comparison of the core coding tools. Our general conclusion is that under constant quality coding, AV1 underperforms HEVC, which underperforms JVET. We also test with rate control, where AV1 currently underperforms the open source X265 HEVC codec. Objective and visual evidence is provided.

Spatial correlation-based side information refinement for distributed video coding

NASA Astrophysics Data System (ADS)

Taieb, Mohamed Haj; Chouinard, Jean-Yves; Wang, Demin

2013-12-01

Distributed video coding (DVC) architecture designs, based on distributed source coding principles, have benefitted from significant progresses lately, notably in terms of achievable rate-distortion performances. However, a significant performance gap still remains when compared to prediction-based video coding schemes such as H.264/AVC. This is mainly due to the non-ideal exploitation of the video sequence temporal correlation properties during the generation of side information (SI). In fact, the decoder side motion estimation provides only an approximation of the true motion. In this paper, a progressive DVC architecture is proposed, which exploits the spatial correlation of the video frames to improve the motion-compensated temporal interpolation (MCTI). Specifically, Wyner-Ziv (WZ) frames are divided into several spatially correlated groups that are then sent progressively to the receiver. SI refinement (SIR) is performed as long as these groups are being decoded, thus providing more accurate SI for the next groups. It is shown that the proposed progressive SIR method leads to significant improvements over the Discover DVC codec as well as other SIR schemes recently introduced in the literature.

A robust coding scheme for packet video

NASA Technical Reports Server (NTRS)

Chen, Y. C.; Sayood, Khalid; Nelson, D. J.

1991-01-01

We present a layered packet video coding algorithm based on a progressive transmission scheme. The algorithm provides good compression and can handle significant packet loss with graceful degradation in the reconstruction sequence. Simulation results for various conditions are presented.

A robust coding scheme for packet video

NASA Technical Reports Server (NTRS)

Chen, Yun-Chung; Sayood, Khalid; Nelson, Don J.

1992-01-01

A layered packet video coding algorithm based on a progressive transmission scheme is presented. The algorithm provides good compression and can handle significant packet loss with graceful degradation in the reconstruction sequence. Simulation results for various conditions are presented.

Influences of Fascicle Length During Isometric Training on Improvement of Muscle Strength.

PubMed

Tanaka, Hiroki; Ikezoe, Tome; Umehara, Jun; Nakamura, Masatoshi; Umegaki, Hiroki; Kobayashi, Takuya; Nishishita, Satoru; Fujita, Kosuke; Araki, Kojiro; Ichihashi, Noriaki

2016-11-01

Tanaka, H, Ikezoe, T, Umehara, J, Nakamura, M, Umegaki, H, Kobayashi, T, Nishishita, S, Fujita, K, Araki, K, and Ichihashi, N. Influences of fascicle length during isometric training on improvement of muscle strength. J Strength Cond Res 30(11): 3249-3255, 2016-This study investigated whether low-intensity isometric training would elicit a greater improvement in maximum voluntary contraction (MVC) at the same fascicle length, rather than the joint angle, adopted during training. Sixteen healthy women (21.8 ± 1.5 years) were randomly divided into an intervention group and a control group. Before (Pre) and after (Post) training, isometric plantarflexion MVCs were measured every 10° through the range of ankle joint position from 20° dorsiflexion to 30° plantarflexion (i.e., 6 ankle angles). Medial gastrocnemius fascicle length was also measured at each position, using B-mode ultrasound under 3 conditions of muscle activation: at rest, 30%MVC at respective angles, and MVC. Plantarflexion resistance training at an angle of 20° plantarflexion was performed 3 days a week for 4 weeks at 30%MVC using 3 sets of twenty 3-second isometric contractions. Maximum voluntary contraction in the intervention group increased at 0 and 10° plantarflexion (0°; Pre: 81.2 ± 26.5 N·m, Post: 105.0 ± 21.6 N·m, 10°; Pre: 63.0 ± 23.6 N·m, Post: 81.3 ± 20.3 N·m), which was not the angle used in training (20°). However, the fascicle length adopted in training at 20° plantarflexion and 30%MVC was similar to the value at 0 or 10° plantarflexion at MVC. Low-intensity isometric training at a shortened muscle length may be effective for improving MVC at a lengthened muscle length because of specificity of the fascicle length than the joint angle.

Calibration of EMG to force for knee muscles is applicable with submaximal voluntary contractions.

PubMed

Doorenbosch, Caroline A M; Joosten, Annemiek; Harlaar, Jaap

2005-08-01

In this study, the influence of using submaximal isokinetic contractions about the knee compared to maximal voluntary contractions as input to obtain the calibration of an EMG-force model for knee muscles is investigated. Isokinetic knee flexion and extension contractions were performed by healthy subjects at five different velocities and at three contraction levels (100%, 75% and 50% of MVC). Joint angle, angular velocity, joint moment and surface EMG of five knee muscles were recorded. Individual calibration values were calculated according to [C.A.M. Doorenbosch, J. Harlaar, A clinically applicable EMG-force model to quantify active stabilization of the knee after a lesion of the anterior cruciate ligament, Clinical Biomechanics 18 (2003) 142-149] for each contraction level. First, the output of the model, calibrated with the 100% MVC was compared to the actually exerted net knee moment at the dynamometer. Normalized root mean square errors were calculated [A.L. Hof, C.A.N. Pronk, J.A. van Best, Comparison between EMG to force processing and kinetic analysis for the calf muscle moment in walking and stepping, Journal of Biomechanics 20 (1987) 167-187] to compare the estimated moments with the actually exerted moments. Mean RMSD errors ranged from 0.06 to 0.21 for extension and from 0.12 to 0.29 for flexion at the 100% trials. Subsequently, the calibration results of the 50% and 75% MVC calibration procedures were used. A standard signal, representing a random EMG level was used as input in the EMG force model, to compare the three models. Paired samples t-tests between the 100% MVC and the 75% MVC and 50% MVC, respectively, showed no significant differences (p>0.05). The application of submaximal contractions of larger than 50% MVC is suitable to calibrate a simple EMG to force model for knee extension and flexion. This means that in clinical practice, the EMG to force model can be applied by patients who cannot exert maximal force.

Surface electromyographic evaluation of jaw muscles in children with unilateral crossbite and lateral shift in the early mixed dentition. Sexual dimorphism

PubMed Central

Lenguas, Leticia; Alarcón, José-Antonio; Venancio, Filipa; Kassem, Marta

2012-01-01

Objectives: To examine the activity of jaw muscles at rest and during maximal voluntary clenching (MVC) in children with unilateral posterior crossbite (UPXB) and functional lateral shift in the early mixed dentition and to evaluate sex differences. Material and Methods: The sample included 30 children (15 males, 15 females) aged 6 to 10 years old, with UPXB and functional mandibular lateral shift (≥1.5 mm) in the early mixed dentition. sEMG activity coming from the muscle areas (anterior temporalis [AT], posterior temporalis [PT], masseter [MA] and suprahyoid [SH]) were obtained from both the crossbite (XB) and noncrossbite (NONXB) sides at mandibular rest position. sEMG acti-vity of the bilateral AT and MA muscles sides was obtained during MVC. Asymmetry and activity indexes were calculated for each muscle area at rest and during MVC; the MA/TA ratio during MVC was also determined. Results: At rest, no differences were found between sexes for any muscle areas or asymmetry and activity indexes. No differences were found between XB and NONXB sides. During MVC, however, significant sex differences were found in AT and MA activity, with higher sEMG values in males than in females, on both XB and NONXB sides. Asymmetry indexes, activity indexes and MA/AT ratios did not show significant differences between the sexes. Activity was symmetric both in males and in females. Conclusions: At rest, no sex differences were found, but during MVC males showed higher activity than did females in both XB and NONXB AT and MA muscle areas. Muscular activity was symmetrical at rest and during MVC in both sexes. Sexual dimorphism should be considered in the diagnosis and treatment of UPXB and lateral shift in the early mixed dentition. Key words:Unilateral crossbite, mandibular shift, jaw muscles, sEMG, early mixed dentition. PMID:22926468

Performance evaluation of the intra compression in the video coding standards

NASA Astrophysics Data System (ADS)

Abramowski, Andrzej

2015-09-01

The article presents a comparison of the Intra prediction algorithms in the current state-of-the-art video coding standards, including MJPEG 2000, VP8, VP9, H.264/AVC and H.265/HEVC. The effectiveness of techniques employed by each standard is evaluated in terms of compression efficiency and average encoding time. The compression efficiency is measured using BD-PSNR and BD-RATE metrics with H.265/HEVC results as an anchor. Tests are performed on a set of video sequences, composed of sequences gathered by Joint Collaborative Team on Video Coding during the development of the H.265/HEVC standard and 4K sequences provided by Ultra Video Group. According to results, H.265/HEVC provides significant bit-rate savings at the expense of computational complexity, while VP9 may be regarded as a compromise between the efficiency and required encoding time.

Coding visual features extracted from video sequences.

PubMed

Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

2014-05-01

Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

Software-codec-based full motion video conferencing on the PC using visual pattern image sequence coding

NASA Astrophysics Data System (ADS)

Barnett, Barry S.; Bovik, Alan C.

1995-04-01

This paper presents a real time full motion video conferencing system based on the Visual Pattern Image Sequence Coding (VPISC) software codec. The prototype system hardware is comprised of two personal computers, two camcorders, two frame grabbers, and an ethernet connection. The prototype system software has a simple structure. It runs under the Disk Operating System, and includes a user interface, a video I/O interface, an event driven network interface, and a free running or frame synchronous video codec that also acts as the controller for the video and network interfaces. Two video coders have been tested in this system. Simple implementations of Visual Pattern Image Coding and VPISC have both proven to support full motion video conferencing with good visual quality. Future work will concentrate on expanding this prototype to support the motion compensated version of VPISC, as well as encompassing point-to-point modem I/O and multiple network protocols. The application will be ported to multiple hardware platforms and operating systems. The motivation for developing this prototype system is to demonstrate the practicality of software based real time video codecs. Furthermore, software video codecs are not only cheaper, but are more flexible system solutions because they enable different computer platforms to exchange encoded video information without requiring on-board protocol compatible video codex hardware. Software based solutions enable true low cost video conferencing that fits the `open systems' model of interoperability that is so important for building portable hardware and software applications.

Building tribal traffic safety capacity

DOT National Transportation Integrated Search

2007-12-01

Nationally, the annual motor vehicle crash (MVC) mortality rates for American Indians per 100,000 persons have been three to four times greater than the general public. This trend has also been consistently evident in Arizona. The annual MVC mortalit...

The presence of social support messages on YouTube videos about inflammatory bowel disease and ostomies.

PubMed

Frohlich, Dennis Owen; Zmyslinski-Seelig, Anne

2012-01-01

The purpose of this study was to explore the types of social support messages YouTube users posted on medical videos. Specifically, the study compared messages posted on inflammatory bowel disease-related videos and ostomy-related videos. Additionally, the study analyzed the differences in social support messages posted on lay-created videos and professionally-created videos. Conducting a content analysis, the researchers unitized the comments on each video; the total number of thought units amounted to 5,960. Researchers coded each thought unit through the use of a coding scheme modified from a previous study. YouTube users posted informational support messages most frequently (65.1%), followed by emotional support messages (18.3%), and finally, instrumental support messages (8.2%).

A motion compensation technique using sliced blocks and its application to hybrid video coding

NASA Astrophysics Data System (ADS)

Kondo, Satoshi; Sasai, Hisao

2005-07-01

This paper proposes a new motion compensation method using "sliced blocks" in DCT-based hybrid video coding. In H.264 ? MPEG-4 Advance Video Coding, a brand-new international video coding standard, motion compensation can be performed by splitting macroblocks into multiple square or rectangular regions. In the proposed method, on the other hand, macroblocks or sub-macroblocks are divided into two regions (sliced blocks) by an arbitrary line segment. The result is that the shapes of the segmented regions are not limited to squares or rectangles, allowing the shapes of the segmented regions to better match the boundaries between moving objects. Thus, the proposed method can improve the performance of the motion compensation. In addition, adaptive prediction of the shape according to the region shape of the surrounding macroblocks can reduce overheads to describe shape information in the bitstream. The proposed method also has the advantage that conventional coding techniques such as mode decision using rate-distortion optimization can be utilized, since coding processes such as frequency transform and quantization are performed on a macroblock basis, similar to the conventional coding methods. The proposed method is implemented in an H.264-based P-picture codec and an improvement in bit rate of 5% is confirmed in comparison with H.264.

Does hip joint positioning affect maximal voluntary contraction in the gluteus maximus, gluteus medius, tensor fasciae latae and sartorius muscles?

PubMed

Bernard, J; Beldame, J; Van Driessche, S; Brunel, H; Poirier, T; Guiffault, P; Matsoukis, J; Billuart, F

2017-11-01

Minimally invasive total hip arthroplasty (THA) is presumed to provide functional and clinical benefits, whereas in fact the literature reveals that gait and posturographic parameters following THA do not recover values found in the general population. There is a significant disturbance of postural sway in THA patients, regardless of the surgical approach, although with some differences between approaches compared to controls: the anterior and anterolateral minimally invasive approaches seem to be more disruptive of postural parameters than the posterior approach. Electromyographic (EMG) study of the hip muscles involved in surgery [gluteus maximus (GMax), gluteus medius (GMed), tensor fasciae latae (TFL), and sartorius (S)] could shed light, the relevant literature involves discordant methodologies. We developed a methodology to assess EMG activity during maximal voluntary contraction (MVC) of the GMax, GMed, TFL and sartorius muscles as a reference for normalization. A prospective study aimed to assess whether hip joint positioning and the learning curve on an MVC test affect the EMG signal during a maximal voluntary contraction. Hip positioning and the learning curve on an MVC test affect EMG signal during MVC of GMax, GMed, TFL and S. Thirty young asymptomatic subjects participated in the study. Each performed 8 hip muscle MVCs in various joint positions recorded with surface EMG sensors. Each MVC was performed 3 times in 1 week, with the same schedule every day, controlling for activity levels in the preceding 24h. EMG activity during MVC was expressed as a ratio of EMG activity during unipedal stance. Non-parametric tests were applied. Statistical analysis showed no difference according to hip position for abductors or flexors in assessing EMG signal during MVC over the 3 sessions. Hip abductors showed no difference between abduction in lateral decubitus with hip straight versus hip flexed: GMax (19.8±13.7 vs. 14.5±7.8, P=0.78), GMed (13.4±9.0 vs. 9.9±6.6, P=0.21) and TFL (69.5±61.7 vs. 65.9±51.3, P=0.50). Flexors showed no difference between hip flexion/abduction/lateral rotation performed in supine or sitting position: TFL (70.6±45.9 vs. 61.6±45.8, P=0.22) and S (101.1±67.9 vs. 72.6±44.6, P=0.21). The most effective tests to assess EMG signal during MVC were for the hip abductors: hip abduction performed in lateral decubitus (36.7% for GMax, 76.7% for GMed), and for hip flexors: hip flexion/abduction/lateral rotation performed in supine decubitus (50% for TFL, 76.7% for S). The study hypothesis was not confirmed, since hip joint positioning and the learning curve on an MVC test did not affect EMG signal during MVC of GMax, GMed, TFL and S muscles. Therefore, a single session and one specific test is enough to assess MVC in hip abductors (abduction in lateral decubitus) and flexors (hip flexion/abduction/lateral rotation in supine position). This method could be applied to assess muscle function after THA, and particularly to compare different approaches. III, case-matched study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Extensions under development for the HEVC standard

NASA Astrophysics Data System (ADS)

Sullivan, Gary J.

2013-09-01

This paper discusses standardization activities for extending the capabilities of the High Efficiency Video Coding (HEVC) standard - the first edition of which was completed in early 2013. These near-term extensions are focused on three areas: range extensions (such as enhanced chroma formats, monochrome video, and increased bit depth), bitstream scalability extensions for spatial and fidelity scalability, and 3D video extensions (including stereoscopic/multi-view coding, and probably also depth map coding and combinations thereof). Standardization extensions on each of these topics will be completed by mid-2014, and further work beyond that timeframe is also discussed.

Using emergency department-based inception cohorts to determine genetic characteristics associated with long term patient outcomes after motor vehicle collision: methodology of the CRASH study.

PubMed

Platts-Mills, Timothy F; Ballina, Lauren; Bortsov, Andrey V; Soward, April; Swor, Robert A; Jones, Jeffrey S; Lee, David C; Peak, David A; Domeier, Robert M; Rathlev, Niels K; Hendry, Phyllis L; McLean, Samuel A

2011-09-26

Persistent musculoskeletal pain and psychological sequelae following minor motor vehicle collision (MVC) are common problems with a large economic cost. Prospective studies of pain following MVC have demonstrated that demographic characteristics, including female gender and low education level, and psychological characteristics, including high pre-collision anxiety, are independent predictors of persistent pain. These results have contributed to the psychological and social components of a biopsychosocial model of post-MVC pain pathogenesis, but the biological contributors to the model remain poorly defined. Recent experimental studies indicate that genetic variations in adrenergic system function influence the vulnerability to post-traumatic pain, but no studies have examined the contribution of genetic factors to existing predictive models of vulnerability to persistent pain. The Project CRASH study is a federally supported, multicenter, prospective study designed to determine whether variations in genes affecting synaptic catecholamine levels and alpha and beta adrenergic receptor function augment social and psychological factors in a predictive model of persistent musculoskeletal pain and posttraumatic stress disorder (PTSD) following minor MVC. The Project CRASH study will assess pain, pain interference and PTSD symptoms at 6 weeks, 6 months, and 1 year in approximately 1,000 patients enrolled from 8 Emergency Departments in four states with no-fault accident laws. The results from this study will provide insights into the pathophysiology of persistent pain and PTSD following MVC and may serve to improve the ability of clinicians and researchers to identify individuals at high risk for adverse outcomes following minor MVC.

The effects of accumulated muscle fatigue on the mechanomyographic waveform: implications for injury prediction.

PubMed

Tosovic, D; Than, C; Brown, J M M

2016-08-01

Muscle fatigue has been identified as a risk factor for spontaneous muscle injuries in sport. However, few studies have investigated the accumulated effects of muscle fatigue on human muscle contractile properties. This study aimed to determine whether repeated bouts of exercise inducing acute fatigue leads to longer-term fatigue-related changes in muscle contractile properties. Maximum voluntary contraction (MVC), electromyographic (EMG) and mechanomyographic (MMG) measures were recorded in the biceps brachii of 11 participants for 13 days, before and after a maximally fatiguing exercise protocol. The exercise protocol involved participants repetitively lifting a weight (concentric contractions only) equal to 40 % MVC, until failure. A significant (p < 0.05) acute pre- to post-exercise decline of biceps brachii MVC and median power frequency (MPF) was observed each day, whilst no difference existed between pre-exercise MVC or MPF values on subsequent days (days 2-13). However, decreases in number of lift repetitions and in pre-exercise MMG values of muscle belly displacement, contraction velocity and half-relaxation velocity were observed through to day 13. Whilst MVC and MPF measures resolved by the following day's test session, MMG measures indicated an ongoing decrement in muscle performance through days 2-13 consistent with the decline in lift repetitions observed. These results suggest that MMG may be more sensitive in detecting accumulated muscle fatigue than the 'gold standard' measures of MVC/MPF. Considering that muscle fatigue leads to injury, the on-going monitoring of MMG derived contractile properties of muscles in athletes may aid in the prediction of fatigued-induced muscle injury.

A Comparison of a Maximum Exertion Method and a Model-Based, Sub-Maximum Exertion Method for Normalizing Trunk EMG

PubMed Central

Cholewicki, Jacek; van Dieën, Jaap; Lee, Angela S.; Reeves, N. Peter

2011-01-01

The problem with normalizing EMG data from patients with painful symptoms (e.g. low back pain) is that such patients may be unwilling or unable to perform maximum exertions. Furthermore, the normalization to a reference signal, obtained from a maximal or sub-maximal task, tends to mask differences that might exist as a result of pathology. Therefore, we presented a novel method (GAIN method) for normalizing trunk EMG data that overcomes both problems. The GAIN method does not require maximal exertions (MVC) and tends to preserve distinct features in the muscle recruitment patterns for various tasks. Ten healthy subjects performed various isometric trunk exertions, while EMG data from 10 muscles were recorded and later normalized using the GAIN and MVC methods. The MVC method resulted in smaller variation between subjects when tasks were executed at the three relative force levels (10%, 20%, and 30% MVC), while the GAIN method resulted in smaller variation between subjects when the tasks were executed at the three absolute force levels (50 N, 100 N, and 145 N). This outcome implies that the MVC method provides a relative measure of muscle effort, while the GAIN-normalized EMG data gives an estimate of the absolute muscle force. Therefore, the GAIN-normalized EMG data tends to preserve the EMG differences between subjects in the way they recruit their muscles to execute various tasks, while the MVC-normalized data will tend to suppress such differences. The appropriate choice of the EMG normalization method will depend on the specific question that an experimenter is attempting to answer. PMID:21665489

The interactive effect of cooling and hypoxia on forearm fatigue development.

PubMed

Lloyd, Alex; Hodder, Simon; Havenith, George

2015-09-01

To examine the effect of separate and combined exposure to hypoxia [normoxia (FIO2 = 0.21) vs. moderate altitude (FIO2 = 0.13)] and temperature [thermoneutral (22 °C) vs. cold (5 °C)] on muscle fatigue development in the forearm, after repeated low-resistance contractions. Eight males were exposed for 70 min to four separate conditions in a balanced order. Conditions were normoxic-thermoneutral (N), hypoxic-thermoneutral, normoxic-cold and hypoxic-cold. After 15-min seated rest, participants carried out intermittent dynamic forearm exercise at 15 % maximal isometric voluntary contraction (MVC) for eight consecutive, 5-min work bouts. Each bout was separated by 110 s rest during which MVC force was collected. When exposed to hypoxia and cold independently, the exercise protocol decreased MVC force of the finger flexors by 8.1 and 13.9 %, respectively, compared to thermoneutral normoxia. When hypoxia and cold were combined, the decrease in MVC force was 21.4 % more than thermoneutral normoxia, reflecting an additive effect and no interaction. EMG relative to force produced during MVC, increased by 2 and 1.2 μV per kg (36 and 23 % of N) for cold and hypoxia, respectively. When the stressors were combined the effect was additive, increasing to 3.1 μV per kg (56 % of N). When compared to exercise in thermoneutral normoxic conditions, both cold and hypoxia significantly reduce brief MVC force output. This effect appears to be of mechanical origin, not a failure in muscle fibre recruitment per se. Additionally, the reduction in force is greater when the stressors are combined, showing an additive effect.

Obesity decreases both whole muscle and fascicle strength in young females but only exacerbates the aging‐related whole muscle level asthenia

PubMed Central

Tomlinson, David J.; Erskine, Robert M.; Winwood, Keith; Morse, Christopher Ian; Onambélé, Gladys L.

2014-01-01

Abstract Obesity has previously been associated with greater muscle strength. Aging, on the other hand, reduces muscle specific force (the force per unit physiological cross‐sectional area [PCSA] of muscle). However, neither the effect of obesity on skeletal muscle specific force nor the combined effects of aging and obesity on this parameter are known. This study aimed to describe the interplay between body mass index (BMI)/adiposity, aging, and skeletal muscle specific force. Ninety‐four untrained healthy women categorized by age into young (Y; mean ± SD: 25.5 ± 9.0 years) versus old (O; 64.8 ± 7.2 years) were assessed for body composition, gastrocnemius medialis (GM) muscle volume (V), net maximum voluntary contraction (nMVC), and specific force (SF). The young obese, while demonstrating 71% and 29% (P < 0.001) higher V and nMVC compared to normal BMI individuals, were in fact 26% (P = 0.007) weaker than these, where V was used to scale nMVC (i.e., nMVC/V). The weakness associated with obesity was further exemplified in the 34% (P < 0.001) lower SF relative to normal BMI individuals. Similarly, ≥40% body fat was associated with 60% and 27% (P < 0.001) higher V and nMVC, but 11% and 25% (P < 0.01) lower nMVC/V and SF than <40% body fat. The aging‐related rates of decline in V (−2 cm3/year P < 0.05) and nMVC (−1.2 cm3/year P < 0.05) were highest in obesity defined by BMI. This effect was also seen when segregating by >40% adiposity. Interestingly, however, obesity appeared advantageous to the aging‐related changes in nMVC/V (P < 0.001) and SF (P < 0.001). Unlike previous reports of greater strength in the obese compared with leaner age‐matched counterparts, we in fact demonstrate that the young sedentary obese, are substantially weaker, where the volume of skeletal muscle is used to scale the maximal torque output, or forces are quantified at the fascicular level. The seemingly positive impact of obesity on rate of aging, however, is complex and warrants further investigations. PMID:24963030

Obesity decreases both whole muscle and fascicle strength in young females but only exacerbates the aging-related whole muscle level asthenia.

PubMed

Tomlinson, David J; Erskine, Robert M; Winwood, Keith; Morse, Christopher Ian; Onambélé, Gladys L

2014-06-24

Obesity has previously been associated with greater muscle strength. Aging, on the other hand, reduces muscle specific force (the force per unit physiological cross-sectional area [PCSA] of muscle). However, neither the effect of obesity on skeletal muscle specific force nor the combined effects of aging and obesity on this parameter are known. This study aimed to describe the interplay between body mass index (BMI)/adiposity, aging, and skeletal muscle specific force. Ninety-four untrained healthy women categorized by age into young (Y; mean ± SD: 25.5 ± 9.0 years) versus old (O; 64.8 ± 7.2 years) were assessed for body composition, gastrocnemius medialis (GM) muscle volume (V), net maximum voluntary contraction (nMVC), and specific force (SF). The young obese, while demonstrating 71% and 29% (P < 0.001) higher V and nMVC compared to normal BMI individuals, were in fact 26% (P = 0.007) weaker than these, where V was used to scale nMVC (i.e., nMVC/V). The weakness associated with obesity was further exemplified in the 34% (P < 0.001) lower SF relative to normal BMI individuals. Similarly, ≥40% body fat was associated with 60% and 27% (P < 0.001) higher V and nMVC, but 11% and 25% (P < 0.01) lower nMVC/V and SF than <40% body fat. The aging-related rates of decline in V (-2 cm(3)/year P < 0.05) and nMVC (-1.2 cm(3)/year P < 0.05) were highest in obesity defined by BMI. This effect was also seen when segregating by >40% adiposity. Interestingly, however, obesity appeared advantageous to the aging-related changes in nMVC/V (P < 0.001) and SF (P < 0.001). Unlike previous reports of greater strength in the obese compared with leaner age-matched counterparts, we in fact demonstrate that the young sedentary obese, are substantially weaker, where the volume of skeletal muscle is used to scale the maximal torque output, or forces are quantified at the fascicular level. The seemingly positive impact of obesity on rate of aging, however, is complex and warrants further investigations. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

A hybrid video codec based on extended block sizes, recursive integer transforms, improved interpolation, and flexible motion representation

NASA Astrophysics Data System (ADS)

Karczewicz, Marta; Chen, Peisong; Joshi, Rajan; Wang, Xianglin; Chien, Wei-Jung; Panchal, Rahul; Coban, Muhammed; Chong, In Suk; Reznik, Yuriy A.

2011-01-01

This paper describes video coding technology proposal submitted by Qualcomm Inc. in response to a joint call for proposal (CfP) issued by ITU-T SG16 Q.6 (VCEG) and ISO/IEC JTC1/SC29/WG11 (MPEG) in January 2010. Proposed video codec follows a hybrid coding approach based on temporal prediction, followed by transform, quantization, and entropy coding of the residual. Some of its key features are extended block sizes (up to 64x64), recursive integer transforms, single pass switched interpolation filters with offsets (single pass SIFO), mode dependent directional transform (MDDT) for intra-coding, luma and chroma high precision filtering, geometry motion partitioning, adaptive motion vector resolution. It also incorporates internal bit-depth increase (IBDI), and modified quadtree based adaptive loop filtering (QALF). Simulation results are presented for a variety of bit rates, resolutions and coding configurations to demonstrate the high compression efficiency achieved by the proposed video codec at moderate level of encoding and decoding complexity. For random access hierarchical B configuration (HierB), the proposed video codec achieves an average BD-rate reduction of 30.88c/o compared to the H.264/AVC alpha anchor. For low delay hierarchical P (HierP) configuration, the proposed video codec achieves an average BD-rate reduction of 32.96c/o and 48.57c/o, compared to the H.264/AVC beta and gamma anchors, respectively.

Implementation issues in source coding

NASA Technical Reports Server (NTRS)

Sayood, Khalid; Chen, Yun-Chung; Hadenfeldt, A. C.

1989-01-01

An edge preserving image coding scheme which can be operated in both a lossy and a lossless manner was developed. The technique is an extension of the lossless encoding algorithm developed for the Mars observer spectral data. It can also be viewed as a modification of the DPCM algorithm. A packet video simulator was also developed from an existing modified packet network simulator. The coding scheme for this system is a modification of the mixture block coding (MBC) scheme described in the last report. Coding algorithms for packet video were also investigated.

Indexing, Browsing, and Searching of Digital Video.

ERIC Educational Resources Information Center

Smeaton, Alan F.

2004-01-01

Presents a literature review that covers the following topics related to indexing, browsing, and searching of digital video: video coding and standards; conventional approaches to accessing digital video; automatically structuring and indexing digital video; searching, browsing, and summarization; measurement and evaluation of the effectiveness of…

Chronic widespread pain after motor vehicle collision typically occurs through immediate development and nonrecovery: results of an emergency department-based cohort study.

PubMed

Hu, JunMei; Bortsov, Andrey V; Ballina, Lauren; Orrey, Danielle C; Swor, Robert A; Peak, David; Jones, Jeffrey; Rathlev, Niels; Lee, David C; Domeier, Robert; Hendry, Phyllis; Parry, Blair A; McLean, Samuel A

2016-02-01

Motor vehicle collision (MVC) can trigger chronic widespread pain (CWP) development in vulnerable individuals. Whether such CWP typically develops through the evolution of pain from regional to widespread or through the early development of widespread pain with nonrecovery is currently unknown. We evaluated the trajectory of CWP development (American College of Rheumatology criteria) among 948 European-American individuals who presented to the emergency department (ED) for care in the early aftermath of MVC. Pain extent was assessed in the ED and 6 weeks, 6 months, and 1 year after MVC on 100%, 91%, 89%, and 91% of participants, respectively. Individuals who reported prior CWP at the time of ED evaluation (n = 53) were excluded. Trajectory modeling identified a 2-group solution as optimal, with the Bayes Factor value (138) indicating strong model selection. Linear solution plots supported a nonrecovery model. Although the number of body regions with pain in the non-CWP group steadily declined, the number of body regions with pain in the CWP trajectory group (192/895, 22%) remained relatively constant over time. These data support the hypothesis that individuals who develop CWP after MVC develop widespread pain in the early aftermath of MVC, which does not remit.

Muscular activity and torque of the foot dorsiflexor muscles during decremental isometric test: A cross-sectional study.

PubMed

Ruiz-Muñoz, Maria; González-Sánchez, Manuel; Martín-Martín, Jaime; Cuesta-Vargas, Antonio I

2017-06-01

To analyse the torque variation level that could be explained by the muscle activation (EMG) amplitude of the three major foot dorsiflexor muscles (tibialis anterior (TA), extensor digitorum longus (EDL), extensor hallucis longus (EHL)) during isometric foot dorsiflexion at different intensities. In a cross-sectional study, forty-one subjects performed foot dorsiflexion at 100%, 75%, 50% and 25% of maximal voluntary contractions (MVC) with the hip and knee flexed 90° and the ankle in neutral position (90° between leg and foot). Three foot dorsiflexions were performed for each intensity. Outcome variables were: maximum (100% MVC) and relative torque (75%, 50%, 25% MVC), maximum and relative EMG amplitude. A linear regression analysis was calculated for each intensity of the isometric foot dorsiflexion. The degree of torque variation (dependent variable) from the independent variables explain (EMG amplitude of the three major foot dorsiflexor muscles) the increases when the foot dorsiflexion intensity is increased, with values of R 2 that range from 0.194 (during 25% MVC) to 0.753 (during 100% MVC). The reliability of the outcome variables was excellent. The EMG amplitude of the three main foot dorsiflexors exhibited more variance in the dependent variable (torque) when foot dorsiflexion intensity increases. Copyright © 2016 Elsevier Ltd. All rights reserved.

Maraviroc, as a Switch Option, in HIV-1-infected Individuals With Stable, Well-controlled HIV Replication and R5-tropic Virus on Their First Nucleoside/Nucleotide Reverse Transcriptase Inhibitor Plus Ritonavir-boosted Protease Inhibitor Regimen: Week 48 Results of the Randomized, Multicenter MARCH Study.

PubMed

Pett, Sarah Lilian; Amin, Janaki; Horban, Andrejz; Andrade-Villanueva, Jaime; Losso, Marcelo; Porteiro, Norma; Sierra Madero, Juan; Belloso, Waldo; Tu, Elise; Silk, David; Kelleher, Anthony; Harrigan, Richard; Clark, Andrew; Sugiura, Wataru; Wolff, Marcelo; Gill, John; Gatell, Jose; Fisher, Martin; Clarke, Amanda; Ruxrungtham, Kiat; Prazuck, Thierry; Kaiser, Rolf; Woolley, Ian; Arnaiz, Juan Alberto; Cooper, David; Rockstroh, Jürgen K; Mallon, Patrick; Emery, Sean

2016-07-01

Alternative combination antiretroviral therapies in virologically suppressed human immunodeficiency virus (HIV)-infected patients experiencing side effects and/or at ongoing risk of important comorbidities from current therapy are needed. Maraviroc (MVC), a chemokine receptor 5 antagonist, is a potential alternative component of therapy in those with R5-tropic virus. The Maraviroc Switch Study is a randomized, multicenter, 96-week, open-label switch study in HIV type 1-infected adults with R5-tropic virus, virologically suppressed on a ritonavir-boosted protease inhibitor (PI/r) plus double nucleoside/nucleotide reverse transcriptase inhibitor (2 N(t)RTI) backbone. Participants were randomized 1:2:2 to current combination antiretroviral therapy (control), or replacing the protease inhibitor (MVC + 2 N(t)RTI arm) or the nucleoside reverse transcriptase inhibitor backbone (MVC + PI/r arm) with twice-daily MVC. The primary endpoint was the difference (switch minus control) in proportion with plasma viral load (VL) <200 copies/mL at 48 weeks. The switch arms were judged noninferior if the lower limit of the 95% confidence interval (CI) for the difference in the primary endpoint was < -12% in the intention-to-treat (ITT) population. The ITT population comprised 395 participants (control, n = 82; MVC + 2 N(t)RTI, n = 156; MVC + PI/r, n = 157). Baseline characteristics were well matched. At week 48, noninferior rates of virological suppression were observed in those switching away from a PI/r (93.6% [95% CI, -9.0% to 2.2%] and 91.7% [95% CI, -9.6% to 3.8%] with VL <200 and <50 copies/mL, respectively) compared to the control arm (97.6% and 95.1% with VL <200 and <50 copies/mL, respectively). In contrast, MVC + PI/r did not meet noninferiority bounds and was significantly inferior (84.1% [95% CI, -19.8% to -5.8%] and 77.7% [95% CI, -24.9% to -8.4%] with VL <200 and <50 copies/mL, respectively) to the control arm in the ITT analysis. These data support MVC as a switch option for ritonavir-boosted PIs when partnered with a 2-N(t)RTI backbone, but not as part of N(t)RTI-sparing regimens comprising MVC with PI/r. NCT01384682. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

[The relevance of core muscles in ice hockey players: a feasibility study].

PubMed

Rogan, S; Blasimann, A; Nyffenegger, D; Zimmerli, N; Radlinger, L

2013-12-01

Good core strength is seen as a condition for high performance in sports. In general, especially maximum voluntary contraction (MVC) and strength endurance (SE) measurements of the core muscles are used. In addition, a few studies can be found that examine the core muscles in terms of MVC, rate of force development (RFD) and SE. Primary aims of this feasibility study were to investigate the feasibility regarding recruiting process, compliance and safety of the testing conditions and raise the force capabilities MVC, RFD and SE of the core muscles in amateur ice hockey players. Secondarily, tendencies of correlations between muscle activity and either shot speed and sprint time shall be examined. In this feasibility study the recruitment process has been approved by 29 ice hockey players, their adherence to the study measurements of trunk muscles, and safety of the measurements was evaluated. To determine the MVC, RFD and SE for the ventral, lateral and dorsal core muscles a dynamic force measurement was performed. To determine the correlation between core muscles and shot speed and 40-m sprint, respectively, the rank correlation coefficient (rho) from Spearman was used. The recruited number of eight field players and one goal-keeper was not very high. The compliance with 100 % was excellent. The players reported no adverse symptoms or injuries after the measurements. The results show median values for the ventral core muscles for MVC with 46.5 kg for RFD with 2.23 m/s2 and 96 s for the SE. For lateral core muscle median values of the lateral core muscles for MVC with 71.10 kg, RFD with 2.59 m/s2 and for SE over 66 s were determined. The dorsal core muscles shows values for MVC 69.7 kg, for RFD 3.39 m/s2 and for SE of 75 s. High correlations between MVC of the ventral core muscles (rho = -0.721, p = 0.021), and between the SE of the ventral core muscles (rho = 0.787, p = 0.012), and the shot velocity rate were determined. Another high correlation between SE of the ventral core muscles and sprint over 40 m (rho = 0.717, p = 0.030) could be demonstrated. This feasibility study has shown that the implementation of the selected design is adapted for future studies. Further studies are needed to better understand the relationship between the velocity rate and the MVC, and the SE respectively, as well as between the sprint and the SE. © Georg Thieme Verlag KG Stuttgart · New York.

Open Source Subtitle Editor Software Study for Section 508 Close Caption Applications

NASA Technical Reports Server (NTRS)

Murphy, F. Brandon

2013-01-01

This paper will focus on a specific item within the NASA Electronic Information Accessibility Policy - Multimedia Presentation shall have synchronized caption; thus making information accessible to a person with hearing impairment. This synchronized caption will assist a person with hearing or cognitive disability to access the same information as everyone else. This paper focuses on the research and implementation for CC (subtitle option) support to video multimedia. The goal of this research is identify the best available open-source (free) software to achieve synchronized captions requirement and achieve savings, while meeting the security requirement for Government information integrity and assurance. CC and subtitling are processes that display text within a video to provide additional or interpretive information for those whom may need it or those whom chose it. Closed captions typically show the transcription of the audio portion of a program (video) as it occurs (either verbatim or in its edited form), sometimes including non-speech elements (such as sound effects). The transcript can be provided by a third party source or can be extracted word for word from the video. This feature can be made available for videos in two forms: either Soft-Coded or Hard-Coded. Soft-Coded is the more optional version of CC, where you can chose to turn them on if you want, or you can turn them off. Most of the time, when using the Soft-Coded option, the transcript is also provided to the view along-side the video. This option is subject to compromise, whereas the transcript is merely a text file that can be changed by anyone who has access to it. With this option the integrity of the CC is at the mercy of the user. Hard-Coded CC is a more permanent form of CC. A Hard-Coded CC transcript is embedded within a video, without the option of removal.

Video Transmission for Third Generation Wireless Communication Systems

PubMed Central

Gharavi, H.; Alamouti, S. M.

2001-01-01

This paper presents a twin-class unequal protected video transmission system over wireless channels. Video partitioning based on a separation of the Variable Length Coded (VLC) Discrete Cosine Transform (DCT) coefficients within each block is considered for constant bitrate transmission (CBR). In the splitting process the fraction of bits assigned to each of the two partitions is adjusted according to the requirements of the unequal error protection scheme employed. Subsequently, partitioning is applied to the ITU-T H.263 coding standard. As a transport vehicle, we have considered one of the leading third generation cellular radio standards known as WCDMA. A dual-priority transmission system is then invoked on the WCDMA system where the video data, after being broken into two streams, is unequally protected. We use a very simple error correction coding scheme for illustration and then propose more sophisticated forms of unequal protection of the digitized video signals. We show that this strategy results in a significantly higher quality of the reconstructed video data when it is transmitted over time-varying multipath fading channels. PMID:27500033

A Comparison of Mental Health Diagnoses Treated via Interactive Video and Face to Face in the Veterans Healthcare Administration.

PubMed

Grubbs, Kathleen M; Fortney, John C; Dean, Tisha; Williams, James S; Godleski, Linda

2015-07-01

This study compares the mental health diagnoses of encounters delivered face to face and via interactive video in the Veterans Healthcare Administration (VHA). We compiled 1 year of national-level VHA administrative data for Fiscal Year 2012 (FY12). Mental health encounters were those with both a VHA Mental Health Stop Code and a Mental Health Diagnosis (n=11,906,114). Interactive video encounters were identified as those with a Mental Health Stop Code, paired with a VHA Telehealth Secondary Stop Code. Primary diagnoses were grouped into posttraumatic stress disorder (PTSD), depression, anxiety, bipolar disorder, psychosis, drug use, alcohol use, and other. In FY12, 1.5% of all mental health encounters were delivered via interactive video. Compared with face-to-face encounters, a larger percentage of interactive video encounters was for PTSD, depression, and anxiety, whereas a smaller percentage was for alcohol use, drug use, or psychosis. Providers and patients may feel more comfortable treating depression and anxiety disorders than substance use or psychosis via interactive video.

Scene-aware joint global and local homographic video coding

NASA Astrophysics Data System (ADS)

Peng, Xiulian; Xu, Jizheng; Sullivan, Gary J.

2016-09-01

Perspective motion is commonly represented in video content that is captured and compressed for various applications including cloud gaming, vehicle and aerial monitoring, etc. Existing approaches based on an eight-parameter homography motion model cannot deal with this efficiently, either due to low prediction accuracy or excessive bit rate overhead. In this paper, we consider the camera motion model and scene structure in such video content and propose a joint global and local homography motion coding approach for video with perspective motion. The camera motion is estimated by a computer vision approach, and camera intrinsic and extrinsic parameters are globally coded at the frame level. The scene is modeled as piece-wise planes, and three plane parameters are coded at the block level. Fast gradient-based approaches are employed to search for the plane parameters for each block region. In this way, improved prediction accuracy and low bit costs are achieved. Experimental results based on the HEVC test model show that up to 9.1% bit rate savings can be achieved (with equal PSNR quality) on test video content with perspective motion. Test sequences for the example applications showed a bit rate savings ranging from 3.7 to 9.1%.

Low-complexity video encoding method for wireless image transmission in capsule endoscope.

PubMed

Takizawa, Kenichi; Hamaguchi, Kiyoshi

2010-01-01

This paper presents a low-complexity video encoding method applicable for wireless image transmission in capsule endoscopes. This encoding method is based on Wyner-Ziv theory, in which side information available at a transmitter is treated as side information at its receiver. Therefore complex processes in video encoding, such as estimation of the motion vector, are moved to the receiver side, which has a larger-capacity battery. As a result, the encoding process is only to decimate coded original data through channel coding. We provide a performance evaluation for a low-density parity check (LDPC) coding method in the AWGN channel.

Improved Techniques for Video Compression and Communication

ERIC Educational Resources Information Center

Chen, Haoming

2016-01-01

Video compression and communication has been an important field over the past decades and critical for many applications, e.g., video on demand, video-conferencing, and remote education. In many applications, providing low-delay and error-resilient video transmission and increasing the coding efficiency are two major challenges. Low-delay and…

Comparison of sympathetic nerve responses to neck and forearm isometric exercise

NASA Technical Reports Server (NTRS)

Steele, S. L. Jr; Ray, C. A.

2000-01-01

PURPOSE: Although the autonomic and cardiovascular responses to arm and leg exercise have been studied, the sympathetic adjustments to exercise of the neck have not. The purpose of the present study was twofold: 1) to determine sympathetic and cardiovascular responses to isometric contractions of the neck extensors and 2) to compare sympathetic and cardiovascular responses to isometric exercise of the neck and forearm. METHODS: Muscle sympathetic nerve activity (MSNA), mean arterial pressure (MAP), and heart rate were measured in nine healthy subjects while performing isometric neck extension (INE) and isometric handgrip (IHG) in the prone position. After a 3-min baseline period, subjects performed three intensities of INE for 2.5 min each: 1) unloaded (supporting head alone), 2) 10% maximal voluntary contraction (MVC), and 3) 30% MVC, then subjects performed two intensities (10% and 30% MVC) of IHG for 2.5 min. RESULTS: Supporting the head by itself did not significantly change any of the variables. During [NE, MAP significantly increased by 10 +/- 2 and 31 +/- 4 mm Hg and MSNA increased by 67 +/- 46 and 168 +/- 36 units/30 s for 10% and 30% MVC, respectively. IHG and INE evoked similar responses at 10% MVC, but IHG elicited higher peak MAP and MSNA at 30% MVC (37 +/- 7 mm Hg (P < 0.05) and 300 +/- 48 units/30 s (P < 0.01) for IHG, respectively). CONCLUSIONS: The data indicate that INE can elicit marked increases in MSNA and cardiovascular responses but that it evokes lower peak responses as compared to IHG. We speculate that possible differences in muscle fiber type composition, muscle mass, and/or muscle architecture of the neck and forearm are responsible for these differences in peak responses.

Factors Associated with Pediatric Mortality from Motor Vehicle Crashes in the United States: A State-Based Analysis.

PubMed

Wolf, Lindsey L; Chowdhury, Ritam; Tweed, Jefferson; Vinson, Lori; Losina, Elena; Haider, Adil H; Qureshi, Faisal G

2017-08-01

To examine geographic variation in motor vehicle crash (MVC)-related pediatric mortality and identify state-level predictors of mortality. Using the 2010-2014 Fatality Analysis Reporting System, we identified passengers <15 years of age involved in fatal MVCs, defined as crashes on US public roads with ≥1 death (adult or pediatric) within 30 days. We assessed passenger, driver, vehicle, crash, and state policy characteristics as factors potentially associated with MVC-related pediatric mortality. Our outcomes were age-adjusted, MVC-related mortality rate per 100 000 children and percentage of children who died of those in fatal MVCs. Unit of analysis was US state. We used multivariable linear regression to define state characteristics associated with higher levels of each outcome. Of 18 116 children in fatal MVCs, 15.9% died. The age-adjusted, MVC-related mortality rate per 100 000 children varied from 0.25 in Massachusetts to 3.23 in Mississippi (mean national rate of 0.94). Predictors of greater age-adjusted, MVC-related mortality rate per 100 000 children included greater percentage of children who were unrestrained or inappropriately restrained (P < .001) and greater percentage of crashes on rural roads (P = .016). Additionally, greater percentages of children died in states without red light camera legislation (P < .001). For 10% absolute improvement in appropriate child restraint use nationally, our risk-adjusted model predicted >1100 pediatric deaths averted over 5 years. MVC-related pediatric mortality varied by state and was associated with restraint nonuse or misuse, rural roads, vehicle type, and red light camera policy. Revising state regulations and improving enforcement around these factors may prevent substantial pediatric mortality. Copyright © 2017 Elsevier Inc. All rights reserved.

Prehospital injury severity of children evacuated by helicopters from combat zones: a retrospective report.

PubMed

Samuel, Nir; Hirschhorn, Gil; Chen, Jacob; Steiner, Ivan P; Shavit, Itai

2013-03-01

In Israel, the Airborne Rescue and Evacuation Unit (AREU) provides prehospital trauma care in times of peace and during times of armed conflict. In peacetime, the AREU transports children who were involved in motor vehicle collisions (MVC) and those who fall off cliffs (FOC). During armed conflict, the AREU evacuates children who sustain firearm injuries (FI) from the fighting zones. To report on prehospital injury severity of children who were evacuated by the AREU from combat zones. A retrospective comparative analysis was conducted on indicators of prehospital injury severity for patients who had MVC, FOC, and FI. It included the National Advisory Committee for Aeronautics (NACA) score, the Glasgow Coma Scale (GCS) score on scene, and the number of procedures performed by emergency medical personnel and by the AREU air-crew. From January 2003 to December 2009, 36 MVC, 25 FOC, and 17 FI children were transported from the scene by the AREU. Five patients were dead at the scene: 1 (2.8%) MVC, 1 (4%) FOC, and 3 (17.6%) FI. Two (11.7%) FI patients were dead on arrival at the hospital. MVC, FOC, and FI patients had mean (±SD) NACA scores of 4.4 ± 1.2, 3.6 ± 1.2, and 5 ± 0.7, respectively. Mean (±SD) GCS scores were 8.9 ± 5.6, 13.6 ± 4, and 6.9 ± 5.3, respectively. Life support interventions were required by 29 (80.6%) MVC, 3 (12%) FOC, and 15 (88.2%) FI patients. In the prehospital setting, children evacuated from combat zones were more severely injured than children who were transported from the scene during peacetime. Copyright © 2013 Elsevier Inc. All rights reserved.

Psychological impact of injuries sustained in motor vehicle crashes: systematic review and meta-analysis.

PubMed

Craig, Ashley; Tran, Yvonne; Guest, Rebecca; Gopinath, Bamini; Jagnoor, Jagnoor; Bryant, Richard A; Collie, Alex; Tate, Robyn; Kenardy, Justin; Middleton, James W; Cameron, Ian

2016-09-08

The aim of this meta-analysis was to determine the psychological impact associated with motor vehicle crash (MVC)-related physical injuries. Systematic review and meta-analysis. Multiple search engines included MEDLINE (via OVID), PsycINFO and Embase, and studies were sourced from scientific journals, conference papers and doctoral theses. A high-yield search strategy was employed. Terms like 'psychological distress', 'depression', 'PTSD' and 'motor vehicle accident' were employed. These key words were run primarily and secondary searches were then conducted in association with the major injury types. Studies needed to compare psychological distress in people injured in an MVC with uninjured controls who had not recently experienced an MVC. Searches resulted in the identification of 2537 articles, and after eliminating duplicates and studies not meeting inclusion criteria, 24 studies were selected involving 4502 injured participants. These studies were entered into separate meta-analyses for mild to moderate traumatic brain injury (mTBI), whiplash-associated disorder (WAD) and spinal cord injury (SCI). Elevated psychological distress was associated with MVC-related injuries with a large summary effect size in WAD (0.90), medium to large effect size in SCI (0.69) and small to medium effect size in mTBI (0.23). No studies meeting inclusion criteria were found for burns, fractures and low back injury. Increased psychological distress remains elevated in SCI, mTBI and WAD for at least 3 years post-MVC. Rehabilitation strategies are needed to minimise distress subsequent to MVC-related physical injuries and the scientific robustness of studies requires improvement. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Psychological impact of injuries sustained in motor vehicle crashes: systematic review and meta-analysis

PubMed Central

Tran, Yvonne; Guest, Rebecca; Gopinath, Bamini; Jagnoor, Jagnoor; Bryant, Richard A; Collie, Alex; Tate, Robyn; Kenardy, Justin; Middleton, James W; Cameron, Ian

2016-01-01

Objective The aim of this meta-analysis was to determine the psychological impact associated with motor vehicle crash (MVC)-related physical injuries. Design Systematic review and meta-analysis. Data sources Multiple search engines included MEDLINE (via OVID), PsycINFO and Embase, and studies were sourced from scientific journals, conference papers and doctoral theses. Study selection A high-yield search strategy was employed. Terms like ‘psychological distress’, ‘depression’, ‘PTSD’ and ‘motor vehicle accident’ were employed. These key words were run primarily and secondary searches were then conducted in association with the major injury types. Studies needed to compare psychological distress in people injured in an MVC with uninjured controls who had not recently experienced an MVC. Data extraction Searches resulted in the identification of 2537 articles, and after eliminating duplicates and studies not meeting inclusion criteria, 24 studies were selected involving 4502 injured participants. These studies were entered into separate meta-analyses for mild to moderate traumatic brain injury (mTBI), whiplash-associated disorder (WAD) and spinal cord injury (SCI). Results Elevated psychological distress was associated with MVC-related injuries with a large summary effect size in WAD (0.90), medium to large effect size in SCI (0.69) and small to medium effect size in mTBI (0.23). No studies meeting inclusion criteria were found for burns, fractures and low back injury. Increased psychological distress remains elevated in SCI, mTBI and WAD for at least 3 years post-MVC. Conclusions Rehabilitation strategies are needed to minimise distress subsequent to MVC-related physical injuries and the scientific robustness of studies requires improvement. PMID:27609849

Obesity and trauma mortality: Sizing up the risks in motor vehicle crashes.

PubMed

Joseph, Bellal; Hadeed, Steven; Haider, Ansab A; Ditillo, Michael; Joseph, Aly; Pandit, Viraj; Kulvatunyou, Narong; Tang, Andrew; Latifi, Rifat; Rhee, Peter

Protective effects of safety devices in obese motorists in motor vehicle collisions (MVC) remain unclear. Aim of our study is to assess the association between morbid obesity and mortality in MVC, and to determine the efficacy of protective devices. We hypothesised that patients with morbid obesity will be at greater risk of death after MVC. A retrospective analysis of MVC patients (age ≥16 y.o.) was performed using the National Trauma Data Bank from 2007 to 2010. Patients with recorded comorbidity of morbid obesity (BMI≥40) were identified. Patients dead on arrival, with isolated traumatic brain injury, or incomplete data were excluded. The primary outcome was in-hospital mortality. Multivariate logistic regression was performed. Our sample of 214,306 MVC occupants included 10,260 (4.8%) morbidly obese patients. Mortality risk was greatest among occupants with morbid obesity (OR crude 1.74 [1.54-1.98]). After adjusting for patient demographics, safety device and physiological severity, odds of death was 1.52 [1.33-1.74] times greater in motorists with morbid obesity. Motorists with morbid obesity were at greater risk of death if no restraint (OR 1.84 [1.47-2.31]), seatbelt only (OR 1.48 [1.17-1.86]), or both seatbelt and airbag were present (OR 1.49 [1.13-1.97]). No significant differences in the odds of death exist between drivers with morbid obesity and non-morbidly obese drivers with only airbag deployment (OR 0.99 [0.65-1.51]). Motorists with morbid obesity are at greater risk of MVC. Regardless of safety device use, occupants with morbid obesity remained at greater risk of death. Further research examining the effectiveness of vehicle restraints in drivers with morbid obesity is warranted. Copyright © 2016. Published by Elsevier Ltd.

Neuromuscular fatigue during high-intensity intermittent exercise in individuals with intellectual disability.

PubMed

Borji, Rihab; Sahli, Sonia; Zarrouk, Nidhal; Zghal, Firas; Rebai, Haithem

2013-12-01

This study examined neuromuscular fatigue after high-intensity intermittent exercise in 10 men with mild intellectual disability (ID) in comparison with 10 controls. Both groups performed three maximal voluntary contractions (MVC) of knee extension with 5 min in-between. The highest level achieved was selected as reference MVC. The fatiguing exercise consists of five sets with a maximal number of flexion-extension cycles at 80% of the one maximal repetition (1RM) for the right leg at 90° with 90 s rest interval between sets. The MVC was tested again after the last set. Peak force and electromyography (EMG) signals were measured during the MVC tests. Root Mean Square (RMS) and Median Frequency (MF) were calculated. Neuromuscular efficiency (NME) was calculated as the ratio of peak force to the RMS. Before exercise, individuals with ID had a lower MVC (p<0.05) and a lower RMS (p<0.05). No significant difference between groups in MF and NME. After exercise, MVC decreases significantly in both groups (p<0.001). Individuals with ID have greater force decline (p<0.001 vs. p<0.01). RMS decreased significantly (p<0.001) whereas the NME increased significantly (p<0.05) in individuals with ID, but both remained unchanged in controls. The MF decreased significantly in both groups (p<0.001). In conclusion, individuals with ID presented a lower peak force than individuals without ID. After a high-intensity intermittent exercise, individuals with ID demonstrated a greater force decline caused by neural activation failure. When rehabilitation and sport train ID individuals, they should consider this nervous system weakness. Copyright © 2013 Elsevier Ltd. All rights reserved.

Reflex regulation during sustained and intermittent submaximal contractions in humans

PubMed Central

Duchateau, Jacques; Balestra, Costantino; Carpentier, Alain; Hainaut, Karl

2002-01-01

To investigate whether the intensity and duration of a sustained contraction influences reflex regulation, we compared sustained fatiguing contractions at 25 % and 50 % of maximal voluntary contraction (MVC) force in the human abductor pollicis brevis (APB) muscle. Because the activation of motoneurones during fatigue may be reflexively controlled by the metabolic status of the muscle, we also compared reflex activities during sustained and intermittent (6 s contraction, 4 s rest) contractions at 25 % MVC for an identical duration. The short-latency Hoffmann(H) reflex and the long-latency reflex (LLR) were recorded during voluntary contractions, before, during and after the fatigue tests, with each response normalised to the compound muscle action potential (M-wave). The results showed that fatigue during sustained contractions was inversely related to the intensity, and hence the duration, of the effort. The MVC force and associated surface electromyogram (EMG) declined by 26.2 % and 35.2 %, respectively, after the sustained contraction at 50 % MVC, and by 34.2 % and 44.2 % after the sustained contraction at 25 % MVC. Although the average EMG increased progressively with time during the two sustained fatiguing contractions, the amplitudes of the H and LLR reflexes decreased significantly. Combined with previous data (Duchateau & Hainaut, 1993), the results show that the effect on the H reflex is independent of the intensity of the sustained contraction, whereas the decline in the LLR is closely related to the duration of the contraction. Because there were no changes in the intermittent test at 25 % MVC, the results indicate that the net excitatory spinal and supraspinal reflex-mediated input to the motoneurone pool is reduced. This decline in excitation to the motoneurones, however, can be temporarily compensated by an enhancement of the central drive. PMID:12068054

Scapular muscle activity in a variety of plyometric exercises.

