Maraviroc, as a Switch Option, in HIV-1-infected Individuals With Stable, Well-controlled HIV Replication and R5-tropic Virus on Their First Nucleoside/Nucleotide Reverse Transcriptase Inhibitor Plus Ritonavir-boosted Protease Inhibitor Regimen: Week 48 Results of the Randomized, Multicenter MARCH Study.

PubMed

Pett, Sarah Lilian; Amin, Janaki; Horban, Andrejz; Andrade-Villanueva, Jaime; Losso, Marcelo; Porteiro, Norma; Sierra Madero, Juan; Belloso, Waldo; Tu, Elise; Silk, David; Kelleher, Anthony; Harrigan, Richard; Clark, Andrew; Sugiura, Wataru; Wolff, Marcelo; Gill, John; Gatell, Jose; Fisher, Martin; Clarke, Amanda; Ruxrungtham, Kiat; Prazuck, Thierry; Kaiser, Rolf; Woolley, Ian; Arnaiz, Juan Alberto; Cooper, David; Rockstroh, Jürgen K; Mallon, Patrick; Emery, Sean

2016-07-01

Alternative combination antiretroviral therapies in virologically suppressed human immunodeficiency virus (HIV)-infected patients experiencing side effects and/or at ongoing risk of important comorbidities from current therapy are needed. Maraviroc (MVC), a chemokine receptor 5 antagonist, is a potential alternative component of therapy in those with R5-tropic virus. The Maraviroc Switch Study is a randomized, multicenter, 96-week, open-label switch study in HIV type 1-infected adults with R5-tropic virus, virologically suppressed on a ritonavir-boosted protease inhibitor (PI/r) plus double nucleoside/nucleotide reverse transcriptase inhibitor (2 N(t)RTI) backbone. Participants were randomized 1:2:2 to current combination antiretroviral therapy (control), or replacing the protease inhibitor (MVC + 2 N(t)RTI arm) or the nucleoside reverse transcriptase inhibitor backbone (MVC + PI/r arm) with twice-daily MVC. The primary endpoint was the difference (switch minus control) in proportion with plasma viral load (VL) <200 copies/mL at 48 weeks. The switch arms were judged noninferior if the lower limit of the 95% confidence interval (CI) for the difference in the primary endpoint was < -12% in the intention-to-treat (ITT) population. The ITT population comprised 395 participants (control, n = 82; MVC + 2 N(t)RTI, n = 156; MVC + PI/r, n = 157). Baseline characteristics were well matched. At week 48, noninferior rates of virological suppression were observed in those switching away from a PI/r (93.6% [95% CI, -9.0% to 2.2%] and 91.7% [95% CI, -9.6% to 3.8%] with VL <200 and <50 copies/mL, respectively) compared to the control arm (97.6% and 95.1% with VL <200 and <50 copies/mL, respectively). In contrast, MVC + PI/r did not meet noninferiority bounds and was significantly inferior (84.1% [95% CI, -19.8% to -5.8%] and 77.7% [95% CI, -24.9% to -8.4%] with VL <200 and <50 copies/mL, respectively) to the control arm in the ITT analysis. These data support MVC as a switch option for ritonavir-boosted PIs when partnered with a 2-N(t)RTI backbone, but not as part of N(t)RTI-sparing regimens comprising MVC with PI/r. NCT01384682. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Neighboring block based disparity vector derivation for multiview compatible 3D-AVC

NASA Astrophysics Data System (ADS)

Kang, Jewon; Chen, Ying; Zhang, Li; Zhao, Xin; Karczewicz, Marta

2013-09-01

3D-AVC being developed under Joint Collaborative Team on 3D Video Coding (JCT-3V) significantly outperforms the Multiview Video Coding plus Depth (MVC+D) which simultaneously encodes texture views and depth views with the multiview extension of H.264/AVC (MVC). However, when the 3D-AVC is configured to support multiview compatibility in which texture views are decoded without depth information, the coding performance becomes significantly degraded. The reason is that advanced coding tools incorporated into the 3D-AVC do not perform well due to the lack of a disparity vector converted from the depth information. In this paper, we propose a disparity vector derivation method utilizing only the information of texture views. Motion information of neighboring blocks is used to determine a disparity vector for a macroblock, so that the derived disparity vector is efficiently used for the coding tools in 3D-AVC. The proposed method significantly improves a coding gain of the 3D-AVC in the multiview compatible mode about 20% BD-rate saving in the coded views and 26% BD-rate saving in the synthesized views on average.