PubMed

Maenhout, Annelies; Benzoor, Maya; Werin, Maria; Cools, Ann

2016-04-01

Plyometric shoulder exercises are commonly used to progress from slow analytical strength training to more demanding high speed power training in the return to play phase after shoulder injury. The aim of this study was first, to investigate scapular muscle activity in plyometric exercises to support exercise selection in practice and second, to enhance understanding of how scapular muscles are recruited during the back and forth movement phase of these exercises. Thirty-two healthy subjects performed 10 plyometric exercises while surface EMG-activity of the scapular muscles (upper (UT), middle (MT) and lower trapezius (LT) and serratus anterior (SA)) was registered. A high speed camera tracked start and end of the back and forth movement. Mean scapular EMG activity during the 10 exercises ranged from 14.50% to 76.26%MVC for UT, from 15.19% to 96.55%MVC for MT, from 13.18% to 94.35%MVC for LT and from 13.50% to 98.50%MVC for SA. Anova for repeated measures showed significant differences in scapular muscle activity between exercises (p<0.001) and between the back and forth movement (p<0.001) within exercises. Plyometric shoulder exercises require moderate (31-60%MVC) to high (>60%MVC) scapular muscle activity. Highest MT/LT activity was present in prone plyometric external rotation and flexion. Highest SA activity was found in plyometric external rotation and flexion with Xco and plyometric push up on Bosu. Specific exercises can be selected that recruit minimal levels of UT activity (<15%): side lying plyometric external rotation and horizontal abduction or plyometric push up on the Bosu. The results of this study support exercise selection for clinical practice. Copyright © 2016 Elsevier Ltd. All rights reserved.

A randomized controlled trial of the effectiveness of brief-CBT for patients with symptoms of posttraumatic stress following a motor vehicle crash.

PubMed

Wu, Kitty K; Li, Frendi W; Cho, Valda W

2014-01-01

Motor vehicle crashes (MVCs) are leading contributors to the global burden of disease. Patients attending accident and emergency (A&E) after an MVC may develop symptoms of posttraumatic stress disorder (PTSD). There is evidence that brief cognitive behavioural therapy (B-CBT) can be effective in treating PTSD; however, there are few studies of the use of B-CBT to treat PTSD in MVC survivors. This study examined the effects of B-CBT and a self-help program on the severity of psychological symptoms in MVC survivors at risk of developing PTSD. Sixty participants who attended A&E after a MVC were screened for PTSD symptoms and randomized to a 4-weekly session B-CBT or a 4-week self-help program (SHP) booklet treatment conditions. Psychological assessments were completed at baseline (1-month post-MVC) and posttreatment (3- and 6-month follow-ups) by utilizing Impact of Event Scale-Revised (IES-R) and Hospital Anxiety and Depression Scale (HADS). There were significant improvements in the measures of anxiety, depression, and PTSD symptoms over time. Participants treated with B-CBT showed greater reductions in anxiety at 3-month and 6-month follow-ups, and in depression at 6-month follow-up. A comparison of effect size favoured B-CBT for the reduction of anxiety and depression symptoms measured by HADS. A high level of pretreatment anxiety and depression were predictive of negative outcome at 6-month follow-up in the SHP condition. There was no differential effect on PTSD symptoms measured by IES-R. This trial supports the efficacy of providing B-CBT as a preventive strategy to improve psychological symptoms after an MVC.

Development of the Strength Level on Arm for Indonesian People in Lifting Activity

NASA Astrophysics Data System (ADS)

Soewardi, H.; Prabaswari, A. D.; Muzakiroh, H. A.

2017-12-01

Lifting is one of manual material handling activity that involves the whole part of a body. This activity is significant to contribute musculoskeletal disorder specifically on arms. It is because the arms are a major strength to lift objects. However, many people do not know the capability of their arm so that the task designed does not comply with the limitation of workers. Thus, it is required to determine a level of strength on arms. The objective of this study is to develop the strength level of arms for Indonesian people based on musculoskeletal contraction. An experimental study is conducted in the ergonomics laboratory. 24 males and 24 females was participated in this study which consists of three different ethnics. They are sixteen participants of Ethnic A, sixteen participants of Ethnic B and sixteen participants of Ethnic C. A case study of lifting consists of 4 positions of object. They are 38 cm in height, 50 cm in height, 85 - 115 cm in height for forming 90 degrees of the elbow and 100 cm in height. Back lift technique was implemented. An Electromyography is used to investigate muscle contraction on arms. Statistical analysis is done to test the hypothesis. The result of this study shows that the arm strength level for Indonesian workers has significant differences between males and females among difference Ethnic. For male, Ethnic A has 28.82% - 79.28% of MVC, Ethnic B has 17.74% - 58.67% of MVC, and Ethnic C has 22.13% - 68.67% of MVC. For female, Ethnic A has 28.28% - 84.63% of MVC, Ethnic B has 24.47% - 70.98% of MVC, and Ethnic C has 24.24% - 75.67% of MVC.

The repeated-bout effect: influence on biceps brachii oxygenation and myoelectrical activity.

PubMed

Muthalib, Makii; Lee, Hoseong; Millet, Guillaume Y; Ferrari, Marco; Nosaka, Kazunori

2011-05-01

This study investigated biceps brachii oxygenation and myoelectrical activity during and following maximal eccentric exercise to better understand the repeated-bout effect. Ten men performed two bouts of eccentric exercise (ECC1, ECC2), consisting of 10 sets of 6 maximal lengthening contractions of the elbow flexors separated by 4 wk. Tissue oxygenation index minimum amplitude (TOI(min)), mean and maximum total hemoglobin volume by near-infrared spectroscopy, torque, and surface electromyography root mean square (EMG(RMS)) during exercise were compared between ECC1 and ECC2. Changes in maximal voluntary isometric contraction (MVC) torque, range of motion, plasma creatine kinase activity, muscle soreness, TOI(min), and EMG(RMS) during sustained (10-s) and 30-repeated isometric contraction tasks at 30% (same absolute force) and 100% MVC (same relative force) for 4 days postexercise were compared between ECC1 and ECC2. No significant differences between ECC1 and ECC2 were evident for changes in torque, TOI(min), mean total hemoglobin volume, maximum total hemoglobin volume, and EMG(RMS) during exercise. Smaller (P < 0.05) changes and faster recovery of muscle damage markers were evident following ECC2 than ECC1. During 30% MVC tasks, TOI(min) did not change, but EMG(RMS) increased 1-4 days following ECC1 and ECC2. During 100% MVC tasks, EMG(RMS) did not change, but torque and TOI(min) decreased 1-4 days following ECC1 and ECC2. TOI(min) during 100% MVC tasks and EMG(RMS) during 30% MVC tasks recovered faster (P < 0.05) following ECC2 than ECC1. We conclude that the repeated-bout effect cannot be explained by altered muscle activation or metabolic/hemodynamic changes, and the faster recovery in muscle oxygenation and activation was mainly due to faster recovery of force.

Selective recruitment of single motor units in human flexor digitorum superficialis muscle during flexion of individual fingers.

PubMed

Butler, T J; Kilbreath, S L; Gorman, R B; Gandevia, S C

2005-08-15

Flexor digitorum superficialis (FDS) is an extrinsic multi-tendoned muscle which flexes the proximal interphalangeal joints of the four fingers. It comprises four digital components, each with a tendon that inserts onto its corresponding finger. To determine the degree to which these digital components can be selectively recruited by volition, we recorded the activity of a single motor unit in one component via an intramuscular electrode while the subject isometrically flexed each of the remaining fingers, one at a time. The finger on which the unit principally acted was defined as the 'test finger' and that which flexed isometrically was the 'active' finger. Activity in 79 units was recorded. Isometric finger flexion forces of 50% maximum voluntary contraction (MVC) activated less than 50% of single units in components of FDS acting on fingers that were not voluntarily flexed. With two exceptions, the median recruitment threshold for all active-test finger combinations involving the index, middle, ring and little finger test units was between 49 and 60% MVC (60% MVC being the value assigned to those not recruited). The exceptions were flexion of the little finger while recording from ring finger units (median: 40% MVC), and vice versa (median: 2% MVC). For all active-test finger combinations, only 35/181 units were activated when the active finger flexed at less than 20% MVC, and the fingers were adjacent for 28 of these. Functionally, to recruit FDS units during grasping and lifting, relatively heavy objects were required, although systematic variation occurred with the width of the object. In conclusion, FDS components can be selectively activated by volition and this may be especially important for grasping at high forces with one or more fingers.

Low-complexity transcoding algorithm from H.264/AVC to SVC using data mining

NASA Astrophysics Data System (ADS)

Garrido-Cantos, Rosario; De Cock, Jan; Martínez, Jose Luis; Van Leuven, Sebastian; Cuenca, Pedro; Garrido, Antonio

2013-12-01

Nowadays, networks and terminals with diverse characteristics of bandwidth and capabilities coexist. To ensure a good quality of experience, this diverse environment demands adaptability of the video stream. In general, video contents are compressed to save storage capacity and to reduce the bandwidth required for its transmission. Therefore, if these compressed video streams were compressed using scalable video coding schemes, they would be able to adapt to those heterogeneous networks and a wide range of terminals. Since the majority of the multimedia contents are compressed using H.264/AVC, they cannot benefit from that scalability. This paper proposes a low-complexity algorithm to convert an H.264/AVC bitstream without scalability to scalable bitstreams with temporal scalability in baseline and main profiles by accelerating the mode decision task of the scalable video coding encoding stage using machine learning tools. The results show that when our technique is applied, the complexity is reduced by 87% while maintaining coding efficiency.

Variability of quadriceps femoris motor neuron discharge and muscle force in human aging.

PubMed

Welsh, Seth J; Dinenno, Devin V; Tracy, Brian L

2007-05-01

The purpose was to determine the contribution of visual feedback and the effect of aging on the variability of knee extensor (KE) muscle force and motor unit (MU) discharge. Single MUs were recorded during two types of isometric trials, (1) visual feedback provided (VIS) and then removed (NOVIS) during the trial (34 MUs from young, 32 from elderly), and (2) only NOVIS (66 MUs from young, 77 from elderly) during the trial. Recruitment threshold (RT) ranged from 0-37% MVC. Standard deviation (SD) and coefficient of variation (CV) of muscle force and MU interspike interval (ISI) was measured during steady contractions at target forces ranging from 0.3 to 54% MVC. Force drift (<0.5 Hz) was removed before analysis. VIS/NOVIS trials: the decrease in the CV of ISI from VIS to NOVIS was greater for MUs from elderly (12.5 +/- 4.1 to 9.94 +/- 2.6%) than young (10.6 +/- 3.3 to 10.3 +/- 2.8%, age group x vision interaction, P = 0.006). The change in CV of force from VIS to NOVIS was significantly greater for elderly (1.45 to 1.05%) than young (1.42 to 1.41%). NOVIS only trials: for all MUs, the average RT (6.6 +/- 7.7 % MVC), target force above RT (1.20 +/- 2.7% MVC), SD of ISI (0.012 +/- 0.005 s), and CV of ISI (11.1 +/- 3.3%) were similar for young and elderly MUs. The CV of force was similar between age groups for trials between 0 and 3% MVC (1.74 +/- 0.74%) and was greater for young subjects from 3 to 10% MVC (1.47 +/- 0.5 vs. 1.21 +/- 0.4%) and >10% MVC (1.44 +/- 0.6 vs. 1.01 +/- 0.3%). The CV of ISI was similar between age groups for MUs in 0-3, 3-10, and >10% bins of RT. Thus, the contribution of visuomotor correction to the variability of motor unit discharge and force is greater for elderly adults. The presence of visual feedback appears to be necessary to find greater discharge variability in motor units from the knee extensors of elderly adults.

An efficient interpolation filter VLSI architecture for HEVC standard

NASA Astrophysics Data System (ADS)

Zhou, Wei; Zhou, Xin; Lian, Xiaocong; Liu, Zhenyu; Liu, Xiaoxiang

2015-12-01

The next-generation video coding standard of High-Efficiency Video Coding (HEVC) is especially efficient for coding high-resolution video such as 8K-ultra-high-definition (UHD) video. Fractional motion estimation in HEVC presents a significant challenge in clock latency and area cost as it consumes more than 40 % of the total encoding time and thus results in high computational complexity. With aims at supporting 8K-UHD video applications, an efficient interpolation filter VLSI architecture for HEVC is proposed in this paper. Firstly, a new interpolation filter algorithm based on the 8-pixel interpolation unit is proposed in this paper. It can save 19.7 % processing time on average with acceptable coding quality degradation. Based on the proposed algorithm, an efficient interpolation filter VLSI architecture, composed of a reused data path of interpolation, an efficient memory organization, and a reconfigurable pipeline interpolation filter engine, is presented to reduce the implement hardware area and achieve high throughput. The final VLSI implementation only requires 37.2k gates in a standard 90-nm CMOS technology at an operating frequency of 240 MHz. The proposed architecture can be reused for either half-pixel interpolation or quarter-pixel interpolation, which can reduce the area cost for about 131,040 bits RAM. The processing latency of our proposed VLSI architecture can support the real-time processing of 4:2:0 format 7680 × 4320@78fps video sequences.

On scalable lossless video coding based on sub-pixel accurate MCTF

NASA Astrophysics Data System (ADS)

Yea, Sehoon; Pearlman, William A.

2006-01-01

We propose two approaches to scalable lossless coding of motion video. They achieve SNR-scalable bitstream up to lossless reconstruction based upon the subpixel-accurate MCTF-based wavelet video coding. The first approach is based upon a two-stage encoding strategy where a lossy reconstruction layer is augmented by a following residual layer in order to obtain (nearly) lossless reconstruction. The key advantages of our approach include an 'on-the-fly' determination of bit budget distribution between the lossy and the residual layers, freedom to use almost any progressive lossy video coding scheme as the first layer and an added feature of near-lossless compression. The second approach capitalizes on the fact that we can maintain the invertibility of MCTF with an arbitrary sub-pixel accuracy even in the presence of an extra truncation step for lossless reconstruction thanks to the lifting implementation. Experimental results show that the proposed schemes achieve compression ratios not obtainable by intra-frame coders such as Motion JPEG-2000 thanks to their inter-frame coding nature. Also they are shown to outperform the state-of-the-art non-scalable inter-frame coder H.264 (JM) lossless mode, with the added benefit of bitstream embeddedness.

Empirical evaluation of H.265/HEVC-based dynamic adaptive video streaming over HTTP (HEVC-DASH)

NASA Astrophysics Data System (ADS)

Irondi, Iheanyi; Wang, Qi; Grecos, Christos

2014-05-01

Real-time HTTP streaming has gained global popularity for delivering video content over Internet. In particular, the recent MPEG-DASH (Dynamic Adaptive Streaming over HTTP) standard enables on-demand, live, and adaptive Internet streaming in response to network bandwidth fluctuations. Meanwhile, emerging is the new-generation video coding standard, H.265/HEVC (High Efficiency Video Coding) promises to reduce the bandwidth requirement by 50% at the same video quality when compared with the current H.264/AVC standard. However, little existing work has addressed the integration of the DASH and HEVC standards, let alone empirical performance evaluation of such systems. This paper presents an experimental HEVC-DASH system, which is a pull-based adaptive streaming solution that delivers HEVC-coded video content through conventional HTTP servers where the client switches to its desired quality, resolution or bitrate based on the available network bandwidth. Previous studies in DASH have focused on H.264/AVC, whereas we present an empirical evaluation of the HEVC-DASH system by implementing a real-world test bed, which consists of an Apache HTTP Server with GPAC, an MP4Client (GPAC) with open HEVC-based DASH client and a NETEM box in the middle emulating different network conditions. We investigate and analyze the performance of HEVC-DASH by exploring the impact of various network conditions such as packet loss, bandwidth and delay on video quality. Furthermore, we compare the Intra and Random Access profiles of HEVC coding with the Intra profile of H.264/AVC when the correspondingly encoded video is streamed with DASH. Finally, we explore the correlation among the quality metrics and network conditions, and empirically establish under which conditions the different codecs can provide satisfactory performance.

Child–adult differences in the kinetics of torque development

PubMed Central

DOTAN, RAFFY; MITCHELL, CAMERON; COHEN, ROTEM; GABRIEL, DAVID; KLENTROU, PANAGIOTA; FALK, BAREKET

2013-01-01

Children have lower size-normalised maximal voluntary force, speed, and power than adults. It has been hypothesised that these and other age-related performance differences are due to lesser type-II motor-unit utilisation in children. This should be manifested as slower force kinetics in explosive muscle contractions. The purpose of this study was to investigate the nature of child–adult force-kinetics differences and whether the latter could support that hypothesis. Untrained boys (n = 20) and men (n = 20) (10.1 ± 1.3 and 22.9 ± 4.4 years, respectively), performed maximal, explosive, isometric elbow flexions and knee extensions on a Biodex dynamometer. Peak torque (MVC), times to 10–100% MVC, and other kinetics parameters were determined. The boys’ body-mass-normalised knee extension MVC, peak rate of torque development, and %MVC at 100 ms were 26, 17 and 23% lower compared with the men and their times to 30% and 80% MVC were 24 and 48% longer, respectively. Elbow flexion kinetics showed similar or greater differences. The findings illuminate boys’ inherent disadvantage in tasks requiring speed or explosive force. It is demonstrated that the extent of the boys–men kinetics disparity cannot be explained by muscle-composition and/or musculo-tendinous-stiffness differences. We suggest therefore that the findings indirectly support children’s lower utilisation of type-II motor units. PMID:23320937

Associations between motor vehicle crashes and mental health problems: data from the National Survey of Adolescents-Replication.

PubMed

Williams, Joah L; Rheingold, Alyssa A; Knowlton, Alice W; Saunders, Benjamin E; Kilpatrick, Dean G

2015-02-01

Motor vehicle crashes (MVCs) are a leading cause of physical injuries and mortality among children and adolescents in the United States. The purpose of this study was to examine associations between having an MVC and mental health outcomes, including posttraumatic stress disorder (PTSD), depression, and drug and alcohol misuse in a nationally representative sample of adolescents. A sample of 3,604 adolescents, aged 12-17 years, was assessed as part of the 2005 National Survey of Adolescents-Replication (NSA-R) study. Data were weighted according to the 2005 U.S. Census estimates. Within this sample, 10.2% of adolescents reported having at least 1 serious MVC. The prevalence of current PTSD and depression among adolescents having an MVC was 7.4% and 11.2%, respectively. Analyses revealed that an MVC among adolescents aged 15 years and younger was independently associated with depression (OR = 2.17) and alcohol abuse (OR = 2.36) after adjusting for other risk factors, including a history of interpersonal violence. Among adolescents aged 16 years and older, an MVC was associated only with alcohol abuse (OR = 2.08). This study was the first attempt to explore adverse mental health outcomes associated with MVCs beyond traumatic stress symptoms among adolescents in a nationally representative sample. Copyright © 2015 International Society for Traumatic Stress Studies.

Comparison between electrically evoked and voluntary isometric contractions for biceps brachii muscle oxidative metabolism using near-infrared spectroscopy.

PubMed

Muthalib, Makii; Jubeau, Marc; Millet, Guillaume Y; Maffiuletti, Nicola A; Nosaka, Kazunori

2009-09-01

This study compared voluntary (VOL) and electrically evoked isometric contractions by muscle stimulation (EMS) for changes in biceps brachii muscle oxygenation (tissue oxygenation index, DeltaTOI) and total haemoglobin concentration (DeltatHb = oxygenated haemoglobin + deoxygenated haemoglobin) determined by near-infrared spectroscopy. Twelve men performed EMS with one arm followed 24 h later by VOL with the contralateral arm, consisting of 30 repeated (1-s contraction, 1-s relaxation) isometric contractions at 30% of maximal voluntary contraction (MVC) for the first 60 s, and maximal intensity contractions thereafter (MVC for VOL and maximal tolerable current at 30 Hz for EMS) until MVC decreased approximately 30% of pre-exercise MVC. During the 30 contractions at 30% MVC, DeltaTOI decrease was significantly (P < 0.05) greater and DeltatHb was significantly (P < 0.05) lower for EMS than VOL, suggesting that the metabolic demand for oxygen in EMS is greater than VOL at the same torque level. However, during maximal intensity contractions, although EMS torque (approximately 40% of VOL) was significantly (P < 0.05) lower than VOL, DeltaTOI was similar and tHb was significantly (P < 0.05) lower for EMS than VOL towards the end, without significant differences between the two sessions in the recovery period. It is concluded that the oxygen demand of the activated biceps brachii muscle in EMS is comparable to VOL at maximal intensity.

Verification testing of the compression performance of the HEVC screen content coding extensions

NASA Astrophysics Data System (ADS)

Sullivan, Gary J.; Baroncini, Vittorio A.; Yu, Haoping; Joshi, Rajan L.; Liu, Shan; Xiu, Xiaoyu; Xu, Jizheng

2017-09-01

This paper reports on verification testing of the coding performance of the screen content coding (SCC) extensions of the High Efficiency Video Coding (HEVC) standard (Rec. ITU-T H.265 | ISO/IEC 23008-2 MPEG-H Part 2). The coding performance of HEVC screen content model (SCM) reference software is compared with that of the HEVC test model (HM) without the SCC extensions, as well as with the Advanced Video Coding (AVC) joint model (JM) reference software, for both lossy and mathematically lossless compression using All-Intra (AI), Random Access (RA), and Lowdelay B (LB) encoding structures and using similar encoding techniques. Video test sequences in 1920×1080 RGB 4:4:4, YCbCr 4:4:4, and YCbCr 4:2:0 colour sampling formats with 8 bits per sample are tested in two categories: "text and graphics with motion" (TGM) and "mixed" content. For lossless coding, the encodings are evaluated in terms of relative bit-rate savings. For lossy compression, subjective testing was conducted at 4 quality levels for each coding case, and the test results are presented through mean opinion score (MOS) curves. The relative coding performance is also evaluated in terms of Bjøntegaard-delta (BD) bit-rate savings for equal PSNR quality. The perceptual tests and objective metric measurements show a very substantial benefit in coding efficiency for the SCC extensions, and provided consistent results with a high degree of confidence. For TGM video, the estimated bit-rate savings ranged from 60-90% relative to the JM and 40-80% relative to the HM, depending on the AI/RA/LB configuration category and colour sampling format.

Novel Integration of Frame Rate Up Conversion and HEVC Coding Based on Rate-Distortion Optimization.

PubMed

Guo Lu; Xiaoyun Zhang; Li Chen; Zhiyong Gao

2018-02-01

Frame rate up conversion (FRUC) can improve the visual quality by interpolating new intermediate frames. However, high frame rate videos by FRUC are confronted with more bitrate consumption or annoying artifacts of interpolated frames. In this paper, a novel integration framework of FRUC and high efficiency video coding (HEVC) is proposed based on rate-distortion optimization, and the interpolated frames can be reconstructed at encoder side with low bitrate cost and high visual quality. First, joint motion estimation (JME) algorithm is proposed to obtain robust motion vectors, which are shared between FRUC and video coding. What's more, JME is embedded into the coding loop and employs the original motion search strategy in HEVC coding. Then, the frame interpolation is formulated as a rate-distortion optimization problem, where both the coding bitrate consumption and visual quality are taken into account. Due to the absence of original frames, the distortion model for interpolated frames is established according to the motion vector reliability and coding quantization error. Experimental results demonstrate that the proposed framework can achieve 21% ~ 42% reduction in BDBR, when compared with the traditional methods of FRUC cascaded with coding.

Telesign: a videophone system for sign language distant communication

NASA Astrophysics Data System (ADS)

Mozelle, Gerard; Preteux, Francoise J.; Viallet, Jean-Emmanuel

1998-09-01

This paper presents a low bit rate videophone system for deaf people communicating by means of sign language. Classic video conferencing systems have focused on head and shoulders sequences which are not well-suited for sign language video transmission since hearing impaired people also use their hands and arms to communicate. To address the above-mentioned functionality, we have developed a two-step content-based video coding system based on: (1) A segmentation step. Four or five video objects (VO) are extracted using a cooperative approach between color-based and morphological segmentation. (2) VO coding are achieved by using a standardized MPEG-4 video toolbox. Results of encoded sign language video sequences, presented for three target bit rates (32 kbits/s, 48 kbits/s and 64 kbits/s), demonstrate the efficiency of the approach presented in this paper.

A brief tailored family-centered seat belt intervention for hospitalized trauma patients.

DOT National Transportation Integrated Search

2010-11-01

"Among children 5-19 years, the commonest cause of unintentional injury-related death is : being an occupant/driver in a motor vehicle crash (MVC). In 2006 in the United States, there : were 568,188 injuries among children (0-18) due to MVC. Of these...

Intra prediction using face continuity in 360-degree video coding

NASA Astrophysics Data System (ADS)

Hanhart, Philippe; He, Yuwen; Ye, Yan

2017-09-01

This paper presents a new reference sample derivation method for intra prediction in 360-degree video coding. Unlike the conventional reference sample derivation method for 2D video coding, which uses the samples located directly above and on the left of the current block, the proposed method considers the spherical nature of 360-degree video when deriving reference samples located outside the current face to which the block belongs, and derives reference samples that are geometric neighbors on the sphere. The proposed reference sample derivation method was implemented in the Joint Exploration Model 3.0 (JEM-3.0) for the cubemap projection format. Simulation results for the all intra configuration show that, when compared with the conventional reference sample derivation method, the proposed method gives, on average, luma BD-rate reduction of 0.3% in terms of the weighted spherical PSNR (WS-PSNR) and spherical PSNR (SPSNR) metrics.

Modeling of video traffic in packet networks, low rate video compression, and the development of a lossy+lossless image compression algorithm

NASA Technical Reports Server (NTRS)

Sayood, K.; Chen, Y. C.; Wang, X.

1992-01-01

During this reporting period we have worked on three somewhat different problems. These are modeling of video traffic in packet networks, low rate video compression, and the development of a lossy + lossless image compression algorithm, which might have some application in browsing algorithms. The lossy + lossless scheme is an extension of work previously done under this grant. It provides a simple technique for incorporating browsing capability. The low rate coding scheme is also a simple variation on the standard discrete cosine transform (DCT) coding approach. In spite of its simplicity, the approach provides surprisingly high quality reconstructions. The modeling approach is borrowed from the speech recognition literature, and seems to be promising in that it provides a simple way of obtaining an idea about the second order behavior of a particular coding scheme. Details about these are presented.

A study on multiresolution lossless video coding using inter/intra frame adaptive prediction

NASA Astrophysics Data System (ADS)

Nakachi, Takayuki; Sawabe, Tomoko; Fujii, Tetsuro

2003-06-01

Lossless video coding is required in the fields of archiving and editing digital cinema or digital broadcasting contents. This paper combines a discrete wavelet transform and adaptive inter/intra-frame prediction in the wavelet transform domain to create multiresolution lossless video coding. The multiresolution structure offered by the wavelet transform facilitates interchange among several video source formats such as Super High Definition (SHD) images, HDTV, SDTV, and mobile applications. Adaptive inter/intra-frame prediction is an extension of JPEG-LS, a state-of-the-art lossless still image compression standard. Based on the image statistics of the wavelet transform domains in successive frames, inter/intra frame adaptive prediction is applied to the appropriate wavelet transform domain. This adaptation offers superior compression performance. This is achieved with low computational cost and no increase in additional information. Experiments on digital cinema test sequences confirm the effectiveness of the proposed algorithm.

Evaluation of in-network adaptation of scalable high efficiency video coding (SHVC) in mobile environments

NASA Astrophysics Data System (ADS)

Nightingale, James; Wang, Qi; Grecos, Christos; Goma, Sergio

2014-02-01

High Efficiency Video Coding (HEVC), the latest video compression standard (also known as H.265), can deliver video streams of comparable quality to the current H.264 Advanced Video Coding (H.264/AVC) standard with a 50% reduction in bandwidth. Research into SHVC, the scalable extension to the HEVC standard, is still in its infancy. One important area for investigation is whether, given the greater compression ratio of HEVC (and SHVC), the loss of packets containing video content will have a greater impact on the quality of delivered video than is the case with H.264/AVC or its scalable extension H.264/SVC. In this work we empirically evaluate the layer-based, in-network adaptation of video streams encoded using SHVC in situations where dynamically changing bandwidths and datagram loss ratios require the real-time adaptation of video streams. Through the use of extensive experimentation, we establish a comprehensive set of benchmarks for SHVC-based highdefinition video streaming in loss prone network environments such as those commonly found in mobile networks. Among other results, we highlight that packet losses of only 1% can lead to a substantial reduction in PSNR of over 3dB and error propagation in over 130 pictures following the one in which the loss occurred. This work would be one of the earliest studies in this cutting-edge area that reports benchmark evaluation results for the effects of datagram loss on SHVC picture quality and offers empirical and analytical insights into SHVC adaptation to lossy, mobile networking conditions.

Deep linear autoencoder and patch clustering-based unified one-dimensional coding of image and video

NASA Astrophysics Data System (ADS)

Li, Honggui

2017-09-01

This paper proposes a unified one-dimensional (1-D) coding framework of image and video, which depends on deep learning neural network and image patch clustering. First, an improved K-means clustering algorithm for image patches is employed to obtain the compact inputs of deep artificial neural network. Second, for the purpose of best reconstructing original image patches, deep linear autoencoder (DLA), a linear version of the classical deep nonlinear autoencoder, is introduced to achieve the 1-D representation of image blocks. Under the circumstances of 1-D representation, DLA is capable of attaining zero reconstruction error, which is impossible for the classical nonlinear dimensionality reduction methods. Third, a unified 1-D coding infrastructure for image, intraframe, interframe, multiview video, three-dimensional (3-D) video, and multiview 3-D video is built by incorporating different categories of videos into the inputs of patch clustering algorithm. Finally, it is shown in the results of simulation experiments that the proposed methods can simultaneously gain higher compression ratio and peak signal-to-noise ratio than those of the state-of-the-art methods in the situation of low bitrate transmission.

Spherical rotation orientation indication for HEVC and JEM coding of 360 degree video

NASA Astrophysics Data System (ADS)

Boyce, Jill; Xu, Qian

2017-09-01

Omnidirectional (or "360 degree") video, representing a panoramic view of a spherical 360° ×180° scene, can be encoded using conventional video compression standards, once it has been projection mapped to a 2D rectangular format. Equirectangular projection format is currently used for mapping 360 degree video to a rectangular representation for coding using HEVC/JEM. However, video in the top and bottom regions of the image, corresponding to the "north pole" and "south pole" of the spherical representation, is significantly warped. We propose to perform spherical rotation of the input video prior to HEVC/JEM encoding in order to improve the coding efficiency, and to signal parameters in a supplemental enhancement information (SEI) message that describe the inverse rotation process recommended to be applied following HEVC/JEM decoding, prior to display. Experiment results show that up to 17.8% bitrate gain (using the WS-PSNR end-to-end metric) can be achieved for the Chairlift sequence using HM16.15 and 11.9% gain using JEM6.0, and an average gain of 2.9% for HM16.15 and 2.2% for JEM6.0.

Programming Video Games and Simulations in Science Education: Exploring Computational Thinking through Code Analysis

ERIC Educational Resources Information Center

Garneli, Varvara; Chorianopoulos, Konstantinos

2018-01-01

Various aspects of computational thinking (CT) could be supported by educational contexts such as simulations and video-games construction. In this field study, potential differences in student motivation and learning were empirically examined through students' code. For this purpose, we performed a teaching intervention that took place over five…

Collision count in rugby union: A comparison of micro-technology and video analysis methods.

PubMed

Reardon, Cillian; Tobin, Daniel P; Tierney, Peter; Delahunt, Eamonn

2017-10-01

The aim of our study was to determine if there is a role for manipulation of g force thresholds acquired via micro-technology for accurately detecting collisions in rugby union. In total, 36 players were recruited from an elite Guinness Pro12 rugby union team. Player movement profiles and collisions were acquired via individual global positioning system (GPS) micro-technology units. Players were assigned to a sub-category of positions in order to determine positional collision demands. The coding of collisions by micro-technology at g force thresholds between 2 and 5.5 g (0.5 g increments) was compared with collision coding by an expert video analyst using Bland-Altman assessments. The most appropriate g force threshold (smallest mean difference compared with video analyst coding) was lower for all forwards positions (2.5 g) than for all backs positions (3.5 g). The Bland-Altman 95% limits of agreement indicated that there may be a substantial over- or underestimation of collisions coded via GPS micro-technology when using expert video analyst coding as the reference comparator. The manipulation of the g force thresholds applied to data acquired by GPS micro-technology units based on incremental thresholds of 0.5 g does not provide a reliable tool for the accurate coding of collisions in rugby union. Future research should aim to investigate smaller g force threshold increments and determine the events that cause coding of false positives.

Reflectance Prediction Modelling for Residual-Based Hyperspectral Image Coding

PubMed Central

Xiao, Rui; Gao, Junbin; Bossomaier, Terry

2016-01-01

A Hyperspectral (HS) image provides observational powers beyond human vision capability but represents more than 100 times the data compared to a traditional image. To transmit and store the huge volume of an HS image, we argue that a fundamental shift is required from the existing “original pixel intensity”-based coding approaches using traditional image coders (e.g., JPEG2000) to the “residual”-based approaches using a video coder for better compression performance. A modified video coder is required to exploit spatial-spectral redundancy using pixel-level reflectance modelling due to the different characteristics of HS images in their spectral and shape domain of panchromatic imagery compared to traditional videos. In this paper a novel coding framework using Reflectance Prediction Modelling (RPM) in the latest video coding standard High Efficiency Video Coding (HEVC) for HS images is proposed. An HS image presents a wealth of data where every pixel is considered a vector for different spectral bands. By quantitative comparison and analysis of pixel vector distribution along spectral bands, we conclude that modelling can predict the distribution and correlation of the pixel vectors for different bands. To exploit distribution of the known pixel vector, we estimate a predicted current spectral band from the previous bands using Gaussian mixture-based modelling. The predicted band is used as the additional reference band together with the immediate previous band when we apply the HEVC. Every spectral band of an HS image is treated like it is an individual frame of a video. In this paper, we compare the proposed method with mainstream encoders. The experimental results are fully justified by three types of HS dataset with different wavelength ranges. The proposed method outperforms the existing mainstream HS encoders in terms of rate-distortion performance of HS image compression. PMID:27695102

A Robust Model-Based Coding Technique for Ultrasound Video

NASA Technical Reports Server (NTRS)

Docef, Alen; Smith, Mark J. T.

1995-01-01

This paper introduces a new approach to coding ultrasound video, the intended application being very low bit rate coding for transmission over low cost phone lines. The method exploits both the characteristic noise and the quasi-periodic nature of the signal. Data compression ratios between 250:1 and 1000:1 are shown to be possible, which is sufficient for transmission over ISDN and conventional phone lines. Preliminary results show this approach to be promising for remote ultrasound examinations.

Use of FEC coding to improve statistical multiplexing performance for video transport over ATM networks

NASA Astrophysics Data System (ADS)

Kurceren, Ragip; Modestino, James W.

1998-12-01

The use of forward error-control (FEC) coding, possibly in conjunction with ARQ techniques, has emerged as a promising approach for video transport over ATM networks for cell-loss recovery and/or bit error correction, such as might be required for wireless links. Although FEC provides cell-loss recovery capabilities it also introduces transmission overhead which can possibly cause additional cell losses. A methodology is described to maximize the number of video sources multiplexed at a given quality of service (QoS), measured in terms of decoded cell loss probability, using interlaced FEC codes. The transport channel is modelled as a block interference channel (BIC) and the multiplexer as single server, deterministic service, finite buffer supporting N users. Based upon an information-theoretic characterization of the BIC and large deviation bounds on the buffer overflow probability, the described methodology provides theoretically achievable upper limits on the number of sources multiplexed. Performance of specific coding techniques using interlaced nonbinary Reed-Solomon (RS) codes and binary rate-compatible punctured convolutional (RCPC) codes is illustrated.

Facilitation and Teacher Behaviors: An Analysis of Literacy Teachers' Video-Case Discussions

ERIC Educational Resources Information Center

Arya, Poonam; Christ, Tanya; Chiu, Ming Ming

2014-01-01

This study explored how peer and professor facilitations are related to teachers' behaviors during video-case discussions. Fourteen inservice teachers produced 1,787 turns of conversation during 12 video-case discussions that were video-recorded, transcribed, coded, and analyzed with statistical discourse analysis. Professor facilitations (sharing…

Dynamic full-scalability conversion in scalable video coding

NASA Astrophysics Data System (ADS)

Lee, Dong Su; Bae, Tae Meon; Thang, Truong Cong; Ro, Yong Man

2007-02-01

For outstanding coding efficiency with scalability functions, SVC (Scalable Video Coding) is being standardized. SVC can support spatial, temporal and SNR scalability and these scalabilities are useful to provide a smooth video streaming service even in a time varying network such as a mobile environment. But current SVC is insufficient to support dynamic video conversion with scalability, thereby the adaptation of bitrate to meet a fluctuating network condition is limited. In this paper, we propose dynamic full-scalability conversion methods for QoS adaptive video streaming in SVC. To accomplish full scalability dynamic conversion, we develop corresponding bitstream extraction, encoding and decoding schemes. At the encoder, we insert the IDR NAL periodically to solve the problems of spatial scalability conversion. At the extractor, we analyze the SVC bitstream to get the information which enable dynamic extraction. Real time extraction is achieved by using this information. Finally, we develop the decoder so that it can manage the changing scalability. Experimental results showed that dynamic full-scalability conversion was verified and it was necessary for time varying network condition.

RD Optimized, Adaptive, Error-Resilient Transmission of MJPEG2000-Coded Video over Multiple Time-Varying Channels

NASA Astrophysics Data System (ADS)

Bezan, Scott; Shirani, Shahram

2006-12-01

To reliably transmit video over error-prone channels, the data should be both source and channel coded. When multiple channels are available for transmission, the problem extends to that of partitioning the data across these channels. The condition of transmission channels, however, varies with time. Therefore, the error protection added to the data at one instant of time may not be optimal at the next. In this paper, we propose a method for adaptively adding error correction code in a rate-distortion (RD) optimized manner using rate-compatible punctured convolutional codes to an MJPEG2000 constant rate-coded frame of video. We perform an analysis on the rate-distortion tradeoff of each of the coding units (tiles and packets) in each frame and adapt the error correction code assigned to the unit taking into account the bandwidth and error characteristics of the channels. This method is applied to both single and multiple time-varying channel environments. We compare our method with a basic protection method in which data is either not transmitted, transmitted with no protection, or transmitted with a fixed amount of protection. Simulation results show promising performance for our proposed method.

Moderate alcohol intake and motor vehicle crashes: the conflict between health advantage and at-risk use.

PubMed

Heng, Kenneth; Hargarten, Stephen; Layde, Peter; Craven, Andy; Zhu, Shankuan

2006-01-01

To review the evidence on moderate alcohol intake and motor vehicle crash (MVC) risk, and discuss the possible public health tension in balancing risk reduction and increment with respect to moderate alcohol intake. A Medline review was conducted on moderate alcohol intake, MVC, and cardiovascular disease (CVD) risks. Moderate alcohol intake (24 g ethanol, two US standard drinks, or less a day) is associated with 20% reduction in risk of CVD. Public awareness of this may contribute to why rates of driving with blood alcohol content (BAC) <0.08 g/dl in the United States are static. Studies show 3- to 17-fold increased risk of a fatal MVC with BAC < 0.08 g/dl compared to sober drivers. The United States has 0.08 g/dl BAC laws, higher than that reached by a driver drinking two drinks per day or less. The public should be educated that although moderate alcohol drinking may not violate BAC laws, it still carries significant risk of MVC. Current BAC laws in some countries needs re-evaluation.

Maximal force and tremor changes across the menstrual cycle.

PubMed

Tenan, Matthew S; Hackney, Anthony C; Griffin, Lisa

2016-01-01

Sex hormones have profound effects on the nervous system in vitro and in vivo. The present study examines the effect of the menstrual cycle on maximal isometric force (MVC) and tremor during an endurance task. Nine eumenorrheic females participated in five study visits across their menstrual cycle. In each menstrual phase, an MVC and an endurance task to failure were performed. Tremor across the endurance task was quantified as the coefficient of variation in force and was assessed in absolute time and relative percent time to task failure. MVC decreases 23% from ovulation to the mid luteal phase of the menstrual cycle. In absolute time, the mid luteal phase has the highest initial tremor, though the early follicular phase has substantially higher tremor than other phases after 150 s of task performance. In relative time, the mid luteal phase has the highest level of tremor throughout the endurance task. Both MVC and tremor during an endurance task are modified by the menstrual cycle. Performance of tasks and sports which require high force and steadiness to exhaustion may be decreased in the mid luteal phase compared to other menstrual phases.

A complexity-scalable software-based MPEG-2 video encoder.

PubMed

Chen, Guo-bin; Lu, Xin-ning; Wang, Xing-guo; Liu, Ji-lin

2004-05-01

With the development of general-purpose processors (GPP) and video signal processing algorithms, it is possible to implement a software-based real-time video encoder on GPP, and its low cost and easy upgrade attract developers' interests to transfer video encoding from specialized hardware to more flexible software. In this paper, the encoding structure is set up first to support complexity scalability; then a lot of high performance algorithms are used on the key time-consuming modules in coding process; finally, at programming level, processor characteristics are considered to improve data access efficiency and processing parallelism. Other programming methods such as lookup table are adopted to reduce the computational complexity. Simulation results showed that these ideas could not only improve the global performance of video coding, but also provide great flexibility in complexity regulation.

Evaluating the effectiveness of SW-only video coding for real-time video transmission over low-rate wireless networks

NASA Astrophysics Data System (ADS)

Bartolini, Franco; Pasquini, Cristina; Piva, Alessandro

2001-04-01

The recent development of video compression algorithms allowed the diffusion of systems for the transmission of video sequences over data networks. However, the transmission over error prone mobile communication channels is yet an open issue. In this paper, a system developed for the real time transmission of H263 video coded sequences over TETRA mobile networks is presented. TETRA is an open digital trunked radio standard defined by the European Telecommunications Standardization Institute developed for professional mobile radio users, providing full integration of voice and data services. Experimental tests demonstrate that, in spite of the low frame rate allowed by the SW only implementation of the decoder and by the low channel rate a video compression technique such as that complying with the H263 standard, is still preferable to a simpler but less effective frame based compression system.

Video streaming with SHVC to HEVC transcoding

NASA Astrophysics Data System (ADS)

Gudumasu, Srinivas; He, Yuwen; Ye, Yan; Xiu, Xiaoyu

2015-09-01

This paper proposes an efficient Scalable High efficiency Video Coding (SHVC) to High Efficiency Video Coding (HEVC) transcoder, which can reduce the transcoding complexity significantly, and provide a desired trade-off between the transcoding complexity and the transcoded video quality. To reduce the transcoding complexity, some of coding information, such as coding unit (CU) depth, prediction mode, merge mode, motion vector information, intra direction information and transform unit (TU) depth information, in the SHVC bitstream are mapped and transcoded to single layer HEVC bitstream. One major difficulty in transcoding arises when trying to reuse the motion information from SHVC bitstream since motion vectors referring to inter-layer reference (ILR) pictures cannot be reused directly in transcoding. Reusing motion information obtained from ILR pictures for those prediction units (PUs) will reduce the complexity of the SHVC transcoder greatly but a significant reduction in the quality of the picture is observed. Pictures corresponding to the intra refresh pictures in the base layer (BL) will be coded as P pictures in enhancement layer (EL) in the SHVC bitstream; and directly reusing the intra information from the BL for transcoding will not get a good coding efficiency. To solve these problems, various transcoding technologies are proposed. The proposed technologies offer different trade-offs between transcoding speed and transcoding quality. They are implemented on the basis of reference software SHM-6.0 and HM-14.0 for the two layer spatial scalability configuration. Simulations show that the proposed SHVC software transcoder reduces the transcoding complexity by up to 98-99% using low complexity transcoding mode when compared with cascaded re-encoding method. The transcoder performance at various bitrates with different transcoding modes are compared in terms of transcoding speed and transcoded video quality.

HEVC for high dynamic range services

NASA Astrophysics Data System (ADS)

Kim, Seung-Hwan; Zhao, Jie; Misra, Kiran; Segall, Andrew

2015-09-01

Displays capable of showing a greater range of luminance values can render content containing high dynamic range information in a way such that the viewers have a more immersive experience. This paper introduces the design aspects of a high dynamic range (HDR) system, and examines the performance of the HDR processing chain in terms of compression efficiency. Specifically it examines the relation between recently introduced Society of Motion Picture and Television Engineers (SMPTE) ST 2084 transfer function and the High Efficiency Video Coding (HEVC) standard. SMPTE ST 2084 is designed to cover the full range of an HDR signal from 0 to 10,000 nits, however in many situations the valid signal range of actual video might be smaller than SMPTE ST 2084 supported range. The above restricted signal range results in restricted range of code values for input video data and adversely impacts compression efficiency. In this paper, we propose a code value remapping method that extends the restricted range code values into the full range code values so that the existing standards such as HEVC may better compress the video content. The paper also identifies related non-normative encoder-only changes that are required for remapping method for a fair comparison with anchor. Results are presented comparing the efficiency of the current approach versus the proposed remapping method for HM-16.2.

Improve load balancing and coding efficiency of tiles in high efficiency video coding by adaptive tile boundary

NASA Astrophysics Data System (ADS)

Chan, Chia-Hsin; Tu, Chun-Chuan; Tsai, Wen-Jiin

2017-01-01

High efficiency video coding (HEVC) not only improves the coding efficiency drastically compared to the well-known H.264/AVC but also introduces coding tools for parallel processing, one of which is tiles. Tile partitioning is allowed to be arbitrary in HEVC, but how to decide tile boundaries remains an open issue. An adaptive tile boundary (ATB) method is proposed to select a better tile partitioning to improve load balancing (ATB-LoadB) and coding efficiency (ATB-Gain) with a unified scheme. Experimental results show that, compared to ordinary uniform-space partitioning, the proposed ATB can save up to 17.65% of encoding times in parallel encoding scenarios and can reduce up to 0.8% of total bit rates for coding efficiency.

Exploration of depth modeling mode one lossless wedgelets storage strategies for 3D-high efficiency video coding

NASA Astrophysics Data System (ADS)

Sanchez, Gustavo; Marcon, César; Agostini, Luciano Volcan

2018-01-01

The 3D-high efficiency video coding has introduced tools to obtain higher efficiency in 3-D video coding, and most of them are related to the depth maps coding. Among these tools, the depth modeling mode-1 (DMM-1) focuses on better encoding edges regions of depth maps. The large memory required for storing all wedgelet patterns is one of the bottlenecks in the DMM-1 hardware design of both encoder and decoder since many patterns must be stored. Three algorithms to reduce the DMM-1 memory requirements and a hardware design targeting the most efficient among these algorithms are presented. Experimental results demonstrate that the proposed solutions surpass related works reducing up to 78.8% of the wedgelet memory, without degrading the encoding efficiency. Synthesis results demonstrate that the proposed algorithm reduces almost 75% of the power dissipation when compared to the standard approach.

Symmetry of proprioceptive sense in female soccer players.

PubMed

Iwańska, Dagmara; Karczewska, Magdalena; Madej, Anna; Urbanik, Czesław

2015-01-01

The purpose of the study was to assess the symmetry of proprioceptive sense among female soccer players when trying to reproduce isometric knee extensions (right and left) and to analyze the impact of a given level of muscle force on proprioception. The study involved 12 soccer players aged 19.5 ± 2.65 years. Soccer players performed a control measurement of a maximum 3s (knee at the 90°) position in the joint. Subsequently, 70%, 50%, and 30% of the maximum voluntary contraction (MVC) were all calculated and then reproduced by each subject with feedback. Next, the players reproduced the predefined muscle contraction values in three sequences: A - 50%, 70%, 30%; B - 50%, 30%, 70%; C - 70%, 30%, 50% of MVC without visual control. In every sequence, the participants found obtaining the value of 30% of MVC the most difficult. The value they reproduced most accurately was 70% of MVC. Both trial II and trial III demonstrated that the symmetry index SI significantly differed from values considered acceptable (SIRa). In each successive sequence the largest asymmetry occurred while reproducing the lowest values of MVC (30%) (p < 0.05). High level of prioprioceptive sense is important to soccer players due to the extensive overload associated with dynamics stops or changes in direction while running. Special attention should be paid to develop skills in sensing force of varying levels. It was much harder to reproduce the predefined values if there was no feedback.

Explosive sport training and torque kinetics in children.

PubMed

Dotan, Raffy; Mitchell, Cameron J; Cohen, Rotem; Gabriel, David; Klentrou, Panagiota; Falk, Bareket

2013-07-01

A high rate of force development (RFD) is often more important than maximal force in daily and sports activities. In children, resistance training has been shown to increase maximal force. It is unclear whether, or to what extent, can children improve RFD and force kinetics. For this study, we compared strength and force kinetics of boy gymnasts with those of untrained boys and untrained men. Eight boy gymnasts (age, 9.5 ± 1.2 y), 20 untrained boys (age, 10.1 ± 1.3 y), and 20 untrained men (age, 22.9 ± 4.4 y) performed maximal, explosive, isometric elbow flexions (EF) and knee flexions (KF). Peak torque (maximal voluntary contraction (MVC)), elapsed times to 10%-100% MVC, peak rate of torque development (RTDpk), and other kinetics parameters were determined. When gymnasts were compared with untrained boys, size-normalized EF MVC was 11%-20% higher, RTDpk was 32% higher, and times to 30% and 80% MVC were 16% and 55% shorter, respectively (p < 0.05). No corresponding differences were observed in KF. Furthermore, although the normalized EF MVC was 28% lower in gymnasts than in men (p < 0.001), their torque kinetics parameters were similar. These findings highlight the specificity of gymnastics training, which markedly elevated the torque kinetics of young, prepubertal boys to adult levels, but only moderately affected peak torque. It is suggested that neurologic adaptations, such as enhanced firing and activation rates or increased type II motor-unit recruitment, as well as changes in musculotendinous stiffness, could explain these findings.

Effect of salbutamol on neuromuscular function in endurance athletes.

PubMed

Decorte, Nicolas; Bachasson, Damien; Guinot, Michel; Flore, Patrice; Levy, Patrick; Verges, Samuel; Wuyam, Bernard

2013-10-01

The potential ergogenic effects of therapeutic inhaled salbutamol doses in endurance athletes have been controversially discussed for decades. We hypothesized that salbutamol inhalation may increase peripheral muscle contractility, reduce fatigability, and improve force recovery after a localized exercise in endurance athletes. Eleven healthy, nonasthmatic male athletes with high aerobic capacities were recruited to be compared in a double-blinded, randomized crossover study of two dose levels of salbutamol (200 and 800 μg) and a placebo administered by inhalation before a quadriceps fatigue test. Subjects performed an incremental exercise protocol consisting in sets of 10 intermittent isometric contractions starting at 20% of maximum voluntary contraction (MVC) with 10% MVC increment until exhaustion. Femoral nerve magnetic stimulation was used during and after MVC to evaluate neuromuscular fatigue after each set, at task failure, and after 10 and 30 min of recovery. Initial MVC and evoked muscular responses were not modified with salbutamol (P > 0.05). The total number of submaximal contractions until task failure significantly differed between treatments (placebo, 72 ± 7; 200 µg, 78 ± 8; and 800 µg, 82 ± 7; P < 0.01). MVC and evoked muscular responses were similarly reduced with all treatments during the fatiguing task (all P > 0.05). Voluntary activation was unaffected by the fatiguing task and treatments (P > 0.05). Supratherapeutic inhaled doses of β2-agonists increased quadriceps endurance during an incremental and localized fatiguing task in healthy endurance-trained athletes without significant effect on neuromuscular fatigue. Further studies are needed to clarify the underlying mechanisms.

Health care utilization and charges following the enactment of the 2007 Graduated Drivers Licensing Law in Massachusetts.

PubMed

Sangji, Naveen F; Ramly, Elie P; Kaafarani, Haytham M A; Seethala, Raghu; Raybould, Toby; Camargo, Carlos A; Velmahos, George; Masiakos, Peter T; Lee, Jarone

2015-10-01

Graduated Drivers Licensing (GDL) programs phase in driving privileges for teenagers. In 2007, Massachusetts implemented a stricter version of the 1998 GDL law, with increased fines and education. This study evaluated the impact of the law on motor vehicle crash (MVC)-related health care utilization and charges. Massachusetts government and US Census Bureau data were analyzed to compare the rates of MVC-related emergency department (ED) visits and hospital charges before (2002-2006) and after (2007-2011) the 2007 GDL law. Three driver age groups were studied: 16-17 (evaluating the law effect), 18-20 (evaluating the sustainability of the effect), and 25-29 years old (control group). MVC-related ED visits per population decreased after the law for all three age groups (16-17: 2326 to 713; 18-20: 2110 to 1304; 25-29: 1694 to 1228; per 100,000, p<0.001), but the decrease was greater amongst teenagers (16-17: -69%; 18-20: -38%) compared to the control group (-27%); p<0.001. MVC-related hospital charges per population also decreased for teenagers but increased for the control group (16-17: $2.70 m to $1.45 m; 18-20: $3.52 m to $2.26 m; 25-29: $1.86 m to $1.92 m; per 100,000, p<0.001). The 2007 GDL law in Massachusetts was associated with significant decreases in MVC-related health care utilization and hospital charges among teenage drivers. Copyright © 2015 Elsevier Inc. All rights reserved.

Torque-onset determination: Unintended consequences of the threshold method.

PubMed

Dotan, Raffy; Jenkins, Glenn; O'Brien, Thomas D; Hansen, Steve; Falk, Bareket

2016-12-01

Compared with visual torque-onset-detection (TOD), threshold-based TOD produces onset bias, which increases with lower torques or rates of torque development (RTD). To compare the effects of differential TOD-bias on common contractile parameters in two torque-disparate groups. Fifteen boys and 12 men performed maximal, explosive, isometric knee-extensions. Torque and EMG were recorded for each contraction. Best contractions were selected by peak torque (MVC) and peak RTD. Visual-TOD-based torque-time traces, electromechanical delays (EMD), and times to peak RTD (tRTD) were compared with corresponding data derived from fixed 4-Nm- and relative 5%MVC-thresholds. The 5%MVC TOD-biases were similar for boys and men, but the corresponding 4-Nm-based biases were markedly different (40.3±14.1 vs. 18.4±7.1ms, respectively; p<0.001). Boys-men EMD differences were most affected, increasing from 5.0ms (visual) to 26.9ms (4Nm; p<0.01). Men's visually-based torque kinetics tended to be faster than the boys' (NS), but the 4-Nm-based kinetics erroneously depicted the boys as being much faster to any given %MVC (p<0.001). When comparing contractile properties of dissimilar groups, e.g., children vs. adults, threshold-based TOD methods can misrepresent reality and lead to erroneous conclusions. Relative-thresholds (e.g., 5% MVC) still introduce error, but group-comparisons are not confounded. Copyright © 2016 Elsevier Ltd. All rights reserved.

AVS on satellite

NASA Astrophysics Data System (ADS)

Zhao, Haiwu; Wang, Guozhong; Hou, Gang

2005-07-01

AVS is a new digital audio-video coding standard established by China. AVS will be used in digital TV broadcasting and next general optical disk. AVS adopted many digital audio-video coding techniques developed by Chinese company and universities in recent years, it has very low complexity compared to H.264, and AVS will charge very low royalty fee through one-step license including all AVS tools. So AVS is a good and competitive candidate for Chinese DTV and next generation optical disk. In addition, Chinese government has published a plan for satellite TV signal directly to home(DTH) and a telecommunication satellite named as SINO 2 will be launched in 2006. AVS will be also one of the best hopeful candidates of audio-video coding standard on satellite signal transmission.

Multicore-based 3D-DWT video encoder

NASA Astrophysics Data System (ADS)

Galiano, Vicente; López-Granado, Otoniel; Malumbres, Manuel P.; Migallón, Hector

2013-12-01

Three-dimensional wavelet transform (3D-DWT) encoders are good candidates for applications like professional video editing, video surveillance, multi-spectral satellite imaging, etc. where a frame must be reconstructed as quickly as possible. In this paper, we present a new 3D-DWT video encoder based on a fast run-length coding engine. Furthermore, we present several multicore optimizations to speed-up the 3D-DWT computation. An exhaustive evaluation of the proposed encoder (3D-GOP-RL) has been performed, and we have compared the evaluation results with other video encoders in terms of rate/distortion (R/D), coding/decoding delay, and memory consumption. Results show that the proposed encoder obtains good R/D results for high-resolution video sequences with nearly in-place computation using only the memory needed to store a group of pictures. After applying the multicore optimization strategies over the 3D DWT, the proposed encoder is able to compress a full high-definition video sequence in real-time.

Density of surgeons is significantly associated with reduced risk of deaths from motor vehicle crashes in US counties.

PubMed

Chang, David C; Eastman, Brent; Talamini, Mark A; Osen, Hayley B; Tran Cao, Hop S; Coimbra, Raul

2011-05-01

The concept of surgery and public health has been introduced in recent years, highlighting the impact of surgeons on improving public health outcomes, a relationship that has traditionally been ascribed to general practitioners. The purpose of this study is to quantify the effect of surgeon availability on deaths from motor vehicle crashes (MVC). Retrospective analysis of the Area Resource File from 2006 was performed. The primary outcome variable was the three-year (2001-2003) average in MVC deaths per 1 million population for each county. The primary independent variable was the density of surgeons per 1 million population in year 2003. Multiple linear regression analysis was performed, adjusting for density of general practitioners, urbanicity of the county, and socioeconomic status of the county. A total of 3,225 counties were analyzed. The median number of MVC deaths per million population was 226 (IQR 158-320). The median number of surgeon per million population was 55 (IQR 0-105), while the median number of general practitioners per million population was 424 (IQR 274-620). On unadjusted analysis, each increase of one surgeon per million population was associated with 0.38 fewer MVC deaths per million population (p < 0.001). On multivariate analysis, each increase of one surgeon per million population was significantly associated with 0.16 fewer MVC deaths per million population (p < 0.001). Rural location, persistent poverty, and low educational level were all associated with significant increases in MVC deaths. Higher density of surgeons is associated with significant reduction in deaths from MVCs. This highlights the need for 1) consideration of surgery as primary care and 2) development of inclusive surgical systems designed to provide care commensurate with patients' degree of injury. Copyright © 2011 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Restraint use in motor vehicle crash fatalities in children 0 year to 9 years old.

PubMed

Lee, Lois K; Farrell, Caitlin A; Mannix, Rebekah

2015-09-01

Despite improvements in child passenger safety legislation and equipment, motor vehicle crashes (MVCs) continue to be the leading cause of death in children younger than 10 years. The objective of this study was to describe factors associated with restraint use in fatal MVC in children 0 year to 9 years old. The Fatality Analysis Reporting System, maintained by the National Highway Transportation Safety Administration, was used to obtain data on MVC fatalities from 2001 to 2010 in children 0 year to 9 years old. The main outcome was restraint use. Demographic information (age, sex, and race) and crash characteristics including vehicle type (sedan, van, truck, sports utility vehicle) and seat position in the vehicle were analyzed with the χ statistic to evaluate these factors for any restraint use compared with no restraint use in MVC fatalities. There were 7,625 MVC fatalities in children 0 year to 9 years old from 2001 to 2010.Among these fatalities, 4,041 (53%) had any restraint use. Front seat passengers accounted for 20.9% (1,595 of 7,625) of the fatalities. Children 0 year to 3 years old had a higher proportion of restraint use than children 4 years to 9 years old (p < 0.001). White children compared with black children had higher use of restraints (p < 0.001). Children riding in sedans/vans compared with sport utility vehicles/trucks and those riding in the rear seats of the vehicle compared with those in front seats were significantly more likely to use restraints (p < 0.001). Overall, only half of children 0 year to 9 years old who died in an MVC were wearing any child restraint in the vehicle, and 20% were sitting in the front seat. Continued efforts must be made to enforce legislation and educate the public about best practices regarding child passenger safety to improve proper restraint use and to decrease MVC fatalities in children. Prognostic/epidemiologic study, level II.

Subjective evaluation of H.265/HEVC based dynamic adaptive video streaming over HTTP (HEVC-DASH)

NASA Astrophysics Data System (ADS)

Irondi, Iheanyi; Wang, Qi; Grecos, Christos

2015-02-01

The Dynamic Adaptive Streaming over HTTP (DASH) standard is becoming increasingly popular for real-time adaptive HTTP streaming of internet video in response to unstable network conditions. Integration of DASH streaming techniques with the new H.265/HEVC video coding standard is a promising area of research. The performance of HEVC-DASH systems has been previously evaluated by a few researchers using objective metrics, however subjective evaluation would provide a better measure of the user's Quality of Experience (QoE) and overall performance of the system. This paper presents a subjective evaluation of an HEVC-DASH system implemented in a hardware testbed. Previous studies in this area have focused on using the current H.264/AVC (Advanced Video Coding) or H.264/SVC (Scalable Video Coding) codecs and moreover, there has been no established standard test procedure for the subjective evaluation of DASH adaptive streaming. In this paper, we define a test plan for HEVC-DASH with a carefully justified data set employing longer video sequences that would be sufficient to demonstrate the bitrate switching operations in response to various network condition patterns. We evaluate the end user's real-time QoE online by investigating the perceived impact of delay, different packet loss rates, fluctuating bandwidth, and the perceived quality of using different DASH video stream segment sizes on a video streaming session using different video sequences. The Mean Opinion Score (MOS) results give an insight into the performance of the system and expectation of the users. The results from this study show the impact of different network impairments and different video segments on users' QoE and further analysis and study may help in optimizing system performance.

Perceptual video quality assessment in H.264 video coding standard using objective modeling.

PubMed

Karthikeyan, Ramasamy; Sainarayanan, Gopalakrishnan; Deepa, Subramaniam Nachimuthu

2014-01-01

Since usage of digital video is wide spread nowadays, quality considerations have become essential, and industry demand for video quality measurement is rising. This proposal provides a method of perceptual quality assessment in H.264 standard encoder using objective modeling. For this purpose, quality impairments are calculated and a model is developed to compute the perceptual video quality metric based on no reference method. Because of the shuttle difference between the original video and the encoded video the quality of the encoded picture gets degraded, this quality difference is introduced by the encoding process like Intra and Inter prediction. The proposed model takes into account of the artifacts introduced by these spatial and temporal activities in the hybrid block based coding methods and an objective modeling of these artifacts into subjective quality estimation is proposed. The proposed model calculates the objective quality metric using subjective impairments; blockiness, blur and jerkiness compared to the existing bitrate only calculation defined in the ITU G 1070 model. The accuracy of the proposed perceptual video quality metrics is compared against popular full reference objective methods as defined by VQEG.

Portrayal of Alcohol Brands Popular Among Underage Youth on YouTube: A Content Analysis.

PubMed

Primack, Brian A; Colditz, Jason B; Rosen, Eva B; Giles, Leila M; Jackson, Kristina M; Kraemer, Kevin L

2017-09-01

We characterized leading YouTube videos featuring alcohol brand references and examined video characteristics associated with each brand and video category. We systematically captured the 137 most relevant and popular videos on YouTube portraying alcohol brands that are popular among underage youth. We used an iterative process to codebook development. We coded variables within domains of video type, character sociodemographics, production quality, and negative and positive associations with alcohol use. All variables were double coded, and Cohen's kappa was greater than .80 for all variables except age, which was eliminated. There were 96,860,936 combined views for all videos. The most common video type was "traditional advertisements," which comprised 40% of videos. Of the videos, 20% were "guides" and 10% focused on chugging a bottle of distilled spirits. While 95% of videos featured males, 40% featured females. Alcohol intoxication was present in 19% of videos. Aggression, addiction, and injuries were uncommonly identified (2%, 3%, and 4%, respectively), but 47% of videos contained humor. Traditional advertisements represented the majority of videos related to Bud Light (83%) but only 18% of Grey Goose and 8% of Hennessy videos. Intoxication was most present in chugging demonstrations (77%), whereas addiction was only portrayed in music videos (22%). Videos containing humor ranged from 11% for music-related videos to 77% for traditional advertisements. YouTube videos depicting the alcohol brands favored by underage youth are heavily viewed, and the majority are traditional or narrative advertisements. Understanding characteristics associated with different brands and video categories may aid in intervention development.

A contourlet transform based algorithm for real-time video encoding

NASA Astrophysics Data System (ADS)

Katsigiannis, Stamos; Papaioannou, Georgios; Maroulis, Dimitris

2012-06-01

In recent years, real-time video communication over the internet has been widely utilized for applications like video conferencing. Streaming live video over heterogeneous IP networks, including wireless networks, requires video coding algorithms that can support various levels of quality in order to adapt to the network end-to-end bandwidth and transmitter/receiver resources. In this work, a scalable video coding and compression algorithm based on the Contourlet Transform is proposed. The algorithm allows for multiple levels of detail, without re-encoding the video frames, by just dropping the encoded information referring to higher resolution than needed. Compression is achieved by means of lossy and lossless methods, as well as variable bit rate encoding schemes. Furthermore, due to the transformation utilized, it does not suffer from blocking artifacts that occur with many widely adopted compression algorithms. Another highly advantageous characteristic of the algorithm is the suppression of noise induced by low-quality sensors usually encountered in web-cameras, due to the manipulation of the transform coefficients at the compression stage. The proposed algorithm is designed to introduce minimal coding delay, thus achieving real-time performance. Performance is enhanced by utilizing the vast computational capabilities of modern GPUs, providing satisfactory encoding and decoding times at relatively low cost. These characteristics make this method suitable for applications like video-conferencing that demand real-time performance, along with the highest visual quality possible for each user. Through the presented performance and quality evaluation of the algorithm, experimental results show that the proposed algorithm achieves better or comparable visual quality relative to other compression and encoding methods tested, while maintaining a satisfactory compression ratio. Especially at low bitrates, it provides more human-eye friendly images compared to algorithms utilizing block-based coding, like the MPEG family, as it introduces fuzziness and blurring instead of artificial block artifacts.

MATIN: a random network coding based framework for high quality peer-to-peer live video streaming.

PubMed

Barekatain, Behrang; Khezrimotlagh, Dariush; Aizaini Maarof, Mohd; Ghaeini, Hamid Reza; Salleh, Shaharuddin; Quintana, Alfonso Ariza; Akbari, Behzad; Cabrera, Alicia Triviño

2013-01-01

In recent years, Random Network Coding (RNC) has emerged as a promising solution for efficient Peer-to-Peer (P2P) video multicasting over the Internet. This probably refers to this fact that RNC noticeably increases the error resiliency and throughput of the network. However, high transmission overhead arising from sending large coefficients vector as header has been the most important challenge of the RNC. Moreover, due to employing the Gauss-Jordan elimination method, considerable computational complexity can be imposed on peers in decoding the encoded blocks and checking linear dependency among the coefficients vectors. In order to address these challenges, this study introduces MATIN which is a random network coding based framework for efficient P2P video streaming. The MATIN includes a novel coefficients matrix generation method so that there is no linear dependency in the generated coefficients matrix. Using the proposed framework, each peer encapsulates one instead of n coefficients entries into the generated encoded packet which results in very low transmission overhead. It is also possible to obtain the inverted coefficients matrix using a bit number of simple arithmetic operations. In this regard, peers sustain very low computational complexities. As a result, the MATIN permits random network coding to be more efficient in P2P video streaming systems. The results obtained from simulation using OMNET++ show that it substantially outperforms the RNC which uses the Gauss-Jordan elimination method by providing better video quality on peers in terms of the four important performance metrics including video distortion, dependency distortion, End-to-End delay and Initial Startup delay.

High-throughput sample adaptive offset hardware architecture for high-efficiency video coding

NASA Astrophysics Data System (ADS)

Zhou, Wei; Yan, Chang; Zhang, Jingzhi; Zhou, Xin

2018-03-01

A high-throughput hardware architecture for a sample adaptive offset (SAO) filter in the high-efficiency video coding video coding standard is presented. First, an implementation-friendly and simplified bitrate estimation method of rate-distortion cost calculation is proposed to reduce the computational complexity in the mode decision of SAO. Then, a high-throughput VLSI architecture for SAO is presented based on the proposed bitrate estimation method. Furthermore, multiparallel VLSI architecture for in-loop filters, which integrates both deblocking filter and SAO filter, is proposed. Six parallel strategies are applied in the proposed in-loop filters architecture to improve the system throughput and filtering speed. Experimental results show that the proposed in-loop filters architecture can achieve up to 48% higher throughput in comparison with prior work. The proposed architecture can reach a high-operating clock frequency of 297 MHz with TSMC 65-nm library and meet the real-time requirement of the in-loop filters for 8 K × 4 K video format at 132 fps.

Comparison of H.265/HEVC encoders

NASA Astrophysics Data System (ADS)

Trochimiuk, Maciej

2016-09-01

The H.265/HEVC is the state-of-the-art video compression standard, which allows the bitrate reduction up to 50% compared with its predecessor, H.264/AVC, maintaining equal perceptual video quality. The growth in coding efficiency was achieved by increasing the number of available intra- and inter-frame prediction features and improvements in existing ones, such as entropy encoding and filtering. Nevertheless, to achieve real-time performance of the encoder, simplifications in algorithm are inevitable. Some features and coding modes shall be skipped, to reduce time needed to evaluate modes forwarded to rate-distortion optimisation. Thus, the potential acceleration of the encoding process comes at the expense of coding efficiency. In this paper, a trade-off between video quality and encoding speed of various H.265/HEVC encoders is discussed.

Links between Characteristics of Collaborative Peer Video Analysis Events and Literacy Teachers' Outcomes

ERIC Educational Resources Information Center

Arya, Poonam; Christ, Tanya; Chiu, Ming

2015-01-01

This study examined how characteristics of Collaborative Peer Video Analysis (CPVA) events are related to teachers' pedagogical outcomes. Data included 39 transcribed literacy video events, in which 14 in-service teachers engaged in discussions of their video clips. Emergent coding and Statistical Discourse Analysis were used to analyze the data.…

Optimal power allocation and joint source-channel coding for wireless DS-CDMA visual sensor networks

NASA Astrophysics Data System (ADS)

Pandremmenou, Katerina; Kondi, Lisimachos P.; Parsopoulos, Konstantinos E.

2011-01-01

In this paper, we propose a scheme for the optimal allocation of power, source coding rate, and channel coding rate for each of the nodes of a wireless Direct Sequence Code Division Multiple Access (DS-CDMA) visual sensor network. The optimization is quality-driven, i.e. the received quality of the video that is transmitted by the nodes is optimized. The scheme takes into account the fact that the sensor nodes may be imaging scenes with varying levels of motion. Nodes that image low-motion scenes will require a lower source coding rate, so they will be able to allocate a greater portion of the total available bit rate to channel coding. Stronger channel coding will mean that such nodes will be able to transmit at lower power. This will both increase battery life and reduce interference to other nodes. Two optimization criteria are considered. One that minimizes the average video distortion of the nodes and one that minimizes the maximum distortion among the nodes. The transmission powers are allowed to take continuous values, whereas the source and channel coding rates can assume only discrete values. Thus, the resulting optimization problem lies in the field of mixed-integer optimization tasks and is solved using Particle Swarm Optimization. Our experimental results show the importance of considering the characteristics of the video sequences when determining the transmission power, source coding rate and channel coding rate for the nodes of the visual sensor network.

VLSI design of lossless frame recompression using multi-orientation prediction

NASA Astrophysics Data System (ADS)

Lee, Yu-Hsuan; You, Yi-Lun; Chen, Yi-Guo

2016-01-01

Pursuing an experience of high-end visual quality drives human to demand a higher display resolution and a higher frame rate. Hence, a lot of powerful coding tools are aggregated together in emerging video coding standards to improve coding efficiency. This also makes video coding standards suffer from two design challenges: heavy computation and tremendous memory bandwidth. The first issue can be properly solved by a careful hardware architecture design with advanced semiconductor processes. Nevertheless, the second one becomes a critical design bottleneck for a modern video coding system. In this article, a lossless frame recompression using multi-orientation prediction technique is proposed to overcome this bottleneck. This work is realised into a silicon chip with the technology of TSMC 0.18 µm CMOS process. Its encoding capability can reach full-HD (1920 × 1080)@48 fps. The chip power consumption is 17.31 mW@100 MHz. Core area and chip area are 0.83 × 0.83 mm2 and 1.20 × 1.20 mm2, respectively. Experiment results demonstrate that this work exhibits an outstanding performance on lossless compression ratio with a competitive hardware performance.

Driving with Pets as a Risk Factor for Motor Vehicle Collisions among Older Drivers

PubMed Central

Blunck, Hallie; Owsley, Cynthia; MacLennan, Paul A.; McGwin, Gerald

2015-01-01

Increasing rates of distraction-related motor vehicle collisions (MVCs) continue to raise concerns regarding driving safety. This study sought to evaluate a novel driving-related distraction, driving with a pet, as a risk factor for MVCs among older, community dwelling adults. Two thousand licensed drivers aged 70 and older were identified, of whom 691 reported pet ownership. Comparing pet owners who did and did not drive with their pets, neither overall MVC rates (rate ratio [RR] 0.97 95% confidence interval [CI] 0.75–1.26) nor at-fault MVC rates (RR 0.84 95% CI 0.57–1.24) were elevated. However, those who reported always driving with a pet in the vehicle had an elevated MVC rate (RR 1.89 95% CI 1.10–3.25), as compared to those who did not drive with a pet. The MVC rate was not increased for those reporting only sometimes or rarely driving with a pet in the vehicle. The current study demonstrates an increased risk of MVC involvement in those older drivers who always take a pet with them when they drive a vehicle. When confronted with an increased cognitive or physical workload while driving, elderly drivers in prior studies have exhibited slower cognitive performance and delayed response times in comparison to younger age groups. Further study of pet-related distracted driving behaviors among older drivers as well as younger populations with respect to driver safety and performance is warranted to appropriately inform the need for policy regulation on this issue. PMID:23708755

Reduced Radial Displacement of the Gastrocnemius Medialis Muscle After Electrically Elicited Fatigue.

PubMed

Macgregor, Lewis J; Ditroilo, Massimiliano; Smith, Iain J; Fairweather, Malcolm M; Hunter, Angus M

2016-08-01

Assessments of skeletal-muscle functional capacity often necessitate maximal contractile effort, which exacerbates muscle fatigue or injury. Tensiomyography (TMG) has been investigated as a means to assess muscle contractile function after fatigue; however, observations have not been contextualized by concurrent physiological measures. To measure peripheral-fatigue-induced alterations in mechanical and contractile properties of the plantar-flexor muscles through noninvasive TMG concurrently with maximal voluntary contraction (MVC) and passive muscle tension (PMT) to validate TMG as a gauge of peripheral fatigue. Pre- and posttest intervention with control. University laboratory. 21 healthy male volunteers. Subjects' plantar flexors were tested for TMG parameters, along with MVC and PMT, before and after either a 5-min rest period (control) or a 5-min electrical-stimulation intervention (fatigue). Temporal (contraction velocity) and spatial (radial displacement) contractile parameters of the gastrocnemius medialis were recorded through TMG. MVC was measured as an indicator of muscle fatigue, and PMT was measured to assess muscle stiffness. Radial displacement demonstrated a fatigue-associated reduction (3.3 ± 1.2 vs 4.0 ± 1.4 mm, P = .031), while contraction velocity remained unaltered. In addition, MVC significantly declined by 122.6 ± 104 N (P < .001) after stimulation (fatigue). PMT was significantly increased after fatigue (139.8 ± 54.3 vs 111.3 ± 44.6 N, P = .007). TMG successfully detected fatigue, evident from reduced MVC, by displaying impaired muscle displacement accompanied by elevated PMT. TMG could be useful in establishing skeletal-muscle fatigue status without exacerbating the functional decrement of the muscle.

Driving with pets as a risk factor for motor vehicle collisions among older drivers.

PubMed

Blunck, Hallie; Owsley, Cynthia; MacLennan, Paul A; McGwin, Gerald

2013-09-01

Increasing rates of distraction-related motor vehicle collisions (MVCs) continue to raise concerns regarding driving safety. This study sought to evaluate a novel driving-related distraction, driving with a pet, as a risk factor for MVCs among older, community dwelling adults. Two thousand licensed drivers aged 70 and older were identified, of whom 691 reported pet ownership. Comparing pet owners who did and did not drive with their pets, neither overall MVC rates (rate ratio [RR] 0.97, 95% confidence interval [CI] 0.75-1.26) nor at-fault MVC rates (RR 0.84, 95% CI 0.57-1.24) were elevated. However, those who reported always driving with a pet in the vehicle had an elevated MVC rate (RR 1.89, 95% CI 1.10-3.25), as compared to those who did not drive with a pet. The MVC rate was not increased for those reporting only sometimes or rarely driving with a pet in the vehicle. The current study demonstrates an increased risk of MVC involvement in those older drivers who always take a pet with them when they drive a vehicle. When confronted with an increased cognitive or physical workload while driving, elderly drivers in prior studies have exhibited slower cognitive performance and delayed response times in comparison to younger age groups. Further study of pet-related distracted driving behaviors among older drivers as well as younger populations with respect to driver safety and performance is warranted to appropriately inform the need for policy regulation on this issue. Published by Elsevier Ltd.

Warfarin use and the risk of valvular calcification.

PubMed

Lerner, R G; Aronow, W S; Sekhri, A; Palaniswamy, C; Ahn, C; Singh, T; Sandhu, R; McClung, J A

2009-12-01

Warfarin affects the synthesis and function of the matrix Gla-protein, a vitamin K-dependent protein, which is a potent inhibitor of tissue calcification. To investigate the incidence of mitral valve calcium (MVC), mitral annular calcium (MAC) and aortic valve calcium (AVC) in patients with non-valvular atrial fibrillation (AF) treated with warfarin vs. no warfarin. Of 1155 patients, mean age 74 years, with AF, 725 (63%) were treated with warfarin and 430 (37%) without warfarin. The incidence of MVC, MAC and AVC was investigated in these 1155 patients with two-dimensional echocardiograms. Unadjusted logistic regression analysis was conducted to examine the association between the use of warfarin and the incidence of MVC, MAC or AVC. Logistic regression analyses were also conducted to investigate whether the relationship stands after adjustment for confounding risk factors such as age, sex, race, ejection fraction, smoking, hypertension, diabetes, dyslipidemia, coronary artery disease (CAD), glomerular filtration rate, calcium, phosphorus, calcium-phosphorus product, alkaline phosphatase, use of aspirin, beta blockers, angiotensin-converting enzyme inhibitors or angiotensin receptor blockers, and statins. There was a significant association between the use of warfarin and the risk of calcification [unadjusted odds ratio = 1.71, 95% CI = (1.34-2.18)]. The association still stands after adjustment for confounding risk factors. MVC, MAC or AVC was present in 473 of 725 patients (65%) on warfarin vs. 225 of 430 patients (52%) not on warfarin (P < 0.0001). Whether this is a causal relationship remains unknown. Use of warfarin in patients with AF is associated with an increased prevalence of MVC, MAC or AVC.

Relationship Between Motor Vehicle Collisions and Results of Perimetry, Useful Field of View, and Driving Simulation in Drivers With Glaucoma.

PubMed

Tatham, Andrew J; Boer, Erwin R; Gracitelli, Carolina P B; Rosen, Peter N; Medeiros, Felipe A

2015-05-01

To examine the relationship between Motor Vehicle Collisions (MVCs) in drivers with glaucoma and standard automated perimetry (SAP), Useful Field of View (UFOV), and driving simulator assessment of divided attention. A cross-sectional study of 153 drivers from the Diagnostic Innovations in Glaucoma Study. All subjects had SAP and divided attention was assessed using UFOV and driving simulation using low-, medium-, and high-contrast peripheral stimuli presented during curve negotiation and car following tasks. Self-reported history of MVCs and average mileage driven were recorded. Eighteen of 153 subjects (11.8%) reported a MVC. There was no difference in visual acuity but the MVC group was older, drove fewer miles, and had worse binocular SAP sensitivity, contrast sensitivity, and ability to divide attention (UFOV and driving simulation). Low contrast driving simulator tasks were the best discriminators of MVC (AUC 0.80 for curve negotiation versus 0.69 for binocular SAP and 0.59 for UFOV). Adjusting for confounding factors, longer reaction times to driving simulator divided attention tasks provided additional value compared with SAP and UFOV, with a 1 standard deviation (SD) increase in reaction time (approximately 0.75 s) associated with almost two-fold increased odds of MVC. Reaction times to low contrast divided attention tasks during driving simulation were significantly associated with history of MVC, performing better than conventional perimetric tests and UFOV. The association between conventional tests of visual function and MVCs in drivers with glaucoma is weak, however, tests of divided attention, particularly using driving simulation, may improve risk assessment.

Matching of postcontraction perfusion to oxygen consumption across submaximal contraction intensities in exercising humans.

PubMed

Buck, Amanda K W; Elder, Christopher P; Donahue, Manus J; Damon, Bruce M

2015-08-01

Studying the magnitude and kinetics of blood flow, oxygen extraction, and oxygen consumption at exercise onset and during the recovery from exercise can lead to insights into both the normal control of metabolism and blood flow and the disturbances to these processes in metabolic and cardiovascular diseases. The purpose of this study was to examine the on- and off-kinetics for oxygen delivery, extraction, and consumption as functions of submaximal contraction intensity. Eight healthy subjects performed four 1-min isometric dorsiflexion contractions, with two at 20% MVC and two at 40% MVC. During one contraction at each intensity, relative perfusion changes were measured by using arterial spin labeling, and the deoxyhemoglobin percentage (%HHb) was estimated using the spin- and gradient-echo sequence and a previously published empirical calibration. For the whole group, the mean perfusion did not increase during contraction. The %HHb increased from ∼28 to 38% during contractions of each intensity, with kinetics well described by an exponential function and mean response times (MRTs) of 22.7 and 21.6 s for 20 and 40% MVC, respectively. Following contraction, perfusion increased ∼2.5-fold. The %HHb, oxygen consumption, and perfusion returned to precontraction levels with MRTs of 27.5, 46.4, and 50.0 s, respectively (20% MVC), and 29.2, 75.3, and 86.0 s, respectively (40% MVC). These data demonstrate in human subjects the varied recovery rates of perfusion and oxygen consumption, along with the similar rates of %HHb recovery, across these exercise intensities. Copyright © 2015 the American Physiological Society.

[A field study on the work load and muscle fatigue at neck-shoulder in female sewing machine operators by using surface electromyography].

PubMed

Zhang, Fei-ruo; Wang, Sheng; He, Li-hua; Zhang, Ying; Wu, Shan-shan; Li, Jing-yun; Hu, Guang-yi; Ye, Kang-ping

2011-03-01

To study neck and shoulder work-related muscle fatigue of female sewing machine operators. 18 health female sewing machine operators without musculoskeletal disorders work in Beijing garment industry factory as volunteers in participate of this study. The maximal voluntary contraction (MVC) and 20% MVC of bilateral upper trapezium and cervical erectors spinae was tested before sewing operations, then the whole 20 time windows (1 time window = 10 min) sewing machine operations was monitored and the surface electromyography (sEMG) signals simultaneously was recorded after monitoring the 20%MVC was tested. Use amplitude analysis method to reduction recorded EMG signals. During work, the median load for the left cervical erector spinae (LCES), right cervical erector spinae (RCES), left upper trapezium (LUT) and right upper trapezium (RUT) respectively was 6.78 ± 1.05, 6.94 ± 1.12, 5.68 ± 2.56 and 6.47 ± 3.22, work load of right is higher than the left; static load analysis indicated the value of RMS(20%MVC) before work was higher than that value after work, the increase of right CES and UT RMS(20%MVC) was more; the largest 20%MVE of bilateral CES occurred at 20th time window, and that of bilateral UT happened at 16th. The work load of female sewing machine operators is sustained "static" load, and work load of right neck-shoulder is higher than left, right neck-shoulder muscle is more fatigable and much serious once fatigued.

Recruitment of motor units in two fascicles of the semispinalis cervicis muscle.

PubMed

Schomacher, Jochen; Dideriksen, Jakob Lund; Farina, Dario; Falla, Deborah

2012-06-01

This study investigated the behavior of motor units in the semispinalis cervicis muscle. Intramuscular EMG recordings were obtained unilaterally at levels C2 and C5 in 15 healthy volunteers (8 men, 7 women) who performed isometric neck extensions at 5%, 10%, and 20% of the maximal force [maximum voluntary contraction (MVC)] for 2 min each and linearly increasing force contractions from 0 to 30% MVC over 3 s. Individual motor unit action potentials were identified. The discharge rate and interspike interval variability of the motor units in the two locations did not differ. However, the recruitment threshold of motor units detected at C2 (n = 16, mean ± SD: 10.3 ± 6.0% MVC) was greater than that of motor units detected at C5 (n = 92, 6.9 ± 4.3% MVC) (P < 0.01). A significant level of short-term synchronization was identified in 246 of 307 motor unit pairs when computed within one spinal level but only in 28 of 110 pairs of motor units between the two levels. The common input strength, which quantifies motor unit synchronization, was greater for pairs within one level (0.47 ± 0.32) compared with pairs between levels (0.09 ± 0.07) (P < 0.05). In a second experiment on eight healthy subjects, interference EMG was recorded from the same locations during a linearly increasing force contraction from 0 to 40% MVC and showed significantly greater EMG amplitude at C5 than at C2. In conclusion, synaptic input is distributed partly independently and nonuniformly to different fascicles of the semispinalis cervicis muscle.

Coding tools investigation for next generation video coding based on HEVC

NASA Astrophysics Data System (ADS)

Chen, Jianle; Chen, Ying; Karczewicz, Marta; Li, Xiang; Liu, Hongbin; Zhang, Li; Zhao, Xin

2015-09-01

The new state-of-the-art video coding standard, H.265/HEVC, has been finalized in 2013 and it achieves roughly 50% bit rate saving compared to its predecessor, H.264/MPEG-4 AVC. This paper provides the evidence that there is still potential for further coding efficiency improvements. A brief overview of HEVC is firstly given in the paper. Then, our improvements on each main module of HEVC are presented. For instance, the recursive quadtree block structure is extended to support larger coding unit and transform unit. The motion information prediction scheme is improved by advanced temporal motion vector prediction, which inherits the motion information of each small block within a large block from a temporal reference picture. Cross component prediction with linear prediction model improves intra prediction and overlapped block motion compensation improves the efficiency of inter prediction. Furthermore, coding of both intra and inter prediction residual is improved by adaptive multiple transform technique. Finally, in addition to deblocking filter and SAO, adaptive loop filter is applied to further enhance the reconstructed picture quality. This paper describes above-mentioned techniques in detail and evaluates their coding performance benefits based on the common test condition during HEVC development. The simulation results show that significant performance improvement over HEVC standard can be achieved, especially for the high resolution video materials.

Complexity control algorithm based on adaptive mode selection for interframe coding in high efficiency video coding

NASA Astrophysics Data System (ADS)

Chen, Gang; Yang, Bing; Zhang, Xiaoyun; Gao, Zhiyong

2017-07-01

The latest high efficiency video coding (HEVC) standard significantly increases the encoding complexity for improving its coding efficiency. Due to the limited computational capability of handheld devices, complexity constrained video coding has drawn great attention in recent years. A complexity control algorithm based on adaptive mode selection is proposed for interframe coding in HEVC. Considering the direct proportionality between encoding time and computational complexity, the computational complexity is measured in terms of encoding time. First, complexity is mapped to a target in terms of prediction modes. Then, an adaptive mode selection algorithm is proposed for the mode decision process. Specifically, the optimal mode combination scheme that is chosen through offline statistics is developed at low complexity. If the complexity budget has not been used up, an adaptive mode sorting method is employed to further improve coding efficiency. The experimental results show that the proposed algorithm achieves a very large complexity control range (as low as 10%) for the HEVC encoder while maintaining good rate-distortion performance. For the lowdelayP condition, compared with the direct resource allocation method and the state-of-the-art method, an average gain of 0.63 and 0.17 dB in BDPSNR is observed for 18 sequences when the target complexity is around 40%.

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

Muscle enzyme release does not predict muscle function impairment after triathlon.

PubMed

Margaritis, I; Tessier, F; Verdera, F; Bermon, S; Marconnet, P

1999-06-01

We sought to determine the effects of a long distance triathlon (4 km swim, 120 km bike-ride, and 30 km run) on the four-day kinetics of the biochemical markers of muscle damage, and whether they were quantitatively linked with muscle function impairment and soreness. Data were collected from 2 days before until 4 days after the completion of the race. Twelve triathletes performed the triathlon and five did not. Maximal voluntary contraction (MVC), muscle soreness (DOMS) and total serum CK, CK-MB, LDH, AST and ALT activities were assessed. Significant changes after triathlon completion were found for all muscle damage indirect markers over time (p < 0.0001). MVC of the knee extensor and flexor muscles decreased over time (p < 0.05). There is disparity in the time point at which peak values where reached for DOMS, MVC and enzyme leakage. There is no correlation between serum enzyme leakage, DOMS and MVC impairment which occur after triathlon. Long distance triathlon race caused muscle damage, but extent, as well as muscle recovery cannot be evaluated by the magnitude of changes in serum enzyme activities. Muscle enzyme release cannot be used to predict the magnitude of the muscle function impairment caused by muscle damage.

The Association of Gasoline Prices With Hospital Utilization and Costs for Motorcycle and Nonmotorcycle Motor Vehicle Injuries in the United States.

PubMed

Zhu, He; Wilson, Fernando A; Stimpson, Jim P; Araz, Ozgur M; Kim, Jungyoon; Chen, Baojiang; Wu, Li-Tzy

2016-09-01

This study examined the association between gasoline prices and hospitalizations for motorcycle and nonmotorcycle motor vehicle crash (MVC) injuries. Data on inpatient hospitalizations were obtained from the 2001 to 2010 Nationwide Inpatient Sample. Panel feasible generalized least squares models were used to estimate the effects of monthly inflation-adjusted gasoline prices on hospitalization rates for MVC injuries and to predict the impact of increasing gasoline taxes. On the basis of the available data, a $1.00 increase in the gasoline tax was associated with an estimated 8348 fewer annual hospitalizations for nonmotorcycle MVC injuries, and reduced hospital costs by $143 million. However, the increase in the gasoline tax was also associated with an estimated 3574 more annual hospitalizations for motorcycle crash injuries, and extended hospital costs by $73 million. This analysis of some existing data suggest that the increased utilization and costs of hospitalization from motorcycle crash injuries associated with an increase in the price of gasoline are likely to substantially offset reductions in nonmotorcycle MVC injuries. A policy decision to increase the gasoline tax could improve traffic safety if the increased tax is paired with public health interventions to improve motorcycle safety.

Effects of implicit theories of ability and stereotype-inconsistent information on handgrip strength in older adults: A regulatory fit perspective.

PubMed

Emile, Mélanie; Chalabaev, Aina; Colson, Serge S; Vaulerin, Jerome; Falzon, Charlene; D'Arripe-Longueville, Fabienne

2017-03-01

This study examined whether stereotype-inconsistent information interacts with implicit theories of ability to affect handgrip strength in older adults. Eighty-two retired older adults (13 men and 69 women) from 61 to 89 years old (M age = 75.8 years; SD = 6.9) performed maximum voluntary contractions (MVC) during a handgrip task in a design manipulating implicit theories of ability and stereotype-inconsistent information related to physical decline with aging. Participants were randomly assigned to one of three groups: incremental condition, entity condition, or control group. The results showed that in the incremental condition the stereotype-inconsistent information improved the peak MVC, the average MVC, the peak rate of force development (RFD), and RFD in the initial 50 ms of the MVC. This study therefore demonstrated that individuals with an incremental mindset who are exposed to stereotype-inconsistent information can boost their physical performance. These findings are discussed from the perspective of regulatory fit (i.e., when task framing is congruent with the individual's goal). © 2016 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

Voluntary muscle activation and evoked volitional-wave responses as a function of torque.

PubMed

Hight, Robert E; Quarshie, Alwyn T; Black, Christopher D

2018-08-01

This study employed a unique stimulation paradigm which allowed for the simultaneous assessment of voluntary activation levels (VA) via twitch-interpolation, and the evoked V-wave responses of the plantar flexors during submaximal and maximal contractions. Test-retest reliability was also examined. Fourteen participants repeated a stimulation protocol over four visits to assess VA and evoked V-wave amplitude across torque levels ranging from 20% to 100% MVC. MVC torque and EMG amplitude were also measured. VA increased nonlinearly with torque production and plateaued by 80% MVC. V-wave amplitude increased linearly from 20% to 100% MVC. There were no differences in any dependent variable across visits (p > 0.05). VA demonstrated moderate to substantial reliability across all torque levels (ICC = 0.76-0.91) while V-wave amplitude exhibited fair to moderate reliability from 40% to 100% (ICC = 0.48-0.74). We were able to reliably collect VA and the V-wave simultaneously in the plantar flexors. Collection of VA and V-wave during the same contraction provides distinct information regarding the contribution of motor-unit recruitment and descending cortico-spinal drive/excitability to force production. Copyright © 2018 Elsevier Ltd. All rights reserved.

DCT based interpolation filter for motion compensation in HEVC

NASA Astrophysics Data System (ADS)

Alshin, Alexander; Alshina, Elena; Park, Jeong Hoon; Han, Woo-Jin

2012-10-01

High Efficiency Video Coding (HEVC) draft standard has a challenging goal to improve coding efficiency twice compare to H.264/AVC. Many aspects of the traditional hybrid coding framework were improved during new standard development. Motion compensated prediction, in particular the interpolation filter, is one area that was improved significantly over H.264/AVC. This paper presents the details of the interpolation filter design of the draft HEVC standard. The coding efficiency improvements over H.264/AVC interpolation filter is studied and experimental results are presented, which show a 4.0% average bitrate reduction for Luma component and 11.3% average bitrate reduction for Chroma component. The coding efficiency gains are significant for some video sequences and can reach up 21.7%.

Dynamic code block size for JPEG 2000

NASA Astrophysics Data System (ADS)

Tsai, Ping-Sing; LeCornec, Yann

2008-02-01

Since the standardization of the JPEG 2000, it has found its way into many different applications such as DICOM (digital imaging and communication in medicine), satellite photography, military surveillance, digital cinema initiative, professional video cameras, and so on. The unified framework of the JPEG 2000 architecture makes practical high quality real-time compression possible even in video mode, i.e. motion JPEG 2000. In this paper, we present a study of the compression impact using dynamic code block size instead of fixed code block size as specified in the JPEG 2000 standard. The simulation results show that there is no significant impact on compression if dynamic code block sizes are used. In this study, we also unveil the advantages of using dynamic code block sizes.

A video coding scheme based on joint spatiotemporal and adaptive prediction.

PubMed

Jiang, Wenfei; Latecki, Longin Jan; Liu, Wenyu; Liang, Hui; Gorman, Ken

2009-05-01

We propose a video coding scheme that departs from traditional Motion Estimation/DCT frameworks and instead uses Karhunen-Loeve Transform (KLT)/Joint Spatiotemporal Prediction framework. In particular, a novel approach that performs joint spatial and temporal prediction simultaneously is introduced. It bypasses the complex H.26x interframe techniques and it is less computationally intensive. Because of the advantage of the effective joint prediction and the image-dependent color space transformation (KLT), the proposed approach is demonstrated experimentally to consistently lead to improved video quality, and in many cases to better compression rates and improved computational speed.

Priority-based methods for reducing the impact of packet loss on HEVC encoded video streams

NASA Astrophysics Data System (ADS)

Nightingale, James; Wang, Qi; Grecos, Christos

2013-02-01

The rapid growth in the use of video streaming over IP networks has outstripped the rate at which new network infrastructure has been deployed. These bandwidth-hungry applications now comprise a significant part of all Internet traffic and present major challenges for network service providers. The situation is more acute in mobile networks where the available bandwidth is often limited. Work towards the standardisation of High Efficiency Video Coding (HEVC), the next generation video coding scheme, is currently on track for completion in 2013. HEVC offers the prospect of a 50% improvement in compression over the current H.264 Advanced Video Coding standard (H.264/AVC) for the same quality. However, there has been very little published research on HEVC streaming or the challenges of delivering HEVC streams in resource-constrained network environments. In this paper we consider the problem of adapting an HEVC encoded video stream to meet the bandwidth limitation in a mobile networks environment. Video sequences were encoded using the Test Model under Consideration (TMuC HM6) for HEVC. Network abstraction layers (NAL) units were packetized, on a one NAL unit per RTP packet basis, and transmitted over a realistic hybrid wired/wireless testbed configured with dynamically changing network path conditions and multiple independent network paths from the streamer to the client. Two different schemes for the prioritisation of RTP packets, based on the NAL units they contain, have been implemented and empirically compared using a range of video sequences, encoder configurations, bandwidths and network topologies. In the first prioritisation method the importance of an RTP packet was determined by the type of picture and the temporal switching point information carried in the NAL unit header. Packets containing parameter set NAL units and video coding layer (VCL) NAL units of the instantaneous decoder refresh (IDR) and the clean random access (CRA) pictures were given the highest priority followed by NAL units containing pictures used as reference pictures from which others can be predicted. The second method assigned a priority to each NAL unit based on the rate-distortion cost of the VCL coding units contained in the NAL unit. The sum of the rate-distortion costs of each coding unit contained in a NAL unit was used as the priority weighting. The preliminary results of extensive experiments have shown that all three schemes offered an improvement in PSNR, when comparing original and decoded received streams, over uncontrolled packet loss. Using the first method consistently delivered a significant average improvement of 0.97dB over the uncontrolled scenario while the second method provided a measurable, but less consistent, improvement across the range of testing conditions and encoder configurations.

Application aware approach to compression and transmission of H.264 encoded video for automated and centralized transportation surveillance.

DOT National Transportation Integrated Search

2012-10-01

In this report we present a transportation video coding and wireless transmission system specically tailored to automated : vehicle tracking applications. By taking into account the video characteristics and the lossy nature of the wireless channe...

Applying an MVC Framework for The System Development Life Cycle with Waterfall Model Extended

NASA Astrophysics Data System (ADS)

Hardyanto, W.; Purwinarko, A.; Sujito, F.; Masturi; Alighiri, D.

2017-04-01

This paper describes the extension of the waterfall model using MVC architectural pattern for software development. The waterfall model is the based model of the most widely used in software development, yet there are still many problems in it. The general issue usually happens on data changes that cause the delays on the process itself. On the other hand, the security factor on the software as well as one of the major problems. This study uses PHP programming language for implementation. Although this model can be implemented in several programming languages with the same concept. This study is based on MVC architecture so that it can improve the performance of both software development and maintenance, especially concerning security, validation, database access, and routing.

Region-of-interest determination and bit-rate conversion for H.264 video transcoding

NASA Astrophysics Data System (ADS)

Huang, Shu-Fen; Chen, Mei-Juan; Tai, Kuang-Han; Li, Mian-Shiuan

2013-12-01

This paper presents a video bit-rate transcoder for baseline profile in H.264/AVC standard to fit the available channel bandwidth for the client when transmitting video bit-streams via communication channels. To maintain visual quality for low bit-rate video efficiently, this study analyzes the decoded information in the transcoder and proposes a Bayesian theorem-based region-of-interest (ROI) determination algorithm. In addition, a curve fitting scheme is employed to find the models of video bit-rate conversion. The transcoded video will conform to the target bit-rate by re-quantization according to our proposed models. After integrating the ROI detection method and the bit-rate transcoding models, the ROI-based transcoder allocates more coding bits to ROI regions and reduces the complexity of the re-encoding procedure for non-ROI regions. Hence, it not only keeps the coding quality but improves the efficiency of the video transcoding for low target bit-rates and makes the real-time transcoding more practical. Experimental results show that the proposed framework gets significantly better visual quality.

Cardiac ultrasonography over 4G wireless networks using a tele-operated robot

PubMed Central

Panayides, Andreas S.; Jossif, Antonis P.; Christoforou, Eftychios G.; Vieyres, Pierre; Novales, Cyril; Voskarides, Sotos; Pattichis, Constantinos S.

2016-01-01

This Letter proposes an end-to-end mobile tele-echography platform using a portable robot for remote cardiac ultrasonography. Performance evaluation investigates the capacity of long-term evolution (LTE) wireless networks to facilitate responsive robot tele-manipulation and real-time ultrasound video streaming that qualifies for clinical practice. Within this context, a thorough video coding standards comparison for cardiac ultrasound applications is performed, using a data set of ten ultrasound videos. Both objective and subjective (clinical) video quality assessment demonstrate that H.264/AVC and high efficiency video coding standards can achieve diagnostically-lossless video quality at bitrates well within the LTE supported data rates. Most importantly, reduced latencies experienced throughout the live tele-echography sessions allow the medical expert to remotely operate the robot in a responsive manner, using the wirelessly communicated cardiac ultrasound video to reach a diagnosis. Based on preliminary results documented in this Letter, the proposed robotised tele-echography platform can provide for reliable, remote diagnosis, achieving comparable quality of experience levels with in-hospital ultrasound examinations. PMID:27733929

Method and system for efficient video compression with low-complexity encoder

NASA Technical Reports Server (NTRS)

Chen, Jun (Inventor); He, Dake (Inventor); Sheinin, Vadim (Inventor); Jagmohan, Ashish (Inventor); Lu, Ligang (Inventor)

2012-01-01

Disclosed are a method and system for video compression, wherein the video encoder has low computational complexity and high compression efficiency. The disclosed system comprises a video encoder and a video decoder, wherein the method for encoding includes the steps of converting a source frame into a space-frequency representation; estimating conditional statistics of at least one vector of space-frequency coefficients; estimating encoding rates based on the said conditional statistics; and applying Slepian-Wolf codes with the said computed encoding rates. The preferred method for decoding includes the steps of; generating a side-information vector of frequency coefficients based on previously decoded source data, encoder statistics, and previous reconstructions of the source frequency vector; and performing Slepian-Wolf decoding of at least one source frequency vector based on the generated side-information, the Slepian-Wolf code bits and the encoder statistics.

Region of interest video coding for low bit-rate transmission of carotid ultrasound videos over 3G wireless networks.

PubMed

Tsapatsoulis, Nicolas; Loizou, Christos; Pattichis, Constantinos

2007-01-01

Efficient medical video transmission over 3G wireless is of great importance for fast diagnosis and on site medical staff training purposes. In this paper we present a region of interest based ultrasound video compression study which shows that significant reduction of the required, for transmission, bit rate can be achieved without altering the design of existing video codecs. Simple preprocessing of the original videos to define visually and clinically important areas is the only requirement.

Quantifying the physical demands of collision sports: does microsensor technology measure what it claims to measure?

PubMed

Gabbett, Tim J

2013-08-01

The physical demands of rugby league, rugby union, and American football are significantly increased through the large number of collisions players are required to perform during match play. Because of the labor-intensive nature of coding collisions from video recordings, manufacturers of wearable microsensor (e.g., global positioning system [GPS]) units have refined the technology to automatically detect collisions, with several sport scientists attempting to use these microsensors to quantify the physical demands of collision sports. However, a question remains over the validity of these microtechnology units to quantify the contact demands of collision sports. Indeed, recent evidence has shown significant differences in the number of "impacts" recorded by microtechnology units (GPSports) and the actual number of collisions coded from video. However, a separate study investigated the validity of a different microtechnology unit (minimaxX; Catapult Sports) that included GPS and triaxial accelerometers, and also a gyroscope and magnetometer, to quantify collisions. Collisions detected by the minimaxX unit were compared with video-based coding of the actual events. No significant differences were detected in the number of mild, moderate, and heavy collisions detected via the minimaxX units and those coded from video recordings of the actual event. Furthermore, a strong correlation (r = 0.96, p < 0.01) was observed between collisions recorded via the minimaxX units and those coded from video recordings of the event. These findings demonstrate that only one commercially available and wearable microtechnology unit (minimaxX) can be considered capable of offering a valid method of quantifying the contact loads that typically occur in collision sports. Until such validation research is completed, sport scientists should be circumspect of the ability of other units to perform similar functions.

Feasibility of video codec algorithms for software-only playback

NASA Astrophysics Data System (ADS)

Rodriguez, Arturo A.; Morse, Ken

1994-05-01

Software-only video codecs can provide good playback performance in desktop computers with a 486 or 68040 CPU running at 33 MHz without special hardware assistance. Typically, playback of compressed video can be categorized into three tasks: the actual decoding of the video stream, color conversion, and the transfer of decoded video data from system RAM to video RAM. By current standards, good playback performance is the decoding and display of video streams of 320 by 240 (or larger) compressed frames at 15 (or greater) frames-per- second. Software-only video codecs have evolved by modifying and tailoring existing compression methodologies to suit video playback in desktop computers. In this paper we examine the characteristics used to evaluate software-only video codec algorithms, namely: image fidelity (i.e., image quality), bandwidth (i.e., compression) ease-of-decoding (i.e., playback performance), memory consumption, compression to decompression asymmetry, scalability, and delay. We discuss the tradeoffs among these variables and the compromises that can be made to achieve low numerical complexity for software-only playback. Frame- differencing approaches are described since software-only video codecs typically employ them to enhance playback performance. To complement other papers that appear in this session of the Proceedings, we review methods derived from binary pattern image coding since these methods are amenable for software-only playback. In particular, we introduce a novel approach called pixel distribution image coding.

From Video to Photo

NASA Technical Reports Server (NTRS)

2004-01-01

Ever wonder whether a still shot from a home video could serve as a "picture perfect" photograph worthy of being framed and proudly displayed on the mantle? Wonder no more. A critical imaging code used to enhance video footage taken from spaceborne imaging instruments is now available within a portable photography tool capable of producing an optimized, high-resolution image from multiple video frames.

Quality Scalability Aware Watermarking for Visual Content.

PubMed

Bhowmik, Deepayan; Abhayaratne, Charith

2016-11-01

Scalable coding-based content adaptation poses serious challenges to traditional watermarking algorithms, which do not consider the scalable coding structure and hence cannot guarantee correct watermark extraction in media consumption chain. In this paper, we propose a novel concept of scalable blind watermarking that ensures more robust watermark extraction at various compression ratios while not effecting the visual quality of host media. The proposed algorithm generates scalable and robust watermarked image code-stream that allows the user to constrain embedding distortion for target content adaptations. The watermarked image code-stream consists of hierarchically nested joint distortion-robustness coding atoms. The code-stream is generated by proposing a new wavelet domain blind watermarking algorithm guided by a quantization based binary tree. The code-stream can be truncated at any distortion-robustness atom to generate the watermarked image with the desired distortion-robustness requirements. A blind extractor is capable of extracting watermark data from the watermarked images. The algorithm is further extended to incorporate a bit-plane discarding-based quantization model used in scalable coding-based content adaptation, e.g., JPEG2000. This improves the robustness against quality scalability of JPEG2000 compression. The simulation results verify the feasibility of the proposed concept, its applications, and its improved robustness against quality scalable content adaptation. Our proposed algorithm also outperforms existing methods showing 35% improvement. In terms of robustness to quality scalable video content adaptation using Motion JPEG2000 and wavelet-based scalable video coding, the proposed method shows major improvement for video watermarking.

The Impact of Video Review on Supervisory Conferencing

ERIC Educational Resources Information Center

Baecher, Laura; McCormack, Bede

2015-01-01

This study investigated how video-based observation may alter the nature of post-observation talk between supervisors and teacher candidates. Audio-recorded post-observation conversations were coded using a conversation analysis framework and interpreted through the lens of interactional sociology. Findings suggest that video-based observations…

Combined Wavelet Video Coding and Error Control for Internet Streaming and Multicast

NASA Astrophysics Data System (ADS)

Chu, Tianli; Xiong, Zixiang

2003-12-01

This paper proposes an integrated approach to Internet video streaming and multicast (e.g., receiver-driven layered multicast (RLM) by McCanne) based on combined wavelet video coding and error control. We design a packetized wavelet video (PWV) coder to facilitate its integration with error control. The PWV coder produces packetized layered bitstreams that are independent among layers while being embedded within each layer. Thus, a lost packet only renders the following packets in the same layer useless. Based on the PWV coder, we search for a multilayered error-control strategy that optimally trades off source and channel coding for each layer under a given transmission rate to mitigate the effects of packet loss. While both the PWV coder and the error-control strategy are new—the former incorporates embedded wavelet video coding and packetization and the latter extends the single-layered approach for RLM by Chou et al.—the main distinction of this paper lies in the seamless integration of the two parts. Theoretical analysis shows a gain of up to 1 dB on a channel with 20% packet loss using our combined approach over separate designs of the source coder and the error-control mechanism. This is also substantiated by our simulations with a gain of up to 0.6 dB. In addition, our simulations show a gain of up to 2.2 dB over previous results reported by Chou et al.

Compression performance comparison in low delay real-time video for mobile applications

NASA Astrophysics Data System (ADS)

Bivolarski, Lazar

2012-10-01

This article compares the performance of several current video coding standards in the conditions of low-delay real-time in a resource constrained environment. The comparison is performed using the same content and the metrics and mix of objective and perceptual quality metrics. The metrics results in different coding schemes are analyzed from a point of view of user perception and quality of service. Multiple standards are compared MPEG-2, MPEG4 and MPEG-AVC and well and H.263. The metrics used in the comparison include SSIM, VQM and DVQ. Subjective evaluation and quality of service are discussed from a point of view of perceptual metrics and their incorporation in the coding scheme development process. The performance and the correlation of results are presented as a predictor of the performance of video compression schemes.

MATIN: A Random Network Coding Based Framework for High Quality Peer-to-Peer Live Video Streaming

PubMed Central

Barekatain, Behrang; Khezrimotlagh, Dariush; Aizaini Maarof, Mohd; Ghaeini, Hamid Reza; Salleh, Shaharuddin; Quintana, Alfonso Ariza; Akbari, Behzad; Cabrera, Alicia Triviño

2013-01-01

In recent years, Random Network Coding (RNC) has emerged as a promising solution for efficient Peer-to-Peer (P2P) video multicasting over the Internet. This probably refers to this fact that RNC noticeably increases the error resiliency and throughput of the network. However, high transmission overhead arising from sending large coefficients vector as header has been the most important challenge of the RNC. Moreover, due to employing the Gauss-Jordan elimination method, considerable computational complexity can be imposed on peers in decoding the encoded blocks and checking linear dependency among the coefficients vectors. In order to address these challenges, this study introduces MATIN which is a random network coding based framework for efficient P2P video streaming. The MATIN includes a novel coefficients matrix generation method so that there is no linear dependency in the generated coefficients matrix. Using the proposed framework, each peer encapsulates one instead of n coefficients entries into the generated encoded packet which results in very low transmission overhead. It is also possible to obtain the inverted coefficients matrix using a bit number of simple arithmetic operations. In this regard, peers sustain very low computational complexities. As a result, the MATIN permits random network coding to be more efficient in P2P video streaming systems. The results obtained from simulation using OMNET++ show that it substantially outperforms the RNC which uses the Gauss-Jordan elimination method by providing better video quality on peers in terms of the four important performance metrics including video distortion, dependency distortion, End-to-End delay and Initial Startup delay. PMID:23940530

Automated comprehensive Adolescent Idiopathic Scoliosis assessment using MVC-Net.

PubMed

Wu, Hongbo; Bailey, Chris; Rasoulinejad, Parham; Li, Shuo

2018-05-18

Automated quantitative estimation of spinal curvature is an important task for the ongoing evaluation and treatment planning of Adolescent Idiopathic Scoliosis (AIS). It solves the widely accepted disadvantage of manual Cobb angle measurement (time-consuming and unreliable) which is currently the gold standard for AIS assessment. Attempts have been made to improve the reliability of automated Cobb angle estimation. However, it is very challenging to achieve accurate and robust estimation of Cobb angles due to the need for correctly identifying all the required vertebrae in both Anterior-posterior (AP) and Lateral (LAT) view x-rays. The challenge is especially evident in LAT x-ray where occlusion of vertebrae by the ribcage occurs. We therefore propose a novel Multi-View Correlation Network (MVC-Net) architecture that can provide a fully automated end-to-end framework for spinal curvature estimation in multi-view (both AP and LAT) x-rays. The proposed MVC-Net uses our newly designed multi-view convolution layers to incorporate joint features of multi-view x-rays, which allows the network to mitigate the occlusion problem by utilizing the structural dependencies of the two views. The MVC-Net consists of three closely-linked components: (1) a series of X-modules for joint representation of spinal structure (2) a Spinal Landmark Estimator network for robust spinal landmark estimation, and (3) a Cobb Angle Estimator network for accurate Cobb Angles estimation. By utilizing an iterative multi-task training algorithm to train the Spinal Landmark Estimator and Cobb Angle Estimator in tandem, the MVC-Net leverages the multi-task relationship between landmark and angle estimation to reliably detect all the required vertebrae for accurate Cobb angles estimation. Experimental results on 526 x-ray images from 154 patients show an impressive 4.04° Circular Mean Absolute Error (CMAE) in AP Cobb angle and 4.07° CMAE in LAT Cobb angle estimation, which demonstrates the MVC-Net's capability of robust and accurate estimation of Cobb angles in multi-view x-rays. Our method therefore provides clinicians with a framework for efficient, accurate, and reliable estimation of spinal curvature for comprehensive AIS assessment. Copyright © 2018. Published by Elsevier B.V.