High-Intensity Strength Training Improves Function of Chronically Painful Muscles: Case-Control and RCT Studies

PubMed Central

Andersen, Christoffer H.; Skotte, Jørgen H.; Suetta, Charlotte; Søgaard, Karen; Saltin, Bengt; Sjøgaard, Gisela

2014-01-01

Aim. This study investigates consequences of chronic neck pain on muscle function and the rehabilitating effects of contrasting interventions. Methods. Women with trapezius myalgia (MYA, n = 42) and healthy controls (CON, n = 20) participated in a case-control study. Subsequently MYA were randomized to 10 weeks of specific strength training (SST, n = 18), general fitness training (GFT, n = 16), or a reference group without physical training (REF, n = 8). Participants performed tests of 100 consecutive cycles of 2 s isometric maximal voluntary contractions (MVC) of shoulder elevation followed by 2 s relaxation at baseline and 10-week follow-up. Results. In the case-control study, peak force, rate of force development, and rate of force relaxation as well as EMG amplitude were lower in MYA than CON throughout all 100 MVC. Muscle fiber capillarization was not significantly different between MYA and CON. In the intervention study, SST improved all force parameters significantly more than the two other groups, to levels comparable to that of CON. This was seen along with muscle fiber hypertrophy and increased capillarization. Conclusion. Women with trapezius myalgia have lower strength capacity during repetitive MVC of the trapezius muscle than healthy controls. High-intensity strength training effectively improves strength capacity during repetitive MVC of the painful trapezius muscle. PMID:24707475

Voluntary activation of the trapezius muscle in cases with neck/shoulder pain compared to healthy controls.

PubMed

Bech, Katrine Tholstrup; Larsen, Camilla Marie; Sjøgaard, Gisela; Holtermann, Andreas; Taylor, Janet L; Søgaard, Karen

2017-10-01

Subjects reporting neck/shoulder pain have been shown to generate less force during maximal voluntary isometric contractions (MVC) of the shoulder muscles compared to healthy controls. This has been suggested to be caused by a pain-related decrease in voluntary activation (VA) rather than lack of muscle mass. The aim of the present study was to investigate VA of the trapezius muscle during MVCs in subjects with and without neck/shoulder pain by use of the twitch interpolation technique. Ten cases suffering from pain and ten age and gender matched, healthy controls were included in the study. Upper trapezius muscle thickness was measured using ultrasonography and pain intensity was measured on a 100mm visual analog scale (VAS). VA was calculated from five maximal muscle activation attempts. Superimposed stimuli were delivered to the accessory nerve at peak force and during a 2% MVC following the maximal contraction. Presented as mean±SD for cases and controls, respectively: VAS; 16.0±14.4mm and 2.1±4.1mm (P=0.004), MVC; 545±161N and 664±195N (P=0.016), upper trapezius muscle thickness; 10.9±1.9mm and 10.4±1.5mm (P=0.20), VA; 93.6±14.2% and 96.3±6.0% (P=0.29). In spite of significantly eight-fold higher pain intensity and ∼20% lower MVC for cases compared to controls, no difference was found in VA. Possible explanations for the reduction in MVC could be differences in co-activation of antagonists and synergists as well as muscle quality. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sensorimotor adaptations to microgravity in humans.