Genotypic tropism testing of proviral DNA to guide maraviroc initiation in aviraemic subjects: 48-week analysis of results from the PROTEST study.

PubMed

Poveda, E; Hernández-Quero, J; Pérez-Elías, M J; Ribas, M A; Martínez-Madrid, O J; Flores, J; Navarro, J; Gutiérrez, F; García-Deltoro, M; Imaz, A; Ocampo, A; Artero, A; Blanco, F; Bernal, E; Pasquau, J; Mínguez-Gallego, C; Pérez, N; Aiestaran, A; García, F; Paredes, R

2017-08-01

Maraviroc (MVC) is a suitable drug for aviraemic subjects on antiretroviral treatment (ART) developing toxicity. Its prescription requires prior tropism testing. It is unknown if proviral DNA genotypic tropism testing is reliable for guiding MVC initiation in aviraemic subjects, so this study was carried out to address this issue. PROTEST was a phase 4, prospective, single-arm clinical trial carried out in 24 HIV care centres in Spain. MVC-naïve HIV-1-infected patients with HIV-1 RNA < 50 copies/mL on stable ART during the previous 6 months who required an ART change because of toxicity and who had R5 HIV, as determined by proviral DNA genotypic tropism testing, initiated MVC with two nucleoside reverse transcriptase inhibitors (NRTIs) and were followed for 48 weeks. Virological failure was defined as two consecutive viral load measurements > 50 copies/mL. Tropism results were available for 141 of 175 (80.6%) subjects screened: 60% had R5 and 85% of these (n = 74) were finally included in the study. Previous ART included protease inhibitors (PIs) in 62% of subjects, nonnucleoside reverse transcriptase inhibitors (NNRTIs) in 36%, and integrase inhibitors (INIs) in 2%. Main reasons for treatment change were dyslipidaemia (42%), gastrointestinal symptoms (22%) and liver toxicity (15%). MVC was given alongside tenofovir (TDF)/emtricitabine (FTC) (54%) and abacavir (ABC)/lamivudine (3TC) (40%) in most patients. Eighty-four per cent of patients maintained a viral load < 50 copies/mL to week 48, whereas 16% discontinued treatment: two withdrew informed consent, one had an R5 to X4 shift between screening and baseline, one was lost to follow-up, one developed an adverse event (rash), two died from non-study-related causes, and five developed protocol-defined virological failure. Initiation of MVC plus two NRTIs in aviraemic subjects based on genotypic tropism testing of proviral HIV-1 DNA is associated with low rates of virological failure for up to 1 year. © 2016 British HIV Association.

Development of MPEG standards for 3D and free viewpoint video

NASA Astrophysics Data System (ADS)

Smolic, Aljoscha; Kimata, Hideaki; Vetro, Anthony

2005-11-01

An overview of 3D and free viewpoint video is given in this paper with special focus on related standardization activities in MPEG. Free viewpoint video allows the user to freely navigate within real world visual scenes, as known from virtual worlds in computer graphics. Suitable 3D scene representation formats are classified and the processing chain is explained. Examples are shown for image-based and model-based free viewpoint video systems, highlighting standards conform realization using MPEG-4. Then the principles of 3D video are introduced providing the user with a 3D depth impression of the observed scene. Example systems are described again focusing on their realization based on MPEG-4. Finally multi-view video coding is described as a key component for 3D and free viewpoint video systems. MPEG is currently working on a new standard for multi-view video coding. The conclusion is that the necessary technology including standard media formats for 3D and free viewpoint is available or will be available in the near future, and that there is a clear demand from industry and user side for such applications. 3DTV at home and free viewpoint video on DVD will be available soon, and will create huge new markets.

Intra Frame Coding In Advanced Video Coding Standard (H.264) to Obtain Consistent PSNR and Reduce Bit Rate for Diagonal Down Left Mode Using Gaussian Pulse

NASA Astrophysics Data System (ADS)

Manjanaik, N.; Parameshachari, B. D.; Hanumanthappa, S. N.; Banu, Reshma

2017-08-01

Intra prediction process of H.264 video coding standard used to code first frame i.e. Intra frame of video to obtain good coding efficiency compare to previous video coding standard series. More benefit of intra frame coding is to reduce spatial pixel redundancy with in current frame, reduces computational complexity and provides better rate distortion performance. To code Intra frame it use existing process Rate Distortion Optimization (RDO) method. This method increases computational complexity, increases in bit rate and reduces picture quality so it is difficult to implement in real time applications, so the many researcher has been developed fast mode decision algorithm for coding of intra frame. The previous work carried on Intra frame coding in H.264 standard using fast decision mode intra prediction algorithm based on different techniques was achieved increased in bit rate, degradation of picture quality(PSNR) for different quantization parameters. Many previous approaches of fast mode decision algorithms on intra frame coding achieved only reduction of computational complexity or it save encoding time and limitation was increase in bit rate with loss of quality of picture. In order to avoid increase in bit rate and loss of picture quality a better approach was developed. In this paper developed a better approach i.e. Gaussian pulse for Intra frame coding using diagonal down left intra prediction mode to achieve higher coding efficiency in terms of PSNR and bitrate. In proposed method Gaussian pulse is multiplied with each 4x4 frequency domain coefficients of 4x4 sub macro block of macro block of current frame before quantization process. Multiplication of Gaussian pulse for each 4x4 integer transformed coefficients at macro block levels scales the information of the coefficients in a reversible manner. The resulting signal would turn abstract. Frequency samples are abstract in a known and controllable manner without intermixing of coefficients, it avoids picture getting bad hit for higher values of quantization parameters. The proposed work was implemented using MATLAB and JM 18.6 reference software. The proposed work measure the performance parameters PSNR, bit rate and compression of intra frame of yuv video sequences in QCIF resolution under different values of quantization parameter with Gaussian value for diagonal down left intra prediction mode. The simulation results of proposed algorithm are tabulated and compared with previous algorithm i.e. Tian et al method. The proposed algorithm achieved reduced in bit rate averagely 30.98% and maintain consistent picture quality for QCIF sequences compared to previous algorithm i.e. Tian et al method.

A hardware-oriented concurrent TZ search algorithm for High-Efficiency Video Coding

NASA Astrophysics Data System (ADS)

Doan, Nghia; Kim, Tae Sung; Rhee, Chae Eun; Lee, Hyuk-Jae

2017-12-01

High-Efficiency Video Coding (HEVC) is the latest video coding standard, in which the compression performance is double that of its predecessor, the H.264/AVC standard, while the video quality remains unchanged. In HEVC, the test zone (TZ) search algorithm is widely used for integer motion estimation because it effectively searches the good-quality motion vector with a relatively small amount of computation. However, the complex computation structure of the TZ search algorithm makes it difficult to implement it in the hardware. This paper proposes a new integer motion estimation algorithm which is designed for hardware execution by modifying the conventional TZ search to allow parallel motion estimations of all prediction unit (PU) partitions. The algorithm consists of the three phases of zonal, raster, and refinement searches. At the beginning of each phase, the algorithm obtains the search points required by the original TZ search for all PU partitions in a coding unit (CU). Then, all redundant search points are removed prior to the estimation of the motion costs, and the best search points are then selected for all PUs. Compared to the conventional TZ search algorithm, experimental results show that the proposed algorithm significantly decreases the Bjøntegaard Delta bitrate (BD-BR) by 0.84%, and it also reduces the computational complexity by 54.54%.

Side-information-dependent correlation channel estimation in hash-based distributed video coding.

PubMed

Deligiannis, Nikos; Barbarien, Joeri; Jacobs, Marc; Munteanu, Adrian; Skodras, Athanassios; Schelkens, Peter

2012-04-01

In the context of low-cost video encoding, distributed video coding (DVC) has recently emerged as a potential candidate for uplink-oriented applications. This paper builds on a concept of correlation channel (CC) modeling, which expresses the correlation noise as being statistically dependent on the side information (SI). Compared with classical side-information-independent (SII) noise modeling adopted in current DVC solutions, it is theoretically proven that side-information-dependent (SID) modeling improves the Wyner-Ziv coding performance. Anchored in this finding, this paper proposes a novel algorithm for online estimation of the SID CC parameters based on already decoded information. The proposed algorithm enables bit-plane-by-bit-plane successive refinement of the channel estimation leading to progressively improved accuracy. Additionally, the proposed algorithm is included in a novel DVC architecture that employs a competitive hash-based motion estimation technique to generate high-quality SI at the decoder. Experimental results corroborate our theoretical gains and validate the accuracy of the channel estimation algorithm. The performance assessment of the proposed architecture shows remarkable and consistent coding gains over a germane group of state-of-the-art distributed and standard video codecs, even under strenuous conditions, i.e., large groups of pictures and highly irregular motion content.

Distributed Coding/Decoding Complexity in Video Sensor Networks

PubMed Central

Cordeiro, Paulo J.; Assunção, Pedro

2012-01-01

Video Sensor Networks (VSNs) are recent communication infrastructures used to capture and transmit dense visual information from an application context. In such large scale environments which include video coding, transmission and display/storage, there are several open problems to overcome in practical implementations. This paper addresses the most relevant challenges posed by VSNs, namely stringent bandwidth usage and processing time/power constraints. In particular, the paper proposes a novel VSN architecture where large sets of visual sensors with embedded processors are used for compression and transmission of coded streams to gateways, which in turn transrate the incoming streams and adapt them to the variable complexity requirements of both the sensor encoders and end-user decoder terminals. Such gateways provide real-time transcoding functionalities for bandwidth adaptation and coding/decoding complexity distribution by transferring the most complex video encoding/decoding tasks to the transcoding gateway at the expense of a limited increase in bit rate. Then, a method to reduce the decoding complexity, suitable for system-on-chip implementation, is proposed to operate at the transcoding gateway whenever decoders with constrained resources are targeted. The results show that the proposed method achieves good performance and its inclusion into the VSN infrastructure provides an additional level of complexity control functionality. PMID:22736972

Distributed coding/decoding complexity in video sensor networks.

PubMed

Cordeiro, Paulo J; Assunção, Pedro

2012-01-01

Video Sensor Networks (VSNs) are recent communication infrastructures used to capture and transmit dense visual information from an application context. In such large scale environments which include video coding, transmission and display/storage, there are several open problems to overcome in practical implementations. This paper addresses the most relevant challenges posed by VSNs, namely stringent bandwidth usage and processing time/power constraints. In particular, the paper proposes a novel VSN architecture where large sets of visual sensors with embedded processors are used for compression and transmission of coded streams to gateways, which in turn transrate the incoming streams and adapt them to the variable complexity requirements of both the sensor encoders and end-user decoder terminals. Such gateways provide real-time transcoding functionalities for bandwidth adaptation and coding/decoding complexity distribution by transferring the most complex video encoding/decoding tasks to the transcoding gateway at the expense of a limited increase in bit rate. Then, a method to reduce the decoding complexity, suitable for system-on-chip implementation, is proposed to operate at the transcoding gateway whenever decoders with constrained resources are targeted. The results show that the proposed method achieves good performance and its inclusion into the VSN infrastructure provides an additional level of complexity control functionality.

A robust low-rate coding scheme for packet video

NASA Technical Reports Server (NTRS)

Chen, Y. C.; Sayood, Khalid; Nelson, D. J.; Arikan, E. (Editor)

1991-01-01

Due to the rapidly evolving field of image processing and networking, video information promises to be an important part of telecommunication systems. Although up to now video transmission has been transported mainly over circuit-switched networks, it is likely that packet-switched networks will dominate the communication world in the near future. Asynchronous transfer mode (ATM) techniques in broadband-ISDN can provide a flexible, independent and high performance environment for video communication. For this paper, the network simulator was used only as a channel in this simulation. Mixture blocking coding with progressive transmission (MBCPT) has been investigated for use over packet networks and has been found to provide high compression rate with good visual performance, robustness to packet loss, tractable integration with network mechanics and simplicity in parallel implementation.

Strength Gains by Motor Imagery with Different Ratios of Physical to Mental Practice

PubMed Central

Reiser, Mathias; Büsch, Dirk; Munzert, Jörn

2011-01-01

The purpose of this training study was to determine the magnitude of strength gains following a high-intensity resistance training (i.e., improvement of neuromuscular coordination) that can be achieved by imagery of the respective muscle contraction imagined maximal isometric contraction (IMC training). Prior to the experimental intervention, subjects completed a 4-week standardized strength training program. 3 groups with different combinations of real maximum voluntary contraction (MVC) and mental (IMC) strength training (M75, M50, M25; numbers indicate percentages of mental trials) were compared to a MVC-only training group (M0) and a control condition without strength training (CO). Training sessions (altogether 12) consisted of four sets of two maximal 5-s isometric contractions with 10 s rest between sets of either MVC or IMC training. Task-specific effects of IMC training were tested in four strength exercises commonly used in practical settings (bench pressing, leg pressing, triceps extension, and calf raising). Maximum isometric voluntary contraction force (MVC) was measured before and after the experimental training intervention and again 1 week after cessation of the program. IMC groups (M25, M50, M75) showed slightly smaller increases in MVC (3.0% to 4.2%) than M0 (5.1%), but significantly stronger improvements than CO (−0.2%). Compared to further strength gains in M0 after 1 week (9.4% altogether), IMC groups showed no “delayed” improvement, but the attained training effects remained stable. It is concluded that high-intensity strength training sessions can be partly replaced by IMC training sessions without any considerable reduction of strength gains. PMID:21897826

Relationship between isometric contraction intensity and muscle hardness assessed by ultrasound strain elastography.

PubMed

Inami, Takayuki; Tsujimura, Toru; Shimizu, Takuya; Watanabe, Takemasa; Lau, Wing Yin; Nosaka, Kazunori

2017-05-01

Ultrasound elastography is used to assess muscle hardness or stiffness; however, no previous studies have validated muscle hardness measures using ultrasound strain elastography (SE). This study investigated the relationship between plantar flexor isometric contraction intensity and gastrocnemius hardness assessed by SE. We hypothesised that the muscle would become harder linearly with an increase in the contraction intensity of the plantar flexors. Fifteen young women (20.1 ± 0.8 years) performed isometric contractions of the ankle plantar flexors at four different intensities (25, 50, 75, 100% of maximal voluntary contraction force: MVC) at 0° plantar flexion. Using SE images, the strain ratio (SR) between the muscle and an acoustic coupler (elastic modulus 22.6 kPa) placed over the skin was calculated (muscle/coupler); pennation angle and muscle thickness were measured for the resting and contracting conditions. SR decreased with increasing contraction intensity from rest (1.28 ± 0.20) to 25% (0.99 ± 0.21), 50% (0.61 ± 0.15), 75% (0.34 ± 0.1) and 100% MVC (0.20 ± 0.05). SR decreased linearly (P < 0.05) with increasing MVC from rest to 75% MVC, but levelled off from 75 and 100% MVC. SR was negatively correlated with pennation angle (r = -0.80, P < 0.01) and muscle thickness ( r= -0.78,  P< 0.01). SR appears to represent muscle hardness changes in response to contraction intensity changes, in the assumption that the gastrocnemius muscle contraction intensity is proportional to the plantar flexion intensity. We concluded that gastrocnemius muscle hardness changes could be validly assessed by SR, and the force-hardness relationship was not linear.

Changes in Achilles tendon moment arm from rest to maximum isometric plantarflexion: in vivo observations in man

PubMed Central

Maganaris, Constantinos N; Baltzopoulos, Vasilios; Sargeant, Anthony J

1998-01-01

The purpose of the present study was to examine the effect of a plantarflexor maximum voluntary contraction (MVC) on Achilles tendon moment arm length. Sagittal magnetic resonance (MR) images of the right ankle were taken in six subjects both at rest and during a plantarflexor MVC in the supine position at a knee angle of 90 deg and at ankle angles of -30 deg (dorsiflexed direction), -15 deg, 0 deg (neutral ankle position), +15 deg (plantarflexed direction), +30 deg and +45 deg. A system of mechanical stops, support triangles and velcro straps was used to secure the subject in the above positions. Location of a moving centre of rotation was calculated for ankle rotations from -30 to 0 deg, -15 to +15 deg, 0 to +30 deg and +15 to +45 deg. All instant centres of rotation were calculated both at rest and during MVC. Achilles tendon moment arms were measured at ankle angles of -15, 0, +15 and +30 deg. At any given ankle angle, Achilles tendon moment arm length during MVC increased by 1-1.5 cm (22-27%, P < 0.01) compared with rest. This was attributed to a displacement of both Achilles tendon by 0.6-1.1 cm (P < 0.01) and all instant centres of rotation by about 0.3 cm (P < 0.05) away from their corresponding resting positions. The findings of this study have important implications for estimating loads in the musculoskeletal system. Substantially unrealistic Achilles tendon forces and moments generated around the ankle joint during a plantarflexor MVC would be calculated using resting Achilles tendon moment arm measurements. PMID:9660906

Changes in Achilles tendon moment arm from rest to maximum isometric plantarflexion: in vivo observations in man.

PubMed

Maganaris, C N; Baltzopoulos, V; Sargeant, A J

1998-08-01

1. The purpose of the present study was to examine the effect of a plantarflexor maximum voluntary contraction (MVC) on Achilles tendon moment arm length. 2. Sagittal magnetic resonance (MR) images of the right ankle were taken in six subjects both at rest and during a plantarflexor MVC in the supine position at a knee angle of 90 deg and at ankle angles of -30 deg (dorsiflexed direction), -15 deg, 0 deg (neutral ankle position), +15 deg (plantarflexed direction), +30 deg and +45 deg. A system of mechanical stops, support triangles and velcro straps was used to secure the subject in the above positions. Location of a moving centre of rotation was calculated for ankle rotations from -30 to 0 deg, -15 to +15 deg, 0 to +30 deg and +15 to +45 deg. All instant centres of rotation were calculated both at rest and during MVC. Achilles tendon moment arms were measured at ankle angles of -15, 0, +15 and +30 deg. 3. At any given ankle angle, Achilles tendon moment arm length during MVC increased by 1-1.5 cm (22-27 %, P < 0.01) compared with rest. This was attributed to a displacement of both Achilles tendon by 0.6-1.1 cm (P < 0.01) and all instant centres of rotation by about 0.3 cm (P < 0.05) away from their corresponding resting positions. 4. The findings of this study have important implications for estimating loads in the musculoskeletal system. Substantially unrealistic Achilles tendon forces and moments generated around the ankle joint during a plantarflexor MVC would be calculated using resting Achilles tendon moment arm measurements.

On the radiobiological impact of metal artifacts in head-and-neck IMRT in terms of tumor control probability (TCP) and normal tissue complication probability (NTCP).

PubMed

Kim, Yusung; Tomé, Wolfgang A

2007-11-01

To investigate the effects of distorted head-and-neck (H&N) intensity-modulated radiation therapy (IMRT) dose distributions (hot and cold spots) on normal tissue complication probability (NTCP) and tumor control probability (TCP) due to dental-metal artifacts. Five patients' IMRT treatment plans have been analyzed, employing five different planning image data-sets: (a) uncorrected (UC); (b) homogeneous uncorrected (HUC); (c) sinogram completion corrected (SCC); (d) minimum-value-corrected (MVC); and (e) streak-artifact-reduction including minimum-value-correction (SAR-MVC), which has been taken as the reference data-set. The effects on NTCP and TCP were evaluated using the Lyman-NTCP model and the Logistic-TCP model, respectively. When compared to the predicted NTCP obtained using the reference data-set, the treatment plan based on the original CT data-set (UC) yielded an increase in NTCP of 3.2 and 2.0% for the spared parotid gland and the spinal cord, respectively. While for the treatment plans based on the MVC CT data-set the NTCP increased by a 1.1% and a 0.1% for the spared parotid glands and the spinal cord, respectively. In addition, the MVC correction method showed a reduction in TCP for target volumes (MVC: delta TCP = -0.6% vs. UC: delta TCP = -1.9%) with respect to that of the reference CT data-set. Our results indicate that the presence of dental-metal-artifacts in H&N planning CT data-sets has an impact on the estimates of TCP and NTCP. In particular dental-metal-artifacts lead to an increase in NTCP for the spared parotid glands and a slight decrease in TCP for target volumes.

A Maraviroc-Resistant HIV-1 with Narrow Cross-Resistance to Other CCR5 Antagonists Depends on both N-Terminal and Extracellular Loop Domains of Drug-Bound CCR5▿

PubMed Central

Tilton, John C.; Wilen, Craig B.; Didigu, Chukwuka A.; Sinha, Rohini; Harrison, Jessamina E.; Agrawal-Gamse, Caroline; Henning, Elizabeth A.; Bushman, Frederick D.; Martin, Jeffrey N.; Deeks, Steven G.; Doms, Robert W.

2010-01-01

CCR5 antagonists inhibit HIV entry by binding to a coreceptor and inducing changes in the extracellular loops (ECLs) of CCR5. In this study, we analyzed viruses from 11 treatment-experienced patients who experienced virologic failure on treatment regimens containing the CCR5 antagonist maraviroc (MVC). Viruses from one patient developed high-level resistance to MVC during the course of treatment. Although resistance to one CCR5 antagonist is often associated with broad cross-resistance to other agents, these viruses remained sensitive to most other CCR5 antagonists, including vicriviroc and aplaviroc. MVC resistance was dependent upon mutations within the V3 loop of the viral envelope (Env) protein and was modulated by additional mutations in the V4 loop. Deep sequencing of pretreatment plasma viral RNA indicated that resistance appears to have occurred by evolution of drug-bound CCR5 use, despite the presence of viral sequences predictive of CXCR4 use. Envs obtained from this patient before and during MVC treatment were able to infect cells expressing very low CCR5 levels, indicating highly efficient use of a coreceptor. In contrast to previous reports in which CCR5 antagonist-resistant viruses interact predominantly with the N terminus of CCR5, these MVC-resistant Envs were also dependent upon the drug-modified ECLs of CCR5 for entry. Our results suggest a model of CCR5 cross-resistance whereby viruses that predominantly utilize the N terminus are broadly cross-resistant to multiple CCR5 antagonists, whereas viruses that require both the N terminus and antagonist-specific ECL changes demonstrate a narrow cross-resistance profile. PMID:20702642

Under the influence with a child in the car: implications for child safety and caregiver intervention.

PubMed

Lawson, Karla A; Yuma-Guerrero, Paula J; von Sternberg, Kirk; Duzinski, Sarah V; Garcia, Nilda M; Brown, Carlos V; Wakefield, Sarah M; Crawford, Natalie M; Velasquez, Mary M; Maxson, R Todd

2011-11-01

Injury is the leading cause of death for those aged 1 year to 44 years in the United States, with motor vehicle collisions (MVCs) the leading cause of injury-related deaths. Little data exist on the relationship between caregiver alcohol and drug use at the time of MVC and child passenger outcomes. We examined the relationship between caregiver substance use in MVCs and a number of demographic, crash severity, and medical outcomes for caregivers and children. We identified family groups treated in the emergency department of a regional Level II trauma center after an MVC in a 1-year period from July 1, 2005, to June 30, 2006. The distribution and means of characteristics for substance and nonsubstance users were compared using χ analysis and Student's t tests, respectively. One in 10 vehicles contained an intoxicated caregiver at the time of MVC. In 363 identified caregivers, intoxication was associated with being male (p < 0.001), lack of safety device use (p = 0.003), rollover (p = 0.008), and ejection (p = 0.016). In the 278 family groups, intoxicated caregivers were related to child ejection (p = 0.009), the need for child hospital admission (p < 0.001), and driver intoxication was related to child lack of restraint (p = 0.045). These findings suggest a substantial number of child MVC victims arrive at the emergency room after riding with an intoxicated caregiver. Findings support the need for prevention programs focusing on substance use and driving for male caregivers, and further investigation on the need for screening and intervention for caregivers' risky alcohol and drug use after a child's MVC.

Properties of tonic episodes of masseter muscle activity during waking hours and sleep in subjects with and without history of orofacial pain.

PubMed

Mude, Acing Habibie; Kawakami, Shigehisa; Kato, Seiya; Minagi, Shogo

2018-04-01

To provide a scientific data related to the tonic activity of masseter muscle in subjects with and without history of orofacial pain during their normal daily life. Thirty-three subjects were divided into two groups, a pain history group (PHG) and a non-pain history group (non-PHG), based on their responses to the Research Diagnostic Criteria for Temporomandibular Disorders questionnaire. After excluding four subjects with incomplete recordings, full-day masseter muscle surface EMGs of 29 subjects (10 men, 19 women; mean age 24.1 years) were analyzed. Tonic episode (TE) was defined as continuous EMG activity with a duration at least 2s with intensities above twice the baseline noise level. TEs were classified into 6 strength categories (<7.5%, 7.5-10%, 10-15%, 15-25%, 25-40% and >40% of the maximum voluntary clenching (MVC)). The mean duration of activity observed in the non-PHG+2 SD was adopted as a cutoff for identifying sustained TE. During waking hours, the incidence of sustained TEs was significantly higher in the PHG than in the non-PHG (p<0.05). The incidence and total duration of sustained TEs were significantly higher in the PHG than in the non-PHG at intensities of 7.5-10% MVC, 10-15% MVC, and 15-25% MVC (p<0.05). No significant difference was observed during sleep. Within the limitations of this study, it would be concluded that sustained TEs may have a correlation with orofacial pain and the intensity range of 7.5-25% MVC would be an important range for future clenching studies. Copyright © 2017. Published by Elsevier Ltd.

Cold water immersion recovery following intermittent-sprint exercise in the heat.

PubMed

Pointon, Monique; Duffield, Rob; Cannon, Jack; Marino, Frank E

2012-07-01

This study examined the effects of cold water immersion (CWI) on recovery of neuromuscular function following simulated team-sport exercise in the heat. Ten male team-sport athletes performed two sessions of a 2 × 30-min intermittent-sprint exercise (ISE) in 32°C and 52% humidity, followed by a 20-min CWI intervention or passive recovery (CONT) in a randomized, crossover design. The ISE involved a 15-m sprint every minute separated by bouts of hard running, jogging and walking. Voluntary and evoked neuromuscular function, ratings of perceived muscle soreness (MS) and blood markers for muscle damage were measured pre- and post-exercise, immediately post-recovery, 2-h and 24-h post-recovery. Measures of core temperature (Tcore), heart rate (HR), capillary blood and perceptions of exertion, thermal strain and thirst were also recorded at the aforementioned time points. Post-exercise maximal voluntary contraction (MVC) and activation (VA) were reduced in both conditions and remained below pre-exercise values for the 24-h recovery (P < 0.05). Increased blood markers of muscle damage were observed post-exercise in both conditions and remained elevated for the 24-h recovery period (P < 0.05). Comparative to CONT, the post-recovery rate of reduction in Tcore, HR and MS was enhanced with CWI whilst increasing MVC and VA (P < 0.05). In contrast, 24-h post-recovery MVC and activation were significantly higher in CONT compared to CWI (P = 0.05). Following exercise in the heat, CWI accelerated the reduction in thermal and cardiovascular load, and improved MVC alongside increased central activation immediately and 2-h post-recovery. However, despite improved acute recovery CWI resulted in an attenuated MVC 24-h post-recovery.

Epidemiology of alcohol and other drug use among motor vehicle crash victims admitted to a trauma center.

PubMed

Walsh, J Michael; Flegel, Ron; Cangianelli, Leo A; Atkins, Randolph; Soderstrom, Carl A; Kerns, Timothy J

2004-09-01

The objectives of this research were to (1) determine the incidence and prevalence of alcohol and other drug use among motor vehicle crash (MVC) victims admitted to a regional Level-I trauma center, and (2) to examine the utility of using a rapid point-of-collection (POC) drug-testing device to identify MVC patients with drug involvement. Blood and urine specimens were routinely collected per clinical protocol for each MVC victim at the time of admission. Blood alcohol concentration (BAC) levels were determined per standard clinical protocol. Clinical urine specimens were routinely split so that a POC drug-testing device for the detection of commonly abused drugs (Marijuana, Cocaine, Amphetamines, Methamphetamines, and Opiates) could be compared to that of the standard hospital laboratory analysis of each urine specimen (which also included Barbiturates and Benzodiazepines). In the six-month period of this study, nearly two-thirds of trauma center admissions were victims of motor vehicle crashes. During this time, blood and urine was collected from 322 MVC victims. Toxicology results indicated that 59.3% of MVC victims tested positive for either commonly abused drugs or alcohol. More patients tested positive for drug use than tested positive for alcohol, with 33.5% testing positive for drug use only, 15.8% testing positive for alcohol use only, and 9.9% testing positive for both drugs and alcohol. Less than half (45.2%) of the substance-abusing patients in this study would have been identified by an alcohol test alone. After alcohol, marijuana and benzodiazepines were the most frequently detected drugs. Point of collection (POC) test results correlated well with laboratory results and provide important information to initiate rapid intervention/treatment for substance use problems among injured patients.

High Virologic Failure Rates with Maraviroc-Based Salvage Regimens Among Indian Patients: A Preliminary Analysis-Maraviroc Effectiveness in HIV-1 Subtype C.

PubMed

Pujari, Sanjay; Gaikwad, Sunil; Bele, Vivek; Joshi, Kedar; Dabhade, Digamber

2018-01-01

There is no information on the clinical effectiveness of Maraviroc (MVC) amongst People Living with HIV (PLHIV) in India infected with HIV-1 Subtype C viruses. We conducted a retrospective chart review of adult PLHIV on MVC based Antiretroviral (ARV) regimens for at least 6 months. Maraviroc was initiated amongst PLHIV with documented R5 tropic viruses (determined by in-house population sequencing of the V3 loop in triplicate and interpreted using the Geno2Pheno algorithm) in combination with an Optimized Background regimen (designed using genotypic resistance testing and past ARV history). Plasma viral loads (PVL) are performed 6 months post-initiation and annually thereafter. Primary outcome d. Median duration on MVC treatment was 1.8 years (range 1-2.9 years) while median duration of ART prior to switching to MVC was 13 years. Maraviroc was combined with Darunavir/ritonavir (DRV/r) (n=10), Atazanavir/r (ATV/r) (n=2) and Lopinavir/r (LPV/r) (n=1). All PLHIV were infected with HIV-1 Subtype C. Only 23.3% PLHIV achieved virologic suppression at 6 months and sustained it for 2.3 years. Median CD4 count change from baseline was +117 (n=13), +228 (n=10), +253 (n=9), and +331 (n=4) at 6, 12, 18 and 24 months respectively. Repeat tropism among patients with virologic failure demonstrated R5 virus. High rates of virologic failure was seen when MVC was used amongst treatment experienced PLHIV infected with HIV-1 Subtype C in India. was the proportion of PLHIV with virologic success (PVL<50 copies/ml) at last follow up visit. Data on 13 PLHIV were analyze.

Voluntary activation of the trapezius muscle in cases with neck/shoulder pain compared to healthy controls.

PubMed

Bech, Katrine Tholstrup; Larsen, Camilla Marie; Sjøgaard, Gisela; Holtermann, Andreas; Taylor, Janet L; Søgaard, Karen

2017-10-01

Subjects reporting neck/shoulder pain have been shown to generate less force during maximal voluntary isometric contractions (MVC) of the shoulder muscles compared to healthy controls. This has been suggested to be caused by a pain-related decrease in voluntary activation (VA) rather than lack of muscle mass. The aim of the present study was to investigate VA of the trapezius muscle during MVCs in subjects with and without neck/shoulder pain by use of the twitch interpolation technique. Ten cases suffering from pain and ten age and gender matched, healthy controls were included in the study. Upper trapezius muscle thickness was measured using ultrasonography and pain intensity was measured on a 100mm visual analog scale (VAS). VA was calculated from five maximal muscle activation attempts. Superimposed stimuli were delivered to the accessory nerve at peak force and during a 2% MVC following the maximal contraction. Presented as mean±SD for cases and controls, respectively: VAS; 16.0±14.4mm and 2.1±4.1mm (P=0.004), MVC; 545±161N and 664±195N (P=0.016), upper trapezius muscle thickness; 10.9±1.9mm and 10.4±1.5mm (P=0.20), VA; 93.6±14.2% and 96.3±6.0% (P=0.29). In spite of significantly eight-fold higher pain intensity and ∼20% lower MVC for cases compared to controls, no difference was found in VA. Possible explanations for the reduction in MVC could be differences in co-activation of antagonists and synergists as well as muscle quality. Copyright © 2017 Elsevier Ltd. All rights reserved.

Obesity and non-fatal motor vehicle crash injuries: sex difference effects.

PubMed

Ma, X; Laud, P W; Pintar, F; Kim, J-E; Shih, A; Shen, W; Heymsfield, S B; Allison, D B; Zhu, S

2011-09-01

Obesity and motor vehicle crash (MVC) injuries are two parallel epidemics in the United States. An important unanswered question is whether there are sex differences in the associations between the presence of obesity and non-fatal MVC injuries. To further understand the association between obesity and non-fatal MVC injuries, particularly the sex differences in these relations. We examined this question by analyzing data from the 2003 to 2007 National Automotive Sampling System Crashworthiness Data System (NASS CDS). A total of 10,962 drivers who were aged 18 years or older and who survived frontal collision crashes were eligible for the study. Male drivers experienced a lower rate of overall non-fatal MVC injuries than did female drivers (38.1 versus 52.2%), but experienced a higher rate of severe injuries (0.7 versus 0.2%). After adjusting for change in velocity (ΔV) during the crashes, obese male drivers showed a much higher risk (logistic coefficients of body mass index (BMI) for moderate, serious and severe injury are 0.0766, 0.1470 and 0.1792, respectively; all P<0.05) of non-fatal injuries than did non-obese male drivers and these risks increased with injury severity. Non-fatal injury risks were not found to be increased in obese female drivers. The association between obesity and risk of non-fatal injury was much stronger for male drivers than for female drivers. The higher risk of non-fatal MVC injuries in obese male drivers might result from their different body shape and fat distribution compared with obese female drivers. Our findings should be considered for obesity reduction, traffic safety evaluation and vehicle design for obese male drivers and provide testable hypotheses for future studies.

Simultaneous Measurement of Etravirine, Maraviroc and Raltegravir in Pigtail Macaque Plasma, Vaginal Secretions and Vaginal Tissue using a LC-MS/MS Assay

PubMed Central

Blakney, Anna K.; Jiang, Yonghou; Whittington, Dale; Woodrow, Kim A.

2016-01-01

Etravirine (ETR), maraviroc (MVC) and raltegravir (RAL) are promising antiretroviral drugs being used in HIV treatment and may be interesting for prevention applications such as oral or topical pre-exposure prophylaxis. Here we describe a sensitive and accurate method for the simultaneous detection of ETR, MVC and RAL from pigtail macaque plasma, vaginal secretions, and vaginal tissue. This method is characterized by a straightforward precipitation extraction method, a limit of quantification <0.5 ng mL−1 for all three antiretrovirals bolstered by a corresponding internal standard for each drug analyte, and short run time. Quantification is performed using positive ion electrospray triple quadrupole mass spectrometry. This method was validated over clinically relevant ranges for the three ARV drugs in all three matrices: 0.1–100 ng mL−1 for ETR, 0.05–100 ng mL−1 for MVC and 1–100 ng mL−1 for RAL. Our method is accurate and precise, with measured mean inter-assay precision (%CV) and accuracy (% bias) of 5.08% and 1.96%, respectively, while the mean intra-assay precision and accuracy were 3.44% and 1.08 %. The overall post-extraction recovery for ETR, MVC and RAL was >94% in all cases. We also show that extracted biological samples are stable after storage at room temperature or 4 °C and after three freeze/thaw cycles. This is the first analytical method capable of quantifying ETR, MVC and RAL in biological matrices relevant for pre-clinical testing of oral or topical HIV prevention methods in pigtailed macaques. PMID:27236000

Differences in the motor unit firing rates and amplitudes in relation to recruitment thresholds during submaximal contractions of the first dorsal interosseous between chronically resistance trained and physically active men.

PubMed

Sterczala, Adam J; Miller, Jonathan D; Trevino, Michael A; Dimmick, Hannah L; Herda, Trent J

2018-02-26

Previous investigations report no changes in motor unit (MU) firing rates during submaximal contractions following resistance training. These investigations did not account for MU recruitment or examine firing rates as a function of recruitment threshold (REC).Therefore, MU recruitment and firing rates in chronically resistance trained (RT) and physically active controls (CON) were examined. Surface electromyography signals were collected from the first dorsal interosseous (FDI) during isometric muscle actions at 40% and 70% maximal voluntary contraction (MVC). For each MU, force at REC, mean firing rate (MFR) during the steady force, and MU action potential amplitude (MUAP_AMP) were analyzed. For each individual and contraction, the MFRs were linearly regressed against REC, whereas, exponential models were applied to the MFR vs. MUAP_AMP and MUAP_AMP vs. REC relationships with the y-intercepts and slopes (linear) and A and B terms (exponential) calculated. For the 40% MVC, the RT group had less negative slopes (p=0.001) and lower y-intercepts (p=0.006) of the MFR vs. REC relationships and lower B terms (p=0.011) of the MUAP_AMP vs. REC relationships. There were no differences in either relationship between groups for the 70% MVC. During the 40% MVC, the RT had a smaller range of MFRs and MUAP_AMPS in comparison to the CON, likely due to reduced MU recruitment. The RT had lower MFRs and recruitment during the 40% MVC that may indicate a leftward shift in the force-frequency relationship, and thus require less excitation to the motoneuron pool to match the same relative force.

Recruitment of motor units in two fascicles of the semispinalis cervicis muscle

PubMed Central

Schomacher, Jochen; Dideriksen, Jakob Lund; Farina, Dario

2012-01-01

This study investigated the behavior of motor units in the semispinalis cervicis muscle. Intramuscular EMG recordings were obtained unilaterally at levels C2 and C5 in 15 healthy volunteers (8 men, 7 women) who performed isometric neck extensions at 5%, 10%, and 20% of the maximal force [maximum voluntary contraction (MVC)] for 2 min each and linearly increasing force contractions from 0 to 30% MVC over 3 s. Individual motor unit action potentials were identified. The discharge rate and interspike interval variability of the motor units in the two locations did not differ. However, the recruitment threshold of motor units detected at C2 (n = 16, mean ± SD: 10.3 ± 6.0% MVC) was greater than that of motor units detected at C5 (n = 92, 6.9 ± 4.3% MVC) (P < 0.01). A significant level of short-term synchronization was identified in 246 of 307 motor unit pairs when computed within one spinal level but only in 28 of 110 pairs of motor units between the two levels. The common input strength, which quantifies motor unit synchronization, was greater for pairs within one level (0.47 ± 0.32) compared with pairs between levels (0.09 ± 0.07) (P < 0.05). In a second experiment on eight healthy subjects, interference EMG was recorded from the same locations during a linearly increasing force contraction from 0 to 40% MVC and showed significantly greater EMG amplitude at C5 than at C2. In conclusion, synaptic input is distributed partly independently and nonuniformly to different fascicles of the semispinalis cervicis muscle. PMID:22402657

Notions of Video Game Addiction and Their Relation to Self-Reported Addiction among Players of World of Warcraft

ERIC Educational Resources Information Center

Oggins, Jean; Sammis, Jeffrey

2012-01-01

In this study, 438 players of the online video game, World of Warcraft, completed a survey about video game addiction and answered an open-ended question about behaviors they considered characteristic of video game addiction. Responses were coded and correlated with players' self-reports of being addicted to games and scores on a modified video…

Layered video transmission over multirate DS-CDMA wireless systems

NASA Astrophysics Data System (ADS)

Kondi, Lisimachos P.; Srinivasan, Deepika; Pados, Dimitris A.; Batalama, Stella N.

2003-05-01

n this paper, we consider the transmission of video over wireless direct-sequence code-division multiple access (DS-CDMA) channels. A layered (scalable) video source codec is used and each layer is transmitted over a different CDMA channel. Spreading codes with different lengths are allowed for each CDMA channel (multirate CDMA). Thus, a different number of chips per bit can be used for the transmission of each scalable layer. For a given fixed energy value per chip and chip rate, the selection of a spreading code length affects the transmitted energy per bit and bit rate for each scalable layer. An MPEG-4 source encoder is used to provide a two-layer SNR scalable bitstream. Each of the two layers is channel-coded using Rate-Compatible Punctured Convolutional (RCPC) codes. Then, the data are interleaved, spread, carrier-modulated and transmitted over the wireless channel. A multipath Rayleigh fading channel is assumed. At the other end, we assume the presence of an antenna array receiver. After carrier demodulation, multiple-access-interference suppressing despreading is performed using space-time auxiliary vector (AV) filtering. The choice of the AV receiver is dictated by realistic channel fading rates that limit the data record available for receiver adaptation and redesign. Indeed, AV filter short-data-record estimators have been shown to exhibit superior bit-error-rate performance in comparison with LMS, RLS, SMI, or 'multistage nested Wiener' adaptive filter implementations. Our experimental results demonstrate the effectiveness of multirate DS-CDMA systems for wireless video transmission.

Progressive Dictionary Learning with Hierarchical Predictive Structure for Scalable Video Coding.

PubMed

Dai, Wenrui; Shen, Yangmei; Xiong, Hongkai; Jiang, Xiaoqian; Zou, Junni; Taubman, David

2017-04-12

Dictionary learning has emerged as a promising alternative to the conventional hybrid coding framework. However, the rigid structure of sequential training and prediction degrades its performance in scalable video coding. This paper proposes a progressive dictionary learning framework with hierarchical predictive structure for scalable video coding, especially in low bitrate region. For pyramidal layers, sparse representation based on spatio-temporal dictionary is adopted to improve the coding efficiency of enhancement layers (ELs) with a guarantee of reconstruction performance. The overcomplete dictionary is trained to adaptively capture local structures along motion trajectories as well as exploit the correlations between neighboring layers of resolutions. Furthermore, progressive dictionary learning is developed to enable the scalability in temporal domain and restrict the error propagation in a close-loop predictor. Under the hierarchical predictive structure, online learning is leveraged to guarantee the training and prediction performance with an improved convergence rate. To accommodate with the stateof- the-art scalable extension of H.264/AVC and latest HEVC, standardized codec cores are utilized to encode the base and enhancement layers. Experimental results show that the proposed method outperforms the latest SHVC and HEVC simulcast over extensive test sequences with various resolutions.

Using QR Codes to Differentiate Learning for Gifted and Talented Students

ERIC Educational Resources Information Center

Siegle, Del

2015-01-01

QR codes are two-dimensional square patterns that are capable of coding information that ranges from web addresses to links to YouTube video. The codes save time typing and eliminate errors in entering addresses incorrectly. These codes make learning with technology easier for students and motivationally engage them in news ways.

High-Intensity Strength Training Improves Function of Chronically Painful Muscles: Case-Control and RCT Studies

PubMed Central

Andersen, Christoffer H.; Skotte, Jørgen H.; Suetta, Charlotte; Søgaard, Karen; Saltin, Bengt; Sjøgaard, Gisela

2014-01-01

Aim. This study investigates consequences of chronic neck pain on muscle function and the rehabilitating effects of contrasting interventions. Methods. Women with trapezius myalgia (MYA, n = 42) and healthy controls (CON, n = 20) participated in a case-control study. Subsequently MYA were randomized to 10 weeks of specific strength training (SST, n = 18), general fitness training (GFT, n = 16), or a reference group without physical training (REF, n = 8). Participants performed tests of 100 consecutive cycles of 2 s isometric maximal voluntary contractions (MVC) of shoulder elevation followed by 2 s relaxation at baseline and 10-week follow-up. Results. In the case-control study, peak force, rate of force development, and rate of force relaxation as well as EMG amplitude were lower in MYA than CON throughout all 100 MVC. Muscle fiber capillarization was not significantly different between MYA and CON. In the intervention study, SST improved all force parameters significantly more than the two other groups, to levels comparable to that of CON. This was seen along with muscle fiber hypertrophy and increased capillarization. Conclusion. Women with trapezius myalgia have lower strength capacity during repetitive MVC of the trapezius muscle than healthy controls. High-intensity strength training effectively improves strength capacity during repetitive MVC of the painful trapezius muscle. PMID:24707475

Assessment of eccentric exercise-induced muscle damage of the elbow flexors by tensiomyography.

PubMed

Hunter, Angus M; Galloway, Stuart D R; Smith, Iain J; Tallent, Jamie; Ditroilo, Massimiliano; Fairweather, Malcolm M; Howatson, Glyn

2012-06-01

Exercise induced muscle damage (EIMD) impairs maximal torque production which can cause a decline in athletic performance and/or mobility. EIMD is commonly assessed by using maximal voluntary contraction (MVC), creatine kinase (CK) and muscle soreness. We propose as an additional technique, tensiomyography (TMG), recently introduced to measure mechanical and muscle contractile characteristics. The purpose of this study was to determine the validity of TMG in detecting changes in maximal torque following EIMD. Nineteen participants performed eccentric elbow flexions to achieve EIMD on the non- dominant arm and used the dominant elbow flexor as a control. TMG parameters, MVC and rate of torque development (RTD) were measured prior to EIMD and repeated for another six consecutive days. Creatine kinase, muscle soreness and limb girth were also measured during this period. Twenty four hours after inducing EIMD, MVC torque, RTD and TMG maximal displacement had significantly (p<0.01) declined by 37%, 44% and 31%, respectively. By day 6 MVC, RTD and TMG recovered to 12%, 24% and 17% of respective pre-EIMD values. In conclusion, as hypothesised TMG maximal displacement significantly followed other standard EIMD responses. This could therefore be useful in detecting muscle damage from impaired muscle function and its recovery following EIMD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Is the Sørensen test valid to assess muscle fatigue of the trunk extensor muscles?

PubMed

Demoulin, Christophe; Boyer, Mathieu; Duchateau, Jacques; Grosdent, Stéphanie; Jidovtseff, Boris; Crielaard, Jean-Michel; Vanderthommen, Marc

2016-01-01

Very few studies have quantified the degree of fatigue characterized by the decline in the maximal voluntary contraction (MVC) force of the trunk extensors induced by the widely used Sørensen test. Measure the degree of fatigue of the trunk extensor muscles induced by the Sørensen test. Eighty young healthy subjects were randomly divided into a control group (CG) and an experimental group (EG), each including 50% of the two genders. The EG performed an isometric MVC of the trunk extensors (pre-fatigue test) followed by the Sørensen test, the latter being immediately followed by another MVC (post-fatigue test). The CG performed only the pre- and post-fatigue tests without any exertion in between. The comparison of the pre- and post-fatigue tests revealed a significant (P< 0.05) decrease in MVC force normalized by body mass (-13%) in the EG, whereas a small increase occurred in the CG (+2.7%, P= 0.001). This study shows that the Sørensen test performed until failure in a young healthy population results in a reduced ability of the trunk extensor muscles to generate maximal force, and indicates that this test is valid for the assessment of fatigue in trunk extensor muscles.

Reliability of near-infrared spectroscopy for measuring biceps brachii oxygenation during sustained and repeated isometric contractions.

PubMed

Muthalib, Makii; Millet, Guillaume Y; Quaresima, Valentina; Nosaka, Kazunori

2010-01-01

We examine the test-retest reliability of biceps brachii tissue oxygenation index (TOI) parameters measured by near-infrared spectroscopy during a 10-s sustained and a 30-repeated (1-s contraction, 1-s relaxation) isometric contraction task at 30% of maximal voluntary contraction (30% MVC) and maximal (100% MVC) intensities. Eight healthy men (23 to 33 yr) were tested on three sessions separated by 3 h and 24 h, and the within-subject reliability of torque and each TOI parameter were determined by Bland-Altman+/-2 SD limits of agreement plots and coefficient of variation (CV). No significant (P>0.05) differences between the three sessions were found for mean values of torque and TOI parameters during the sustained and repeated tasks at both contraction intensities. All TOI parameters were within+/-2 SD limits of agreement. The CVs for torque integral were similar between the sustained and repeated task at both intensities (4 to 7%); however, the CVs for TOI parameters during the sustained and repeated task were lower for 100% MVC (7 to 11%) than for 30% MVC (22 to 36%). It is concluded that the reliability of the biceps brachii NIRS parameters during both sustained and repeated isometric contraction tasks is acceptable.

Dynamic quality of service differentiation using fixed code weight in optical CDMA networks

NASA Astrophysics Data System (ADS)

Kakaee, Majid H.; Essa, Shawnim I.; Abd, Thanaa H.; Seyedzadeh, Saleh

2015-11-01

The emergence of network-driven applications, such as internet, video conferencing, and online gaming, brings in the need for a network the environments with capability of providing diverse Quality of Services (QoS). In this paper, a new code family of novel spreading sequences, called a Multi-Service (MS) code, has been constructed to support multiple services in Optical- Code Division Multiple Access (CDMA) system. The proposed method uses fixed weight for all services, however reducing the interfering codewords for the users requiring higher QoS. The performance of the proposed code is demonstrated using mathematical analysis. It shown that the total number of served users with satisfactory BER of 10-9 using NB=2 is 82, while they are only 36 and 10 when NB=3 and 4 respectively. The developed MS code is compared with variable-weight codes such as Variable Weight-Khazani Syed (VW-KS) and Multi-Weight-Random Diagonal (MW-RD). Different numbers of basic users (NB) are used to support triple-play services (audio, data and video) with different QoS requirements. Furthermore, reference to the BER of 10-12, 10-9, and 10-3 for video, data and audio, respectively, the system can support up to 45 total users. Hence, results show that the technique can clearly provide a relative QoS differentiation with lower value of basic users can support larger number of subscribers as well as better performance in terms of acceptable BER of 10-9 at fixed code weight.

Exclusively visual analysis of classroom group interactions

NASA Astrophysics Data System (ADS)

Tucker, Laura; Scherr, Rachel E.; Zickler, Todd; Mazur, Eric

2016-12-01

Large-scale audiovisual data that measure group learning are time consuming to collect and analyze. As an initial step towards scaling qualitative classroom observation, we qualitatively coded classroom video using an established coding scheme with and without its audio cues. We find that interrater reliability is as high when using visual data only—without audio—as when using both visual and audio data to code. Also, interrater reliability is high when comparing use of visual and audio data to visual-only data. We see a small bias to code interactions as group discussion when visual and audio data are used compared with video-only data. This work establishes that meaningful educational observation can be made through visual information alone. Further, it suggests that after initial work to create a coding scheme and validate it in each environment, computer-automated visual coding could drastically increase the breadth of qualitative studies and allow for meaningful educational analysis on a far greater scale.

Compression of computer generated phase-shifting hologram sequence using AVC and HEVC

NASA Astrophysics Data System (ADS)

Xing, Yafei; Pesquet-Popescu, Béatrice; Dufaux, Frederic

2013-09-01

With the capability of achieving twice the compression ratio of Advanced Video Coding (AVC) with similar reconstruction quality, High Efficiency Video Coding (HEVC) is expected to become the newleading technique of video coding. In order to reduce the storage and transmission burden of digital holograms, in this paper we propose to use HEVC for compressing the phase-shifting digital hologram sequences (PSDHS). By simulating phase-shifting digital holography (PSDH) interferometry, interference patterns between illuminated three dimensional( 3D) virtual objects and the stepwise phase changed reference wave are generated as digital holograms. The hologram sequences are obtained by the movement of the virtual objects and compressed by AVC and HEVC. The experimental results show that AVC and HEVC are efficient to compress PSDHS, with HEVC giving better performance. Good compression rate and reconstruction quality can be obtained with bitrate above 15000kbps.

Meeting highlights applications of Nek5000 simulation code | Argonne

Science.gov Websites

Photos Videos Fact Sheets, Brochures and Reports Summer Science Writing Internship Careers Education Photos Videos Fact Sheets, Brochures and Reports Summer Science Writing Internship Meeting highlights

"F*ck It! Let's Get to Drinking-Poison our Livers!": a Thematic Analysis of Alcohol Content in Contemporary YouTube MusicVideos.

PubMed

Cranwell, Jo; Britton, John; Bains, Manpreet

2017-02-01

The purpose of the present study is to describe the portrayal of alcohol content in popular YouTube music videos. We used inductive thematic analysis to explore the lyrics and visual imagery in 49 UK Top 40 songs and music videos previously found to contain alcohol content and watched by many British adolescents aged between 11 and 18 years and to examine if branded content contravened alcohol industry advertising codes of practice. The analysis generated three themes. First, alcohol content was associated with sexualised imagery or lyrics and the objectification of women. Second, alcohol was associated with image, lifestyle and sociability. Finally, some videos showed alcohol overtly encouraging excessive drinking and drunkenness, including those containing branding, with no negative consequences to the drinker. Our results suggest that YouTube music videos promote positive associations with alcohol use. Further, several alcohol companies adopt marketing strategies in the video medium that are entirely inconsistent with their own or others agreed advertising codes of practice. We conclude that, as a harm reduction measure, policies should change to prevent adolescent exposure to the positive promotion of alcohol and alcohol branding in music videos.

Development of a Video-Based Evaluation Tool in Rett Syndrome

ERIC Educational Resources Information Center

Fyfe, S.; Downs, J.; McIlroy, O.; Burford, B.; Lister, J.; Reilly, S.; Laurvick, C. L.; Philippe, C.; Msall, M.; Kaufmann, W. E.; Ellaway, C.; Leonard, H.

2007-01-01

This paper describes the development of a video-based evaluation tool for use in Rett syndrome (RTT). Components include a parent-report checklist, and video filming and coding protocols that contain items on eating, drinking, communication, hand function and movements, personal care and mobility. Ninety-seven of the 169 families who initially…

Context adaptive binary arithmetic coding-based data hiding in partially encrypted H.264/AVC videos

NASA Astrophysics Data System (ADS)

Xu, Dawen; Wang, Rangding

2015-05-01

A scheme of data hiding directly in a partially encrypted version of H.264/AVC videos is proposed which includes three parts, i.e., selective encryption, data embedding and data extraction. Selective encryption is performed on context adaptive binary arithmetic coding (CABAC) bin-strings via stream ciphers. By careful selection of CABAC entropy coder syntax elements for selective encryption, the encrypted bitstream is format-compliant and has exactly the same bit rate. Then a data-hider embeds the additional data into partially encrypted H.264/AVC videos using a CABAC bin-string substitution technique without accessing the plaintext of the video content. Since bin-string substitution is carried out on those residual coefficients with approximately the same magnitude, the quality of the decrypted video is satisfactory. Video file size is strictly preserved even after data embedding. In order to adapt to different application scenarios, data extraction can be done either in the encrypted domain or in the decrypted domain. Experimental results have demonstrated the feasibility and efficiency of the proposed scheme.

[Development of a video image system for wireless capsule endoscopes based on DSP].

PubMed

Yang, Li; Peng, Chenglin; Wu, Huafeng; Zhao, Dechun; Zhang, Jinhua

2008-02-01

A video image recorder to record video picture for wireless capsule endoscopes was designed. TMS320C6211 DSP of Texas Instruments Inc. is the core processor of this system. Images are periodically acquired from Composite Video Broadcast Signal (CVBS) source and scaled by video decoder (SAA7114H). Video data is transported from high speed buffer First-in First-out (FIFO) to Digital Signal Processor (DSP) under the control of Complex Programmable Logic Device (CPLD). This paper adopts JPEG algorithm for image coding, and the compressed data in DSP was stored to Compact Flash (CF) card. TMS320C6211 DSP is mainly used for image compression and data transporting. Fast Discrete Cosine Transform (DCT) algorithm and fast coefficient quantization algorithm are used to accelerate operation speed of DSP and decrease the executing code. At the same time, proper address is assigned for each memory, which has different speed;the memory structure is also optimized. In addition, this system uses plenty of Extended Direct Memory Access (EDMA) to transport and process image data, which results in stable and high performance.

Simulation and Real-Time Verification of Video Algorithms on the TI C6400 Using Simulink

DTIC Science & Technology

2004-08-20

SPONSOR/MONITOR’S ACRONYM(S) 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12 . DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release...plot estimates over time (scrolling data) Adjust detection threshold (click mouse on graph) Monitor video capture Input video frames Captured frames 12 ...Video App: Surveillance Recording 1 2 7 3 4 9 5 6 11 SL for video Explanation of GUI 12 Target Options8 Build Process 10 13 14 15 16 M-code snippet

Tactile Cueing for Target Acquisition and Identification

DTIC Science & Technology

2005-09-01

method of coding tactile information, and the method of presenting elevation information were studied. Results: Subjects were divided into video game experienced...VGP) subjects and non- video game (NVGP) experienced subjects. VGPs showed a significantly lower’ target acquisition time with the 12...that video game players performed better with the highest level of tactile resolution, while non- video game players performed better with simpler pattern and a lower resolution display.

Do the Depictions of Sexual Attire and Sexual Behavior in Music Videos Differ Based on Video Network and Character Gender?

ERIC Educational Resources Information Center

King, Keith; Laake, Rebecca A.; Bernard, Amy

2006-01-01

This study examined the sexual messages depicted in music videos aired on MTV, MTV2, BET, and GAC from August 2, 2004 to August 15, 2004. One-hour segments of music videos were taped daily for two weeks. Depictions of sexual attire and sexual behavior were analyzed via a four-page coding sheet (interrater-reliability = 0.93). Results indicated…

Analysis of view synthesis prediction architectures in modern coding standards

NASA Astrophysics Data System (ADS)

Tian, Dong; Zou, Feng; Lee, Chris; Vetro, Anthony; Sun, Huifang

2013-09-01

Depth-based 3D formats are currently being developed as extensions to both AVC and HEVC standards. The availability of depth information facilitates the generation of intermediate views for advanced 3D applications and displays, and also enables more efficient coding of the multiview input data through view synthesis prediction techniques. This paper outlines several approaches that have been explored to realize view synthesis prediction in modern video coding standards such as AVC and HEVC. The benefits and drawbacks of various architectures are analyzed in terms of performance, complexity, and other design considerations. It is hence concluded that block-based VSP prediction for multiview video signals provides attractive coding gains with comparable complexity as traditional motion/disparity compensation.

Unified transform architecture for AVC, AVS, VC-1 and HEVC high-performance codecs

NASA Astrophysics Data System (ADS)

Dias, Tiago; Roma, Nuno; Sousa, Leonel

2014-12-01

A unified architecture for fast and efficient computation of the set of two-dimensional (2-D) transforms adopted by the most recent state-of-the-art digital video standards is presented in this paper. Contrasting to other designs with similar functionality, the presented architecture is supported on a scalable, modular and completely configurable processing structure. This flexible structure not only allows to easily reconfigure the architecture to support different transform kernels, but it also permits its resizing to efficiently support transforms of different orders (e.g. order-4, order-8, order-16 and order-32). Consequently, not only is it highly suitable to realize high-performance multi-standard transform cores, but it also offers highly efficient implementations of specialized processing structures addressing only a reduced subset of transforms that are used by a specific video standard. The experimental results that were obtained by prototyping several configurations of this processing structure in a Xilinx Virtex-7 FPGA show the superior performance and hardware efficiency levels provided by the proposed unified architecture for the implementation of transform cores for the Advanced Video Coding (AVC), Audio Video coding Standard (AVS), VC-1 and High Efficiency Video Coding (HEVC) standards. In addition, such results also demonstrate the ability of this processing structure to realize multi-standard transform cores supporting all the standards mentioned above and that are capable of processing the 8k Ultra High Definition Television (UHDTV) video format (7,680 × 4,320 at 30 fps) in real time.

Cross-Layer Design for Robust and Scalable Video Transmission in Dynamic Wireless Environment

DTIC Science & Technology

2011-02-01

code rate convolutional codes or prioritized Rate - Compatible Punctured ...34New rate - compatible punctured convolutional codes for Viterbi decoding," IEEE Trans. Communications, Volume 42, Issue 12, pp. 3073-3079, Dec...Quality of service RCPC Rate - compatible and punctured convolutional codes SNR Signal to noise

A Video Transmission System for Severely Degraded Channels

DTIC Science & Technology

2006-07-01

rate compatible punctured convolutional codes (RCPC) . By separating the SPIHT bitstream...June 2000. 149 [170] J. Hagenauer, Rate - compatible punctured convolutional codes (RCPC codes ) and their applications, IEEE Transactions on...Farvardin [160] used rate compatible convolutional codes . They noticed that for some transmission rates , one of their EEP schemes, which may

Robust Pedestrian Tracking and Recognition from FLIR Video: A Unified Approach via Sparse Coding

PubMed Central

Li, Xin; Guo, Rui; Chen, Chao

2014-01-01

Sparse coding is an emerging method that has been successfully applied to both robust object tracking and recognition in the vision literature. In this paper, we propose to explore a sparse coding-based approach toward joint object tracking-and-recognition and explore its potential in the analysis of forward-looking infrared (FLIR) video to support nighttime machine vision systems. A key technical contribution of this work is to unify existing sparse coding-based approaches toward tracking and recognition under the same framework, so that they can benefit from each other in a closed-loop. On the one hand, tracking the same object through temporal frames allows us to achieve improved recognition performance through dynamical updating of template/dictionary and combining multiple recognition results; on the other hand, the recognition of individual objects facilitates the tracking of multiple objects (i.e., walking pedestrians), especially in the presence of occlusion within a crowded environment. We report experimental results on both the CASIAPedestrian Database and our own collected FLIR video database to demonstrate the effectiveness of the proposed joint tracking-and-recognition approach. PMID:24961216

A Secure and Robust Object-Based Video Authentication System

NASA Astrophysics Data System (ADS)

He, Dajun; Sun, Qibin; Tian, Qi

2004-12-01

An object-based video authentication system, which combines watermarking, error correction coding (ECC), and digital signature techniques, is presented for protecting the authenticity between video objects and their associated backgrounds. In this system, a set of angular radial transformation (ART) coefficients is selected as the feature to represent the video object and the background, respectively. ECC and cryptographic hashing are applied to those selected coefficients to generate the robust authentication watermark. This content-based, semifragile watermark is then embedded into the objects frame by frame before MPEG4 coding. In watermark embedding and extraction, groups of discrete Fourier transform (DFT) coefficients are randomly selected, and their energy relationships are employed to hide and extract the watermark. The experimental results demonstrate that our system is robust to MPEG4 compression, object segmentation errors, and some common object-based video processing such as object translation, rotation, and scaling while securely preventing malicious object modifications. The proposed solution can be further incorporated into public key infrastructure (PKI).

Reconstructing Interlaced High-Dynamic-Range Video Using Joint Learning.

PubMed

Inchang Choi; Seung-Hwan Baek; Kim, Min H

2017-11-01

For extending the dynamic range of video, it is a common practice to capture multiple frames sequentially with different exposures and combine them to extend the dynamic range of each video frame. However, this approach results in typical ghosting artifacts due to fast and complex motion in nature. As an alternative, video imaging with interlaced exposures has been introduced to extend the dynamic range. However, the interlaced approach has been hindered by jaggy artifacts and sensor noise, leading to concerns over image quality. In this paper, we propose a data-driven approach for jointly solving two specific problems of deinterlacing and denoising that arise in interlaced video imaging with different exposures. First, we solve the deinterlacing problem using joint dictionary learning via sparse coding. Since partial information of detail in differently exposed rows is often available via interlacing, we make use of the information to reconstruct details of the extended dynamic range from the interlaced video input. Second, we jointly solve the denoising problem by tailoring sparse coding to better handle additive noise in low-/high-exposure rows, and also adopt multiscale homography flow to temporal sequences for denoising. We anticipate that the proposed method will allow for concurrent capture of higher dynamic range video frames without suffering from ghosting artifacts. We demonstrate the advantages of our interlaced video imaging compared with the state-of-the-art high-dynamic-range video methods.

eMontage: An Architecture for Rapid Integration of Situational Awareness Data at the Edge

DTIC Science & Technology

2013-05-01

Request Response Interaction Android Client Dispatcher Servlet Spring MVC Controller Camel Producer Template Camel Route Remote Data Service - REST...8SATURN 2013© 2013 Carnegie Mellon University Publish Subscribe Interaction Android Client Dispatcher Servlet Spring MVC Controller Remote Data...set ..., "’"C oUkRelw•b J’- - ’ ~ ’~------’ ~-------- ’-------~ , Parse XML into a single Java XML Document object. -=--:=’ Software Engineering

MVC for Content Management on the Cloud

DTIC Science & Technology

2011-09-01

Windows, Linux , MacOS, PalmOS and other customized ones (Qiu). Figure 20 illustrates implementation of MVC architecture. Qiu examines a “universal...Listing of Unzipped Text Document (From O’Reilly & Associates, Inc, 2005) Figure 37 shows the results of unzipping this file in Linux . The contents of the...ODF Adoption TC, and the ODF Alliance include members from Adobe, BBC, Bristol City Council, Bull, Corel, EDS, EMC, GNOME, IBM, Intel, KDE , MySQL

Wireless Visual Sensor Network Resource Allocation using Cross-Layer Optimization

DTIC Science & Technology

2009-01-01

Rate Compatible Punctured Convolutional (RCPC) codes for channel...vol. 44, pp. 2943–2959, November 1998. [22] J. Hagenauer, “ Rate - compatible punctured convolutional codes (RCPC codes ) and their applications,” IEEE... coding rate for H.264/AVC video compression is determined. At the data link layer, the Rate - Compatible Puctured Convolutional (RCPC) channel coding

Recovery Effect of the Muscle Fatigue by the Magnetic Stimulation

NASA Astrophysics Data System (ADS)

Uchida, Kousuke; Nuruki, Atsuo; Tsujimura, Sei-Ichi; Tamari, Youzou; Yunokuchi, Kazutomo

The purpose of this study is to investigate the effect of magnetic stimulation for muscle fatigue. The six healthy subjects participated in the experiment with the repetition grasp using a hand dynamometer. The measurement of EMG (electromyography) and MMG (mechanomyography) is performed on the left forearm. All subjects performed MVC (maximum voluntary contraction), and repeated exercise in 80%MVC after the MVC measurement. The repetition task was entered when display muscular strength deteriorated. We used an EMG and MMG for the measurement of the muscle fatigue. Provided EMG and MMG waves were calculated integral calculus value (iEMG, and iMMG). The result of iEMG and iMMG were divided by muscular strength, because we calculate integral calculus value per the unit display muscular strength. The result of our study, we found recovery effect by the magnetic stimulation in voluntarily muscular strength and iEMG. However, we can not found in a figure of iMMG.

Predicting significant torso trauma.

PubMed

Nirula, Ram; Talmor, Daniel; Brasel, Karen

2005-07-01

Identification of motor vehicle crash (MVC) characteristics associated with thoracoabdominal injury would advance the development of automatic crash notification systems (ACNS) by improving triage and response times. Our objective was to determine the relationships between MVC characteristics and thoracoabdominal trauma to develop a torso injury probability model. Drivers involved in crashes from 1993 to 2001 within the National Automotive Sampling System were reviewed. Relationships between torso injury and MVC characteristics were assessed using multivariate logistic regression. Receiver operating characteristic curves were used to compare the model to current ACNS models. There were a total of 56,466 drivers. Age, ejection, braking, avoidance, velocity, restraints, passenger-side impact, rollover, and vehicle weight and type were associated with injury (p < 0.05). The area under the receiver operating characteristic curve (83.9) was significantly greater than current ACNS models. We have developed a thoracoabdominal injury probability model that may improve patient triage when used with ACNS.

Traumatic subarachnoid hemorrhage due to motor vehicle crash versus fall from height: a 4-year epidemiologic study.

PubMed

Parchani, Ashok; El-Menyar, Ayman; Al-Thani, Hassan; El-Faramawy, Ahmed; Zarour, Ahmad; Asim, Mohammad; Latifi, Rifat

2014-11-01

Traumatic brain injury (TBI) is a common cause of morbidity and mortality worldwide. It is difficult to estimate the real incidence of traumatic subarachnoid hemorrhage (TSAH). Although TSAH after trauma is associated with poor prognoses, the impact of mechanism of injury (MOI) and the pathophysiology remains unknown. We hypothesized that outcome of TSAH caused by motor vehicle crash (MVC) or fall from height (FFH) varies based on the MOI. Data were collected retrospectively from a prospectively created database registry in the section of Trauma Surgery at Hamad General Hospital between January 2008 and July 2012. All patients presented with head trauma and TSAH were included. Patient data included age, gender, nationality, mechanism of injury, injury severity score (ISS), types of head injuries, and associated injuries. Ventilator days, intensive care unit length of stay, pneumonia, and mortality were also studied. A total of 1665 patients with TBI were identified, of them 403 had TSAH with a mean age of 35 ± 15 years. Of them 93% were male patients and 86% were expatriates. MVC (53%) and FFH (35%) were the major mechanisms of injury. The overall mean ISS and head abbreviated injury score were 19 ± 10.6 and 3.4 ± 0.96, respectively. Patients in MVC group sustained severe TSAH, had significantly greater head abbreviated injury score (3.5 ± 0.9 vs. 3.2 ± 0.9; P = 0.009) and ISS (21.6 ± 10.6 vs. 15.9 ± 9.5; P = 0.001), and lower scene Glasgow coma scale (10.8 ± 4.8 vs. 13.2 ± 3.4; P = 0.001) compared with the FFH group. In addition, the MVC group sustained more intraventricular hemorrhage (4.7 vs. 0.7; P = 0.001) and diffuse axonal injury (4.2 vs. 2.9; P = 0.001). In contrast, extradural hemorrhage (14.3% vs. 11.6%; P = 0.008) was higher in the FFH group. Lower extremities (14% vs. 4.3%; P = 0.004) injury was mainly associated with the MVC group. The overall mortality was 19 % among patients with TSAH. The mortality rate was higher in the MVC group when compared with the FFH group (24% vs. 10%; P = 0.001). In both groups, ISS and Glasgow coma scale at the scene were independent predictors of mortality. Patients with TSAH have a higher mortality rate. In this population, MVCs are associated with a 3-fold increased risk of mortality. Therefore, prevention of MVC and fall can reduce the incidence and severity of TBI in Qatar. Copyright © 2014 Elsevier Inc. All rights reserved.

Audiovisual focus of attention and its application to Ultra High Definition video compression

NASA Astrophysics Data System (ADS)

Rerabek, Martin; Nemoto, Hiromi; Lee, Jong-Seok; Ebrahimi, Touradj

2014-02-01

Using Focus of Attention (FoA) as a perceptual process in image and video compression belongs to well-known approaches to increase coding efficiency. It has been shown that foveated coding, when compression quality varies across the image according to region of interest, is more efficient than the alternative coding, when all region are compressed in a similar way. However, widespread use of such foveated compression has been prevented due to two main conflicting causes, namely, the complexity and the efficiency of algorithms for FoA detection. One way around these is to use as much information as possible from the scene. Since most video sequences have an associated audio, and moreover, in many cases there is a correlation between the audio and the visual content, audiovisual FoA can improve efficiency of the detection algorithm while remaining of low complexity. This paper discusses a simple yet efficient audiovisual FoA algorithm based on correlation of dynamics between audio and video signal components. Results of audiovisual FoA detection algorithm are subsequently taken into account for foveated coding and compression. This approach is implemented into H.265/HEVC encoder producing a bitstream which is fully compliant to any H.265/HEVC decoder. The influence of audiovisual FoA in the perceived quality of high and ultra-high definition audiovisual sequences is explored and the amount of gain in compression efficiency is analyzed.

A comparison of cigarette- and hookah-related videos on YouTube.

PubMed

Carroll, Mary V; Shensa, Ariel; Primack, Brian A

2013-09-01

YouTube is now the second most visited site on the internet. The authors aimed to compare characteristics of and messages conveyed by cigarette- and hookah-related videos on YouTube. Systematic search procedures yielded 66 cigarette-related and 61 hookah-related videos. After three trained qualitative researchers used an iterative approach to develop and refine definitions for the coding of variables, two of them independently coded each video for content including positive and negative associations with smoking and major content type. Median view counts were 606,884 for cigarettes-related videos and 102,307 for hookah-related videos (p<0.001). However, the number of comments per 1000 views was significantly lower for cigarette-related videos than for hookah-related videos (1.6 vs 2.5, p=0.003). There was no significant difference in the number of 'like' designations per 100 reactions (91 vs 87, p=0.39). Cigarette-related videos were less likely than hookah-related videos to portray tobacco use in a positive light (24% vs 92%, p<0.001). In addition, cigarette-related videos were more likely to be of high production quality (42% vs 5%, p<0.001), to mention short-term consequences (50% vs 18%, p<0.001) and long-term consequences (44% vs 2%, p<0.001) of tobacco use, to contain explicit antismoking messages (39% vs 0%, p<0.001) and to provide specific information on how to quit tobacco use (21% vs 0%, p<0.001). Although internet user-generated videos related to cigarette smoking often acknowledge harmful consequences and provide explicit antismoking messages, hookah-related videos do not. It may be valuable for public health programmes to correct common misconceptions regarding hookah use.

Code inspection instructional validation

NASA Technical Reports Server (NTRS)

Orr, Kay; Stancil, Shirley

1992-01-01

The Shuttle Data Systems Branch (SDSB) of the Flight Data Systems Division (FDSD) at Johnson Space Center contracted with Southwest Research Institute (SwRI) to validate the effectiveness of an interactive video course on the code inspection process. The purpose of this project was to determine if this course could be effective for teaching NASA analysts the process of code inspection. In addition, NASA was interested in the effectiveness of this unique type of instruction (Digital Video Interactive), for providing training on software processes. This study found the Carnegie Mellon course, 'A Cure for the Common Code', effective for teaching the process of code inspection. In addition, analysts prefer learning with this method of instruction, or this method in combination with other methods. As is, the course is definitely better than no course at all; however, findings indicate changes are needed. Following are conclusions of this study. (1) The course is instructionally effective. (2) The simulation has a positive effect on student's confidence in his ability to apply new knowledge. (3) Analysts like the course and prefer this method of training, or this method in combination with current methods of training in code inspection, over the way training is currently being conducted. (4) Analysts responded favorably to information presented through scenarios incorporating full motion video. (5) Some course content needs to be changed. (6) Some content needs to be added to the course. SwRI believes this study indicates interactive video instruction combined with simulation is effective for teaching software processes. Based on the conclusions of this study, SwRI has outlined seven options for NASA to consider. SwRI recommends the option which involves creation of new source code and data files, but uses much of the existing content and design from the current course. Although this option involves a significant software development effort, SwRI believes this option will produce the most effective results.

Self-reported vs state-recorded motor vehicle collisions among older community dwelling individuals.

PubMed

Singletary, B A; Do, A N; Donnelly, J P; Huisingh, C; Mefford, M T; Modi, R; Mondesir, F L; Ye, Y; Owsley, C; McGwin, G

2017-04-01

Motor vehicle collisions (MVCs) continue to place an increased burden on both individuals and health care systems. Self-reported and state-recorded police reports are the most common methods for MVC evaluation in epidemiologic studies, with varying degrees of agreement of information when compared in previous studies. The objective of the current study is to address the differences in MVC reporting and provide a more robust measure of the agreement between self-reported and state-recorded MVCs in a community dwelling population of older adults. A three-year prospective study was conducted in a population-based sample of 2000 licensed drivers aged 70 and older. At annual visits, participants were asked to self-report information on any MVC that occurred over the prior year where police were called to the scene. Information on police-reported MVCs was also ascertained from Alabama official state-recorded databases. The kappa coefficient was calculated to determine overall agreement between any self-reported and state-recorded crashes, as well as the raw number of crashes reported. In addition, agreement was stratified by demographics, health status, medication use, functional status (i.e. vision, cognition), and driving habits. 1747 participants who completed three years of follow up were involved in 225 state-recorded MVCs and 208 self-reported MVCs yielding overall substantial agreement between any self-report and state-recorded MVC (kappa=0.64). Cumulative number of self-reported and state-recorded MVCs was also compared, with agreement slightly reduced (kappa=0.55). The clinical characteristic resulting in the greatest variation in agreement with drivers was impaired contrast sensitivity showing better agreement between self-reported and state-recorded MVCs (kappa=0.9) than those with non-impaired contrast sensitivity (kappa=0.6). Study results showed substantial agreement between self-reported and state-recorded MVCs for any MVC involvement among the study population. When examining the reporting of the total number of MVCs over the three year period, agreement was reduced to a moderate level. There was consistency in agreement across MVC risk factors except among individuals with contrast sensitivity. These findings have implications for the design and analytic planning of epidemiologic and clinical research focused on MVCs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prevalence and psychometric screening for the detection of major depressive disorder and post-traumatic stress disorder in adults injured in a motor vehicle crash who are engaged in compensation.

PubMed

Guest, Rebecca; Tran, Yvonne; Gopinath, Bamini; Cameron, Ian D; Craig, Ashley

2018-02-21

Physical injury and psychological disorder following a motor vehicle crash (MVC) is a public health concern. The objective of this research was to determine rates of major depressive disorder (MDD) and post-traumatic stress disorder (PTSD) in adults with MVC-related injury engaged in compensation, and to determine the capacity (e.g. sensitivity and specificity) of two psychometric scales for estimating the presence of MDD and PTSD. Participants included 109 adults with MVC-related injury engaged in compensation during 2015 to 2017, in Sydney, Australia. The mean time from MVC to baseline assessment was 11 weeks. Comprehensive assessment was conducted at baseline, and the Depression Anxiety Stress Scales (DASS-21) and the Impact of Event Scale-Revised (IES-R) were administered to determine probable MDD and PTSD. An online psychiatric interview, based on Diagnostic and Statistical Manual for Mental Disorders (DSM-5), was used to diagnose actual MDD and PTSD, acknowledged as gold standard diagnostic criteria. One-way multivariate analyses of variance established criterion validity of the DASS-21 and IES-R, and sensitivity and specificity analyses were conducted to determine the most sensitive cut-off points for detecting probable MDD and PTSD. Substantial rates of MDD (53.2%) and PTSD (19.3%) were found. The DASS-21 and IES-R were shown to have excellent criterion validity for detecting MDD and PTSD in injured participants. A range of cut-off points were investigated and shown to have acceptable sensitivity and specificity for detecting MDD and PTSD in an injured population engaged in compensation. The preferred cut-off points based on this study are: to detect MDD, a DASS-21 total score of 30 and/or a DASS-21 depression score of 10; to detect PTSD, IES-R scores of 33-40 and/or a DASS-21 anxiety score of 7-8. Major psychological disorder is prevalent following a MVC. Results suggest the DASS-21 and IES-R are suitable for use in clinical/compensation settings to detect probable MDD and PTSD soon after a MVC in physically injured people engaged in compensation. These results provide positive direction in the public health arena for improving mental health outcomes. Clinical Trials registration number: ANZCTR - ACTRN12615000326594 (9th April 2015).

Building Automatic Grading Tools for Basic of Programming Lab in an Academic Institution

NASA Astrophysics Data System (ADS)

Harimurti, Rina; Iwan Nurhidayat, Andi; Asmunin

2018-04-01

The skills of computer programming is a core competency that must be mastered by students majoring in computer sciences. The best way to improve this skill is through the practice of writing many programs to solve various problems from simple to complex. It takes hard work and a long time to check and evaluate the results of student labs one by one, especially if the number of students a lot. Based on these constrain, web proposes Automatic Grading Tools (AGT), the application that can evaluate and deeply check the source code in C, C++. The application architecture consists of students, web-based applications, compilers, and operating systems. Automatic Grading Tools (AGT) is implemented MVC Architecture and using open source software, such as laravel framework version 5.4, PostgreSQL 9.6, Bootstrap 3.3.7, and jquery library. Automatic Grading Tools has also been tested for real problems by submitting source code in C/C++ language and then compiling. The test results show that the AGT application has been running well.

A new DWT/MC/DPCM video compression framework based on EBCOT

NASA Astrophysics Data System (ADS)

Mei, L. M.; Wu, H. R.; Tan, D. M.

2005-07-01

A novel Discrete Wavelet Transform (DWT)/Motion Compensation (MC)/Differential Pulse Code Modulation (DPCM) video compression framework is proposed in this paper. Although the Discrete Cosine Transform (DCT)/MC/DPCM is the mainstream framework for video coders in industry and international standards, the idea of DWT/MC/DPCM has existed for more than one decade in the literature and the investigation is still undergoing. The contribution of this work is twofold. Firstly, the Embedded Block Coding with Optimal Truncation (EBCOT) is used here as the compression engine for both intra- and inter-frame coding, which provides good compression ratio and embedded rate-distortion (R-D) optimization mechanism. This is an extension of the EBCOT application from still images to videos. Secondly, this framework offers a good interface for the Perceptual Distortion Measure (PDM) based on the Human Visual System (HVS) where the Mean Squared Error (MSE) can be easily replaced with the PDM in the R-D optimization. Some of the preliminary results are reported here. They are also compared with benchmarks such as MPEG-2 and MPEG-4 version 2. The results demonstrate that under specified condition the proposed coder outperforms the benchmarks in terms of rate vs. distortion.

Real-time video streaming using H.264 scalable video coding (SVC) in multihomed mobile networks: a testbed approach

NASA Astrophysics Data System (ADS)

Nightingale, James; Wang, Qi; Grecos, Christos

2011-03-01

Users of the next generation wireless paradigm known as multihomed mobile networks expect satisfactory quality of service (QoS) when accessing streamed multimedia content. The recent H.264 Scalable Video Coding (SVC) extension to the Advanced Video Coding standard (AVC), offers the facility to adapt real-time video streams in response to the dynamic conditions of multiple network paths encountered in multihomed wireless mobile networks. Nevertheless, preexisting streaming algorithms were mainly proposed for AVC delivery over multipath wired networks and were evaluated by software simulation. This paper introduces a practical, hardware-based testbed upon which we implement and evaluate real-time H.264 SVC streaming algorithms in a realistic multihomed wireless mobile networks environment. We propose an optimised streaming algorithm with multi-fold technical contributions. Firstly, we extended the AVC packet prioritisation schemes to reflect the three-dimensional granularity of SVC. Secondly, we designed a mechanism for evaluating the effects of different streamer 'read ahead window' sizes on real-time performance. Thirdly, we took account of the previously unconsidered path switching and mobile networks tunnelling overheads encountered in real-world deployments. Finally, we implemented a path condition monitoring and reporting scheme to facilitate the intelligent path switching. The proposed system has been experimentally shown to offer a significant improvement in PSNR of the received stream compared with representative existing algorithms.

Postactivation potentiation biases maximal isometric strength assessment.

PubMed

Lima, Leonardo Coelho Rabello; Oliveira, Felipe Bruno Dias; Oliveira, Thiago Pires; Assumpção, Claudio de Oliveira; Greco, Camila Coelho; Cardozo, Adalgiso Croscato; Denadai, Benedito Sérgio

2014-01-01

Postactivation potentiation (PAP) is known to enhance force production. Maximal isometric strength assessment protocols usually consist of two or more maximal voluntary isometric contractions (MVCs). The objective of this study was to determine if PAP would influence isometric strength assessment. Healthy male volunteers (n = 23) performed two five-second MVCs separated by a 180-seconds interval. Changes in isometric peak torque (IPT), time to achieve it (tPTI), contractile impulse (CI), root mean square of the electromyographic signal during PTI (RMS), and rate of torque development (RTD), in different intervals, were measured. Significant increases in IPT (240.6 ± 55.7 N·m versus 248.9 ± 55.1 N·m), RTD (746 ± 152 N·m·s(-1) versus 727 ± 158 N·m·s(-1)), and RMS (59.1 ± 12.2% RMSMAX  versus 54.8 ± 9.4% RMSMAX) were found on the second MVC. tPTI decreased significantly on the second MVC (2373 ± 1200 ms versus 2784 ± 1226 ms). We conclude that a first MVC leads to PAP that elicits significant enhancements in strength-related variables of a second MVC performed 180 seconds later. If disconsidered, this phenomenon might bias maximal isometric strength assessment, overestimating some of these variables.

Assessment of H reflex sensitivity with M wave alternation consequent to fatiguing contractions.

PubMed

Hwang, Ing-Shiou; Huang, Cheng-Ya; Wu, Pei-Shan; Chen, Yi-Ching; Wang, Chun-Hou

2008-09-01

The objective of this study was to examine the changes in H reflex sensitivity after neuromuscular fatigue associated with fluctuations of the M wave. In the maximal and submaximal voluntary contraction (MVC and SMVC) paradigms, subjects performed voluntary plantarflexion at 100% MVC and 40% MVC respectively until the limit of torque maintenance was reached. In the submaximal electrical stimulation (SMES) paradigm, the tricep surae was exhausted with sustained electrical stimulation of 40% of the maximal tolerable intensity at a 40-Hz stimulus rate. The H reflexes and maximal M waves (M(max)) of the soleus were recorded before and after the three fatigue paradigms, and the H reflex was standardized with M(max) to minimize possible bias due to fatigue-induced M wave fluctuation. The results showed a significant increase in the standardized H reflex due to the SMES paradigm in spite of M(max) potentiation. The SMVC paradigm led to a reduction in size of the standardized H reflex without modification of M(max), whereas the standardized H reflex was not mediated by the MVC paradigm, which contributed to a noticeable M(max) potentiation. The present study underscored the fact that the H reflex sensitivity and M wave amplitude were not necessarily suppressed consequent to neuromuscular fatigue, but varied with the activation history of a muscle for size-dependent efficacy of the Ia transmission pathways and postactivation potentiation.

Medication use and the risk of motor vehicle collisions among licensed drivers: A systematic review

PubMed Central

Rudisill, Toni M.; Zhu, Motao; Kelley, George A.; Pilkerton, Courtney; Rudisill, Brandon R.

2016-01-01

Objectives Driving under the influence of prescription and over-the-counter medication is a growing public health concern. A systematic review of the literature was performed to investigate which specific medications were associated with increased risk of motor vehicle collision (MVC). Methods The a priori inclusion criteria were: 1) studies published from English-language sources on or after January 1, 1960, 2) licensed drivers 15 years of age and older, 3) peer-reviewed publications, master's theses, doctoral dissertations, and conference papers, 4) studies limited to randomized control trials, cohort studies, case-control studies, or case-control type studies 5) outcome measure reported for at least one specific medication, 6) outcome measure reported as the odds or risk of a motor vehicle collision. Fourteen databases were examined along with hand-searching. Independent, dual selection of studies and data abstraction was performed. Results Fifty-three medications were investigated by 27 studies included in the review. Fifteen (28.3%) were associated with an increased risk of MVC. These included Buprenorphine, Codeine, Dihydrocodeine, Methadone, Tramadol, Levocitirizine, Diazepam, Flunitrazepam, Flurazepam, Lorazepam, Temazepam, Triazolam, Carisoprodol, Zolpidem, and Zopiclone. Conclusions Several medications were associated with an increased risk of MVC and decreased driving ability. The associations between specific medication use and the increased risk of MVC and/or affected driving ability are complex. Future research opportunities are plentiful and worthy of such investigation. PMID:27569655

Relationship between pelvic floor muscle and hormone levels in polycystic ovary syndrome.

PubMed

Micussi, Maria Thereza; Freitas, Rodrigo Pegado; Varella, Larissa; Soares, Elvira Maria; Lemos, Telma Maria; Maranhão, Técia Maria

2016-09-01

To evaluate the electrical activity of the pelvic floor muscles (PFM) in women with polycystic ovary syndrome. Forty-two women with polycystic ovary syndrome (PCOS group) and 13 premenopausal women (control group) were recruited in this cross-sectional study. Total testosterone and estradiol were measured and muscle tone and maximum voluntary contraction (MVC) of PFM were determined by surface electromyography. There was a difference in muscle tone (PCOS = 59.9 µV and Control group = 25.5 µV; P < 0.0001) and MVC (PCOS = 159.7 µV and Control group = 63.7 µV; P < 0.0002) between groups. The concentration of estradiol and testosterone showed a strong correlation with tone (r = 0.9, r = 0.8 respectively) and MVC (r = 0.9, r = 0.9 respectively) in women with PCOS. The control group exhibited a strong correlation between testosterone and muscle tone (r = 0.9) and MVC (r = 0.9). Women with PCOS display higher electromyographic values than those in premenopause. Moreover, electrical activity showed a positive relation with estradiol and testosterone concentrations. Although PCOS is a heterogeneous disorder affecting young women, it is suggested that the hyperandrogenic state associated with PCOS is a protective factor for PFM. Neurourol. Urodynam. 35:780-785, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Acoustic myography as an indicator of force during sustained contractions of a small hand muscle.

PubMed

Goldenberg, M S; Yack, H J; Cerny, F J; Burton, H W

1991-01-01

To test the hypothesis that muscle sound amplitudes would remain constant during sustained submaximal isometric contractions, we recorded acoustic myograms from the abductor digiti minimi muscle in 12 subjects at 15, 25, 50, and 75% of a maximum voluntary contraction (MVC). Muscle sounds were detected with an omni-directional electret microphone encased in closed-cell foam and attached to the skin over the muscle. Acoustic amplitudes from the middle and end of the sustained contractions were compared with the amplitudes from the beginning of contractions to determine whether acoustic amplitudes varied in magnitude as force remained constant. Physiological tremor was eliminated from the acoustic signal by use of a Fourier truncation at 14 Hz. The amplitudes of the acoustic signal at a contraction intensity of 75% MVC remained constant, reflecting force production over time. At 50% MVC, the root-mean-square amplitude decreased from the beginning to the end of the contraction (P less than 0.05). Acoustic amplitudes increased over time at 15 and 25% MVC and were significantly higher at the end of the contractions than at the beginning (P less than 0.05). Alterations in the acoustic amplitude, which reflect changes in the lateral vibrations of the muscle, may be indicative of the different recruitment strategies used to maintain force during sustained isometric contractions.

Effect of angular velocity on soleus and medial gastrocnemius H-reflex during maximal concentric and eccentric muscle contraction.

PubMed

Duclay, Julien; Robbe, Alice; Pousson, Michel; Martin, Alain

2009-10-01

At rest, the H-reflex is lower during lengthening than shortening actions. During passive lengthening, both soleus (SOL) and medial gastrocnemius (MG) H-reflex amplitudes decrease with increasing angular velocity. This study was designed to investigate whether H-reflex amplitude is affected by angular velocity during concentric and eccentric maximal voluntary contraction (MVC). Experiments were performed on nine healthy men. At a constant angular velocity of 60 degrees /s and 20 degrees /s, maximal H-reflex and M-wave potentials were evoked at rest (i.e., H(max) and M(max), respectively) and during concentric and eccentric MVC (i.e., H(sup) and M(sup), respectively). Regardless of the muscle, H(max)/M(max) was lower during lengthening than shortening actions and the H(sup)/M(sup) ratio was higher than H(max)/M(max) during lengthening actions. Whereas no action type and angular velocity effects on the MG H(sup)/M(sup) were found, the SOL H(sup)/M(sup) was lower during eccentric than concentric MVC and this depression was increased with higher angular velocity. Our findings indicate that the depression of the H-reflex amplitude during eccentric compared to concentric MVC depends mainly on the amount of inhibition induced by lengthening action. In conclusion, H-reflex should be evoked during both passive and active dynamic trials to evaluate the plasticity of the spinal loop.

Effects of a Finger Tapping Fatiguing Task on M1-Intracortical Inhibition and Central Drive to the Muscle.

PubMed

Madrid, Antonio; Madinabeitia-Mancebo, Elena; Cudeiro, Javier; Arias, Pablo

2018-06-19

The central drive to the muscle reduces when muscle force wanes during sustained MVC, and this is generally considered the neurophysiological footprint of central fatigue. The question is if force loss and the failure of central drive to the muscle are responsible mechanisms of fatigue induced by un-resisted repetitive movements. In various experimental blocks, we validated a 3D-printed hand-fixation system permitting the execution of finger-tapping and maximal voluntary contractions (MVC). Subsequently, we checked the suitability of the system to test the level of central drive to the muscle and developed an algorithm to test it at the MVC force plateau. Our main results show that the maximum rate of finger-tapping dropped at 30 s, while the excitability of inhibitory M1-intracortical circuits and corticospinal excitability increased (all by approximately 15%). Furthermore, values obtained immediately after finger-tapping showed that MVC force and the level of central drive to the muscle remained unchanged. Our data suggest that force and central drive to the muscle are not determinants of fatigue induced by short-lasting un-resisted repetitive finger movements, even in the presence of increased inhibition of the motor cortex. According to literature, this profile might be different in longer-lasting, more complex and/or resisted repetitive movements.

Reading your own lips: common-coding theory and visual speech perception.

PubMed

Tye-Murray, Nancy; Spehar, Brent P; Myerson, Joel; Hale, Sandra; Sommers, Mitchell S

2013-02-01

Common-coding theory posits that (1) perceiving an action activates the same representations of motor plans that are activated by actually performing that action, and (2) because of individual differences in the ways that actions are performed, observing recordings of one's own previous behavior activates motor plans to an even greater degree than does observing someone else's behavior. We hypothesized that if observing oneself activates motor plans to a greater degree than does observing others, and if these activated plans contribute to perception, then people should be able to lipread silent video clips of their own previous utterances more accurately than they can lipread video clips of other talkers. As predicted, two groups of participants were able to lipread video clips of themselves, recorded more than two weeks earlier, significantly more accurately than video clips of others. These results suggest that visual input activates speech motor activity that links to word representations in the mental lexicon.

Fast image interpolation for motion estimation using graphics hardware

NASA Astrophysics Data System (ADS)

Kelly, Francis; Kokaram, Anil

2004-05-01

Motion estimation and compensation is the key to high quality video coding. Block matching motion estimation is used in most video codecs, including MPEG-2, MPEG-4, H.263 and H.26L. Motion estimation is also a key component in the digital restoration of archived video and for post-production and special effects in the movie industry. Sub-pixel accurate motion vectors can improve the quality of the vector field and lead to more efficient video coding. However sub-pixel accuracy requires interpolation of the image data. Image interpolation is a key requirement of many image processing algorithms. Often interpolation can be a bottleneck in these applications, especially in motion estimation due to the large number pixels involved. In this paper we propose using commodity computer graphics hardware for fast image interpolation. We use the full search block matching algorithm to illustrate the problems and limitations of using graphics hardware in this way.

Sirepo - Warp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagler, Robert; Moeller, Paul

Sirepo is an open source framework for cloud computing. The graphical user interface (GUI) for Sirepo, also known as the client, executes in any HTML5 compliant web browser on any computing platform, including tablets. The client is built in JavaScript, making use of the following open source libraries: Bootstrap, which is fundamental for cross-platform web applications; AngularJS, which provides a model–view–controller (MVC) architecture and GUI components; and D3.js, which provides interactive plots and data-driven transformations. The Sirepo server is built on the following Python technologies: Flask, which is a lightweight framework for web development; Jin-ja, which is a secure andmore » widely used templating language; and Werkzeug, a utility library that is compliant with the WSGI standard. We use Nginx as the HTTP server and proxy, which provides a scalable event-driven architecture. The physics codes supported by Sirepo execute inside a Docker container. One of the codes supported by Sirepo is Warp. Warp is a particle-in-cell (PIC) code de-signed to simulate high-intensity charged particle beams and plasmas in both the electrostatic and electromagnetic regimes, with a wide variety of integrated physics models and diagnostics. At pre-sent, Sirepo supports a small subset of Warp’s capabilities. Warp is open source and is part of the Berkeley Lab Accelerator Simulation Toolkit.« less

Sparse/DCT (S/DCT) two-layered representation of prediction residuals for video coding.

PubMed

Kang, Je-Won; Gabbouj, Moncef; Kuo, C-C Jay

2013-07-01

In this paper, we propose a cascaded sparse/DCT (S/DCT) two-layer representation of prediction residuals, and implement this idea on top of the state-of-the-art high efficiency video coding (HEVC) standard. First, a dictionary is adaptively trained to contain featured patterns of residual signals so that a high portion of energy in a structured residual can be efficiently coded via sparse coding. It is observed that the sparse representation alone is less effective in the R-D performance due to the side information overhead at higher bit rates. To overcome this problem, the DCT representation is cascaded at the second stage. It is applied to the remaining signal to improve coding efficiency. The two representations successfully complement each other. It is demonstrated by experimental results that the proposed algorithm outperforms the HEVC reference codec HM5.0 in the Common Test Condition.

FBCOT: a fast block coding option for JPEG 2000

NASA Astrophysics Data System (ADS)

Taubman, David; Naman, Aous; Mathew, Reji

2017-09-01

Based on the EBCOT algorithm, JPEG 2000 finds application in many fields, including high performance scientific, geospatial and video coding applications. Beyond digital cinema, JPEG 2000 is also attractive for low-latency video communications. The main obstacle for some of these applications is the relatively high computational complexity of the block coder, especially at high bit-rates. This paper proposes a drop-in replacement for the JPEG 2000 block coding algorithm, achieving much higher encoding and decoding throughputs, with only modest loss in coding efficiency (typically < 0.5dB). The algorithm provides only limited quality/SNR scalability, but offers truly reversible transcoding to/from any standard JPEG 2000 block bit-stream. The proposed FAST block coder can be used with EBCOT's post-compression RD-optimization methodology, allowing a target compressed bit-rate to be achieved even at low latencies, leading to the name FBCOT (Fast Block Coding with Optimized Truncation).

Audiovisual quality evaluation of low-bitrate video

NASA Astrophysics Data System (ADS)

Winkler, Stefan; Faller, Christof

2005-03-01

Audiovisual quality assessment is a relatively unexplored topic. We designed subjective experiments for audio, video, and audiovisual quality using content and encoding parameters representative of video for mobile applications. Our focus were the MPEG-4 AVC (a.k.a. H.264) and AAC coding standards. Our goals in this study are two-fold: we want to understand the interactions between audio and video in terms of perceived audiovisual quality, and we use the subjective data to evaluate the prediction performance of our non-reference video and audio quality metrics.

Wireless visual sensor network resource allocation using cross-layer optimization

NASA Astrophysics Data System (ADS)

Bentley, Elizabeth S.; Matyjas, John D.; Medley, Michael J.; Kondi, Lisimachos P.

2009-01-01

In this paper, we propose an approach to manage network resources for a Direct Sequence Code Division Multiple Access (DS-CDMA) visual sensor network where nodes monitor scenes with varying levels of motion. It uses cross-layer optimization across the physical layer, the link layer and the application layer. Our technique simultaneously assigns a source coding rate, a channel coding rate, and a power level to all nodes in the network based on one of two criteria that maximize the quality of video of the entire network as a whole, subject to a constraint on the total chip rate. One criterion results in the minimal average end-to-end distortion amongst all nodes, while the other criterion minimizes the maximum distortion of the network. Our approach allows one to determine the capacity of the visual sensor network based on the number of nodes and the quality of video that must be transmitted. For bandwidth-limited applications, one can also determine the minimum bandwidth needed to accommodate a number of nodes with a specific target chip rate. Video captured by a sensor node camera is encoded and decoded using the H.264 video codec by a centralized control unit at the network layer. To reduce the computational complexity of the solution, Universal Rate-Distortion Characteristics (URDCs) are obtained experimentally to relate bit error probabilities to the distortion of corrupted video. Bit error rates are found first by using Viterbi's upper bounds on the bit error probability and second, by simulating nodes transmitting data spread by Total Square Correlation (TSC) codes over a Rayleigh-faded DS-CDMA channel and receiving that data using Auxiliary Vector (AV) filtering.

Dynamic frame resizing with convolutional neural network for efficient video compression

NASA Astrophysics Data System (ADS)

Kim, Jaehwan; Park, Youngo; Choi, Kwang Pyo; Lee, JongSeok; Jeon, Sunyoung; Park, JeongHoon

2017-09-01

In the past, video codecs such as vc-1 and H.263 used a technique to encode reduced-resolution video and restore original resolution from the decoder for improvement of coding efficiency. The techniques of vc-1 and H.263 Annex Q are called dynamic frame resizing and reduced-resolution update mode, respectively. However, these techniques have not been widely used due to limited performance improvements that operate well only under specific conditions. In this paper, video frame resizing (reduced/restore) technique based on machine learning is proposed for improvement of coding efficiency. The proposed method features video of low resolution made by convolutional neural network (CNN) in encoder and reconstruction of original resolution using CNN in decoder. The proposed method shows improved subjective performance over all the high resolution videos which are dominantly consumed recently. In order to assess subjective quality of the proposed method, Video Multi-method Assessment Fusion (VMAF) which showed high reliability among many subjective measurement tools was used as subjective metric. Moreover, to assess general performance, diverse bitrates are tested. Experimental results showed that BD-rate based on VMAF was improved by about 51% compare to conventional HEVC. Especially, VMAF values were significantly improved in low bitrate. Also, when the method is subjectively tested, it had better subjective visual quality in similar bit rate.

Problem-based learning using patient-simulated videos showing daily life for a comprehensive clinical approach

PubMed Central

Ohira, Yoshiyuki; Uehara, Takanori; Noda, Kazutaka; Suzuki, Shingo; Shikino, Kiyoshi; Kajiwara, Hideki; Kondo, Takeshi; Hirota, Yusuke; Ikusaka, Masatomi

2017-01-01

Objectives We examined whether problem-based learning tutorials using patient-simulated videos showing daily life are more practical for clinical learning, compared with traditional paper-based problem-based learning, for the consideration rate of psychosocial issues and the recall rate for experienced learning. Methods Twenty-two groups with 120 fifth-year students were each assigned paper-based problem-based learning and video-based problem-based learning using patient-simulated videos. We compared target achievement rates in questionnaires using the Wilcoxon signed-rank test and discussion contents diversity using the Mann-Whitney U test. A follow-up survey used a chi-square test to measure students’ recall of cases in three categories: video, paper, and non-experienced. Results Video-based problem-based learning displayed significantly higher achievement rates for imagining authentic patients (p=0.001), incorporating a comprehensive approach including psychosocial aspects (p<0.001), and satisfaction with sessions (p=0.001). No significant differences existed in the discussion contents diversity regarding the International Classification of Primary Care Second Edition codes and chapter types or in the rate of psychological codes. In a follow-up survey comparing video and paper groups to non-experienced groups, the rates were higher for video (χ2=24.319, p<0.001) and paper (χ2=11.134, p=0.001). Although the video rate tended to be higher than the paper rate, no significant difference was found between the two. Conclusions Patient-simulated videos showing daily life facilitate imagining true patients and support a comprehensive approach that fosters better memory. The clinical patient-simulated video method is more practical and clinical problem-based tutorials can be implemented if we create patient-simulated videos for each symptom as teaching materials.  PMID:28245193

A video to improve patient and surrogate understanding of cardiopulmonary resuscitation choices in the ICU: a randomized controlled trial.

PubMed

Wilson, Michael E; Krupa, Artur; Hinds, Richard F; Litell, John M; Swetz, Keith M; Akhoundi, Abbasali; Kashyap, Rahul; Gajic, Ognjen; Kashani, Kianoush

2015-03-01

To determine if a video depicting cardiopulmonary resuscitation and resuscitation preference options would improve knowledge and decision making among patients and surrogates in the ICU. Randomized, unblinded trial. Single medical ICU. Patients and surrogate decision makers in the ICU. The usual care group received a standard pamphlet about cardiopulmonary resuscitation and cardiopulmonary resuscitation preference options plus routine code status discussions with clinicians. The video group received usual care plus an 8-minute video that depicted cardiopulmonary resuscitation, showed a simulated hospital code, and explained resuscitation preference options. One hundred three patients and surrogates were randomized to usual care. One hundred five patients and surrogates were randomized to video plus usual care. Median total knowledge scores (0-15 points possible for correct answers) in the video group were 13 compared with 10 in the usual care group, p value of less than 0.0001. Video group participants had higher rates of understanding the purpose of cardiopulmonary resuscitation and resuscitation options and terminology and could correctly name components of cardiopulmonary resuscitation. No statistically significant differences in documented resuscitation preferences following the interventions were found between the two groups, although the trial was underpowered to detect such differences. A majority of participants felt that the video was helpful in cardiopulmonary resuscitation decision making (98%) and would recommend the video to others (99%). A video depicting cardiopulmonary resuscitation and explaining resuscitation preference options was associated with improved knowledge of in-hospital cardiopulmonary resuscitation options and cardiopulmonary resuscitation terminology among patients and surrogate decision makers in the ICU, compared with receiving a pamphlet on cardiopulmonary resuscitation. Patients and surrogates found the video helpful in decision making and would recommend the video to others.

Problem-based learning using patient-simulated videos showing daily life for a comprehensive clinical approach.

PubMed

Ikegami, Akiko; Ohira, Yoshiyuki; Uehara, Takanori; Noda, Kazutaka; Suzuki, Shingo; Shikino, Kiyoshi; Kajiwara, Hideki; Kondo, Takeshi; Hirota, Yusuke; Ikusaka, Masatomi

2017-02-27

We examined whether problem-based learning tutorials using patient-simulated videos showing daily life are more practical for clinical learning, compared with traditional paper-based problem-based learning, for the consideration rate of psychosocial issues and the recall rate for experienced learning. Twenty-two groups with 120 fifth-year students were each assigned paper-based problem-based learning and video-based problem-based learning using patient-simulated videos. We compared target achievement rates in questionnaires using the Wilcoxon signed-rank test and discussion contents diversity using the Mann-Whitney U test. A follow-up survey used a chi-square test to measure students' recall of cases in three categories: video, paper, and non-experienced. Video-based problem-based learning displayed significantly higher achievement rates for imagining authentic patients (p=0.001), incorporating a comprehensive approach including psychosocial aspects (p<0.001), and satisfaction with sessions (p=0.001). No significant differences existed in the discussion contents diversity regarding the International Classification of Primary Care Second Edition codes and chapter types or in the rate of psychological codes. In a follow-up survey comparing video and paper groups to non-experienced groups, the rates were higher for video (χ 2 =24.319, p<0.001) and paper (χ 2 =11.134, p=0.001). Although the video rate tended to be higher than the paper rate, no significant difference was found between the two. Patient-simulated videos showing daily life facilitate imagining true patients and support a comprehensive approach that fosters better memory. The clinical patient-simulated video method is more practical and clinical problem-based tutorials can be implemented if we create patient-simulated videos for each symptom as teaching materials.

MODIS NDVI Change Detection Techniques and Products Used in the Near Real Time ForWarn System for Detecting, Monitoring, and Analyzing Regional Forest Disturbances

NASA Technical Reports Server (NTRS)

Spruce, Joseph P.; Hargrove, William; Gasser, Jerry; Smoot, James; Kuper, Philip D.

2014-01-01

This presentation discusses MODIS NDVI change detection methods and products used in the ForWarn Early Warning System (EWS) for near real time (NRT) recognition and tracking of regionally evident forest disturbances throughout the conterminous US (CONUS). The latter has provided NRT forest change products to the forest health protection community since 2010, using temporally processed MODIS Aqua and Terra NDVI time series data to currently compute and post 6 different forest change products for CONUS every 8 days. Multiple change products are required to improve detectability and to more fully assess the nature of apparent disturbances. Each type of forest change product reports per pixel percent change in NDVI for a given 24 day interval, comparing current versus a given historical baseline NDVI. EMODIS 7 day expedited MODIS MOD13 data are used to obtain current and historical NDVIs, respectively. Historical NDVI data is processed with Time Series Product Tool (TSPT); and 2) the Phenological Parameters Estimation Tool (PPET) software. While each change products employ maximum value compositing (MVC) of NDVI, the design of specific products primarily differs in terms of the historical baseline. The three main change products use either 1, 3, or all previous years of MVC NDVI as a baseline. Another product uses an Adaptive Length Compositing (ALC) version of MVC to derive an alternative current NDVI that is the freshest quality NDVI as opposed to merely the MVC NDVI across a 24 day time frame. The ALC approach can improve detection speed by 8 to 16 days. ForWarn also includes 2 change products that improve detectability of forest disturbances in lieu of climatic fluctuations, especially in the spring and fall. One compares current MVC NDVI to the zonal maximum under the curve NDVI per pheno-region cluster class, considering all previous years in the MODIS record. The other compares current maximum NDVI to the mean of maximum NDVI for all previous MODIS years.

Reducing Older Driver Motor Vehicle Collisions via Earlier Cataract Surgery

PubMed Central

Mennemeyer, Stephen T.; Owsley, Cynthia; McGwin, Gerald

2013-01-01

Older adults who undergo cataract extraction have roughly half the rate of motor vehicle collision (MVC) involvement per mile driven compared to cataract patients who do not elect cataract surgery. Currently in the U.S., most insurers do not allow payment for cataract surgery based upon the findings of a vision exam unless accompanied by an individual’s complaint of visual difficulties that seriously interfere with driving or other daily activities and individuals themselves may be slow or reluctant to complain and seek relief. As a consequence, surgery tends to occur after significant vision problems have emerged. We hypothesize that a proactive policy encouraging cataract surgery earlier for a lesser level of complaint would significantly reduce MVCs among older drivers. We used a Monte Carlo model to simulate the MVC experience of the U.S. population from age 60 to 89 under alternative protocols for the timing of cataract surgery which we call “Current Practice” (CP) and “Earlier Surgery” (ES). Our base model finds, from a societal perspective with undiscounted 2010 dollars, that switching to ES from CP reduces by about 21% the average number of MVCs, fatalities, and MVC cost per person. The net effect on total cost – all MVC costs plus cataract surgery expenditures -- is a reduction of about 16%. Quality Adjusted Life Years would increase by about 5%. From the perspective of payers for healthcare, the switch would increase cataract surgery expenditure for ages 65+ by about 8% and for ages 60 to 64 by about 47% but these expenditures are substantially offset after age 65 by reductions in the medical and emergency services component of MVC cost. Similar results occur with discounting at 3% and with various sensitivity analyses. We conclude that a policy of ES would significantly reduce MVCs and their associated consequences. PMID:23369786

Handgrip force steadiness in young and older adults: a reproducibility study.

PubMed

Blomkvist, Andreas W; Eika, Fredrik; de Bruin, Eling D; Andersen, Stig; Jorgensen, Martin

2018-04-02

Force steadiness is a quantitative measure of the ability to control muscle tonus. It is an independent predictor of functional performance and has shown to correlate well with different degrees of motor impairment following stroke. Despite being clinically relevant, few studies have assessed the validity of measuring force steadiness. The aim of this study was to explore the reproducibility of handgrip force steadiness, and to assess age difference in steadiness. Intrarater reproducibility (the degree to which a rating gives consistent result on separate occasions) was investigated in a test-retest design with seven days between sessions. Ten young and thirty older adults were recruited and handgrip steadiness was tested at 5%, 10% and 25% of maximum voluntary contraction (MVC) using Nintendo Wii Balance Board (WBB). Coefficients of variation were calculated from the mean force produced (CVM) and the target force (CVT). Area between the force curve and the target force line (Area) was also calculated. For the older adults we explored reliability using intraclass correlation coefficient (ICC) and agreement using standard error of measurement (SEM), limits of agreement (LOA) and smallest real difference (SRD). A systematic improvement in handgrip steadiness was found between sessions for all measures (CVM, CVT, Area). CVM and CVT at 5% of MVC showed good to high reliability, while Area had poor reliability for all percentages of MVC. Averaged ICC for CVM, CVT and Area was 0.815, 0.806 and 0.464, respectively. Averaged ICC on 5%, 10%, and 25% of MVC was 0.751, 0.667 and 0.668, respectively. Measures of agreement showed similar trends with better results for CVM and CVT than for Area. Young adults had better handgrip steadiness than older adults across all measures. The CVM and CVT measures demonstrated good reproducibility at lower percentages of MVC using the WBB, and could become relevant measures in the clinical setting. The Area measure had poor reproducibility. Young adults have better handgrip steadiness than old adults.

Reduction in motor vehicle collisions following treatment of sleep apnoea with nasal CPAP

PubMed Central

George, C

2001-01-01

BACKGROUND—Patients with untreated obstructive sleep apnoea (OSA) have increased motor vehicle collisions (MVCs). When successfully treated, they report improved driving and fewer mishaps, but there are few objective data to confirm this. A study was therefore undertaken to examine actual MVC data in a large group of patients with OSA before and after treatment with continuous positive airway pressure (CPAP) compared with a control group matched for age, sex, and type of driver's licence (commercial or non-commercial).
METHODS—Two hundred and ten patients of mean (SD) age 52 (11) years, body mass index (BMI) 35.5 (10) kg/m2, apnoea/hypopnoea index (AHI) 54 (29) events/h were treated with CPAP for at least 3 years. MVC records were obtained from the Ontario Ministry of Transportation (MTO) database for patients and an equal number of randomly selected control drivers. MVC rates were compared for 3 years before and after CPAP therapy for patients and for the corresponding time frames for controls.
RESULTS—Untreated patients with OSA had more MVCs than controls (mean (SD) MVCs/driver/year 0.18 (0.29) v 0.06 (0.17), p<0.001). Following CPAP treatment the number of MVCs/driver/year fell to normal (0.06(0.17)) while, in controls, the MVC rate was unchanged over time (0.06 (0.17) v 0.07 (0.18), p=NS). Thus, the change in MVCs over time between the groups was very significant (change = -0.12 (95% CI -0.17 to -0.06), p<0.001)). The MVC rate in untreated patients (n=27) remained high over time. Driving exposure was not different following CPAP.
CONCLUSIONS—The risk of MVCs due to OSA is removed when patients are treated with CPAP. As such, any restrictions on driving because of OSA could be safely removed after treatment.

 PMID:11413347

The influence of bar diameter on neuromuscular strength and activation: inferences from an isometric unilateral bench press.

PubMed

Fioranelli, Douglas; Lee, C Matthew

2008-05-01

The purpose of this study was to examine the influence of two different bar diameters on neuromuscular activation and strength. The bar diameters used reflected a standard Olympic bar (28 mm (1.1 inch); THIN) and a larger fat bar (51 mm [2 inch]; THICK). Eighteen healthy men (age 25.0 +/- 1 years) were assessed for their maximal voluntary contraction (MVC) during a unilateral isometric bench press exercise with the 2 bar types at 2 different joint angles (angle 1 and angle 2; elbow joint at approximately 45 and 90 degrees , respectively). Additionally, on a separate day, subjects performed three 10-second isometric repetitions at an intensity of 80% MVC using the 2 different bars at angle 1 and angle 2. Electromyographic recordings were collected in the pectoralis major and the muscles of the forearm flexor region at a sampling rate of 1000 Hz during the second day of testing. Analysis of variance was used to examine differences in MVC between bars and also examine between bar differences in electromyographic activity for each muscle group at each joint angle. A significance level of 0.05 was used for all tests. MVC was not different between bar types, although there was a main effect of joint angle on MVC such that it was greater at angle 2. There was a main effect of bar at both angles for the forearm muscles and at angle 1 for the pectoralis such that electromyographic activity was greater with THIN. Our data do not support the hypothesis that bar diameter influences performance during an isometric bench press exercise. However, higher electromyographic activity with THIN suggests greater neuromuscular activation with a standard Olympic bar as opposed to a larger diameter "fat" bar. Although our data do not support the use of a fat bar for increasing neuromuscular activation, these findings should be confirmed in other resistance training exercises.

Effects of 4 weeks of low-load unilateral resistance training, with and without blood flow restriction, on strength, thickness, V wave, and H reflex of the soleus muscle in men.

PubMed

Colomer-Poveda, David; Romero-Arenas, Salvador; Vera-Ibáñez, Antonio; Viñuela-García, Manuel; Márquez, Gonzalo

2017-07-01

To test the effects of 4 weeks of unilateral low-load resistance training (LLRT), with and without blood flow restriction (BFR), on maximal voluntary contraction (MVC), muscle thickness, volitional wave (V wave), and Hoffmann reflex (H reflex) of the soleus muscle. Twenty-two males were randomly distributed into three groups: a control group (CTR; n = 8); a low-load blood flow restriction resistance training group (BFR-LLRT; n = 7), who were an inflatable cuff to occlude blood flow; and a low-load resistance training group without blood flow restriction (LLRT; n = 7). The training consisted of four sets of unilateral isometric LLRT (25% of MVC) three times a week over 4 weeks. MVC increased 33% (P < 0.001) and 22% (P < 0.01) in the trained leg of both BFR-LLRT and LLRT groups, respectively. The soleus thickness increased 9.5% (P < 0.001) and 6.5% (P < 0.01) in the trained leg of both BFR-LLRT and LLRT groups, respectively. However, neither MVC nor thickness changed in either of the legs tested in the CTR group (MVC -1 and -5%, and muscle thickness 1.9 and 1.2%, for the control and trained leg, respectively). Moreover, V wave and H reflex did not change significantly in all the groups studied (V wave /M wave ratio -7.9 and -2.6%, and H max /M max ratio -3.8 and -4%, for the control and trained leg, respectively). Collectively, the present data suggest that in spite of the changes occurring in soleus strength and thickness, 4 weeks of low-load resistance training, with or without BFR, does not cause any change in neural drive or motoneuronal excitability.

Fatigue-related firing of distal muscle nociceptors reduces voluntary activation of proximal muscles of the same limb.

PubMed

Kennedy, David S; McNeil, Chris J; Gandevia, Simon C; Taylor, Janet L

2014-02-15

With fatiguing exercise, firing of group III/IV muscle afferents reduces voluntary activation and force of the exercised muscles. These afferents can also act across agonist/antagonist pairs, reducing voluntary activation and force in nonfatigued muscles. We hypothesized that maintained firing of group III/IV muscle afferents after a fatiguing adductor pollicis (AP) contraction would decrease voluntary activation and force of AP and ipsilateral elbow flexors. In two experiments (n = 10) we examined voluntary activation of AP and elbow flexors by measuring changes in superimposed twitches evoked by ulnar nerve stimulation and transcranial magnetic stimulation of the motor cortex, respectively. Inflation of a sphygmomanometer cuff after a 2-min AP maximal voluntary contraction (MVC) blocked circulation of the hand for 2 min and maintained firing of group III/IV muscle afferents. After a 2-min AP MVC, maximal AP voluntary activation was lower with than without ischemia (56.2 ± 17.7% vs. 76.3 ± 14.6%; mean ± SD; P < 0.05) as was force (40.3 ± 12.8% vs. 57.1 ± 13.8% peak MVC; P < 0.05). Likewise, after a 2-min AP MVC, elbow flexion voluntary activation was lower with than without ischemia (88.3 ± 7.5% vs. 93.6 ± 3.9%; P < 0.05) as was torque (80.2 ± 4.6% vs. 86.6 ± 1.0% peak MVC; P < 0.05). Pain during ischemia was reported as Moderate to Very Strong. Postfatigue firing of group III/IV muscle afferents from the hand decreased voluntary drive and force of AP. Moreover, this effect decreased voluntary drive and torque of proximal unfatigued muscles, the elbow flexors. Fatigue-sensitive group III/IV muscle nociceptors act to limit voluntary drive not only to fatigued muscles but also to unfatigued muscles within the same limb.

Patterns in deer-related traffic injuries over a decade: the Mayo clinic experience

PubMed Central

2010-01-01

Background Our American College of Surgeons Level 1 Trauma Center serves a rural population. As a result, there is a unique set of accidents that are not present in an urban environment such as deer related motor vehicle crashes (dMVC). We characterized injury patterns between motorcycle/all-terrain vehicles (MCC) and automobile (MVC) crashes related to dMVC (deer motor vehicle crash) with the hypotheses that MCC will present with higher Injury Severity Score (ISS) and that it would be related to whether the driver struck the deer or swerved. Methods The records of 157 consecutive patients evaluated at our institution for injury related to dMVC from January 1st, 1997 to December 31st, 2006 were reviewed from our prospectively collected trauma database. Demographic, clinical, and crash specific parameters were abstracted. Injury severity was analyzed by the Abbreviated Injury Scale score for each body region as well as the overall Injury Severity Score (ISS). Results Motorcycle crashes presented with a higher median ISS than MVCs (14 vs 5, p < 0.001). Median Abbreviated Injury Score (AIS) of the spine for MCC riders was higher (3 vs 0, p < 0.001) if they swerved rather than collided. Seventy-seven percent of riders were not wearing a helmet which did not result in a statistically significant increase in median ISS (16 vs 10), head AIS (2 vs 0) or spine AIS (0 vs 0). Within the MVC group, there was no difference between swerving and hitting the deer in any AIS group. Forty-seven percent of drivers were not wearing seat belts which resulted in similar median ISS (6 vs 5) and AIS of all body regions. Conclusions Motorcycle operators suffered higher ISS. There were no significant differences in median ISS if a driver involved in a deer-related motor vehicle crash swerved rather than collided, was helmeted, or restrained. PMID:20716341

Patterns in deer-related traffic injuries over a decade: the Mayo Clinic experience.

PubMed

Smoot, Dustin L; Zielinski, Martin D; Cullinane, Daniel C; Jenkins, Donald H; Schiller, Henry J; Sawyer, Mark D

2010-08-17

Our American College of Surgeons Level 1 Trauma Center serves a rural population. As a result, there is a unique set of accidents that are not present in an urban environment such as deer related motor vehicle crashes (dMVC). We characterized injury patterns between motorcycle/all-terrain vehicles (MCC) and automobile (MVC) crashes related to dMVC (deer motor vehicle crash) with the hypotheses that MCC will present with higher Injury Severity Score (ISS) and that it would be related to whether the driver struck the deer or swerved. The records of 157 consecutive patients evaluated at our institution for injury related to dMVC from January 1st, 1997 to December 31st, 2006 were reviewed from our prospectively collected trauma database. Demographic, clinical, and crash specific parameters were abstracted. Injury severity was analyzed by the Abbreviated Injury Scale score for each body region as well as the overall Injury Severity Score (ISS). Motorcycle crashes presented with a higher median ISS than MVCs (14 vs 5, p < 0.001). Median Abbreviated Injury Score (AIS) of the spine for MCC riders was higher (3 vs 0, p < 0.001) if they swerved rather than collided. Seventy-seven percent of riders were not wearing a helmet which did not result in a statistically significant increase in median ISS (16 vs 10), head AIS (2 vs 0) or spine AIS (0 vs 0).Within the MVC group, there was no difference between swerving and hitting the deer in any AIS group. Forty-seven percent of drivers were not wearing seat belts which resulted in similar median ISS (6 vs 5) and AIS of all body regions. Motorcycle operators suffered higher ISS. There were no significant differences in median ISS if a driver involved in a deer-related motor vehicle crash swerved rather than collided, was helmeted, or restrained.

ACE ID genotype and the muscle strength and size response to unilateral resistance training.

PubMed

Pescatello, Linda S; Kostek, Matthew A; Gordish-Dressman, Heather; Thompson, Paul D; Seip, Richard L; Price, Thomas B; Angelopoulos, Theodore J; Clarkson, Priscilla M; Gordon, Paul M; Moyna, Niall M; Visich, Paul S; Zoeller, Robert F; Devaney, Joseph M; Hoffman, Eric P

2006-06-01

To examine associations among the angiotensin I-converting enzyme (ACE) insertion (I)/deletion (D) polymorphism and the response to a 12-wk (2 d.wk) unilateral, upper-arm resistance training (RT) program in the trained (T, nondominant) and untrained (UT, dominant) arms. Subjects were 631 (mean+/-SEM, 24.2+/-0.2 yr) white (80%) men (42%) and women (58%). The ACE ID genotype was in Hardy-Weinberg equilibrium with frequencies of 23.1, 46.1, and 30.8% for ACE II, ID, and DD, respectively (chi=1.688, P=0.430). Maximum voluntary contraction (MVC) and one-repetition maximum (1RM) assessed peak elbow flexor muscle strength. Magnetic resonance imaging measured biceps muscle cross-sectional area (CSA). Multiple variable and repeated-measures ANCOVA tested whether muscle strength and size differed at baseline and pre- to post-RT among T and UT and ACE ID genotype. Baseline muscle strength and size were greater in UT than T (P<0.001) and did not differ among ACE ID genotype in either arm (P >or= 0.05). In T, MVC increases were greater for ACE II/ID (22%) than DD (17%) (P<0.05), whereas 1RM (51%) and CSA (19%) gains were not different among ACE ID genotype pre- to post-RT (P >or= 0.05). In UT, MVC increased among ACE II/ID (7%) (P<0.001) but was similar among ACE DD (2%) pre- to post-RT (P >or= 0.05). In UT, 1RM (11%) and CSA (2%) increases were greater for ACE DD/ID than ACE II (1RM, 7%; CSA, -0.1%) (P<0.05). ACE ID genotype explained approximately 1% of the MVC response to RT in T and approximately 2% of MVC, 2% of 1RM, and 4% of CSA response in UT (P<0.05). ACE ID genotype is associated with the contralateral effects of unilateral RT, perhaps more so than with the muscle strength and size adaptations that result from RT.

Ergonomic analysis of primary and assistant surgical roles.

PubMed

Zihni, Ahmed M; Cavallo, Jaime A; Ray, Shuddhadeb; Ohu, Ikechukwu; Cho, Sohyung; Awad, Michael M

2016-06-15

Laparoscopic surgery is associated with a high degree of ergonomic stress. However, the stress associated with surgical assisting is not known. In this study, we compare the ergonomic stress associated with primary and assistant surgical roles during laparoscopic surgery. We hypothesize that higher ergonomic stress will be detected in the primary operating surgeon when compared with the surgical assistant. One right-hand dominant attending surgeon performed 698 min of laparoscopic surgery over 13 procedures (222 min primary and 476 min assisting), whereas electromyography data were collected from bilateral biceps, triceps, deltoids, and trapezius muscles. Data were analyzed in 1-min segments. Average muscle activation as quantified by maximal voluntary contraction (%MVC) was calculated for each muscle group during primary surgery and assisting. We compared mean %MVC values with unpaired t-tests. Activation of right (R) biceps and triceps muscle groups is significantly elevated while operating when compared with assisting (R biceps primary: 5.47 ± 0.21 %MVC, assistant: 3.93 ± 0.11, P < 0.001; R triceps primary: 6.53 ± 0.33 %MVC, assistant: 5.48 ± 0.18, P = 0.002). Mean activation of the left trapezius muscle group is elevated during assisting (primary: 4.33 ± 0.26 %MVC, assistant: 5.70 ± 0.40, P = 0.024). No significance difference was noted in the other muscle groups (R deltoid, R trapezius, left [L] biceps, L triceps, and L deltoid). We used surface electromyography to quantify ergonomic differences between operating and assisting. Surgical assisting was associated with similar and occasionally higher levels of muscle activation compared with primary operating. These findings suggest that surgical assistants face significant ergonomic stress, just as operating surgeons do. Steps must be taken to recognize and mitigate this stress in both operating surgeons and assistants. Copyright © 2016 Elsevier Inc. All rights reserved.

Eccentric muscle damage has variable effects on motor unit recruitment thresholds and discharge patterns in elbow flexor muscles.

PubMed

Dartnall, Tamara J; Rogasch, Nigel C; Nordstrom, Michael A; Semmler, John G

2009-07-01

The purpose of this study was to determine the effect of eccentric muscle damage on recruitment threshold force and repetitive discharge properties of low-threshold motor units. Ten subjects performed four tasks involving isometric contraction of elbow flexors while electromyographic (EMG) data were recorded from human biceps brachii and brachialis muscles. Tasks were 1) maximum voluntary contraction (MVC); 2) constant-force contraction at various submaximal targets; 3) motor unit recruitment threshold task; and 4) minimum motor unit discharge rate task. These tasks were performed on three separate days before, immediately after, and 24 h after eccentric exercise of elbow flexor muscles. MVC force declined (42%) immediately after exercise and remained depressed (29%) 24 h later, indicative of muscle damage. Mean motor unit recruitment threshold for biceps brachii was 8.4+/-4.2% MVC, (n=34) before eccentric exercise, and was reduced by 41% (5.0+/-3.0% MVC, n=34) immediately after and by 39% (5.2+/-2.5% MVC, n=34) 24 h after exercise. No significant changes in motor unit recruitment threshold were observed in the brachialis muscle. However, for the minimum tonic discharge rate task, motor units in both muscles discharged 11% faster (10.8+/-2.0 vs. 9.7+/-1.7 Hz) immediately after (n=29) exercise compared with that before (n=32). The minimum discharge rate variability was greater in brachialis muscle immediately after exercise (13.8+/-3.1%) compared with that before (11.9+/-3.1%) and 24 h after exercise (11.7+/-2.4%). No significant changes in minimum discharge rate variability were observed in the biceps brachii motor units after exercise. These results indicate that muscle damage from eccentric exercise alters motor unit recruitment thresholds for >or=24 h, but the effect is not the same in the different elbow flexor muscles.

Protection of HEVC Video Delivery in Vehicular Networks with RaptorQ Codes

PubMed Central

Martínez-Rach, Miguel; López, Otoniel; Malumbres, Manuel Pérez

2014-01-01

With future vehicles equipped with processing capability, storage, and communications, vehicular networks will become a reality. A vast number of applications will arise that will make use of this connectivity. Some of them will be based on video streaming. In this paper we focus on HEVC video coding standard streaming in vehicular networks and how it deals with packet losses with the aid of RaptorQ, a Forward Error Correction scheme. As vehicular networks are packet loss prone networks, protection mechanisms are necessary if we want to guarantee a minimum level of quality of experience to the final user. We have run simulations to evaluate which configurations fit better in this type of scenarios. PMID:25136675

Subjective quality evaluation of low-bit-rate video

NASA Astrophysics Data System (ADS)

Masry, Mark; Hemami, Sheila S.; Osberger, Wilfried M.; Rohaly, Ann M.

2001-06-01

A subjective quality evaluation was performed to qualify vie4wre responses to visual defects that appear in low bit rate video at full and reduced frame rates. The stimuli were eight sequences compressed by three motion compensated encoders - Sorenson Video, H.263+ and a Wavelet based coder - operating at five bit/frame rate combinations. The stimulus sequences exhibited obvious coding artifacts whose nature differed across the three coders. The subjective evaluation was performed using the Single Stimulus Continuos Quality Evaluation method of UTI-R Rec. BT.500-8. Viewers watched concatenated coded test sequences and continuously registered the perceived quality using a slider device. Data form 19 viewers was colleted. An analysis of their responses to the presence of various artifacts across the range of possible coding conditions and content is presented. The effects of blockiness and blurriness on perceived quality are examined. The effects of changes in frame rate on perceived quality are found to be related to the nature of the motion in the sequence.

Novel inter and intra prediction tools under consideration for the emerging AV1 video codec

NASA Astrophysics Data System (ADS)

Joshi, Urvang; Mukherjee, Debargha; Han, Jingning; Chen, Yue; Parker, Sarah; Su, Hui; Chiang, Angie; Xu, Yaowu; Liu, Zoe; Wang, Yunqing; Bankoski, Jim; Wang, Chen; Keyder, Emil

2017-09-01

Google started the WebM Project in 2010 to develop open source, royalty- free video codecs designed specifically for media on the Web. The second generation codec released by the WebM project, VP9, is currently served by YouTube, and enjoys billions of views per day. Realizing the need for even greater compression efficiency to cope with the growing demand for video on the web, the WebM team embarked on an ambitious project to develop a next edition codec AV1, in a consortium of major tech companies called the Alliance for Open Media, that achieves at least a generational improvement in coding efficiency over VP9. In this paper, we focus primarily on new tools in AV1 that improve the prediction of pixel blocks before transforms, quantization and entropy coding are invoked. Specifically, we describe tools and coding modes that improve intra, inter and combined inter-intra prediction. Results are presented on standard test sets.

Representing videos in tangible products

NASA Astrophysics Data System (ADS)

Fageth, Reiner; Weiting, Ralf

2014-03-01

Videos can be taken with nearly every camera, digital point and shoot cameras, DSLRs as well as smartphones and more and more with so-called action cameras mounted on sports devices. The implementation of videos while generating QR codes and relevant pictures out of the video stream via a software implementation was contents in last years' paper. This year we present first data about what contents is displayed and how the users represent their videos in printed products, e.g. CEWE PHOTOBOOKS and greeting cards. We report the share of the different video formats used, the number of images extracted out of the video in order to represent the video, the positions in the book and different design strategies compared to regular books.

Understanding the Delay in Onset of Paget’s Disease of Bone

DTIC Science & Technology

2014-09-01

Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

Efficient depth intraprediction method for H.264/AVC-based three-dimensional video coding

NASA Astrophysics Data System (ADS)

Oh, Kwan-Jung; Oh, Byung Tae

2015-04-01

We present an intracoding method that is applicable to depth map coding in multiview plus depth systems. Our approach combines skip prediction and plane segmentation-based prediction. The proposed depth intraskip prediction uses the estimated direction at both the encoder and decoder, and does not need to encode residual data. Our plane segmentation-based intraprediction divides the current block into biregions, and applies a different prediction scheme for each segmented region. This method avoids incorrect estimations across different regions, resulting in higher prediction accuracy. Simulation results demonstrate that the proposed scheme is superior to H.264/advanced video coding intraprediction and has the ability to improve the subjective rendering quality.

Recent advances in multiview distributed video coding

NASA Astrophysics Data System (ADS)

Dufaux, Frederic; Ouaret, Mourad; Ebrahimi, Touradj

2007-04-01

We consider dense networks of surveillance cameras capturing overlapped images of the same scene from different viewing directions, such a scenario being referred to as multi-view. Data compression is paramount in such a system due to the large amount of captured data. In this paper, we propose a Multi-view Distributed Video Coding approach. It allows for low complexity / low power consumption at the encoder side, and the exploitation of inter-view correlation without communications among the cameras. We introduce a combination of temporal intra-view side information and homography inter-view side information. Simulation results show both the improvement of the side information, as well as a significant gain in terms of coding efficiency.

Mass-storage management for distributed image/video archives

NASA Astrophysics Data System (ADS)

Franchi, Santina; Guarda, Roberto; Prampolini, Franco

1993-04-01

The realization of image/video database requires a specific design for both database structures and mass storage management. This issue has addressed the project of the digital image/video database system that has been designed at IBM SEMEA Scientific & Technical Solution Center. Proper database structures have been defined to catalog image/video coding technique with the related parameters, and the description of image/video contents. User workstations and servers are distributed along a local area network. Image/video files are not managed directly by the DBMS server. Because of their wide size, they are stored outside the database on network devices. The database contains the pointers to the image/video files and the description of the storage devices. The system can use different kinds of storage media, organized in a hierarchical structure. Three levels of functions are available to manage the storage resources. The functions of the lower level provide media management. They allow it to catalog devices and to modify device status and device network location. The medium level manages image/video files on a physical basis. It manages file migration between high capacity media and low access time media. The functions of the upper level work on image/video file on a logical basis, as they archive, move and copy image/video data selected by user defined queries. These functions are used to support the implementation of a storage management strategy. The database information about characteristics of both storage devices and coding techniques are used by the third level functions to fit delivery/visualization requirements and to reduce archiving costs.

Interframe vector wavelet coding technique

NASA Astrophysics Data System (ADS)

Wus, John P.; Li, Weiping

1997-01-01

Wavelet coding is often used to divide an image into multi- resolution wavelet coefficients which are quantized and coded. By 'vectorizing' scalar wavelet coding and combining this with vector quantization (VQ), vector wavelet coding (VWC) can be implemented. Using a finite number of states, finite-state vector quantization (FSVQ) takes advantage of the similarity between frames by incorporating memory into the video coding system. Lattice VQ eliminates the potential mismatch that could occur using pre-trained VQ codebooks. It also eliminates the need for codebook storage in the VQ process, thereby creating a more robust coding system. Therefore, by using the VWC coding method in conjunction with the FSVQ system and lattice VQ, the formulation of a high quality very low bit rate coding systems is proposed. A coding system using a simple FSVQ system where the current state is determined by the previous channel symbol only is developed. To achieve a higher degree of compression, a tree-like FSVQ system is implemented. The groupings are done in this tree-like structure from the lower subbands to the higher subbands in order to exploit the nature of subband analysis in terms of the parent-child relationship. Class A and Class B video sequences from the MPEG-IV testing evaluations are used in the evaluation of this coding method.

MPCM: a hardware coder for super slow motion video sequences

NASA Astrophysics Data System (ADS)

Alcocer, Estefanía; López-Granado, Otoniel; Gutierrez, Roberto; Malumbres, Manuel P.

2013-12-01

In the last decade, the improvements in VLSI levels and image sensor technologies have led to a frenetic rush to provide image sensors with higher resolutions and faster frame rates. As a result, video devices were designed to capture real-time video at high-resolution formats with frame rates reaching 1,000 fps and beyond. These ultrahigh-speed video cameras are widely used in scientific and industrial applications, such as car crash tests, combustion research, materials research and testing, fluid dynamics, and flow visualization that demand real-time video capturing at extremely high frame rates with high-definition formats. Therefore, data storage capability, communication bandwidth, processing time, and power consumption are critical parameters that should be carefully considered in their design. In this paper, we propose a fast FPGA implementation of a simple codec called modulo-pulse code modulation (MPCM) which is able to reduce the bandwidth requirements up to 1.7 times at the same image quality when compared with PCM coding. This allows current high-speed cameras to capture in a continuous manner through a 40-Gbit Ethernet point-to-point access.

A Comparison of Cigarette- and Hookah-Related Videos on YouTube

PubMed Central

Carroll, Mary V.; Shensa, Ariel; Primack, Brian A.

2013-01-01

Objective YouTube is now the second most visited site on the Internet. We aimed to compare characteristics of and messages conveyed by cigarette- and hookah-related videos on YouTube. Methods Systematic search procedures yielded 66 cigarette-related and 61 hookah-related videos. After 3 trained qualitative researchers used an iterative approach to develop and refine definitions for the coding of variables, 2 of them independently coded each video for content including positive and negative associations with smoking and major content type. Results Median view counts were 606,884 for cigarettes and 102,307 for hookahs (P<.001). However, the number of comments per 1,000 views was significantly lower for cigarette-related videos than for hookah-related videos (1.6 vs 2.5, P=.003). There was no significant difference in the number of “like” designations per 100 reactions (91 vs. 87, P=.39). Cigarette-related videos were less likely than hookah-related videos to portray tobacco use in a positive light (24% vs. 92%, P<.001). In addition, cigarette-related videos were more likely to be of high production quality (42% vs. 5%, P<.001), to mention short-term consequences (50% vs. 18%, P<.001) and long-term consequences (44% vs. 2%, P<.001) of tobacco use, to contain explicit antismoking messages (39% vs. 0%, P<.001), and to provide specific information on how to quit tobacco use (21% vs. 0%, P<.001). Conclusions Although Internet user–generated videos related to cigarette smoking often acknowledge harmful consequences and provide explicit antismoking messages, hookah-related videos do not. It may be valuable for public health programs to correct common misconceptions regarding hookah use. PMID:22363069

Study of information transfer optimization for communication satellites

NASA Technical Reports Server (NTRS)

Odenwalder, J. P.; Viterbi, A. J.; Jacobs, I. M.; Heller, J. A.

1973-01-01

The results are presented of a study of source coding, modulation/channel coding, and systems techniques for application to teleconferencing over high data rate digital communication satellite links. Simultaneous transmission of video, voice, data, and/or graphics is possible in various teleconferencing modes and one-way, two-way, and broadcast modes are considered. A satellite channel model including filters, limiter, a TWT, detectors, and an optimized equalizer is treated in detail. A complete analysis is presented for one set of system assumptions which exclude nonlinear gain and phase distortion in the TWT. Modulation, demodulation, and channel coding are considered, based on an additive white Gaussian noise channel model which is an idealization of an equalized channel. Source coding with emphasis on video data compression is reviewed, and the experimental facility utilized to test promising techniques is fully described.

A review of serious injuries and deaths among car occupants after motor vehicle crashes in Sweden from 1987 to 1994.

PubMed

Boström, L; Wladis, A; Nilsson, B

2001-01-01

Car occupants injured in motor vehicle crashes (MVC) are a common problem in emergency departments. The aims of this study were to determine the incidence over time, according to the type of injury, age and sex distribution, mortality rate and geographical differences among all patients admitted to Swedish hospitals because of MVC injuries. Between 1987 and 1994, Swedish hospitals admitted 37,871 persons (51,348 admissions) who had been involved in MVC as drivers or passengers. There were 23,369 men and 14,502 women. The annual frequency of hospital admissions ranged from 5,943 to 7,175. There were 74.8 injured persons admitted per 100,000 of the population each year. Males between 16 and 24 years of age were more commonly involved. Injuries to the head and neck were particularly frequent (39%). Older persons, males, and passengers had a poor survival outcome. The incidence of injured car occupants was significantly higher in sparsly populated areas of Sweden.

QUADRICEPS LOW FREQUENCY FATIGUE AND MUSCLE PAIN ARE CONTRACTION TYPE DEPENDENT

PubMed Central

Iguchi, Masaki; Shields, Richard K.

2010-01-01

Introduction Eccentric contractions are thought to induce greater low frequency fatigue (LFF) and delayed onset muscle soreness (DOMS) than concentric contractions. This study induced a similar amount of eccentric quadriceps muscle fatigue during either a concentric or eccentric fatigue task to compare LFF and DOMS. Methods Subjects (n=22) performed concentric or eccentric fatigue tasks using 75% of the pre-fatigue maximal voluntary contraction (MVC) torque, and both tasks ended when the MVC eccentric torque decreased by 25% pre-fatigue. Results When subjects reached the failure criterion during the eccentric and concentric tasks, the concentric MVC was 78 ± 9.8% and 64 ± 8.4% of initial, respectively. LFF was greater after the concentric than the eccentric protocols (22 ± 12.4% and 15 ± 7.6% increase, respectively; p < 0.01). DOMS was over 100% greater for the eccentric protocol. Discussion These results indicate that DOMS is not dependent on the events that contribute to LFF. PMID:20544933

Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

PubMed Central

Borges, Andrew Rosa; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne

2010-01-01

Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3’-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC50s ranging from 0.1 – 7.4 µg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. PMID:20880566

Robust video transmission with distributed source coded auxiliary channel.

PubMed

Wang, Jiajun; Majumdar, Abhik; Ramchandran, Kannan

2009-12-01

We propose a novel solution to the problem of robust, low-latency video transmission over lossy channels. Predictive video codecs, such as MPEG and H.26x, are very susceptible to prediction mismatch between encoder and decoder or "drift" when there are packet losses. These mismatches lead to a significant degradation in the decoded quality. To address this problem, we propose an auxiliary codec system that sends additional information alongside an MPEG or H.26x compressed video stream to correct for errors in decoded frames and mitigate drift. The proposed system is based on the principles of distributed source coding and uses the (possibly erroneous) MPEG/H.26x decoder reconstruction as side information at the auxiliary decoder. The distributed source coding framework depends upon knowing the statistical dependency (or correlation) between the source and the side information. We propose a recursive algorithm to analytically track the correlation between the original source frame and the erroneous MPEG/H.26x decoded frame. Finally, we propose a rate-distortion optimization scheme to allocate the rate used by the auxiliary encoder among the encoding blocks within a video frame. We implement the proposed system and present extensive simulation results that demonstrate significant gains in performance both visually and objectively (on the order of 2 dB in PSNR over forward error correction based solutions and 1.5 dB in PSNR over intrarefresh based solutions for typical scenarios) under tight latency constraints.

Substance Abuse among Drivers of Motor Vehicle Collisions

PubMed Central

Derakhshanfar, Hojjat; Kalantari Meibodi, Mohamad; Kariman, Hamid; Arhamidolatabadi, Ali; Safari, Saeed

2012-01-01

Background: Motor vehicle collisions (MVC) comprise a majority cause of referral to the emergency department (ED). A large proportion of MVC appear to be preventable, if more effective measures against driving after substance abuse can be implemented. Objective: This study was aimed to investigate the prevalence of substance abuse among drivers of MVC, following road traffic accidents (RTA). Materials and Methods: This case-control research was conducted from July to October 2007. One hundred MVC drivers admitted in the ED were included as the case group and 110 hospitalized patients, due to nontraumatic causes were used as controls. History of substances abused was obtained and urine samples were tested for opium in both groups. Finally the history and laboratory results of the groups were compared using SPSS 18. Results: Of the 100 patients in the case group, 39 (39%) were positive for substance abuse (100% males). On the other hand, 49 (44.5%) patients in the control group had positive history or laboratory findings of substance abuse (73.9% male). Opioids were the most common agent abused in both groups. There was no significant difference between two groups regarding the prevalence of substance abuse (P = 0.92). Conclusions: The prevalence of substance abuse is high among victims of road traffic injury but in equal proportion to the control group. Health education and counseling is needed to reduce substance abuse in the general population although it was not significantly related to the cause of RTA. PMID:24829889

Evaluation of Central and Peripheral Fatigue in the Quadriceps Using Fractal Dimension and Conduction Velocity in Young Females

PubMed Central

Beretta-Piccoli, Matteo; D’Antona, Giuseppe; Barbero, Marco; Fisher, Beth; Dieli-Conwright, Christina M.; Clijsen, Ron; Cescon, Corrado

2015-01-01

Purpose Over the past decade, linear and non-linear surface electromyography descriptors for central and peripheral components of fatigue have been developed. In the current study, we tested fractal dimension (FD) and conduction velocity (CV) as myoelectric descriptors of central and peripheral fatigue, respectively. To this aim, we analyzed FD and CV slopes during sustained fatiguing contractions of the quadriceps femoris in healthy humans. Methods A total of 29 recreationally active women (mean age±standard deviation: 24±4 years) and two female elite athletes (one power athlete, age 24 and one endurance athlete, age 30 years) performed two knee extensions: (1) at 20% maximal voluntary contraction (MVC) for 30 s, and (2) at 60% MVC held until exhaustion. Surface EMG signals were detected from the vastus lateralis and vastus medialis using bidimensional arrays. Results Central and peripheral fatigue were described as decreases in FD and CV, respectively. A positive correlation between FD and CV (R=0.51, p<0.01) was found during the sustained 60% MVC, probably as a result of simultaneous motor unit synchronization and a decrease in muscle fiber CV during the fatiguing task. Conclusions Central and peripheral fatigue can be described as changes in FD and CV, at least in young, healthy women. The significant correlation between FD and CV observed at 60% MVC suggests that a mutual interaction between central and peripheral fatigue can arise during submaximal isometric contractions. PMID:25880369

Prediction of maximal surface electromyographically based voluntary contractions of erector spinae muscles from sonographic measurements during isometric contractions.

PubMed

Cuesta-Vargas, Antonio I; González-Sánchez, Manuel

2014-03-01

Currently, there are no studies combining electromyography (EMG) and sonography to estimate the absolute and relative strength values of erector spinae (ES) muscles in healthy individuals. The purpose of this study was to establish whether the maximum voluntary contraction (MVC) of the ES during isometric contractions could be predicted from the changes in surface EMG as well as in fiber pennation and thickness as measured by sonography. Thirty healthy adults performed 3 isometric extensions at 45° from the vertical to calculate the MVC force. Contractions at 33% and 100% of the MVC force were then used during sonographic and EMG recordings. These measurements were used to observe the architecture and function of the muscles during contraction. Statistical analysis was performed using bivariate regression and regression equations. The slope for each regression equation was statistically significant (P < .001) with R(2) values of 0.837 and 0.986 for the right and left ES, respectively. The standard error estimate between the sonographic measurements and the regression-estimated pennation angles for the right and left ES were 0.10 and 0.02, respectively. Erector spinae muscle activation can be predicted from the changes in fiber pennation during isometric contractions at 33% and 100% of the MVC force. These findings could be essential for developing a regression equation that could estimate the level of muscle activation from changes in the muscle architecture.

Newspaper media reporting of motor vehicle crashes in Singapore: an opportunity lost for injury prevention education?

PubMed

Heng, Kenneth W J; Vasu, Alicia

2010-06-01

Newspaper media advocacy can help steer public attention away from motor vehicle crash (MVC) injuries as a personal problem to that of a social and public health issue. If used properly, newspaper media is potentially a powerful mass educator on MVC prevention. However, there is often a conflict of interest in which newspapers, in an attempt to boost readership and revenue, may over-emphasize and sensationalize the human-interest aspect of an MVC story. The aim of this study is to examine newspaper articles of MVCs in Singapore to assess how our newspaper media coverage portray MVCs and identify factors that mitigate injury and educate the public on injury prevention measures. Details of the MVC were extracted from 12 months of newspaper coverage in Singapore. Two independent coders were used to establish inter-rater reliability. From 1 January to 31 December 2007, 201 articles about MVCs were published. About 74.1% of articles assigned blame to a particular road user, negligence on either road user was implied in 56.7% of articles, and road safety messages were mentioned in 8% of the articles. The mainstream communication tone used was positive for law enforcement (71.1%) and neutral towards injury prevention or road safety messages (89.1%). Newspaper media reporting of MVCs in Singapore generally does not include injury prevention messages or highlight injury-mitigating measures. This is a lost opportunity for public education. Collaboration between public health practitioners and newspaper media is required to address this issue.

Interhemispheric plasticity in humans.

PubMed

Hortobágyi, Tibor; Richardson, Sarah Pirio; Lomarev, Mikhael; Shamim, Ejaz; Meunier, Sabine; Russman, Heike; Dang, Nguyet; Hallett, Mark

2011-07-01

Chronic unimanual motor practice increases the motor output not only in the trained but also in the nonexercised homologous muscle in the opposite limb. We examined the hypothesis that adaptations in motor cortical excitability of the nontrained primary motor cortex (iM1) and in interhemispheric inhibition from the trained to the nontrained M1 mediate this interlimb cross education. Healthy, young volunteers (n=12) performed 1000 submaximal voluntary contractions (MVC) of the right first dorsal interosseus (FDI) at 80% MVC during 20 sessions. Trained FDI's MVC increased 49.9%, and the untrained FDI's MVC increased 28.1%. Although corticospinal excitability in iM1, measured with transcranial magnetic stimulation (TMS) before and after every fifth session, increased 6% at rest, these changes, as those in intracortical inhibition and facilitation, did not correlate with cross education. When weak and strong TMS of iM1 were delivered on a background of a weak and strong muscle contraction, respectively, of the right FDI, excitability of iM1 increased dramatically after 20 sessions. Interhemispheric inhibition decreased 8.9% acutely within sessions and 30.9% chronically during 20 sessions and these chronic reductions progressively became more strongly associated with cross education. There were no changes in force or TMS measures in the trained group's left abductor minimi digiti and there were no changes in the nonexercising control group (n=8). The findings provide the first evidence for plasticity of interhemispheric connections to mediate cross education produced by a simple motor task.

Accuracy of the surface electromyography RMS processing for the diagnosis of myogenous temporomandibular disorder.

PubMed

Berni, Kelly Cristina dos Santos; Dibai-Filho, Almir Vieira; Pires, Paulo Fernandes; Rodrigues-Bigaton, Delaine

2015-08-01

Due to the multifactor etiology of temporomandibular disorder (TMD), the precise diagnosis remains a matter of debate and validated diagnostic tools are needed. The aim was to determine the accuracy of surface electromyography (sEMG) activity, assessed in the amplitude domain by the root mean square (RMS), in the diagnosis of TMD. One hundred twenty-three volunteers were evaluated using the Research Diagnostic Criteria for Temporomandibular Disorders and distributed into two groups: women with myogenous TMD (n=80) and women without TMD (n=43). The volunteers were then submitted to sEMG evaluation of the anterior temporalis, masseter and suprahyoid muscles at rest and during maximum voluntary teeth clenching (MVC) on parafilm. The accuracy, sensitivity and specificity of the muscle activity were analyzed. Differences between groups were found in all muscles analyzed at rest as well as in the masseter and suprahyoid muscles during MVC on parafilm. Moderate accuracy (AUC: 0.74-0.84) of the RMS sEMG was found in all muscles regarding the diagnosis of TMD at rest and in the suprahyoid muscles during MVC on parafilm. Moreover, sensitivity ranging from 71.3% to 80% and specificity from 60.5% to 76.6%. In contrast, RMS sEMG did not exhibit acceptable degrees of accuracy in the other masticatory muscles during MVC on parafilm. It was concluded that the RMS sEMG is a complementary tool for clinical diagnosis of the myogenous TMD. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reduced firing rates of high threshold motor units in response to eccentric overload.

PubMed

Balshaw, Tom G; Pahar, Madhu; Chesham, Ross; Macgregor, Lewis J; Hunter, Angus M

2017-01-01

Acute responses of motor units were investigated during submaximal voluntary isometric tasks following eccentric overload (EO) and constant load (CL) knee extension resistance exercise. Ten healthy resistance-trained participants performed four experimental test sessions separated by 5 days over a 20 day period. Two sessions involved constant load and the other two used eccentric overload. EO and CL used both sessions for different target knee eccentric extension phases; one at 2 sec and the other at 4 sec. Maximal voluntary contractions (MVC) and isometric trapezoid efforts for 10 sec at 70% MVC were completed before and after each intervention and decomposed electromyography was used to measure motor unit firing rate. The firing rate of later recruited, high-threshold motor units declined following the 2-sec EO but was maintained following 2sec CL (P < 0.05), whereas MUFR for all motor units were maintained for both loading types following 4-sec extension phases. MVC and rate of force development where maintained following both EO and CL and 2 and 4 sec phases. This study demonstrates a slower firing rate of high-threshold motor units following fast eccentric overload while MVC was maintained. This suggests that there was a neuromuscular stimulus without cost to the force-generating capacity of the knee extensors. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Polar Coding with CRC-Aided List Decoding

DTIC Science & Technology

2015-08-01

TECHNICAL REPORT 2087 August 2015 Polar Coding with CRC-Aided List Decoding David Wasserman Approved...list decoding . RESULTS Our simulation results show that polar coding can produce results very similar to the FEC used in the Digital Video...standard. RECOMMENDATIONS In any application for which the DVB-S2 FEC is considered, polar coding with CRC-aided list decod - ing with N = 65536

Scalable Coding of Plenoptic Images by Using a Sparse Set and Disparities.

PubMed

Li, Yun; Sjostrom, Marten; Olsson, Roger; Jennehag, Ulf

2016-01-01

One of the light field capturing techniques is the focused plenoptic capturing. By placing a microlens array in front of the photosensor, the focused plenoptic cameras capture both spatial and angular information of a scene in each microlens image and across microlens images. The capturing results in a significant amount of redundant information, and the captured image is usually of a large resolution. A coding scheme that removes the redundancy before coding can be of advantage for efficient compression, transmission, and rendering. In this paper, we propose a lossy coding scheme to efficiently represent plenoptic images. The format contains a sparse image set and its associated disparities. The reconstruction is performed by disparity-based interpolation and inpainting, and the reconstructed image is later employed as a prediction reference for the coding of the full plenoptic image. As an outcome of the representation, the proposed scheme inherits a scalable structure with three layers. The results show that plenoptic images are compressed efficiently with over 60 percent bit rate reduction compared with High Efficiency Video Coding intra coding, and with over 20 percent compared with an High Efficiency Video Coding block copying mode.

Towards high dynamic range extensions of HEVC: subjective evaluation of potential coding technologies

NASA Astrophysics Data System (ADS)

Hanhart, Philippe; Řeřábek, Martin; Ebrahimi, Touradj

2015-09-01

This paper reports the details and results of the subjective evaluations conducted at EPFL to evaluate the responses to the Call for Evidence (CfE) for High Dynamic Range (HDR) and Wide Color Gamut (WCG) Video Coding issued by Moving Picture Experts Group (MPEG). The CfE on HDR/WCG Video Coding aims to explore whether the coding efficiency and/or the functionality of the current version of HEVC standard can be signi_cantly improved for HDR and WCG content. In total, nine submissions, five for Category 1 and four for Category 3a, were compared to the HEVC Main 10 Profile based Anchor. More particularly, five HDR video contents, compressed at four bit rates by each proponent responding to the CfE, were used in the subjective evaluations. Further, the side-by-side presentation methodology was used for the subjective experiment to discriminate small differences between the Anchor and proponents. Subjective results shows that the proposals provide evidence that the coding efficiency can be improved in a statistically noticeable way over MPEG CfE Anchors in terms of perceived quality within the investigated content. The paper further benchmarks the selected objective metrics based on their correlations with the subjective ratings. It is shown that PSNR-DE1000, HDRVDP- 2, and PSNR-Lx can reliably detect visible differences between the proposed encoding solutions and current HEVC standard.

Efficient space-time sampling with pixel-wise coded exposure for high-speed imaging.

PubMed

Liu, Dengyu; Gu, Jinwei; Hitomi, Yasunobu; Gupta, Mohit; Mitsunaga, Tomoo; Nayar, Shree K

2014-02-01

Cameras face a fundamental trade-off between spatial and temporal resolution. Digital still cameras can capture images with high spatial resolution, but most high-speed video cameras have relatively low spatial resolution. It is hard to overcome this trade-off without incurring a significant increase in hardware costs. In this paper, we propose techniques for sampling, representing, and reconstructing the space-time volume to overcome this trade-off. Our approach has two important distinctions compared to previous works: 1) We achieve sparse representation of videos by learning an overcomplete dictionary on video patches, and 2) we adhere to practical hardware constraints on sampling schemes imposed by architectures of current image sensors, which means that our sampling function can be implemented on CMOS image sensors with modified control units in the future. We evaluate components of our approach, sampling function and sparse representation, by comparing them to several existing approaches. We also implement a prototype imaging system with pixel-wise coded exposure control using a liquid crystal on silicon device. System characteristics such as field of view and modulation transfer function are evaluated for our imaging system. Both simulations and experiments on a wide range of scenes show that our method can effectively reconstruct a video from a single coded image while maintaining high spatial resolution.

Towards a next generation open-source video codec

NASA Astrophysics Data System (ADS)

Bankoski, Jim; Bultje, Ronald S.; Grange, Adrian; Gu, Qunshan; Han, Jingning; Koleszar, John; Mukherjee, Debargha; Wilkins, Paul; Xu, Yaowu

2013-02-01

Google has recently been developing a next generation opensource video codec called VP9, as part of the experimental branch of the libvpx repository included in the WebM project (http://www.webmproject.org/). Starting from the VP8 video codec released by Google in 2010 as the baseline, a number of enhancements and new tools have been added to improve the coding efficiency. This paper provides a technical overview of the current status of this project along with comparisons and other stateoftheart video codecs H. 264/AVC and HEVC. The new tools that have been added so far include: larger prediction block sizes up to 64x64, various forms of compound INTER prediction, more modes for INTRA prediction, ⅛pel motion vectors and 8tap switchable subpel interpolation filters, improved motion reference generation and motion vector coding, improved entropy coding and framelevel entropy adaptation for various symbols, improved loop filtering, incorporation of Asymmetric Discrete Sine Transforms and larger 16x16 and 32x32 DCTs, frame level segmentation to group similar areas together, etc. Other tools and various bitstream features are being actively worked on as well. The VP9 bitstream is expected to be finalized by earlyto mid2013. Results show VP9 to be quite competitive in performance with mainstream stateoftheart codecs.

Constrained motion estimation-based error resilient coding for HEVC

NASA Astrophysics Data System (ADS)

Guo, Weihan; Zhang, Yongfei; Li, Bo

2018-04-01

Unreliable communication channels might lead to packet losses and bit errors in the videos transmitted through it, which will cause severe video quality degradation. This is even worse for HEVC since more advanced and powerful motion estimation methods are introduced to further remove the inter-frame dependency and thus improve the coding efficiency. Once a Motion Vector (MV) is lost or corrupted, it will cause distortion in the decoded frame. More importantly, due to motion compensation, the error will propagate along the motion prediction path, accumulate over time, and significantly degrade the overall video presentation quality. To address this problem, we study the problem of encoder-sider error resilient coding for HEVC and propose a constrained motion estimation scheme to mitigate the problem of error propagation to subsequent frames. The approach is achieved by cutting off MV dependencies and limiting the block regions which are predicted by temporal motion vector. The experimental results show that the proposed method can effectively suppress the error propagation caused by bit errors of motion vector and can improve the robustness of the stream in the bit error channels. When the bit error probability is 10-5, an increase of the decoded video quality (PSNR) by up to1.310dB and on average 0.762 dB can be achieved, compared to the reference HEVC.

Embed dynamic content in your poster.

PubMed

Hutchins, B Ian

2013-01-29

A new technology has emerged that will facilitate the presentation of dynamic or otherwise inaccessible data on posters at scientific meetings. Video, audio, or other digital files hosted on mobile-friendly sites can be linked to through a quick response (QR) code, a two-dimensional barcode that can be scanned by smartphones, which then display the content. This approach is more affordable than acquiring tablet computers for playing dynamic content and can reach many users at large conferences. This resource details how to host videos, generate QR codes, and view the associated files on mobile devices.

Unexpected factors affecting the excitability of human motoneurones in voluntary and stimulated contractions

PubMed Central

Khan, Serajul I.; Taylor, Janet L.

2016-01-01

Key points The output of human motoneurone pools decreases with fatiguing exercise, but the mechanisms involved are uncertain. We explored depression of recurrent motoneurone discharges (F‐waves) after sustained maximal voluntary contractions (MVCs).MVC depressed the size and frequency of F‐waves in a hand muscle but a submaximal contraction (at 50% MVC) did not.Surprisingly, activation of the motoneurones antidromically by stimulation of the ulnar nerve (at 20 or 40 Hz) did not depress F‐wave area or persistence.Furthermore, a sustained (3 min) MVC of a hand muscle depressed F‐waves in its antagonist but not in a remote hand muscle.Our findings suggest that depression of F‐waves after voluntary contractions is not simply due to repetitive activation of the motoneurones but requires descending voluntary drive.  Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools. Abstract There are major spinal changes induced by repetitive activity and fatigue that could contribute to ‘central’ fatigue but the mechanisms involved are poorly understood in humans. Here we confirmed that the recurrent motoneuronal discharge (F‐wave) is reduced during relaxation immediately after a sustained maximal voluntary contraction (MVC) of an intrinsic hand muscle (abductor digiti minimi, ADM) and explored the relationship between motoneurone firing and the depression of F‐waves in three ways. First, the depression (in both F‐wave area and F‐wave persistence) was present after a 10 s MVC (initial decrease 36.4 ± 19.1%; mean ± SD) but not after a submaximal voluntary contraction at 50% maximum. Second, to evoke motoneurone discharge without volitional effort, 10 s tetanic contractions were produced by supramaximal ulnar nerve stimulation at the elbow at physiological frequencies of 25 and 40 Hz. Surprisingly, neither produced depression of F‐waves in ADM to test supramaximal stimulation of the ulnar nerve at the wrist. Finally, a sustained MVC (3 min) of the antagonist to ADM (4th palmar interosseous) depressed F‐waves in the anatomically close ADM (20 ± 18.2%) but not in the more remote first dorsal interosseous on the radial side of the hand. We argue that depression of F‐waves after voluntary contractions may not be due to repetitive activation of the motoneurones but requires descending voluntary drive. Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools and it reveals potentially novel mechanisms controlling the output of human motoneurones. PMID:26940402

Unexpected factors affecting the excitability of human motoneurones in voluntary and stimulated contractions.

PubMed

Khan, Serajul I; Taylor, Janet L; Gandevia, Simon C

2016-05-15

The output of human motoneurone pools decreases with fatiguing exercise, but the mechanisms involved are uncertain. We explored depression of recurrent motoneurone discharges (F-waves) after sustained maximal voluntary contractions (MVCs). MVC depressed the size and frequency of F-waves in a hand muscle but a submaximal contraction (at 50% MVC) did not. Surprisingly, activation of the motoneurones antidromically by stimulation of the ulnar nerve (at 20 or 40 Hz) did not depress F-wave area or persistence. Furthermore, a sustained (3 min) MVC of a hand muscle depressed F-waves in its antagonist but not in a remote hand muscle. Our findings suggest that depression of F-waves after voluntary contractions is not simply due to repetitive activation of the motoneurones but requires descending voluntary drive.  Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools. There are major spinal changes induced by repetitive activity and fatigue that could contribute to 'central' fatigue but the mechanisms involved are poorly understood in humans. Here we confirmed that the recurrent motoneuronal discharge (F-wave) is reduced during relaxation immediately after a sustained maximal voluntary contraction (MVC) of an intrinsic hand muscle (abductor digiti minimi, ADM) and explored the relationship between motoneurone firing and the depression of F-waves in three ways. First, the depression (in both F-wave area and F-wave persistence) was present after a 10 s MVC (initial decrease 36.4 ± 19.1%; mean ± SD) but not after a submaximal voluntary contraction at 50% maximum. Second, to evoke motoneurone discharge without volitional effort, 10 s tetanic contractions were produced by supramaximal ulnar nerve stimulation at the elbow at physiological frequencies of 25 and 40 Hz. Surprisingly, neither produced depression of F-waves in ADM to test supramaximal stimulation of the ulnar nerve at the wrist. Finally, a sustained MVC (3 min) of the antagonist to ADM (4th palmar interosseous) depressed F-waves in the anatomically close ADM (20 ± 18.2%) but not in the more remote first dorsal interosseous on the radial side of the hand. We argue that depression of F-waves after voluntary contractions may not be due to repetitive activation of the motoneurones but requires descending voluntary drive. Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools and it reveals potentially novel mechanisms controlling the output of human motoneurones. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

Potential digitization/compression techniques for Shuttle video

NASA Technical Reports Server (NTRS)

Habibi, A.; Batson, B. H.

1978-01-01

The Space Shuttle initially will be using a field-sequential color television system but it is possible that an NTSC color TV system may be used for future missions. In addition to downlink color TV transmission via analog FM links, the Shuttle will use a high resolution slow-scan monochrome system for uplink transmission of text and graphics information. This paper discusses the characteristics of the Shuttle video systems, and evaluates digitization and/or bandwidth compression techniques for the various links. The more attractive techniques for the downlink video are based on a two-dimensional DPCM encoder that utilizes temporal and spectral as well as the spatial correlation of the color TV imagery. An appropriate technique for distortion-free coding of the uplink system utilizes two-dimensional HCK codes.

Augmenting advance care planning in poor prognosis cancer with a video decision aid: a preintervention-postintervention study.

PubMed

Volandes, Angelo E; Levin, Tomer T; Slovin, Susan; Carvajal, Richard D; O'Reilly, Eileen M; Keohan, Mary Louise; Theodoulou, Maria; Dickler, Maura; Gerecitano, John F; Morris, Michael; Epstein, Andrew S; Naka-Blackstone, Anastazia; Walker-Corkery, Elizabeth S; Chang, Yuchiao; Noy, Ariela

2012-09-01

The authors tested whether an educational video on the goals of care in advanced cancer (life-prolonging care, basic care, or comfort care) helped patients understand these goals and had an impact on their preferences for resuscitation. A survey of 80 patients with advanced cancer was conducted before and after they viewed an educational video. The outcomes of interest included changes in goals of care preference and knowledge and consistency of preferences with code status. Before viewing the video, 10 patients (13%) preferred life-prolonging care, 24 patients (30%) preferred basic care, 29 patients (36%) preferred comfort care, and 17 patients (21%) were unsure. Preferences did not change after the video, when 9 patients (11%) chose life-prolonging care, 28 patients (35%) chose basic care, 29 patients (36%) chose comfort care, and, 14 patients (18%) were unsure (P = .28). Compared with baseline, after the video presentation, more patients did not want cardiopulmonary resuscitation (CPR) (71% vs 62%; P = .03) or ventilation (80% vs 67%; P = .008). Knowledge about goals of care and likelihood of resuscitation increased after the video (P < .001). Of the patients who did not want CPR or ventilation after the video augmentation, only 4 patients (5%) had a documented do-not-resuscitate order in their medical record (kappa statistic, -0.01; 95% confidence interval, -0.06 to 0.04). Acceptability of the video was high. Patients with advanced cancer did not change care preferences after viewing the video, but fewer wanted CPR or ventilation. Documented code status was inconsistent with patient preferences. Patients were more knowledgeable after the video, reported that the video was acceptable, and said they would recommend it to others. The current results indicated that this type of video may enable patients to visualize "goals of care," enriching patient understanding of worsening health states and better informing decision making. Copyright © 2012 American Cancer Society.

“It’s Totally Okay to Be Sad, but Never Lose Hope”: Content Analysis of Infertility-Related Videos on YouTube in Relation to Viewer Preferences

PubMed Central

Kelly-Hedrick, Margot; Grunberg, Paul H; Brochu, Felicia

2018-01-01

Background Infertility patients frequently use the internet to find fertility-related information and support from people in similar circumstances. YouTube is increasingly used as a source of health-related information and may influence health decision making. There have been no studies examining the content of infertility-related videos on YouTube. Objective The purpose of this study was to (1) describe the content of highly viewed videos on YouTube related to infertility and (2) identify video characteristics that relate to viewer preference. Methods Using the search term “infertility,” the 80 top-viewed YouTube videos and their viewing statistics (eg, views, likes, and comments) were collected. Videos that were non-English, unrelated to infertility, or had age restrictions were excluded. Content analysis was used to examine videos, employing a coding rubric that measured the presence or absence of video codes related to purpose, tone, and demographic and fertility characteristics (eg, sex, parity, stage of fertility treatment). Results A total of 59 videos, with a median of 156,103 views, met the inclusion criteria and were categorized into 35 personal videos (35/59, 59%) and 24 informational-educational videos (24/59, 41%). Personal videos did not differ significantly from informational-educational videos on number of views, dislikes, subscriptions driven, or shares. However, personal videos had significantly more likes (P<.001) and comments (P<.001) than informational-educational videos. The purposes of the videos were treatment outcomes (33/59, 56%), sharing information (30/59, 51%), emotional aspects of infertility (20/59, 34%), and advice to others (6/59, 10%). The tones of the videos were positive (26/59, 44%), neutral (25/59, 42%), and mixed (8/59, 14%); there were no videos with negative tone. No videos contained only male posters. Videos with a positive tone did not differ from neutral videos in number of views, dislikes, subscriptions driven, or shares; however, positive videos had significantly more likes (P<.001) and comments (P<.001) than neutral videos. A majority (21/35, 60%) of posters of personal videos shared a pregnancy announcement. Conclusions YouTube is a source of both technical and personal experience-based information about infertility. However, videos that include personal experiences may elicit greater viewer engagement. Positive videos and stories of treatment success may provide hope to viewers but could also create and perpetuate unrealistic expectations about the success rates of fertility treatment. PMID:29792296

An overview of new video coding tools under consideration for VP10: the successor to VP9

NASA Astrophysics Data System (ADS)

Mukherjee, Debargha; Su, Hui; Bankoski, James; Converse, Alex; Han, Jingning; Liu, Zoe; Xu, Yaowu

2015-09-01

Google started an opensource project, entitled the WebM Project, in 2010 to develop royaltyfree video codecs for the web. The present generation codec developed in the WebM project called VP9 was finalized in mid2013 and is currently being served extensively by YouTube, resulting in billions of views per day. Even though adoption of VP9 outside Google is still in its infancy, the WebM project has already embarked on an ambitious project to develop a next edition codec VP10 that achieves at least a generational bitrate reduction over the current generation codec VP9. Although the project is still in early stages, a set of new experimental coding tools have already been added to baseline VP9 to achieve modest coding gains over a large enough test set. This paper provides a technical overview of these coding tools.

Joint-layer encoder optimization for HEVC scalable extensions

NASA Astrophysics Data System (ADS)

Tsai, Chia-Ming; He, Yuwen; Dong, Jie; Ye, Yan; Xiu, Xiaoyu; He, Yong

2014-09-01

Scalable video coding provides an efficient solution to support video playback on heterogeneous devices with various channel conditions in heterogeneous networks. SHVC is the latest scalable video coding standard based on the HEVC standard. To improve enhancement layer coding efficiency, inter-layer prediction including texture and motion information generated from the base layer is used for enhancement layer coding. However, the overall performance of the SHVC reference encoder is not fully optimized because rate-distortion optimization (RDO) processes in the base and enhancement layers are independently considered. It is difficult to directly extend the existing joint-layer optimization methods to SHVC due to the complicated coding tree block splitting decisions and in-loop filtering process (e.g., deblocking and sample adaptive offset (SAO) filtering) in HEVC. To solve those problems, a joint-layer optimization method is proposed by adjusting the quantization parameter (QP) to optimally allocate the bit resource between layers. Furthermore, to make more proper resource allocation, the proposed method also considers the viewing probability of base and enhancement layers according to packet loss rate. Based on the viewing probability, a novel joint-layer RD cost function is proposed for joint-layer RDO encoding. The QP values of those coding tree units (CTUs) belonging to lower layers referenced by higher layers are decreased accordingly, and the QP values of those remaining CTUs are increased to keep total bits unchanged. Finally the QP values with minimal joint-layer RD cost are selected to match the viewing probability. The proposed method was applied to the third temporal level (TL-3) pictures in the Random Access configuration. Simulation results demonstrate that the proposed joint-layer optimization method can improve coding performance by 1.3% for these TL-3 pictures compared to the SHVC reference encoder without joint-layer optimization.

Learning dictionaries of sparse codes of 3D movements of body joints for real-time human activity understanding.

PubMed

Qi, Jin; Yang, Zhiyong

2014-01-01

Real-time human activity recognition is essential for human-robot interactions for assisted healthy independent living. Most previous work in this area is performed on traditional two-dimensional (2D) videos and both global and local methods have been used. Since 2D videos are sensitive to changes of lighting condition, view angle, and scale, researchers begun to explore applications of 3D information in human activity understanding in recently years. Unfortunately, features that work well on 2D videos usually don't perform well on 3D videos and there is no consensus on what 3D features should be used. Here we propose a model of human activity recognition based on 3D movements of body joints. Our method has three steps, learning dictionaries of sparse codes of 3D movements of joints, sparse coding, and classification. In the first step, space-time volumes of 3D movements of body joints are obtained via dense sampling and independent component analysis is then performed to construct a dictionary of sparse codes for each activity. In the second step, the space-time volumes are projected to the dictionaries and a set of sparse histograms of the projection coefficients are constructed as feature representations of the activities. Finally, the sparse histograms are used as inputs to a support vector machine to recognize human activities. We tested this model on three databases of human activities and found that it outperforms the state-of-the-art algorithms. Thus, this model can be used for real-time human activity recognition in many applications.

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction

PubMed Central

Watanabe, Eiji; Kitaoka, Akiyoshi; Sakamoto, Kiwako; Yasugi, Masaki; Tanaka, Kenta

2018-01-01

The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning) predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research. PMID:29599739

Illusory Motion Reproduced by Deep Neural Networks Trained for Prediction.

PubMed

Watanabe, Eiji; Kitaoka, Akiyoshi; Sakamoto, Kiwako; Yasugi, Masaki; Tanaka, Kenta

2018-01-01

The cerebral cortex predicts visual motion to adapt human behavior to surrounding objects moving in real time. Although the underlying mechanisms are still unknown, predictive coding is one of the leading theories. Predictive coding assumes that the brain's internal models (which are acquired through learning) predict the visual world at all times and that errors between the prediction and the actual sensory input further refine the internal models. In the past year, deep neural networks based on predictive coding were reported for a video prediction machine called PredNet. If the theory substantially reproduces the visual information processing of the cerebral cortex, then PredNet can be expected to represent the human visual perception of motion. In this study, PredNet was trained with natural scene videos of the self-motion of the viewer, and the motion prediction ability of the obtained computer model was verified using unlearned videos. We found that the computer model accurately predicted the magnitude and direction of motion of a rotating propeller in unlearned videos. Surprisingly, it also represented the rotational motion for illusion images that were not moving physically, much like human visual perception. While the trained network accurately reproduced the direction of illusory rotation, it did not detect motion components in negative control pictures wherein people do not perceive illusory motion. This research supports the exciting idea that the mechanism assumed by the predictive coding theory is one of basis of motion illusion generation. Using sensory illusions as indicators of human perception, deep neural networks are expected to contribute significantly to the development of brain research.

Video analysis for insight and coding: Examples from tutorials in introductory physics

NASA Astrophysics Data System (ADS)

Scherr, Rachel E.

2009-12-01

The increasing ease of video recording offers new opportunities to create richly detailed records of classroom activities. These recordings, in turn, call for research methodologies that balance generalizability with interpretive validity. This paper shares methodology for two practices of video analysis: (1) gaining insight into specific brief classroom episodes and (2) developing and applying a systematic observational protocol for a relatively large corpus of video data. These two aspects of analytic practice are illustrated in the context of a particular research interest but are intended to serve as general suggestions.

Fast bi-directional prediction selection in H.264/MPEG-4 AVC temporal scalable video coding.

PubMed

Lin, Hung-Chih; Hang, Hsueh-Ming; Peng, Wen-Hsiao

2011-12-01

In this paper, we propose a fast algorithm that efficiently selects the temporal prediction type for the dyadic hierarchical-B prediction structure in the H.264/MPEG-4 temporal scalable video coding (SVC). We make use of the strong correlations in prediction type inheritance to eliminate the superfluous computations for the bi-directional (BI) prediction in the finer partitions, 16×8/8×16/8×8 , by referring to the best temporal prediction type of 16 × 16. In addition, we carefully examine the relationship in motion bit-rate costs and distortions between the BI and the uni-directional temporal prediction types. As a result, we construct a set of adaptive thresholds to remove the unnecessary BI calculations. Moreover, for the block partitions smaller than 8 × 8, either the forward prediction (FW) or the backward prediction (BW) is skipped based upon the information of their 8 × 8 partitions. Hence, the proposed schemes can efficiently reduce the extensive computational burden in calculating the BI prediction. As compared to the JSVM 9.11 software, our method saves the encoding time from 48% to 67% for a large variety of test videos over a wide range of coding bit-rates and has only a minor coding performance loss. © 2011 IEEE

Overview of MPEG internet video coding

NASA Astrophysics Data System (ADS)

Wang, R. G.; Li, G.; Park, S.; Kim, J.; Huang, T.; Jang, E. S.; Gao, W.

2015-09-01

MPEG has produced standards that have provided the industry with the best video compression technologies. In order to address the diversified needs of the Internet, MPEG issued the Call for Proposals (CfP) for internet video coding in July, 2011. It is anticipated that any patent declaration associated with the Baseline Profile of this standard will indicate that the patent owner is prepared to grant a free of charge license to an unrestricted number of applicants on a worldwide, non-discriminatory basis and under other reasonable terms and conditions to make, use, and sell implementations of the Baseline Profile of this standard in accordance with the ITU-T/ITU-R/ISO/IEC Common Patent Policy. Three different codecs had responded to the CfP, which are WVC, VCB and IVC. WVC was proposed jointly by Apple, Cisco, Fraunhofer HHI, Magnum Semiconductor, Polycom and RIM etc. it's in fact AVC baseline. VCB was proposed by Google, and it's in fact VP8. IVC was proposed by several Universities (Peking University, Tsinghua University, Zhejiang University, Hanyang University and Korea Aerospace University etc.) and its coding tools was developed from Zero. In this paper, we give an overview of the coding tools in IVC, and evaluate its performance by comparing it with WVC, VCB and AVC High Profile.

Efficient biprediction decision scheme for fast high efficiency video coding encoding

NASA Astrophysics Data System (ADS)

Park, Sang-hyo; Lee, Seung-ho; Jang, Euee S.; Jun, Dongsan; Kang, Jung-Won

2016-11-01

An efficient biprediction decision scheme of high efficiency video coding (HEVC) is proposed for fast-encoding applications. For low-delay video applications, bidirectional prediction can be used to increase compression performance efficiently with previous reference frames. However, at the same time, the computational complexity of the HEVC encoder is significantly increased due to the additional biprediction search. Although a some research has attempted to reduce this complexity, whether the prediction is strongly related to both motion complexity and prediction modes in a coding unit has not yet been investigated. A method that avoids most compression-inefficient search points is proposed so that the computational complexity of the motion estimation process can be dramatically decreased. To determine if biprediction is critical, the proposed method exploits the stochastic correlation of the context of prediction units (PUs): the direction of a PU and the accuracy of a motion vector. Through experimental results, the proposed method showed that the time complexity of biprediction can be reduced to 30% on average, outperforming existing methods in view of encoding time, number of function calls, and memory access.

An efficient CU partition algorithm for HEVC based on improved Sobel operator

NASA Astrophysics Data System (ADS)

Sun, Xuebin; Chen, Xiaodong; Xu, Yong; Sun, Gang; Yang, Yunsheng

2018-04-01

As the latest video coding standard, High Efficiency Video Coding (HEVC) achieves over 50% bit rate reduction with similar video quality compared with previous standards H.264/AVC. However, the higher compression efficiency is attained at the cost of significantly increasing computational load. In order to reduce the complexity, this paper proposes a fast coding unit (CU) partition technique to speed up the process. To detect the edge features of each CU, a more accurate improved Sobel filtering is developed and performed By analyzing the textural features of CU, an early CU splitting termination is proposed to decide whether a CU should be decomposed into four lower-dimensions CUs or not. Compared with the reference software HM16.7, experimental results indicate the proposed algorithm can lessen the encoding time up to 44.09% on average, with a negligible bit rate increase of 0.24%, and quality losses lower 0.03 dB, respectively. In addition, the proposed algorithm gets a better trade-off between complexity and rate-distortion among the other proposed works.

Vastus lateralis surface and single motor unit EMG following submaximal shortening and lengthening contractions.

PubMed

Altenburg, Teatske M; de Ruiter, Cornelis J; Verdijk, Peter W L; van Mechelen, Willem; de Haan, Arnold

2008-12-01

A single shortening contraction reduces the force capacity of muscle fibers, whereas force capacity is enhanced following lengthening. However, how motor unit recruitment and discharge rate (muscle activation) are adapted to such changes in force capacity during submaximal contractions remains unknown. Additionally, there is limited evidence for force enhancement in larger muscles. We therefore investigated lengthening- and shortening-induced changes in activation of the knee extensors. We hypothesized that when the same submaximal torque had to be generated following shortening, muscle activation had to be increased, whereas a lower activation would suffice to produce the same torque following lengthening. Muscle activation following shortening and lengthening (20 degrees at 10 degrees /s) was determined using rectified surface electromyography (rsEMG) in a 1st session (at 10% and 50% maximal voluntary contraction (MVC)) and additionally with EMG of 42 vastus lateralis motor units recorded in a 2nd session (at 4%-47%MVC). rsEMG and motor unit discharge rates following shortening and lengthening were normalized to isometric reference contractions. As expected, normalized rsEMG (1.15 +/- 0.19) and discharge rate (1.11 +/- 0.09) were higher following shortening (p < 0.05). Following lengthening, normalized rsEMG (0.91 +/- 0.10) was, as expected, lower than 1.0 (p < 0.05), but normalized discharge rate (0.99 +/- 0.08) was not (p > 0.05). Thus, muscle activation was increased to compensate for a reduced force capacity following shortening by increasing the discharge rate of the active motor units (rate coding). In contrast, following lengthening, rsEMG decreased while the discharge rates of active motor units remained similar, suggesting that derecruitment of units might have occurred.

Recruitment and rate coding organisation for soleus motor units across entire range of voluntary isometric plantar flexions.

PubMed

Oya, Tomomichi; Riek, Stephan; Cresswell, Andrew G

2009-10-01

Unlike upper limb muscles, it remains undocumented as to how motor units in the soleus muscle are organised in terms of recruitment range and discharge rates with respect to their recruitment and de-recruitment thresholds. The possible influence of neuromodulation, such as persistent inward currents (PICs) on lower limb motor unit recruitment and discharge rates has also yet to be reported. To address these issues, electromyographic (EMG) activities from the soleus muscle were recorded using selective branched-wire intramuscular electrodes during ramp-and-hold contractions with intensities up to maximal voluntary contraction (MVC). The multiple single motor unit activities were then derived using a decomposition technique. The onset-offset hysteresis of motor unit discharge, i.e. a difference between recruitment and de-recruitment thresholds, as well as PIC magnitude calculated by a paired motor unit analysis were used to examine the neuromodulatory effects on discharge behaviours, such as minimum firing rate, peak firing rate and degree of increase in firing rate. Forty-two clearly identified motor units from five subjects revealed that soleus motor units are recruited progressively from rest to contraction strengths close to 95% of MVC, with low-threshold motor units discharging action potentials slower at their recruitment and with a lower peak rate than later recruited high-threshold units. This observation is in contrast to the 'onion skin phenomenon' often reported for the upper limb muscles. Based on positive correlations of the peak discharge rates, initial rates and recruitment order of the units with the magnitude of the onset-offset hysteresis and not PIC contribution, we conclude that discharge behaviours among motor units appear to be related to a variation in an intrinsic property other than PICs.

Video coding for next-generation surveillance systems

NASA Astrophysics Data System (ADS)

Klasen, Lena M.; Fahlander, Olov

1997-02-01

Video is used as recording media in surveillance system and also more frequently by the Swedish Police Force. Methods for analyzing video using an image processing system have recently been introduced at the Swedish National Laboratory of Forensic Science, and new methods are in focus in a research project at Linkoping University, Image Coding Group. The accuracy of the result of those forensic investigations often depends on the quality of the video recordings, and one of the major problems when analyzing videos from crime scenes is the poor quality of the recordings. Enhancing poor image quality might add manipulative or subjective effects and does not seem to be the right way of getting reliable analysis results. The surveillance system in use today is mainly based on video techniques, VHS or S-VHS, and the weakest link is the video cassette recorder, (VCR). Multiplexers for selecting one of many camera outputs for recording is another problem as it often filters the video signal, and recording is limited to only one of the available cameras connected to the VCR. A way to get around the problem of poor recording is to simultaneously record all camera outputs digitally. It is also very important to build such a system bearing in mind that image processing analysis methods becomes more important as a complement to the human eye. Using one or more cameras gives a large amount of data, and the need for data compression is more than obvious. Crime scenes often involve persons or moving objects, and the available coding techniques are more or less useful. Our goal is to propose a possible system, being the best compromise with respect to what needs to be recorded, movements in the recorded scene, loss of information and resolution etc., to secure the efficient recording of the crime and enable forensic analysis. The preventative effective of having a well functioning surveillance system and well established image analysis methods is not to be neglected. Aspects of this next generation of digital surveillance systems are discussed in this paper.

Introducing video recording in primary care midwifery for research purposes: procedure, dataset, and use.

PubMed

Spelten, Evelien R; Martin, Linda; Gitsels, Janneke T; Pereboom, Monique T R; Hutton, Eileen K; van Dulmen, Sandra

2015-01-01

video recording studies have been found to be complex; however very few studies describe the actual introduction and enrolment of the study, the resulting dataset and its interpretation. In this paper we describe the introduction and the use of video recordings of health care provider (HCP)-client interactions in primary care midwifery for research purposes. We also report on the process of data management, data coding and the resulting data set. we describe our experience in undertaking a study using video recording to assess the interaction of the midwife and her client in the first antenatal consultation, in a real life clinical practice setting in the Netherlands. Midwives from six practices across the Netherlands were recruited to videotape 15-20 intakes. The introduction, complexity of the study and intrusiveness of the study were discussed within the research group. The number of valid recordings and missing recordings was measured; reasons not to participate, non-response analyses, and the inter-rater reliability of the coded videotapes were assessed. Video recordings were supplemented by questionnaires for midwives and clients. The Roter Interaction Analysis System (RIAS) was used for coding as well as an obstetric topics scale. at the introduction of the study, more initial hesitation in co-operation was found among the midwives than among their clients. The intrusive nature of the recording on the interaction was perceived to be minimal. The complex nature of the study affected recruitment and data collection. Combining the dataset with the questionnaires and medical records proved to be a challenge. The final dataset included videotapes of 20 midwives (7-23 recordings per midwife). Of the 460 eligible clients, 324 gave informed consent. The study resulted in a significant dataset of first antenatal consultations involving recording 269 clients and 194 partners. video recording of midwife-client interaction was both feasible and challenging and resulted in a unique dataset of recordings of midwife-client interaction. Video recording studies will benefit from a tight design, and vigilant monitoring during the data collection to ensure effective data collection. We provide suggestions to promote successful introduction of video recording for research purposes. Copyright © 2014 Elsevier Ltd. All rights reserved.

On-line content creation for photo products: understanding what the user wants

NASA Astrophysics Data System (ADS)

Fageth, Reiner

2015-03-01

This paper describes how videos can be implemented into printed photo books and greeting cards. We will show that - surprisingly or not- pictures from videos are similarly used such as classical images to tell compelling stories. Videos can be taken with nearly every camera, digital point and shoot cameras, DSLRs as well as smartphones and more and more with so-called action cameras mounted on sports devices. The implementation of videos while generating QR codes and relevant pictures out of the video stream via a software implementation was contents in last years' paper. This year we present first data about what contents is displayed and how the users represent their videos in printed products, e.g. CEWE PHOTOBOOKS and greeting cards. We report the share of the different video formats used.

Week 96 results of the randomized, multicentre Maraviroc Switch (MARCH) study.

PubMed

Pett, S L; Amin, J; Horban, A; Andrade-Villanueva, J; Losso, M; Porteiro, N; Madero, J S; Belloso, W; Tu, E; Silk, D; Kelleher, A; Harrigan, R; Clark, A; Sugiura, W; Wolff, M; Gill, J; Gatell, J; Clarke, A; Ruxrungtham, K; Prazuck, T; Kaiser, R; Woolley, I; Alberto Arnaiz, J; Cooper, D; Rockstroh, J K; Mallon, P; Emery, S

2018-01-01

The Maraviroc Switch (MARCH) study week 48 data demonstrated that maraviroc, a chemokine receptor-5 (CCR5) inhibitor, was a safe and effective switch for the ritonavir-boosted protease inhibitor (PI/r) component of a two nucleos(t)ide reverse transcriptase inhibitor [N(t)RTI] plus PI/r-based antiretroviral regimen in patients with R5-tropic virus. Here we report the durability of this finding. MARCH, an international, multicentre, randomized, 96-week open-label switch study, enrolled HIV-1-infected adults with R5-tropic virus who were stable (> 24 weeks) and virologically suppressed [plasma viral load (pVL) < 50 HIV-1 RNA copies/mL]. Participants were randomized to continue their current PI/r-based regimen (PI/r) or to switch to MVC plus two N(t)RTIs (MVC) (1:2 randomization). The primary endpoint was the difference in the proportion with pVL < 200 copies/mL at 96 weeks. The switch arm was defined as noninferior if the lower limit of the 95% confidence interval (CI) for the difference was < -12% in the intention-to-treat (ITT) population. Safety endpoints (the difference in the mean change from baseline or a comparison of proportions) were analysed as key secondary endpoints. Eighty-two (PI/r) and 156 (MVC) participants were randomized and included in the ITT analysis; 71 (87%) and 130 (83%) were in follow-up and on therapy at week 96. At week 96, 89.0% and 90.4% in the PI/r and MVC arms, respectively, had pVL < 50 copies/mL (95% CI -6.6, 10.2). Moreover, in those switching away from PI/r, there were significant reductions in mean total cholesterol (differences 0.31 mmol/L; P = 0.02) and triglycerides (difference 0.44 mmol/L; P < 0.001). Changes in CD4 T-cell count, renal function, and serious and nonserious adverse events were similar in the two arms. MVC as a switch for a PI/r is safe and effective at maintaining virological suppression while having significant lipid benefits over 96 weeks. © 2017 British HIV Association.

Psychological distress following a motor vehicle crash: evidence from a statewide retrospective study examining settlement times and costs of compensation claims.

PubMed

Guest, Rebecca; Tran, Yvonne; Gopinath, Bamini; Cameron, Ian D; Craig, Ashley

2017-09-05

To determine whether psychological distress associated with musculoskeletal injuries sustained in a motor vehicle crash (MVC), regardless of time of onset, impacts compensation outcomes such as claim settlement times and costs. Second, to identify factors routinely collected by insurance companies that contribute to psychological distress during the compensation process. Statewide retrospective study. Analysis of the New South Wales statewide (Australia) injury register for MVC survivors who lodged a compensation claim from 2011 to 2013. 6341 adults who sustained a musculoskeletal injury and who settled a claim for injury after an MVC. Participants included those diagnosed with psychological distress (n=607) versus those not (n=5734). Time to settlement and total costs of claims, as well as socio-demographic and injury characteristics that may contribute to elevated psychological distress, such as socio-economic disadvantage, and injury severity. Psychological distress in those with a musculoskeletal injury was associated with significantly longer settlement times (an additional 17 weeks) and considerably higher costs (an additional $A41 575.00 or 4.3 times more expensive). Multivariate logistic regression analysis identified risk factors for psychological distress including being female, social disadvantage, unemployment prior to the claim, not being at fault in the MVC, requiring ambulance transportation and rehabilitation as part of recovery. Results provide compelling evidence that psychological distress has an adverse impact on people with musculoskeletal injury as they progress through compensation. Findings suggest that additional resources should be directed toward claimants who are at risk (eg, the socially disadvantaged or those unemployed prior to the claim), the major aim being to reduce risk of psychological distress, such as post-traumatic stress disorder, and associated risk of increased settlement times and claim costs. Prospective studies are now required that investigate treatment strategies for those at risk of psychological distress associated with an MVC. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Association of RAGE gene polymorphism with circulating AGEs level and paraoxonase activity in relation to macro-vascular complications in Indian type 2 diabetes mellitus patients.

PubMed

Bansal, Savita; Chawla, Diwesh; Banerjee, Basu Dev; Madhu, Sri Venkata; Tripathi, Ashok Kumar

2013-09-10

Sustained interaction of advanced glycation end products (AGEs) with their receptor RAGE and subsequent signaling plays an important role in the development of diabetic complications. Genetic variation of RAGE gene may be associated with the development of vascular complications in type 2 diabetes mellitus (T2DM). The present study aimed to explore the possible association of RAGE gene polymorphisms namely -374T/A, -429T/C and G82S with serum level of AGEs, paraoxonase (PON1) activity and macro-vascular complications (MVC) in Indian type 2 diabetes mellitus patients (T2DM). A total of 265 diabetic patients, including DM without any complications (n=135), DM-MVC (n=130) and 171 healthy individuals were enrolled. Genotyping of RAGE variants were assessed by polymerase chain reaction-restriction fragment length polymorphism. Serum AGEs were estimated by ELISA and fluorometrically. and PON1 activity was assessed spectrophotometrically. Of the three examined SNPs, association of -429T/C polymorphism with MVC in T2DM was observed (OR=3.001, p=0.001) in the dominant model. Allele 'A' of -374T/A polymorphism seems to confer better cardiac outcome in T2DM. Patients carrying C allele (-429T/C) and S allele (G82S) had significantly higher AGEs levels. -429T/C polymorphism was also found to be associated with low PON1 activity. Interaction analysis revealed that the risk of development of MVC was higher in T2DM patients carrying both a CC genotype of -429T/C polymorphism and a higher level of AGEs (OR=1.343, p=0.040). RAGE gene polymorphism has a significant effect on AGEs level and PON1 activity in diabetic subjects compared to healthy individuals. Diabetic patients with a CC genotype of -429T/C are prone to develop MVC, more so if AGEs levels are high and PON1 activity is low. Copyright © 2013 Elsevier B.V. All rights reserved.

Trends in Alabama teen driving death and injury.

PubMed

Monroe, Kathy; Irons, Elizabeth; Crew, Marie; Norris, Jesse; Nichols, Michele; King, William D

2014-09-01

Motor vehicle crashes (MVCs) are a leading cause of morbidity and mortality in teens. Alabama has been in the Top 5 states for MVC fatality rate among teens in the United States for several years. Twelve years of teen MVC deaths and injuries were evaluated. Our hypothesis is that the teen driving motor vehicle-related deaths and injuries have decreased related to legislative and community awareness activities. A retrospective analysis of Alabama teen MVC deaths and injury for the years 2000 to 2011 was conducted. MVC data were obtained from a Fatality Analysis Reporting System data set managed by the Center for Advanced Public Safety at the University of Alabama. A Lowess regression-scattergram analysis was used to identify period specific changes in deaths and injury over time. Statistical analysis was conducted using True Epistat 5.0 software. When the Lowess regression was applied, there was an obvious change in the trend line in 2007. To test that observation, we then compared medians in the pre-2007 and post-2007 periods, which validated our observation. Moreover, it provided a near-even number of observations for comparison. The Spearman rank correlation was used to test for correlation of deaths and injury over time. The Mann-Whitney U-test was used to evaluate median differences in deaths and injury comparing pre-2007 and post-2007 data. Alabama teen MVC deaths and injury demonstrated a significant negative correlation over the 12-year period (Rs for deaths and injury, -0.87 [p < 0.001] and -0.92 [p < 0.001], respectively). Lowess regression identified a notable decline in deaths and injury after the year 2006. Median deaths and injury for the pre-2007 period were significantly higher than the post-2007 period, (U = 35.0, p = 0.003). Alabama teen driver deaths and injury have decreased during the 12-year study period, most notably after 2006. Factors that may have contributed to this trend may include stricter laws for teen drivers (enacted in 2002 and updated in 2010), less teen driving because of a nationwide economic downturn, delayed licensing in teens, steady improvements in overall seat belt use, and heightened public awareness of risky behaviors in teen driving.

An examination of traffic-related traumatic injuries among children at a Level-1 pediatric trauma center, 2005-2014.

PubMed

Ma, Ping; Hussain, Nazia; Abbe, Marisa

2017-11-01

Traffic-related injuries are the leading fatal injury among children in the United States, but no published study compares the different types of traffic-related pediatric injuries to date. Thus, this study was aimed at examining the10-year trend of traffic-related injury among children at a pediatric hospital and to assess if there were differences in injury mechanism. All data were drawn from a Level-1 pediatric trauma center in North Texas in 2005-2014. Demographic characteristics, length of hospitalization, and patient type were included. Severity of injury outcome was assessed by injury severity score and fatality. The traffic-related injury mechanism included motor vehicle collision (MVC), motor-pedestrian collision (MPC), and motorcycle/moped collision (MMC). Description analyses and multinominal logistic regressions were applied to examine the factors associated with the type of motor-related injuries adjusting for covariates. All analyses were conducted by STATA version 14.0. A total of 3,742 traffic-related pediatric injuries were identified. The mean (SD) age was 6.4 (4.0) years; most patients were boys (59%) and Hispanic (40%). There was a waving trend of the number of traffic-related injuries over the 10-year period. Compared with MVC, demographic disparities exist with children experiencing an MPC injury. Hispanic and African American children were more likely to have an MPC but less likely to have a motorcycle/moped collision injury (relative risk [RR], 1.6; 95% confidence interval, 1.3-1.9; RR, 2.0; 95% confidence interval, 1.9-2.4, respectively). Children with an MPC injury had a more severe outcome than those with an MVC injury, but no difference was found in fatality. The MCC injuries did not significantly differ from MVC in injury severity. Although efforts have been made to prevent MVC-related pediatric injuries, the trend of MVCs was stable in the most recent years. The MPC-related injury continues to be a higher likelihood of severe pediatric trauma. Thus, continuing efforts and innovative intervention programs are still needed to prevent traffic-related pediatric injuries. Epidemiologic study, level III.

Intramuscular pressures in antigravity muscles using gravity-independent, pneumatic hardware.

PubMed

Macias, Brandon R; Minocha, Ranjeet; Cutuk, Adnan A; Hill, James; Shiau, Jonathon; Hargens, Alan R

2008-08-01

Resistive exercise helps prevent muscle atrophy in microgravity, but better exercise equipment is needed. Therefore, the purpose of this study was to determine if a pneumatic, gravity-independent leg-press device (LPD) provides sufficient force to leg musculature. We hypothesized that intramuscular pressure (IMP), a quantitative index of muscle force, is greater in the antigravity superficial posterior and deep posterior compartments than in the non-antigravity anterior compartment during bilateral leg-press exercise. Millar pressure transducers were inserted into the anterior, lateral, superficial posterior, and deep posterior muscle compartments of the left leg of eight healthy subjects (three women, five men). Subjects were supine on the Keiser SX-1, a pneumatic LPD. Then maximal voluntary contraction (MVC) was determined; each subject performed three consecutive voluntary contractions at approximately 18%, 50%, and 100% MVC while continuously measuring IMP. Repeated measures ANOVA were used to determine differences of IMPs between compartments and loads. The magnitudes of IMP (mean +/- SEM) at 18 - 3% (abbreviated approximately 18%), 50%, and 100% MVC in the superficial and deep posterior compartments were significantly greater than that in the anterior compartment during exercise (P < 0.05). Additionally, IMPs in all four compartments significantly rose as resistance increased at approximately 18%, 50%, and 100% MVC (P < 0.05). The LPD provides significantly increased resistance to all four compartments, but with greater loading of the antigravity compartments as compared to the non-antigravity compartment. Since antigravity muscles of the leg are contained primarily in the superficial and deep posterior compartments, the LPD may help prevent muscle atrophy associated with microgravity.

Impaired hip muscle strength in patients with femoroacetabular impingement syndrome.

PubMed

Kierkegaard, Signe; Mechlenburg, Inger; Lund, Bent; Søballe, Kjeld; Dalgas, Ulrik

2017-12-01

Patients with femoroacetabular impingement (FAI) experience hip pain as well as decreased function and lowered quality of life. The aim was to compare maximal isometric and isokinetic muscle strength (MVC) during hip flexion and extension and rate of force development (RFD) during extension between patients with FAI and a matched reference group. Secondary, the aim was to compare patient hips and subgroups defined by gender and age as well as to investigate associations between hip muscle strength and self-reported outcomes. Design Cross-sectional, comparative study Methods Sixty patients (36±9 years, 63% females) and 30 age and gender matched reference persons underwent MVC tests in an isokinetic dynamometer. During hip flexion and extension, patients' affected hip showed a strength deficit of 15-21% (p<0.001) and 10-25% (p<0.03) compared with reference MVC, respectively. The affected hip of the patients was significantly weaker than their contralateral hip. RFD was significantly decreased for both patient hips compared to the reference group (p<0.05). While age had less effect on MVC, female patients were more affected than male patients. Self-reported measures were associated with isometric hip muscle strength. Patients with FAI demonstrate decreased hip flexion and extension strength when compared to (1) reference persons and (2) their contralateral hip. There seems to be a gender specific affection which should be investigated further and addressed when planning training protocols. Furthermore, self-reported measures were associated with isometric muscle strength, which underlines the clinical importance of the reduced muscle strength. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Is Borg's perceived exertion scale a useful indicator of muscular and cardiovascular load in blue-collar workers with lifting tasks? A cross-sectional workplace study.

PubMed

Jakobsen, Markus Due; Sundstrup, Emil; Persson, Roger; Andersen, Christoffer H; Andersen, Lars L

2014-02-01

To investigate associations between perceived exertion and objectively assessed muscular and cardiovascular load during a full working day among workers with manual lifting tasks. A total of 159 men and 41 women from 14 workplaces with manual lifting tasks participated. Participants reported perceived exertion (BORG-CR10) at midday and after work. Surface electromyography of the thigh, lower back and neck muscles were normalized to isometric voluntary contractions (MVC) to express relative muscle load during the day. Cardiovascular load was measured with electrocardiography and calculated as the average percentage of the heart rate reserve capacity (((heart rate during work - resting heart rate) / (maximum heart rate - resting heart rate)) * 100) during the day. Using linear regression, significant but weak associations (β < 0.23) were observed between perceived exertion and (1) high muscle activity (>60% of MVC) of the neck muscles and (2) inactivity (<1% of MVC) of the thigh muscles and (3) cardiovascular load, respectively. Using logistic regression, perceived exertion ≥4 (high exertion), referencing <4 (low-to-moderate exertion), was related to high activity of the trapezius muscle [OR 18 (95% CI 2-143)], i.e., the odds for experiencing high exertion during work increased 18-fold for each percentage increase in time above 60% MVC. During a full working day among blue-collar workers with lifting tasks, high neck muscle activity increases the odds for experiencing high perceived physical exertion. Perceived exertion of at least 4 on the BORG CR10 scale appears to be a good indicator that high muscular loading occurs.

Manipulation of sensory input can improve stretching outcomes.

PubMed

Capobianco, Robyn A; Almuklass, Awad M; Enoka, Roger M

2018-02-01

The primary purpose of our study was to assess the influence of modulating sensory input with either transcutaneous electrical nerve stimulation (TENS) or self-massage with therapy balls on the maximal range of motion (ROM) about the ankle joint when stretching the calf muscles. We also investigated the influence of these two conditions on the force capacity and force control of plantar flexor muscles. Twenty healthy adults (25 ± 3 yr) performed three sessions of ankle plantar flexor stretching (three stretches of 30 s each): stretching alone (SS), stretching with concurrent TENS (TENS), and stretching after self-massage using therapy balls (SM). TENS was applied for 60 s prior to and during each stretch, and SM was performed for 60 s prior to each of the three stretches. Maximal voluntary contraction (MVC) torque and force steadiness at 20% MVC were recorded before and at 15 min after the final stretch. Ankle dorsiflexion ROM was assessed before, after, and at 5, 10, and 15 min after the last stretch. The increase in ROM was greater after SM (24%) than after SS (13%) and TENS (9%; p < .001). Maximal discomfort level (0-10 VAS) during stretching was similar for all conditions. MVC torque increased after SM only (p < .001, Cohen's D = 1.5): SM, 16%; SS, -1%; TENS, -3%. Force steadiness did not change. The sensory fibres that contribute to stretch tolerance were engaged by self-massage but not by TENS, resulting in greater increases in flexibility and MVC torque after self-massage.

The physical demands of Olympic yacht racing.

PubMed

Mackie, H; Sanders, R; Legg, S

1999-12-01

The primary purpose of this study was to quantify the up wards forces of the feet on the hiking strap and the forces in the mainsheet of four Olympic classes of racing dinghies (Europe, Laser. Finn and 470) during realistic on-water sailing in varying wind conditions. The secondary aim of the study was to measure the joint angles adopted by the sailors and boat heel angles. The tertiary aim was to identify events and sailing conditions associated with large or patterned force production. Forces in the hiking strap and mainsheet of four classes of Olympic sailing dinghies were measured on eleven New Zealand sailors during simulated on-water racing in a range of wind conditions. Up-wind hiking strap forces reached an average of 73-87% of predicted maximal voluntary contraction (pred MVC), with peak forces exceeding 100% pred MVC. Mainsheet forces reached 25-35% pred MVC, with peak forces reaching 40-50% pred MVC. Off-wind hiking strap and mainsheet forces were considerably lower than up-wind forces. Ankle and hip joint angles increased and knee joint angles decreased with increasing wind speed during up-wind sailing. Large forces occurred in the hiking strap and mainsheet when boats reached the tops of wave during up-wind sailing in high wind speeds and when a gust of wind hit the boat. During off-wind sailing large forces were observed in the mainsheet when surfing down waves. It is recommended that the intensities and joint angles found in this study be used as a basis for the development of class specific off-water physical conditioning programmes.

Objective assessment of actual chewing side by measurement of bilateral masseter muscle electromyography.

PubMed

Yamasaki, Yo; Kuwatsuru, Rika; Tsukiyama, Yoshihiro; Matsumoto, Hiroshi; Oki, Kyosuke; Koyano, Kiyoshi

2015-12-01

The aim of this study was to examine the validity of objective assessment of actual chewing side by measurement of electromyographic (EMG) activity of the bilateral masseter muscles upon chewing test foods. The sample consisted of 19 healthy, dentate individuals. The subjects were asked to chew three types of test foods (peanuts, beef jerky, and chewing gum) for 10 strokes on the right side and then on the left side, and instructed to perform maximum voluntary clenching for 3s, three times. EMG activity from the bilateral masseter muscles was recorded. The data were collected in three different days. The root mean square EMG amplitude obtained from the maximum clenching task was used as the maximum voluntary contraction (MVC). Then, the level of amplitude against the MVC (%MVC) was calculated for the right and left sides on each stroke. The side with the larger %MVC value was judged as the chewing side, and the concordance rates (CRs) for the instructed chewing side (ICS) and the judged chewing side (JCS) were calculated. Intraclass correlation coefficients (ICCs) of the CRs were calculated to evaluate the reproducibility of the method. High CRs between the ICS and JCS for each test food were recognized. There were significant ICCs for beef jerky (R=0.761, P<0.001) and chewing gum (R=0.785, P<0.001). The results suggested that the measurement of EMG activity from the bilateral masseter muscles may be a useful method for the objective determination of the actual chewing side during mastication. Copyright © 2015 Elsevier Ltd. All rights reserved.

Temporal Coding of Volumetric Imagery

NASA Astrophysics Data System (ADS)

Llull, Patrick Ryan

'Image volumes' refer to realizations of images in other dimensions such as time, spectrum, and focus. Recent advances in scientific, medical, and consumer applications demand improvements in image volume capture. Though image volume acquisition continues to advance, it maintains the same sampling mechanisms that have been used for decades; every voxel must be scanned and is presumed independent of its neighbors. Under these conditions, improving performance comes at the cost of increased system complexity, data rates, and power consumption. This dissertation explores systems and methods capable of efficiently improving sensitivity and performance for image volume cameras, and specifically proposes several sampling strategies that utilize temporal coding to improve imaging system performance and enhance our awareness for a variety of dynamic applications. Video cameras and camcorders sample the video volume (x,y,t) at fixed intervals to gain understanding of the volume's temporal evolution. Conventionally, one must reduce the spatial resolution to increase the framerate of such cameras. Using temporal coding via physical translation of an optical element known as a coded aperture, the compressive temporal imaging (CACTI) camera emonstrates a method which which to embed the temporal dimension of the video volume into spatial (x,y) measurements, thereby greatly improving temporal resolution with minimal loss of spatial resolution. This technique, which is among a family of compressive sampling strategies developed at Duke University, temporally codes the exposure readout functions at the pixel level. Since video cameras nominally integrate the remaining image volume dimensions (e.g. spectrum and focus) at capture time, spectral (x,y,t,lambda) and focal (x,y,t,z) image volumes are traditionally captured via sequential changes to the spectral and focal state of the system, respectively. The CACTI camera's ability to embed video volumes into images leads to exploration of other information within that video; namely, focal and spectral information. The next part of the thesis demonstrates derivative works of CACTI: compressive extended depth of field and compressive spectral-temporal imaging. These works successfully show the technique's extension of temporal coding to improve sensing performance in these other dimensions. Geometrical optics-related tradeoffs, such as the classic challenges of wide-field-of-view and high resolution photography, have motivated the development of mulitscale camera arrays. The advent of such designs less than a decade ago heralds a new era of research- and engineering-related challenges. One significant challenge is that of managing the focal volume (x,y,z ) over wide fields of view and resolutions. The fourth chapter shows advances on focus and image quality assessment for a class of multiscale gigapixel cameras developed at Duke. Along the same line of work, we have explored methods for dynamic and adaptive addressing of focus via point spread function engineering. We demonstrate another form of temporal coding in the form of physical translation of the image plane from its nominal focal position. We demonstrate this technique's capability to generate arbitrary point spread functions.

Sirepo for Synchrotron Radiation Workshop

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagler, Robert; Moeller, Paul; Rakitin, Maksim

Sirepo is an open source framework for cloud computing. The graphical user interface (GUI) for Sirepo, also known as the client, executes in any HTML5 compliant web browser on any computing platform, including tablets. The client is built in JavaScript, making use of the following open source libraries: Bootstrap, which is fundamental for cross-platform web applications; AngularJS, which provides a model–view–controller (MVC) architecture and GUI components; and D3.js, which provides interactive plots and data-driven transformations. The Sirepo server is built on the following Python technologies: Flask, which is a lightweight framework for web development; Jinja, which is a secure andmore » widely used templating language; and Werkzeug, a utility library that is compliant with the WSGI standard. We use Nginx as the HTTP server and proxy, which provides a scalable event-driven architecture. The physics codes supported by Sirepo execute inside a Docker container. One of the codes supported by Sirepo is the Synchrotron Radiation Workshop (SRW). SRW computes synchrotron radiation from relativistic electrons in arbitrary magnetic fields and propagates the radiation wavefronts through optical beamlines. SRW is open source and is primarily supported by Dr. Oleg Chubar of NSLS-II at Brookhaven National Laboratory.« less

Augmenting communication and decision making in the intensive care unit with a cardiopulmonary resuscitation video decision support tool: a temporal intervention study.

PubMed

McCannon, Jessica B; O'Donnell, Walter J; Thompson, B Taylor; El-Jawahri, Areej; Chang, Yuchiao; Ananian, Lillian; Bajwa, Ednan K; Currier, Paul F; Parikh, Mihir; Temel, Jennifer S; Cooper, Zara; Wiener, Renda Soylemez; Volandes, Angelo E

2012-12-01

Effective communication between intensive care unit (ICU) providers and families is crucial given the complexity of decisions made regarding goals of therapy. Using video images to supplement medical discussions is an innovative process to standardize and improve communication. In this six-month, quasi-experimental, pre-post intervention study we investigated the impact of a cardiopulmonary resuscitation (CPR) video decision support tool upon knowledge about CPR among surrogate decision makers for critically ill adults. We interviewed surrogate decision makers for patients aged 50 and over, using a structured questionnaire that included a four-question CPR knowledge assessment similar to those used in previous studies. Surrogates in the post-intervention arm viewed a three-minute video decision support tool about CPR before completing the knowledge assessment and completed questions about perceived value of the video. We recruited 23 surrogates during the first three months (pre-intervention arm) and 27 surrogates during the latter three months of the study (post-intervention arm). Surrogates viewing the video had more knowledge about CPR (p=0.008); average scores were 2.0 (SD 1.1) and 2.9 (SD 1.2) (out of a total of 4) in pre-intervention and post-intervention arms. Surrogates who viewed the video were comfortable with its content (81% very) and 81% would recommend the video. CPR preferences for patients at the time of ICU discharge/death were distributed as follows: pre-intervention: full code 78%, DNR 22%; post-intervention: full code 59%, DNR 41% (p=0.23).

Joint Machine Learning and Game Theory for Rate Control in High Efficiency Video Coding.

PubMed

Gao, Wei; Kwong, Sam; Jia, Yuheng

2017-08-25

In this paper, a joint machine learning and game theory modeling (MLGT) framework is proposed for inter frame coding tree unit (CTU) level bit allocation and rate control (RC) optimization in High Efficiency Video Coding (HEVC). First, a support vector machine (SVM) based multi-classification scheme is proposed to improve the prediction accuracy of CTU-level Rate-Distortion (R-D) model. The legacy "chicken-and-egg" dilemma in video coding is proposed to be overcome by the learning-based R-D model. Second, a mixed R-D model based cooperative bargaining game theory is proposed for bit allocation optimization, where the convexity of the mixed R-D model based utility function is proved, and Nash bargaining solution (NBS) is achieved by the proposed iterative solution search method. The minimum utility is adjusted by the reference coding distortion and frame-level Quantization parameter (QP) change. Lastly, intra frame QP and inter frame adaptive bit ratios are adjusted to make inter frames have more bit resources to maintain smooth quality and bit consumption in the bargaining game optimization. Experimental results demonstrate that the proposed MLGT based RC method can achieve much better R-D performances, quality smoothness, bit rate accuracy, buffer control results and subjective visual quality than the other state-of-the-art one-pass RC methods, and the achieved R-D performances are very close to the performance limits from the FixedQP method.

Immunoexpression of vascular endothelial growth factor in periapical granulomas, radicular cysts, and residual radicular cysts.

PubMed

Nonaka, Cassiano Francisco Weege; Maia, Alexandre Pinto; Nascimento, George João Ferreira do; de Almeida Freitas, Roseana; Batista de Souza, Lélia; Galvão, Hébel Cavalcanti

2008-12-01

Our aim was to assess and compare the immunoexpression of vascular endothelial growth factor (VEGF) in periapical granulomas (PGs), radicular cysts (RCs), and residual radicular cysts (RRCs), relating it to the angiogenic index and the intensity of the inflammatory infiltrate. Twenty PGs, 20 RCs, and 10 RRCs were evaluated by immunohistochemistry using anti-VEGF antibody. Angiogenic index was determined by microvessel count (MVC) using anti-von Willebrand factor antibody. The PGs and RCs showed higher expression of VEGF than the RRCs. Lesions presenting few inflammatory infiltrate revealed the lowest immunoexpression of VEGF (P < .05). Irrespective of the intensity of the inflammatory infiltrate, most of the RCs and RRCs showed moderate to strong epithelial expression of VEGF. Lesions showing dense inflammatory infiltrate presented higher MVC indices (P < .05). VEGF expression and MVC did not reveal a significant correlation (P > .05). VEGF is present in periapical inflammatory lesions but at a lower level in RRCs. The expression of this proangiogenic factor is closely related to the intensity of the inflammatory infiltrate in these lesions.

Conflicting effects of fatigue and potentiation on voluntary force.

PubMed

Behm, David G; Button, Duane C; Barbour, Glen; Butt, Jeremy C; Young, Warren B

2004-05-01

The objective of this study was to investigate whether a warm-up consisting of a series of maximal contractions would augment the force and activation of subsequent leg extensor contractions. Both voluntary and evoked isometric contractions were tested to determine the mechanisms underlying the response. Nine subjects were tested for twitch, tetanic, submaximal (30%), and maximal voluntary contractile (MVC) properties before and after (1, 5, 10, and 15 minutes) one to three 10-second MVCs. MVC force either did not change following 1-2 MVCs or was depressed at 10 and 15 minutes after 3 MVCs. MVC activation was decreased (4.4-6.9%) throughout recovery, whereas submaximal contractions were minimally affected. Although overall, twitches were potentiated (15.5-19.8%) posttest, 3 MVCs had significantly greater twitch potentiation than 1 or 2 MVCs at 5 and 10 minutes. Results suggest that voluntary and evoked contractions respond differently to prior 10-second MVCs. In the present study, a warm-up routine of 1-3 MVCs of a 10-second duration did not enhance subsequent voluntary performance.

The influence of aging on the isometric torque sharing patterns among the plantar flexor muscles.

PubMed

Oliveira, Liliam F; Verneque, Debora; Menegaldo, Luciano L

2017-01-01

Physiological cross-sectional area (PCSA) reduction of the triceps surae (TS) muscles during aging suggests a proportional loss of torque among its components: soleus, medial and lateral gastrocnemii. However, direct measurements of muscle forces in vivo are not feasible. The purpose of this paper was to compare, between older and young women, isometric ankle joint torque sharing patterns among TS muscles and tibialis anterior (TA). An EMG-driven model was used for estimating individual muscle torque contributions to the total plantar flexor torque, during sustained contractions of 10% and 40% of maximum voluntary contraction (MVC). Relative individual muscle contributions to the total plantar flexion torque were similar between older and young women groups, for both intensities, increasing from LG, MG to SOL. Muscle strength (muscle torque/body mass) was significantly greater for all TS components in 40% MVC contractions. Increased TA activation was observed in 10% of MVC for older people. Despite the reduced maximum isometric torque and muscle strength, the results suggest small variations of ankle muscle synergies during the aging process.

AphasiaBank: a resource for clinicians.

PubMed

Forbes, Margaret M; Fromm, Davida; Macwhinney, Brian

2012-08-01

AphasiaBank is a shared, multimedia database containing videos and transcriptions of ~180 aphasic individuals and 140 nonaphasic controls performing a uniform set of discourse tasks. The language in the videos is transcribed in Codes for the Human Analysis of Transcripts (CHAT) format and coded for analysis with Computerized Language ANalysis (CLAN) programs, which can perform a wide variety of language analyses. The database and the CLAN programs are freely available to aphasia researchers and clinicians for educational, clinical, and scholarly uses. This article describes the database, suggests some ways in which clinicians and clinician researchers might find these materials useful, and introduces a new language analysis program, EVAL, designed to streamline the transcription and coding processes, while still producing an extensive and useful language profile. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Applications of just-noticeable depth difference model in joint multiview video plus depth coding

NASA Astrophysics Data System (ADS)

Liu, Chao; An, Ping; Zuo, Yifan; Zhang, Zhaoyang

2014-10-01

A new multiview just-noticeable-depth-difference(MJNDD) Model is presented and applied to compress the joint multiview video plus depth. Many video coding algorithms remove spatial and temporal redundancies and statistical redundancies but they are not capable of removing the perceptual redundancies. Since the final receptor of video is the human eyes, we can remove the perception redundancy to gain higher compression efficiency according to the properties of human visual system (HVS). Traditional just-noticeable-distortion (JND) model in pixel domain contains luminance contrast and spatial-temporal masking effects, which describes the perception redundancy quantitatively. Whereas HVS is very sensitive to depth information, a new multiview-just-noticeable-depth-difference(MJNDD) model is proposed by combining traditional JND model with just-noticeable-depth-difference (JNDD) model. The texture video is divided into background and foreground areas using depth information. Then different JND threshold values are assigned to these two parts. Later the MJNDD model is utilized to encode the texture video on JMVC. When encoding the depth video, JNDD model is applied to remove the block artifacts and protect the edges. Then we use VSRS3.5 (View Synthesis Reference Software) to generate the intermediate views. Experimental results show that our model can endure more noise and the compression efficiency is improved by 25.29 percent at average and by 54.06 percent at most compared to JMVC while maintaining the subject quality. Hence it can gain high compress ratio and low bit rate.

Complexity reduction in the H.264/AVC using highly adaptive fast mode decision based on macroblock motion activity

NASA Astrophysics Data System (ADS)

Abdellah, Skoudarli; Mokhtar, Nibouche; Amina, Serir

2015-11-01

The H.264/AVC video coding standard is used in a wide range of applications from video conferencing to high-definition television according to its high compression efficiency. This efficiency is mainly acquired from the newly allowed prediction schemes including variable block modes. However, these schemes require a high complexity to select the optimal mode. Consequently, complexity reduction in the H.264/AVC encoder has recently become a very challenging task in the video compression domain, especially when implementing the encoder in real-time applications. Fast mode decision algorithms play an important role in reducing the overall complexity of the encoder. In this paper, we propose an adaptive fast intermode algorithm based on motion activity, temporal stationarity, and spatial homogeneity. This algorithm predicts the motion activity of the current macroblock from its neighboring blocks and identifies temporal stationary regions and spatially homogeneous regions using adaptive threshold values based on content video features. Extensive experimental work has been done in high profile, and results show that the proposed source-coding algorithm effectively reduces the computational complexity by 53.18% on average compared with the reference software encoder, while maintaining the high-coding efficiency of H.264/AVC by incurring only 0.097 dB in total peak signal-to-noise ratio and 0.228% increment on the total bit rate.

Audiovisual signal compression: the 64/P codecs

NASA Astrophysics Data System (ADS)

Jayant, Nikil S.

1996-02-01

Video codecs operating at integral multiples of 64 kbps are well-known in visual communications technology as p * 64 systems (p equals 1 to 24). Originally developed as a class of ITU standards, these codecs have served as core technology for videoconferencing, and they have also influenced the MPEG standards for addressable video. Video compression in the above systems is provided by motion compensation followed by discrete cosine transform -- quantization of the residual signal. Notwithstanding the promise of higher bit rates in emerging generations of networks and storage devices, there is a continuing need for facile audiovisual communications over voice band and wireless modems. Consequently, video compression at bit rates lower than 64 kbps is a widely-sought capability. In particular, video codecs operating at rates in the neighborhood of 64, 32, 16, and 8 kbps seem to have great practical value, being matched respectively to the transmission capacities of basic rate ISDN (64 kbps), and voiceband modems that represent high (32 kbps), medium (16 kbps) and low- end (8 kbps) grades in current modem technology. The purpose of this talk is to describe the state of video technology at these transmission rates, without getting too literal about the specific speeds mentioned above. In other words, we expect codecs designed for non- submultiples of 64 kbps, such as 56 kbps or 19.2 kbps, as well as for sub-multiples of 64 kbps, depending on varying constraints on modem rate and the transmission rate needed for the voice-coding part of the audiovisual communications link. The MPEG-4 video standards process is a natural platform on which to examine current capabilities in sub-ISDN rate video coding, and we shall draw appropriately from this process in describing video codec performance. Inherent in this summary is a reinforcement of motion compensation and DCT as viable building blocks of video compression systems, although there is a need for improving signal quality even in the very best of these systems. In a related part of our talk, we discuss the role of preprocessing and postprocessing subsystems which serve to enhance the performance of an otherwise standard codec. Examples of these (sometimes proprietary) subsystems are automatic face-tracking prior to the coding of a head-and-shoulders scene, and adaptive postfiltering after conventional decoding, to reduce generic classes of artifacts in low bit rate video. The talk concludes with a summary of technology targets and research directions. We discuss targets in terms of four fundamental parameters of coder performance: quality, bit rate, delay and complexity; and we emphasize the need for measuring and maximizing the composite quality of the audiovisual signal. In discussing research directions, we examine progress and opportunities in two fundamental approaches for bit rate reduction: removal of statistical redundancy and reduction of perceptual irrelevancy; we speculate on the value of techniques such as analysis-by-synthesis that have proved to be quite valuable in speech coding, and we examine the prospect of integrating speech and image processing for developing next-generation technology for audiovisual communications.

Reference View Selection in DIBR-Based Multiview Coding.

PubMed

Maugey, Thomas; Petrazzuoli, Giovanni; Frossard, Pascal; Cagnazzo, Marco; Pesquet-Popescu, Beatrice

2016-04-01

Augmented reality, interactive navigation in 3D scenes, multiview video, and other emerging multimedia applications require large sets of images, hence larger data volumes and increased resources compared with traditional video services. The significant increase in the number of images in multiview systems leads to new challenging problems in data representation and data transmission to provide high quality of experience on resource-constrained environments. In order to reduce the size of the data, different multiview video compression strategies have been proposed recently. Most of them use the concept of reference or key views that are used to estimate other images when there is high correlation in the data set. In such coding schemes, the two following questions become fundamental: 1) how many reference views have to be chosen for keeping a good reconstruction quality under coding cost constraints? And 2) where to place these key views in the multiview data set? As these questions are largely overlooked in the literature, we study the reference view selection problem and propose an algorithm for the optimal selection of reference views in multiview coding systems. Based on a novel metric that measures the similarity between the views, we formulate an optimization problem for the positioning of the reference views, such that both the distortion of the view reconstruction and the coding rate cost are minimized. We solve this new problem with a shortest path algorithm that determines both the optimal number of reference views and their positions in the image set. We experimentally validate our solution in a practical multiview distributed coding system and in the standardized 3D-HEVC multiview coding scheme. We show that considering the 3D scene geometry in the reference view, positioning problem brings significant rate-distortion improvements and outperforms the traditional coding strategy that simply selects key frames based on the distance between cameras.

Driving with pets and motor vehicle collision involvement among older drivers: a prospective population-based study

PubMed Central

Huisingh, Carrie; Levitan, Emily B.; Irvin, Marguerite R.; Owsley, Cynthia; McGwin, Gerald

2016-01-01

Objective Distracted driving is a major cause of motor vehicle collision (MVC) involvement. Pets have been identified as potential distraction to drivers, particularly in the front. This type of distraction could be worse for those with impairment in the cognitive aspects of visual processing. The purpose of this study is to evaluate the association between driving with pets and rates of motor vehicle collision involvementin a cohort of older drivers. Methods A three-year prospective was conducted in a population-based sample of 2000 licensed drivers aged 70 years and older. At the baseline visit, a trained interviewer asked participants about pet ownership, whether they drive with pets, how frequently, and where the pet sits in the vehicle. Motor vehicle collision (MVC) involvement during the three-year study period was obtained from the Alabama Department of Public Safety. At-fault status was determined by the police officer who arrived on the scene. Participants were followed until the earliest of death, driving cessation, or end of the study period. Poisson regression was used to calculate crude and adjusted rate ratios (RR) examining the association between pet ownership, presence of a pet in a vehicle, frequency of driving with a pet, and location of the pet inside with vehicle with any and at-fault MVC involvement. We examined whether the associations differed by higher order visual processing impairment status, as measured by Useful Field Of View, Trails B, and Motor-free Visual Perception Test. Results Rates of crash involvement were similar for older adults who have ever driven with a pet compared to those who never drove with their pet (RR=1.15, 95% CI 0.76-1.75). Drivers who reported always or sometimes driving with their pet had higherMVC rates compared topet owners who never drive with a pet, but this association was not statistically significant (RR=1.39, 95% CI 0.86-2.24). In terms of location, those reporting having a pet frequently ride in the front of the vehicle had similar rates of MVC involvement compared to those who did not drive with a pet in the front. A similar pattern of results was observed for at-fault MVCs. This association was not modified by visual processing impairment status. Conclusion The current study demonstrates a positive but non-significant association between frequently driving with pets and MVC involvement. More research is needed, particularly on restraint use and whether the pet was in the car at the time of the crash, to help characterize the public safety benefit of regulations on driving with pets. PMID:26774042

Driving with pets and motor vehicle collision involvement among older drivers: A prospective population-based study.

PubMed

Huisingh, Carrie; Levitan, Emily B; Irvin, Marguerite R; Owsley, Cynthia; McGwin, Gerald

2016-03-01

Distracted driving is a major cause of motor vehicle collision (MVC) involvement. Pets have been identified as potential distraction to drivers, particularly in the front. This type of distraction could be worse for those with impairment in the cognitive aspects of visual processing. The purpose of this study is to evaluate the association between driving with pets and rates of motor vehicle collision involvement in a cohort of older drivers. A three-year prospective study was conducted in a population-based sample of 2000 licensed drivers aged 70 years and older. At the baseline visit, a trained interviewer asked participants about pet ownership, whether they drive with pets, how frequently, and where the pet sits in the vehicle. Motor vehicle collision (MVC) involvement during the three-year study period was obtained from the Alabama Department of Public Safety. At-fault status was determined by the police officer who arrived on the scene. Participants were followed until the earliest of death, driving cessation, or end of the study period. Poisson regression was used to calculate crude and adjusted rate ratios (RR) examining the association between pet ownership, presence of a pet in a vehicle, frequency of driving with a pet, and location of the pet inside with vehicle with any and at-fault MVC involvement. We examined whether the associations differed by higher order visual processing impairment status, as measured by Useful Field of View, Trails B, and Motor-free Visual Perception Test. Rates of crash involvement were similar for older adults who have ever driven with a pet compared to those who never drove with their pet (RR=1.15, 95% CI 0.76-1.75). Drivers who reported always or sometimes driving with their pet had higher MVC rates compared to pet owners who never drive with a pet, but this association was not statistically significant (RR=1.39, 95% CI 0.86-2.24). In terms of location, those reporting having a pet frequently ride in the front of the vehicle had similar rates of MVC involvement compared to those who did not drive with a pet in the front. A similar pattern of results was observed for at-fault MVCs. This association was not modified by visual processing impairment status. The current study demonstrates a positive but non-significant association between frequently driving with pets and MVC involvement. More research is needed, particularly on restraint use and whether the pet was in the car at the time of the crash, to help characterize the public safety benefit of regulations on driving with pets. Copyright © 2015 Elsevier Ltd. All rights reserved.

"It's Totally Okay to Be Sad, but Never Lose Hope": Content Analysis of Infertility-Related Videos on YouTube in Relation to Viewer Preferences.

PubMed

Kelly-Hedrick, Margot; Grunberg, Paul H; Brochu, Felicia; Zelkowitz, Phyllis

2018-05-23

Infertility patients frequently use the internet to find fertility-related information and support from people in similar circumstances. YouTube is increasingly used as a source of health-related information and may influence health decision making. There have been no studies examining the content of infertility-related videos on YouTube. The purpose of this study was to (1) describe the content of highly viewed videos on YouTube related to infertility and (2) identify video characteristics that relate to viewer preference. Using the search term "infertility," the 80 top-viewed YouTube videos and their viewing statistics (eg, views, likes, and comments) were collected. Videos that were non-English, unrelated to infertility, or had age restrictions were excluded. Content analysis was used to examine videos, employing a coding rubric that measured the presence or absence of video codes related to purpose, tone, and demographic and fertility characteristics (eg, sex, parity, stage of fertility treatment). A total of 59 videos, with a median of 156,103 views, met the inclusion criteria and were categorized into 35 personal videos (35/59, 59%) and 24 informational-educational videos (24/59, 41%). Personal videos did not differ significantly from informational-educational videos on number of views, dislikes, subscriptions driven, or shares. However, personal videos had significantly more likes (P<.001) and comments (P<.001) than informational-educational videos. The purposes of the videos were treatment outcomes (33/59, 56%), sharing information (30/59, 51%), emotional aspects of infertility (20/59, 34%), and advice to others (6/59, 10%). The tones of the videos were positive (26/59, 44%), neutral (25/59, 42%), and mixed (8/59, 14%); there were no videos with negative tone. No videos contained only male posters. Videos with a positive tone did not differ from neutral videos in number of views, dislikes, subscriptions driven, or shares; however, positive videos had significantly more likes (P<.001) and comments (P<.001) than neutral videos. A majority (21/35, 60%) of posters of personal videos shared a pregnancy announcement. YouTube is a source of both technical and personal experience-based information about infertility. However, videos that include personal experiences may elicit greater viewer engagement. Positive videos and stories of treatment success may provide hope to viewers but could also create and perpetuate unrealistic expectations about the success rates of fertility treatment. ©Margot Kelly-Hedrick, Paul H Grunberg, Felicia Brochu, Phyllis Zelkowitz. Originally published in the Journal of Medical Internet Research (http://www.jmir.org), 23.05.2018.

A Snapshot of the Depiction of Electronic Cigarettes in YouTube Videos.

PubMed

Romito, Laura M; Hurwich, Risa A; Eckert, George J

2015-11-01

To assess the depiction of e-cigarettes in YouTube videos. The sample (N = 63) was selected from the top 20 search results for "electronic cigarette," and "e-cig" with each term searched twice by the filters "Relevance" and "View Count." Data collected included title, length, number of views, "likes," "dislikes," comments, and inferred demographics of individuals appearing in the videos. Seventy-six percent of videos included at least one man, 62% included a Caucasian, and 50% included at least one young individual. Video content connotation was coded as positive (76%), neutral (18%), or negative (6%). Videos were categorized as advertisement (33%), instructional (17%), news clip (19%), product review (13%), entertainment (11%), public health (3%), and personal testimonial (3%). Most e-cigarette YouTube videos are non-traditional or covert advertisements featuring young Caucasian men.

Optimal UAV Path Planning for Tracking a Moving Ground Vehicle with a Gimbaled Camera

DTIC Science & Technology

2014-03-27

micro SD card slot to record all video taken at 1080P resolution. This feature allows the team to record the high definition video taken by the...Inequality constraints 64 h=[]; %Equality constraints 104 Bibliography 1. “ DIY Drones: Official ArduPlane Repository”, 2013. URL https://code

77 FR 64514 - Sunshine Act Meeting; Open Commission Meeting; Wednesday, October 17, 2012

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-22

.../Video coverage of the meeting will be broadcast live with open captioning over the Internet from the FCC... format and alternative media, including large print/ type; digital disk; and audio and video tape. Best.... 2012-26060 Filed 10-18-12; 4:15 pm] BILLING CODE 6712-01-P ...

Differences in Fidelity of Implementation Measures: What Videos and Surveys Reveal about Algebra Instruction

ERIC Educational Resources Information Center

Durkin, Kelley; Pollack, Courtney; Star, Jon R.; Rittle-Johnson, Bethany

2012-01-01

The current paper investigated the following research questions regarding measures of fidelity: (1) Is there a significant relationship between two different measures of fidelity of implementation: a survey of instructional practices and coded videos of classroom lessons? Does the strength of this relationship differ between treatment and control…

ISO-IEC MPEG-2 software video codec

NASA Astrophysics Data System (ADS)

Eckart, Stefan; Fogg, Chad E.

1995-04-01

Part 5 of the International Standard ISO/IEC 13818 `Generic Coding of Moving Pictures and Associated Audio' (MPEG-2) is a Technical Report, a sample software implementation of the procedures in parts 1, 2 and 3 of the standard (systems, video, and audio). This paper focuses on the video software, which gives an example of a fully compliant implementation of the standard and of a good video quality encoder, and serves as a tool for compliance testing. The implementation and some of the development aspects of the codec are described. The encoder is based on Test Model 5 (TM5), one of the best, published, non-proprietary coding models, which was used during MPEG-2 collaborative stage to evaluate proposed algorithms and to verify the syntax. The most important part of the Test Model is controlling the quantization parameter based on the image content and bit rate constraints under both signal-to-noise and psycho-optical aspects. The decoder has been successfully tested for compliance with the MPEG-2 standard, using the ISO/IEC MPEG verification and compliance bitstream test suites as stimuli.

Huffman coding in advanced audio coding standard

NASA Astrophysics Data System (ADS)

Brzuchalski, Grzegorz

2012-05-01

This article presents several hardware architectures of Advanced Audio Coding (AAC) Huffman noiseless encoder, its optimisations and working implementation. Much attention has been paid to optimise the demand of hardware resources especially memory size. The aim of design was to get as short binary stream as possible in this standard. The Huffman encoder with whole audio-video system has been implemented in FPGA devices.

Binary video codec for data reduction in wireless visual sensor networks

NASA Astrophysics Data System (ADS)

Khursheed, Khursheed; Ahmad, Naeem; Imran, Muhammad; O'Nils, Mattias

2013-02-01

Wireless Visual Sensor Networks (WVSN) is formed by deploying many Visual Sensor Nodes (VSNs) in the field. Typical applications of WVSN include environmental monitoring, health care, industrial process monitoring, stadium/airports monitoring for security reasons and many more. The energy budget in the outdoor applications of WVSN is limited to the batteries and the frequent replacement of batteries is usually not desirable. So the processing as well as the communication energy consumption of the VSN needs to be optimized in such a way that the network remains functional for longer duration. The images captured by VSN contain huge amount of data and require efficient computational resources for processing the images and wide communication bandwidth for the transmission of the results. Image processing algorithms must be designed and developed in such a way that they are computationally less complex and must provide high compression rate. For some applications of WVSN, the captured images can be segmented into bi-level images and hence bi-level image coding methods will efficiently reduce the information amount in these segmented images. But the compression rate of the bi-level image coding methods is limited by the underlined compression algorithm. Hence there is a need for designing other intelligent and efficient algorithms which are computationally less complex and provide better compression rate than that of bi-level image coding methods. Change coding is one such algorithm which is computationally less complex (require only exclusive OR operations) and provide better compression efficiency compared to image coding but it is effective for applications having slight changes between adjacent frames of the video. The detection and coding of the Region of Interest (ROIs) in the change frame efficiently reduce the information amount in the change frame. But, if the number of objects in the change frames is higher than a certain level then the compression efficiency of both the change coding and ROI coding becomes worse than that of image coding. This paper explores the compression efficiency of the Binary Video Codec (BVC) for the data reduction in WVSN. We proposed to implement all the three compression techniques i.e. image coding, change coding and ROI coding at the VSN and then select the smallest bit stream among the results of the three compression techniques. In this way the compression performance of the BVC will never become worse than that of image coding. We concluded that the compression efficiency of BVC is always better than that of change coding and is always better than or equal that of ROI coding and image coding.

AVC/H.264 patent portfolio license

NASA Astrophysics Data System (ADS)

Horn, Lawrence A.

2004-11-01

MPEG LA, LLC recently announced terms of a joint patent license for the AVC (a/k/a H.264) Standard (ISO/IEC IS 14496-10: Information technology -- Coding of audio-visual objects -- Part 10: Advanced Video Coding | ITU-T Rec. H.264: Series H: Audiovisual and Multimedia Systems: Infrastructure of audiovisual services -- Coding of moving video: Advanced video coding for generic audiovisual services). Like MPEG LA"s other licenses, the AVC Patent Portfolio License is offered for the convenience of the marketplace as an alternative enabling users to access essential intellectual property owned by many patent holders under a single license rather than negotiating licenses with each of them individually. The AVC Patent Portfolio License includes essential patents owned by Columbia Innovation Enterprises; Electronics and Telecommunications Research Institute (ETRI); France Télécom, société anonyme; Fujitsu Limited; Koninklijke Philips Electronics N.V.; Matsushita Electric Industrial Co., Ltd.; Microsoft Corporation; Mitsubishi Electric Corporation; Robert Bosch GmbH; Samsung Electronics Co., Ltd.; Sharp Kabushiki Kaisha; Sony Corporation; Toshiba Corporation; and Victor Company of Japan, Limited. MPEG LA"s objective is to provide worldwide access to as much AVC essential intellectual property as possible for the benefit of AVC users. Therefore, any party that believes it has essential patents is welcome to submit them for evaluation of their essentiality and inclusion in the License if found essential.

Processes involved in solving mathematical problems

NASA Astrophysics Data System (ADS)

Shahrill, Masitah; Putri, Ratu Ilma Indra; Zulkardi, Prahmana, Rully Charitas Indra

2018-04-01

This study examines one of the instructional practices features utilized within the Year 8 mathematics lessons in Brunei Darussalam. The codes from the TIMSS 1999 Video Study were applied and strictly followed, and from the 183 mathematics problems recorded, there were 95 problems with a solution presented during the public segments of the video-recorded lesson sequences of the four sampled teachers. The analyses involved firstly, identifying the processes related to mathematical problem statements, and secondly, examining the different processes used in solving the mathematical problems for each problem publicly completed during the lessons. The findings revealed that for three of the teachers, their problem statements coded as `using procedures' ranged from 64% to 83%, while the remaining teacher had 40% of his problem statements coded as `making connections.' The processes used when solving the problems were mainly `using procedures', and none of the problems were coded as `giving results only'. Furthermore, all four teachers made use of making the relevant connections in solving the problems given to their respective students.

Time synchronized video systems

NASA Technical Reports Server (NTRS)

Burnett, Ron

1994-01-01

The idea of synchronizing multiple video recordings to some type of 'range' time has been tried to varying degrees of success in the past. Combining this requirement with existing time code standards (SMPTE) and the new innovations in desktop multimedia however, have afforded an opportunity to increase the flexibility and usefulness of such efforts without adding costs over the traditional data recording and reduction systems. The concept described can use IRIG, GPS or a battery backed internal clock as the master time source. By converting that time source to Vertical Interval Time Code or Longitudinal Time Code, both in accordance with the SMPTE standards, the user will obtain a tape that contains machine/computer readable time code suitable for use with editing equipment that is available off-the-shelf. Accuracy on playback is then determined by the playback system chosen by the user. Accuracies of +/- 2 frames are common among inexpensive systems and complete frame accuracy is more a matter of the users' budget than the capability of the recording system.

Postmaximal contraction blood volume responses are blunted in obese and type 2 diabetic subjects in a muscle-specific manner

PubMed Central

Sanchez, Otto A.; Copenhaver, Elizabeth A.; Chance, Marti A.; Fowler, Michael J.; Towse, Theodore F.; Kent-Braun, Jane A.

2011-01-01

The purpose of this study was to determine whether there are differences in postisometric contraction blood volume and oxygenation responses among groups of type 2 diabetes mellitus (T2DM), obese, and lean individuals detectable using MRI. Eight T2DM patients were individually matched by age, sex, and race to non-T2DM individuals with similar body mass index (obese) and lean subjects. Functional MRI was performed using a dual-gradient-recalled echo, echo-planar imaging sequence with a repetition time of 1 s and at two echo times (TE = 6 and 46 ms). Data were acquired before, during, and after 10-s isometric dorsiflexion contractions performed at 50 and 100% of maximal voluntary contraction (MVC) force. MRI signal intensity (SI) changes from the tibialis anterior and extensor digitorum longus muscles were plotted as functions of time for each TE. From each time course, the difference between the minimum and the maximum postcontraction SI (ΔSI) were determined for TE = 6 ms (ΔSI6) and TE = 46 ms (ΔSI46), reflecting variations in blood volume and oxyhemoglobin saturation, respectively. Following 50% MVC contractions, the mean postcontraction ΔSI6 values were similar in the three groups. Following MVC only, and in the EDL muscle only, T2DM and obese participants had ∼56% lower ΔSI6 than the lean individuals. Also following MVC only, the ΔSI46 response in the EDL was lower in T2DM subjects than in lean individuals. These data suggest that skeletal muscle small vessel impairment occurs in T2DM and body mass index-matched subjects, in muscle-specific and contraction intensity-dependent manners. PMID:21572006

Alcohol Policies and Alcohol-Related Motor Vehicle Crash Fatalities Among Young People in the US.

PubMed

Hadland, Scott E; Xuan, Ziming; Sarda, Vishnudas; Blanchette, Jason; Swahn, Monica H; Heeren, Timothy C; Voas, Robert B; Naimi, Timothy S

2017-03-01

Motor vehicle crashes (MVCs) are a leading cause of death among young people in the United States. We examined the relationship between states' alcohol policy environments and alcohol-related MVC fatalities among children, adolescents, and young adults under the minimum legal drinking age of 21 years. We used the Alcohol Policy Scale (APS), an assessment of 29 alcohol policies across 50 states and Washington, DC, developed with the assistance of an interdisciplinary Delphi panel. Using the Fatality Analysis Reporting System, we examined APS scores in relation to fatalities of people ≤20 years old from 2000 to 2013 occurring in crashes in which ≥1 involved driver had a blood alcohol content ≥0.08%. Logistic regression was used with a 1-year lag between policies and MVC fatalities and adjusted for potential confounders. Of 84 756 MVC fatalities of those ≤20 years old during the study period, 23 757 (28.0%) were alcohol related, including deaths of 11 006 (46.3%) drivers, 10 212 (43.0%) passengers, and 2539 (10.7%) pedestrians, cyclists, and others. People killed in alcohol-related MVCs were predominantly male (72.7%) and older (65.5% were 18-20 years old), and 51.2% were non-Hispanic white. Restrictive policy environments were associated with fewer fatalities (adjusted odds ratio, 0.91 per 10-percentage-point increase in APS score; 95% confidence interval, 0.89-0.94). The association was observed for drivers and passengers, male and female decendents, and children, adolescents, and young adults. More restrictive alcohol policies are associated with reduced alcohol-related MVC mortality among young people. Studies should scrutinize the relationship between policies and fatalities to highlight mechanisms. Copyright © 2017 by the American Academy of Pediatrics.

Polymorphisms in PTK2 are associated with skeletal muscle specific force: an independent replication study.

PubMed

Stebbings, Georgina K; Williams, A G; Morse, C I; Day, S H

2017-04-01

The aim of the study was to investigate two single nucleotide polymorphisms (SNP) in PTK2 for associations with human muscle strength phenotypes in healthy men. Measurement of maximal isometric voluntary knee extension (MVC KE ) torque, net MVC KE torque and vastus lateralis (VL) specific force, using established techniques, was completed on 120 Caucasian men (age = 20.6 ± 2.3 year; height = 1.79 ± 0.06 m; mass = 75.0 ± 10.0 kg; mean ± SD). All participants provided either a blood (n = 96) or buccal cell sample, from which DNA was isolated and genotyped for the PTK2 rs7843014 A/C and rs7460 A/T SNPs using real-time polymerase chain reaction. Genotype frequencies for both SNPs were in Hardy-Weinberg equilibrium (X 2  ≤ 1.661, P ≥ 0.436). VL specific force was 8.3% higher in rs7843014 AA homozygotes than C-allele carriers (P = 0.017) and 5.4% higher in rs7460 AA homozygotes than T-allele carriers (P = 0.029). No associations between either SNP and net MVC KE torque (P ≥ 0.094) or peak MVC KE torque (P ≥ 0.107) were observed. These findings identify a genetic contribution to the inter-individual variability within muscle specific force and provides the first independent replication, in a larger Caucasian cohort, of an association between these PTK2 SNPs and muscle specific force, thus extending our understanding of the influence of genetic variation on the intrinsic strength of muscle.

High-threshold motor unit firing reflects force recovery following a bout of damaging eccentric exercise.

PubMed

Macgregor, Lewis J; Hunter, Angus M

2018-01-01

Exercise-induced muscle damage (EIMD) is associated with impaired muscle function and reduced neuromuscular recruitment. However, motor unit firing behaviour throughout the recovery period is unclear. EIMD impairment of maximal voluntary force (MVC) will, in part, be caused by reduced high-threshold motor unit firing, which will subsequently increase to recover MVC. Fourteen healthy active males completed a bout of eccentric exercise on the knee extensors, with measurements of MVC, rate of torque development and surface electromyography performed pre-exercise and 2, 3, 7 and 14 days post-exercise, on both damaged and control limb. EIMD was associated with decreased MVC (235.2 ± 49.3 Nm vs. 161.3 ± 52.5 Nm; p <0.001) and rate of torque development (495.7 ± 136.9 Nm.s-1 vs. 163.4 ± 163.7 Nm.s-1; p <0.001) 48h post-exercise. Mean motor unit firing rate was reduced (16.4 ± 2.2 Hz vs. 12.6 ± 1.7 Hz; p <0.01) in high-threshold motor units only, 48h post-exercise, and common drive was elevated (0.36 ± 0.027 vs. 0.56 ± 0.032; p< 0.001) 48h post-exercise. The firing rate of high-threshold motor units was reduced in parallel with impaired muscle function, whilst early recruited motor units remained unaltered. Common drive of motor units increased in offset to the firing rate impairment. These alterations correlated with the recovery of force decrement, but not of pain elevation. This study provides fresh insight into the central mechanisms associated with EIMD recovery, relative to muscle function. These findings may in turn lead to development of novel management and preventative procedures.

Upper limb discomfort profile due to intermittent isometric pronation torque at different postural combinations of the shoulder-arm system.

PubMed

Mukhopadhyay, Prabir; O'Sullivan, Leonard W; Gallwey, Timothy J

2009-05-01

Twenty-seven right-handed male university students participated in this study, which comprised a full factorial model consisting of three forearm rotation angles (60% prone and supine and neutral range of motion), three elbow angles (45 degrees , 90 degrees and 135 degrees ), three upper arm angles (45 degrees flexion/extension and neutral), one exertion frequency (15 per min) and one level of pronation torque (20% maximum voluntary contraction (MVC) relative to MVC at each articulation). Discomfort rating after the end of each 5 min treatment was recorded on a visual analogue scale. Results of a repeated measures analysis of covariance on discomfort score, with torque endurance time as covariate, indicated that none of the factors was significant including torque endurance time (p = 0.153). An initial data collection phase preceded the main experiment in order to ensure that participants exerted exactly 20% MVC of the particular articulation. In this phase MVC pronation torque was measured at each articulation. The data revealed a significant forearm rotation angle effect (p = 0.001) and participant effect (p = 0.001). Of the two-way interactions, elbow*participant (p = 0.004), forearm*participant (p = 0.001) and upper arm*participant (p = 0.005) were the significant factors. Electromyographic activity of the pronator teres and biceps brachii muscles revealed no significant change in muscle activity in most of the articulations. Industrial jobs involving deviated upper arm postures are typical in industry but have a strong association with injury. Data from this study will enable better understanding of the effects of deviated upper arm postures on musculoskeletal disorders and can also be used to identify and control high-risk tasks in industry.

Obesity and Non-fatal Motor Vehicle Crash Injuries: Sex Difference Effects

PubMed Central

Ma, Xiaoguang; Laud, Purushottam W.; Pintar, Frank; Kim, Jong-Eun; Shih, Alan; Shen, Wei; Heymsfield, Steven B.; Allison, David B.; Zhu, Shankuan

2010-01-01

Background Obesity and motor vehicle crash (MVC) injuries are two parallel epidemics in the United States. An important unanswered question is if there are sex differences in the associations between the presence of obesity and non-fatal MVC injuries. Objectives To further understand the association between obesity and non-fatal motor vehicle crash injuries, particularly the sex differences in these relations. Methods We examined this question by analyzing data from the 2003 to 2007 National Automotive Sampling System Crashworthiness Data System (NASS CDS). A total of 10, 962 drivers who were aged 18 years or older and who survived frontal collision crashes were eligible for study. Results Male drivers experienced a lower rate of overall non-fatal MVC injuries than did female drivers (38.1% vs. 52.2%) but a higher rate of severe injuries (0.7% vs. 0.2%). After adjusting for change in velocity (ΔV) during the crashes, obese male drivers showed a much higher risk [logistic coefficients of BMI for moderate, serious, and severe injury are 0.0766, 0.1470, and 0.1792, respectively; all p<0.05] of non-fatal injuries than did non-obese male drivers and these risks increased with injury severity. Non-fatal injury risks were not found to be increased in obese female drivers. The association between obesity and risk of non-fatal injury was much stronger for male drivers than for female drivers. Conclusion The higher risk of non-fatal MVC injuries in obese male drivers might result from their different body shape and fat distribution compared with obese female drivers. Our findings should be considered for obesity reduction, traffic safety evaluation and vehicle design for obese male drivers and provide testable hypotheses for future studies. PMID:21224830

Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study.

PubMed

Jones, David E J; Hollingsworth, Kieren G; Jakovljevic, Djordje G; Fattakhova, Gulnar; Pairman, Jessie; Blamire, Andrew M; Trenell, Michael I; Newton, Julia L

2012-02-01

Chronic fatigue syndrome (CFS) patients frequently describe difficulties with repeat exercise. Here, we explore muscle bioenergetic function in response to three bouts of exercise. A total of 18 CFS (CDC 1994) patients and 12 sedentary controls underwent assessment of maximal voluntary contraction (MVC), repeat exercise with magnetic resonance spectroscopy and cardio-respiratory fitness test to determine anaerobic threshold. Chronic fatigue syndrome patients undertaking MVC fell into two distinct groups: 8 (45%) showed normal PCr depletion in response to exercise at 35% of MVC (PCr depletion >33%; lower 95% CI for controls); 10 CFS patients had low PCr depletion (generating abnormally low MVC values). The CFS whole group exhibited significantly reduced anaerobic threshold, heart rate, VO(2) , VO(2) peak and peak work compared to controls. Resting muscle pH was similar in controls and both CFS patient groups. However, the CFS group achieving normal PCr depletion values showed increased intramuscular acidosis compared to controls after similar work after each of the three exercise periods with no apparent reduction in acidosis with repeat exercise of the type reported in normal subjects. This CFS group also exhibited significant prolongation (almost 4-fold) of the time taken for pH to recover to baseline. When exercising to comparable levels to normal controls, CFS patients exhibit profound abnormality in bioenergetic function and response to it. Although exercise intervention is the logical treatment for patients showing acidosis, any trial must exclude subjects who do not initiate exercise as they will not benefit. This potentially explains previous mixed results in CFS exercise trials. © 2011 The Authors. European Journal of Clinical Investigation © 2011 Stichting European Society for Clinical Investigation Journal Foundation.

Does photobiomodulation therapy is better than cryotherapy in muscle recovery after a high-intensity exercise? A randomized, double-blind, placebo-controlled clinical trial.

PubMed

De Marchi, Thiago; Schmitt, Vinicius Mazzochi; Machado, Guilherme Pinheiro; de Sene, Juliane Souza; de Col, Camila Dallavechia; Tairova, Olga; Salvador, Mirian; Leal-Junior, Ernesto Cesar Pinto

2017-02-01

This study aimed to determine the effectiveness of photobiomodulation therapy (PBMT) and cryotherapy, in isolated and combined forms, as muscle recovery techniques after muscle fatigue-inducing protocol. Forty volunteers were randomly divided into five groups: a placebo group (PG); a PBMT group (PBMT); a cryotherapy group (CG); a cryotherapy-PBMT group (CPG); and a PBMT-cryotherapy group (PCG). All subjects performed four sessions at 24-h intervals, during which they submitted to isometric assessment (MVC) and blood collection in the pre-exercise period, and 5 and 60 min post-exercise, while the muscle fatigue induction protocol occurred after the pre-exercise collections. In the remaining sessions performed 24, 48, and 72 h later, only blood collections and MVCs were performed. A single treatment with PBMT and/or cryotherapy was applied after only 2 min of completing the post-5-min MVC test at the first session. In the intragroup comparison, it was found that exercise led to a significant decrease (p < 0.05) in the production of MVC in all groups. Comparing the results of MVCs between groups, we observed significant increases in the MVC capacity of the PBMT, CPG, and PCG volunteers in comparison with both PG and CG (p < 0.05). We observed a significant decrease in the concentrations of the biochemical markers of oxidative damage (TBARS and PC) in all groups and muscle damage (creatine kinase-CK) in the PBMT, PCG, and CPG compared with the PG (p < 0.01). The clinical impact of these findings is clear because they demonstrate that the use of phototherapy is more effective than the use of cryotherapy for muscle recovery, additionally cryotherapy decreases PBMT efficacy.

Recovery of voluntary and evoked muscle performance following intermittent-sprint exercise in the heat.

PubMed

Duffield, Rob; King, Monique; Skein, Melissa

2009-06-01

This study investigated the effects of hot conditions on the acute recovery of voluntary and evoked muscle performance and physiological responses following intermittent exercise. Seven youth male and six female team-sport athletes performed two sessions separated by 7 d, involving a 30-min exercise protocol and 60-min passive recovery in either 22 degrees C or 33 degrees C and 40% relative humidity. The exercise protocol involved a 20-s maximal sprint every 5 min, separated by constant-intensity exercise at 100 W on a cycle ergometer. Maximal voluntary contraction (MVC) and a resting evoked twitch (Pf) of the right knee extensors were assessed before and immediately following exercise and again 15, 30, and 60 min postexercise, and capillary blood was obtained at the same time points to measure lactate, pH, and HCO3. During and following exercise, core temperature, heart rate and rating of perceived exertion (RPE) were also measured. No differences (P=0.73 to 0.95) in peak power during repeated sprints were present between conditions. Postexercise MVC was reduced (P<.05) in both conditions and a moderate effect size (d=0.60) indicated a slower percentage MVC recovered by 60 min in the heat (83+/-10 vs 74+/-11% recovered). Both heart rate and core temperature were significantly higher (P<.05) during recovery in the heat. Capillary blood values did not differ between conditions at any time point, whereas sessional RPE was higher 60 min postexercise in the heat. The current data suggests that passive recovery in warm temperatures not only delays cardiovascular and thermal recovery, but may also slow the recovery of MVC and RPE.

Pharmacodynamic correlations using fresh and cryopreserved tissue following use of vaginal rings containing dapivirine and/or maraviroc in a randomized, placebo controlled trial

PubMed Central

Dezzutti, Charlene S.; Richardson-Harman, Nicola; Rohan, Lisa C.; Marzinke, Mark A.; Hoesley, Craig J.; Panther, Lori; Johnson, Sherri; Nuttall, Jeremy P.; Nel, Annalene; Chen, Beatrice A.

2016-01-01

Abstract Background: The ex vivo challenge assay is a bio-indicator of drug efficacy and was utilized in this randomized, placebo controlled trial as one of the exploratory endpoints. Fresh and cryopreserved tissues were evaluated for human immunodeficiency virus (HIV) infection and pharmacokinetic (PK)/pharmacodynamic (PD) relationships. Methods: HIV-negative women used vaginal rings containing 25 mg dapivirine (DPV)/100 mg maraviroc (MVC) (n = 12), DPV only (n = 12), MVC only (n = 12), or placebo (n = 12) for 28 days. Blood plasma, cervicovaginal fluid (CVF), and cervical biopsies were collected for drug quantification and the ex vivo challenge assay; half (fresh) were exposed immediately to HIV while the other half were cryopreserved, thawed, then exposed to HIV. HIV replication was monitored by p24 enzyme-linked immunosorbent assay from culture supernatant. Data were log-transformed and analyzed by linear least squared regression, nonlinear Emax dose–response model and Satterthwaite t test. Results: HIV replication was greater in fresh compared to cryopreserved tissue (P = 0.04). DPV was detected in all compartments, while MVC was consistently detected only in CVF. Significant negative correlations between p24 and DPV levels were observed in fresh cervical tissue (P = 0.01) and CVF (P = 0.03), but not plasma. CVF MVC levels showed a significant negative correlation with p24 levels (P = 0.03); drug levels in plasma and tissue were not correlated with HIV suppression. p24 levels from cryopreserved tissue did not correlate to either drug from any compartment. Conclusion: Fresh tissue replicated HIV to greater levels and defined PK/PD relationships while cryopreserved tissue did not. The ex vivo challenge assay using fresh tissue could prioritize drugs being considered for HIV prevention. PMID:27428211

Pharmacodynamic correlations using fresh and cryopreserved tissue following use of vaginal rings containing dapivirine and/or maraviroc in a randomized, placebo controlled trial.

PubMed

Dezzutti, Charlene S; Richardson-Harman, Nicola; Rohan, Lisa C; Marzinke, Mark A; Hoesley, Craig J; Panther, Lori; Johnson, Sherri; Nuttall, Jeremy P; Nel, Annalene; Chen, Beatrice A

2016-07-01

The ex vivo challenge assay is a bio-indicator of drug efficacy and was utilized in this randomized, placebo controlled trial as one of the exploratory endpoints. Fresh and cryopreserved tissues were evaluated for human immunodeficiency virus (HIV) infection and pharmacokinetic (PK)/pharmacodynamic (PD) relationships. HIV-negative women used vaginal rings containing 25 mg dapivirine (DPV)/100 mg maraviroc (MVC) (n = 12), DPV only (n = 12), MVC only (n = 12), or placebo (n = 12) for 28 days. Blood plasma, cervicovaginal fluid (CVF), and cervical biopsies were collected for drug quantification and the ex vivo challenge assay; half (fresh) were exposed immediately to HIV while the other half were cryopreserved, thawed, then exposed to HIV. HIV replication was monitored by p24 enzyme-linked immunosorbent assay from culture supernatant. Data were log-transformed and analyzed by linear least squared regression, nonlinear Emax dose-response model and Satterthwaite t test. HIV replication was greater in fresh compared to cryopreserved tissue (P = 0.04). DPV was detected in all compartments, while MVC was consistently detected only in CVF. Significant negative correlations between p24 and DPV levels were observed in fresh cervical tissue (P = 0.01) and CVF (P = 0.03), but not plasma. CVF MVC levels showed a significant negative correlation with p24 levels (P = 0.03); drug levels in plasma and tissue were not correlated with HIV suppression. p24 levels from cryopreserved tissue did not correlate to either drug from any compartment. Fresh tissue replicated HIV to greater levels and defined PK/PD relationships while cryopreserved tissue did not. The ex vivo challenge assay using fresh tissue could prioritize drugs being considered for HIV prevention.

Beetroot-based gel supplementation improves handgrip strength, forearm muscle O2 saturation but not exercise tolerance and blood volume in jiu-jitsu athletes.

PubMed

de Oliveira, Gustavo Vieira; Nascimento, Luiz; Volino-Souza, Mônica; Mesquita, Jacilene; Alvares, Thiago

2018-03-22

The ergogenic effect of beetroot on the exercise performance of trained cyclists, runners, kayakers, and swimmers has been demonstrated. However, whether or not beetroot supplementation presents a beneficial effect on the exercise performance of jiu-jitsu athletes (JJA) remains inconclusive. Therefore, present study assessed the effect of beetroot-based gel (BG) supplementation on maximal voluntary contraction (MVC), exercise time until fatigue (ETF), muscle O2 saturation (SmO2), blood volume (tHb), and plasma nitrate and lactate in response to handgrip isotonic exercise (HIE) in JJA. In a randomized, crossover, double-blind design, 12 JJA performed three sets of HIE at 40% of the MVC until fatigue after 8 days (8th dose was offered 120 min previous exercise) of BG supplementation or a nitrate-depleted gel (PLA), and forearm SmO2 and tHb were continuously monitored by using near-infrared spectroscopy. Blood samples were taken before, immediately after exercise, and 20 min after exercise recovery in PLA and BG condition. MVC was evaluated at baseline and 20 min after HIE. There was a significant reduction in ∆MVC decline after HIE in BG condition. Forearm SmO2 during exercise recovery was significantly greater only after BG supplementation. No significant difference in ETF and tHb were observed between both BG and PLA in response to HIE. Plasma nitrate increased only after BG, whereas the exercise-induced increase in plasma lactate was significantly lower in BG when compared to PLA. In conclusion, BG supplementation may be a good nutritional strategy to improve forearm SmO2 and prevent force decline in response to exercise in JJA.

High-threshold motor unit firing reflects force recovery following a bout of damaging eccentric exercise

PubMed Central

Macgregor, Lewis J.

2018-01-01

Exercise-induced muscle damage (EIMD) is associated with impaired muscle function and reduced neuromuscular recruitment. However, motor unit firing behaviour throughout the recovery period is unclear. EIMD impairment of maximal voluntary force (MVC) will, in part, be caused by reduced high-threshold motor unit firing, which will subsequently increase to recover MVC. Fourteen healthy active males completed a bout of eccentric exercise on the knee extensors, with measurements of MVC, rate of torque development and surface electromyography performed pre-exercise and 2, 3, 7 and 14 days post-exercise, on both damaged and control limb. EIMD was associated with decreased MVC (235.2 ± 49.3 Nm vs. 161.3 ± 52.5 Nm; p <0.001) and rate of torque development (495.7 ± 136.9 Nm.s-1 vs. 163.4 ± 163.7 Nm.s-1; p <0.001) 48h post-exercise. Mean motor unit firing rate was reduced (16.4 ± 2.2 Hz vs. 12.6 ± 1.7 Hz; p <0.01) in high-threshold motor units only, 48h post-exercise, and common drive was elevated (0.36 ± 0.027 vs. 0.56 ± 0.032; p< 0.001) 48h post-exercise. The firing rate of high-threshold motor units was reduced in parallel with impaired muscle function, whilst early recruited motor units remained unaltered. Common drive of motor units increased in offset to the firing rate impairment. These alterations correlated with the recovery of force decrement, but not of pain elevation. This study provides fresh insight into the central mechanisms associated with EIMD recovery, relative to muscle function. These findings may in turn lead to development of novel management and preventative procedures. PMID:29630622

Deriving video content type from HEVC bitstream semantics

NASA Astrophysics Data System (ADS)

Nightingale, James; Wang, Qi; Grecos, Christos; Goma, Sergio R.

2014-05-01

As network service providers seek to improve customer satisfaction and retention levels, they are increasingly moving from traditional quality of service (QoS) driven delivery models to customer-centred quality of experience (QoE) delivery models. QoS models only consider metrics derived from the network however, QoE models also consider metrics derived from within the video sequence itself. Various spatial and temporal characteristics of a video sequence have been proposed, both individually and in combination, to derive methods of classifying video content either on a continuous scale or as a set of discrete classes. QoE models can be divided into three broad categories, full reference, reduced reference and no-reference models. Due to the need to have the original video available at the client for comparison, full reference metrics are of limited practical value in adaptive real-time video applications. Reduced reference metrics often require metadata to be transmitted with the bitstream, while no-reference metrics typically operate in the decompressed domain at the client side and require significant processing to extract spatial and temporal features. This paper proposes a heuristic, no-reference approach to video content classification which is specific to HEVC encoded bitstreams. The HEVC encoder already makes use of spatial characteristics to determine partitioning of coding units and temporal characteristics to determine the splitting of prediction units. We derive a function which approximates the spatio-temporal characteristics of the video sequence by using the weighted averages of the depth at which the coding unit quadtree is split and the prediction mode decision made by the encoder to estimate spatial and temporal characteristics respectively. Since the video content type of a sequence is determined by using high level information parsed from the video stream, spatio-temporal characteristics are identified without the need for full decoding and can be used in a timely manner to aid decision making in QoE oriented adaptive real time streaming.

GLOBECOM '88 - IEEE Global Telecommunications Conference and Exhibition, Hollywood, FL, Nov. 28-Dec. 1, 1988, Conference Record. Volumes 1, 2, & 3

NASA Astrophysics Data System (ADS)

Various papers on communications for the information age are presented. Among the general topics considered are: telematic services and terminals, satellite communications, telecommunications mangaement network, control of integrated broadband networks, advances in digital radio systems, the intelligent network, broadband networks and services deployment, future switch architectures, performance analysis of computer networks, advances in spread spectrum, optical high-speed LANs, and broadband switching and networks. Also addressed are: multiple access protocols, video coding techniques, modulation and coding, photonic switching, SONET terminals and applications, standards for video coding, digital switching, progress in MANs, mobile and portable radio, software design for improved maintainability, multipath propagation and advanced countermeasure, data communication, network control and management, fiber in the loop, network algorithm and protocols, and advances in computer communications.

Games for Training: Leveraging Commercial Off the Shelf Multiplayer Gaming Software for Infantry Squad Collective Training

DTIC Science & Technology

2005-09-01

squad training, team training, dismounted training, video games , computer games, multiplayer games. 16. PRICE CODE 17. SECURITY CLASSIFICATION OF...Multiplayer - mode of play for computer and video games in which multiple people can play the same game at the same time (Wikipedia, 2005) D...that “improvements in 3-D image generation on the PC and the speed of the internet” have increased the military’s interest in the use of video games as

An Analysis of a Video Game

NASA Astrophysics Data System (ADS)

Allain, Rhett; Williams, Richard

2009-02-01

Suppose we had a brand new world to study—a world that possibly works with a different set of principles, a non-Newtonian world. Maybe this world is Newtonian, maybe it isn't. This world exists in video games, and it is open for exploration. Most video games try to incorporate realistic physics, but sometimes this does not happen. The obvious approach is to look at the source code for the game, but this would not allow students to apply analysis techniques.

Method and System for Temporal Filtering in Video Compression Systems

NASA Technical Reports Server (NTRS)

Lu, Ligang; He, Drake; Jagmohan, Ashish; Sheinin, Vadim

2011-01-01

Three related innovations combine improved non-linear motion estimation, video coding, and video compression. The first system comprises a method in which side information is generated using an adaptive, non-linear motion model. This method enables extrapolating and interpolating a visual signal, including determining the first motion vector between the first pixel position in a first image to a second pixel position in a second image; determining a second motion vector between the second pixel position in the second image and a third pixel position in a third image; determining a third motion vector between the first pixel position in the first image and the second pixel position in the second image, the second pixel position in the second image, and the third pixel position in the third image using a non-linear model; and determining a position of the fourth pixel in a fourth image based upon the third motion vector. For the video compression element, the video encoder has low computational complexity and high compression efficiency. The disclosed system comprises a video encoder and a decoder. The encoder converts the source frame into a space-frequency representation, estimates the conditional statistics of at least one vector of space-frequency coefficients with similar frequencies, and is conditioned on previously encoded data. It estimates an encoding rate based on the conditional statistics and applies a Slepian-Wolf code with the computed encoding rate. The method for decoding includes generating a side-information vector of frequency coefficients based on previously decoded source data and encoder statistics and previous reconstructions of the source frequency vector. It also performs Slepian-Wolf decoding of a source frequency vector based on the generated side-information and the Slepian-Wolf code bits. The video coding element includes receiving a first reference frame having a first pixel value at a first pixel position, a second reference frame having a second pixel value at a second pixel position, and a third reference frame having a third pixel value at a third pixel position. It determines a first motion vector between the first pixel position and the second pixel position, a second motion vector between the second pixel position and the third pixel position, and a fourth pixel value for a fourth frame based upon a linear or nonlinear combination of the first pixel value, the second pixel value, and the third pixel value. A stationary filtering process determines the estimated pixel values. The parameters of the filter may be predetermined constants.

Video data compression using artificial neural network differential vector quantization

NASA Technical Reports Server (NTRS)

Krishnamurthy, Ashok K.; Bibyk, Steven B.; Ahalt, Stanley C.

1991-01-01

An artificial neural network vector quantizer is developed for use in data compression applications such as Digital Video. Differential Vector Quantization is used to preserve edge features, and a new adaptive algorithm, known as Frequency-Sensitive Competitive Learning, is used to develop the vector quantizer codebook. To develop real time performance, a custom Very Large Scale Integration Application Specific Integrated Circuit (VLSI ASIC) is being developed to realize the associative memory functions needed in the vector quantization algorithm. By using vector quantization, the need for Huffman coding can be eliminated, resulting in superior performance against channel bit errors than methods that use variable length codes.

Performance comparison of leading image codecs: H.264/AVC Intra, JPEG2000, and Microsoft HD Photo

NASA Astrophysics Data System (ADS)

Tran, Trac D.; Liu, Lijie; Topiwala, Pankaj

2007-09-01

This paper provides a detailed rate-distortion performance comparison between JPEG2000, Microsoft HD Photo, and H.264/AVC High Profile 4:4:4 I-frame coding for high-resolution still images and high-definition (HD) 1080p video sequences. This work is an extension to our previous comparative study published in previous SPIE conferences [1, 2]. Here we further optimize all three codecs for compression performance. Coding simulations are performed on a set of large-format color images captured from mainstream digital cameras and 1080p HD video sequences commonly used for H.264/AVC standardization work. Overall, our experimental results show that all three codecs offer very similar coding performances at the high-quality, high-resolution setting. Differences tend to be data-dependent: JPEG2000 with the wavelet technology tends to be the best performer with smooth spatial data; H.264/AVC High-Profile with advanced spatial prediction modes tends to cope best with more complex visual content; Microsoft HD Photo tends to be the most consistent across the board. For the still-image data sets, JPEG2000 offers the best R-D performance gains (around 0.2 to 1 dB in peak signal-to-noise ratio) over H.264/AVC High-Profile intra coding and Microsoft HD Photo. For the 1080p video data set, all three codecs offer very similar coding performance. As in [1, 2], neither do we consider scalability nor complexity in this study (JPEG2000 is operating in non-scalable, but optimal performance mode).

How Is Marijuana Vaping Portrayed on YouTube? Content, Features, Popularity and Retransmission of Vaping Marijuana YouTube Videos.

PubMed

Yang, Qinghua; Sangalang, Angeline; Rooney, Molly; Maloney, Erin; Emery, Sherry; Cappella, Joseph N

2018-01-01

The purpose of the study is to investigate how vaping marijuana, a novel but emerging risky health behavior, is portrayed on YouTube, and how the content and features of these YouTube videos influence their popularity and retransmission. A content analysis of vaping marijuana YouTube videos published between July 2014 to June 2015 (n = 214) was conducted. Video genre, valence, promotional and warning arguments, emotional appeals, message sensation value, presence of misinformation and misleading information, and user-generated statistics, including number of views, comments, shares, likes and dislikes, were coded. The results showed that these videos were predominantly pro-marijuana-vaping, with the most frequent videos being user-sharing. The genre and message features influenced the popularity, evaluations, and retransmission of vaping marijuana YouTube videos. Theoretical and practical implications are discussed.

5 CFR 532.267 - Special wage schedules for aircraft, electronic, and optical instrument overhaul and repair...

Code of Federal Regulations, 2011 CFR

2011-01-01

... Industry Classification System (NAICS) codes: 2007 NAICS codes 2007 NAICS industry titles 3341 Computer and peripheral equipment manufacturing. 33422 Radio and television broadcasting and wireless communications equipment manufacturing. 33429 Other communications equipment manufacturing. 3343 Audio and video equipment...

5 CFR 532.267 - Special wage schedules for aircraft, electronic, and optical instrument overhaul and repair...

Code of Federal Regulations, 2012 CFR

2012-01-01

... Industry Classification System (NAICS) codes: 2007 NAICS codes 2007 NAICS industry titles 3341 Computer and peripheral equipment manufacturing. 33422 Radio and television broadcasting and wireless communications equipment manufacturing. 33429 Other communications equipment manufacturing. 3343 Audio and video equipment...

5 CFR 532.267 - Special wage schedules for aircraft, electronic, and optical instrument overhaul and repair...

Code of Federal Regulations, 2013 CFR

2013-01-01

... Industry Classification System (NAICS) codes: 2007 NAICS codes 2007 NAICS industry titles 3341 Computer and peripheral equipment manufacturing. 33422 Radio and television broadcasting and wireless communications equipment manufacturing. 33429 Other communications equipment manufacturing. 3343 Audio and video equipment...

Embedded DCT and wavelet methods for fine granular scalable video: analysis and comparison

NASA Astrophysics Data System (ADS)

van der Schaar-Mitrea, Mihaela; Chen, Yingwei; Radha, Hayder

2000-04-01

Video transmission over bandwidth-varying networks is becoming increasingly important due to emerging applications such as streaming of video over the Internet. The fundamental obstacle in designing such systems resides in the varying characteristics of the Internet (i.e. bandwidth variations and packet-loss patterns). In MPEG-4, a new SNR scalability scheme, called Fine-Granular-Scalability (FGS), is currently under standardization, which is able to adapt in real-time (i.e. at transmission time) to Internet bandwidth variations. The FGS framework consists of a non-scalable motion-predicted base-layer and an intra-coded fine-granular scalable enhancement layer. For example, the base layer can be coded using a DCT-based MPEG-4 compliant, highly efficient video compression scheme. Subsequently, the difference between the original and decoded base-layer is computed, and the resulting FGS-residual signal is intra-frame coded with an embedded scalable coder. In order to achieve high coding efficiency when compressing the FGS enhancement layer, it is crucial to analyze the nature and characteristics of residual signals common to the SNR scalability framework (including FGS). In this paper, we present a thorough analysis of SNR residual signals by evaluating its statistical properties, compaction efficiency and frequency characteristics. The signal analysis revealed that the energy compaction of the DCT and wavelet transforms is limited and the frequency characteristic of SNR residual signals decay rather slowly. Moreover, the blockiness artifacts of the low bit-rate coded base-layer result in artificial high frequencies in the residual signal. Subsequently, a variety of wavelet and embedded DCT coding techniques applicable to the FGS framework are evaluated and their results are interpreted based on the identified signal properties. As expected from the theoretical signal analysis, the rate-distortion performances of the embedded wavelet and DCT-based coders are very similar. However, improved results can be obtained for the wavelet coder by deblocking the base- layer prior to the FGS residual computation. Based on the theoretical analysis and our measurements, we can conclude that for an optimal complexity versus coding-efficiency trade- off, only limited wavelet decomposition (e.g. 2 stages) needs to be performed for the FGS-residual signal. Also, it was observed that the good rate-distortion performance of a coding technique for a certain image type (e.g. natural still-images) does not necessarily translate into similarly good performance for signals with different visual characteristics and statistical properties.

2D-pattern matching image and video compression: theory, algorithms, and experiments.

PubMed

Alzina, Marc; Szpankowski, Wojciech; Grama, Ananth

2002-01-01

In this paper, we propose a lossy data compression framework based on an approximate two-dimensional (2D) pattern matching (2D-PMC) extension of the Lempel-Ziv (1977, 1978) lossless scheme. This framework forms the basis upon which higher level schemes relying on differential coding, frequency domain techniques, prediction, and other methods can be built. We apply our pattern matching framework to image and video compression and report on theoretical and experimental results. Theoretically, we show that the fixed database model used for video compression leads to suboptimal but computationally efficient performance. The compression ratio of this model is shown to tend to the generalized entropy. For image compression, we use a growing database model for which we provide an approximate analysis. The implementation of 2D-PMC is a challenging problem from the algorithmic point of view. We use a range of techniques and data structures such as k-d trees, generalized run length coding, adaptive arithmetic coding, and variable and adaptive maximum distortion level to achieve good compression ratios at high compression speeds. We demonstrate bit rates in the range of 0.25-0.5 bpp for high-quality images and data rates in the range of 0.15-0.5 Mbps for a baseline video compression scheme that does not use any prediction or interpolation. We also demonstrate that this asymmetric compression scheme is capable of extremely fast decompression making it particularly suitable for networked multimedia applications.

Analyzing communication skills of Pediatric Postgraduate Residents in Clinical Encounter by using video recordings

PubMed Central

Bari, Attia; Khan, Rehan Ahmed; Jabeen, Uzma; Rathore, Ahsan Waheed

2017-01-01

Objective: To analyze communication skills of pediatric postgraduate residents in clinical encounter by using video recordings. Methods: This qualitative exploratory research was conducted through video recording at The Children’s Hospital Lahore, Pakistan. Residents who had attended the mandatory communication skills workshop offered by CPSP were included. The video recording of clinical encounter was done by a trained audiovisual person while the resident was interacting with the patient in the clinical encounter. Data was analyzed by thematic analysis. Results: Initially on open coding 36 codes emerged and then through axial and selective coding these were condensed to 17 subthemes. Out of these four main themes emerged: (1) Courteous and polite attitude, (2) Marginal nonverbal communication skills, (3) Power game/Ignoring child participation and (4) Patient as medical object/Instrumental behaviour. All residents treated the patient as a medical object to reach a right diagnosis and ignored them as a human being. There was dominant role of doctors and marginal nonverbal communication skills were displayed by the residents in the form of lack of social touch, and appropriate eye contact due to documenting notes. A brief non-medical interaction for rapport building at the beginning of interaction was missing and there was lack of child involvement. Conclusion: Paediatric postgraduate residents were polite while communicating with parents and child but lacking in good nonverbal communication skills. Communication pattern in our study was mostly one-way showing doctor’s instrumental behaviour and ignoring the child participation. PMID:29492050

The Use of Video Feedback in Teaching Process-Approach EFL Writing

ERIC Educational Resources Information Center

Özkul, Sertaç; Ortaçtepe, Deniz

2017-01-01

This experimental study investigated the use of video feedback as an alternative to feedback with correction codes at an institution where the latter was commonly used for teaching process-approach English as a foreign language (EFL) writing. Over a 5-week period, the control and the experimental groups were provided with feedback based on…

The Influence of Video Reflection on Preservice Music Teachers' Concerns in Peer- and Field-Teaching Settings

ERIC Educational Resources Information Center

Powell, Sean R.

2016-01-01

The purpose of this study was to investigate preservice music teacher concerns as stated in written reflections before and after video feedback. Nineteen preservice music teachers enrolled in instrumental methods courses wrote free-response reflections of peer- and field-teaching episodes. Statements were coded utilizing the Fuller and Bown…

A simulator tool set for evaluating HEVC/SHVC streaming

NASA Astrophysics Data System (ADS)

Al Hadhrami, Tawfik; Nightingale, James; Wang, Qi; Grecos, Christos; Kehtarnavaz, Nasser

2015-02-01

Video streaming and other multimedia applications account for an ever increasing proportion of all network traffic. The recent adoption of High Efficiency Video Coding (HEVC) as the H.265 standard provides many opportunities for new and improved services multimedia services and applications in the consumer domain. Since the delivery of version one of H.265, the Joint Collaborative Team on Video Coding have been working towards standardisation of a scalable extension (SHVC) to the H.265 standard and a series of range extensions and new profiles. As these enhancements are added to the standard the range of potential applications and research opportunities will expend. For example the use of video is also growing rapidly in other sectors such as safety, security, defence and health with real-time high quality video transmission playing an important role in areas like critical infrastructure monitoring and disaster management. Each of which may benefit from the application of enhanced HEVC/H.265 and SHVC capabilities. The majority of existing research into HEVC/H.265 transmission has focussed on the consumer domain addressing issues such as broadcast transmission and delivery to mobile devices with the lack of freely available tools widely cited as an obstacle to conducting this type of research. In this paper we present a toolset which facilitates the transmission and evaluation of HEVC/H.265 and SHVC encoded video on the popular open source NCTUns simulator. Our toolset provides researchers with a modular, easy to use platform for evaluating video transmission and adaptation proposals on large scale wired, wireless and hybrid architectures. The toolset consists of pre-processing, transmission, SHVC adaptation and post-processing tools to gather and analyse statistics. It has been implemented using HM15 and SHM5, the latest versions of the HEVC and SHVC reference software implementations to ensure that currently adopted proposals for scalable and range extensions to the standard can be investigated. We demonstrate the effectiveness and usability of our toolset by evaluating SHVC streaming and adaptation to meet terminal constraints and network conditions in a range of wired, wireless, and large scale wireless mesh network scenarios, each of which is designed to simulate a realistic environment. Our results are compared to those for H264/SVC, the scalable extension to the existing H.264/AVC advanced video coding standard.

Secure Video Surveillance System Acquisition Software

DOE Office of Scientific and Technical Information (OSTI.GOV)

2009-12-04

The SVSS Acquisition Software collects and displays video images from two cameras through a VPN, and store the images onto a collection controller. The software is configured to allow a user to enter a time window to display up to 2 1/2, hours of video review. The software collects images from the cameras at a rate of 1 image per second and automatically deletes images older than 3 hours. The software code operates in a linux environment and can be run in a virtual machine on Windows XP. The Sandia software integrates the different COTS software together to build themore » video review system.« less

College curriculum-sharing via CTS. [Communications Technology Satellite

NASA Technical Reports Server (NTRS)

Hudson, H. E.; Guild, P. D.; Coll, D. C.; Lumb, D. R.

1975-01-01

Domestic communication satellites and video compression techniques will increase communication channel capacity and reduce cost of video transmission. NASA Ames Research Center, Stanford University and Carleton University are participants in an experiment to develop, demonstrate, and evaluate college course sharing techniques via satellite using video compression. The universities will exchange televised seminar and lecture courses via CTS. The experiment features real-time video compression with channel coding and quadra-phase modulation for reducing transmission bandwidth and power requirements. Evaluation plans and preliminary results of Carleton surveys on student attitudes to televised teaching are presented. Policy implications for the U.S. and Canada are outlined.