PubMed

Edgerton, V R; McCall, G E; Hodgson, J A; Gotto, J; Goulet, C; Fleischmann, K; Roy, R R

2001-09-01

Motor function is altered by microgravity, but little detail is available as to what these changes are and how changes in the individual components of the sensorimotor system affect the control of movement. Further, there is little information on whether the changes in motor performance reflect immediate or chronic adaptations to changing gravitational environments. To determine the effects of microgravity on the neural control properties of selected motor pools, four male astronauts from the NASA STS-78 mission performed motor tasks requiring the maintenance of either ankle dorsiflexor or plantarflexor torque. Torques of 10 or 50% of a maximal voluntary contraction (MVC) were requested of the subjects during 10 degrees peak-to-peak sinusoidal movements at 0.5 Hz. When 10% MVC of the plantarflexors was requested, the actual torques generated in-flight were similar to pre-flight values. Post-flight torques were higher than pre- and in-flight torques. The actual torques when 50% MVC was requested were higher in- and post-flight than pre-flight. Soleus (Sol) electromyographic (EMG) amplitudes during plantarflexion were higher in-flight than pre- or post-flight for both the 10 and 50% MVC tasks. No differences in medial gastrocnemius (MG) EMG amplitudes were observed for either the 10 or 50% MVC tasks. The EMG amplitudes of the tibialis anterior (TA), an antagonist to plantarflexion, were higher in- and post-flight than pre-flight for the 50% MVC task. During the dorsiflexion tasks, the torques generated in both the 10 and 50% MVC tasks did not differ pre-, in- and post-flight. TA EMG amplitudes were significantly higher in- than pre-flight for both the 10 or 50% MVC tasks, and remained elevated post-flight for the 50% MVC test. Both the Sol and MG EMG amplitudes were significantly higher in-flight than either pre- or post-flight for both the 10 and 50% MVC tests. These data suggest that the most consistent response to space flight was an elevation in the level of contractions of agonists and antagonists when attempting to maintain constant torques at a given level of MVC. Also, the chronic levels of EMG activity in selected ankle flexor and extensor muscles during space flight and during routine activities on Earth were recorded. Compared with pre- and post-flight values, there was a marked increase in the total EMG activity of the TA and the Sol and no change in the MG EMG activity in-flight. These data indicate that space flight, as occurs on shuttle missions, is a model of elevated activation of both flexor and extensor muscles, probably reflecting the effects of programmed work schedules in flight rather than a direct effect of microgravity.

Sensorimotor adaptations to microgravity in humans

NASA Technical Reports Server (NTRS)

Edgerton, V. R.; McCall, G. E.; Hodgson, J. A.; Gotto, J.; Goulet, C.; Fleischmann, K.; Roy, R. R.

2001-01-01

Motor function is altered by microgravity, but little detail is available as to what these changes are and how changes in the individual components of the sensorimotor system affect the control of movement. Further, there is little information on whether the changes in motor performance reflect immediate or chronic adaptations to changing gravitational environments. To determine the effects of microgravity on the neural control properties of selected motor pools, four male astronauts from the NASA STS-78 mission performed motor tasks requiring the maintenance of either ankle dorsiflexor or plantarflexor torque. Torques of 10 or 50% of a maximal voluntary contraction (MVC) were requested of the subjects during 10 degrees peak-to-peak sinusoidal movements at 0.5 Hz. When 10% MVC of the plantarflexors was requested, the actual torques generated in-flight were similar to pre-flight values. Post-flight torques were higher than pre- and in-flight torques. The actual torques when 50% MVC was requested were higher in- and post-flight than pre-flight. Soleus (Sol) electromyographic (EMG) amplitudes during plantarflexion were higher in-flight than pre- or post-flight for both the 10 and 50% MVC tasks. No differences in medial gastrocnemius (MG) EMG amplitudes were observed for either the 10 or 50% MVC tasks. The EMG amplitudes of the tibialis anterior (TA), an antagonist to plantarflexion, were higher in- and post-flight than pre-flight for the 50% MVC task. During the dorsiflexion tasks, the torques generated in both the 10 and 50% MVC tasks did not differ pre-, in- and post-flight. TA EMG amplitudes were significantly higher in- than pre-flight for both the 10 or 50% MVC tasks, and remained elevated post-flight for the 50% MVC test. Both the Sol and MG EMG amplitudes were significantly higher in-flight than either pre- or post-flight for both the 10 and 50% MVC tests. These data suggest that the most consistent response to space flight was an elevation in the level of contractions of agonists and antagonists when attempting to maintain constant torques at a given level of MVC. Also, the chronic levels of EMG activity in selected ankle flexor and extensor muscles during space flight and during routine activities on Earth were recorded. Compared with pre- and post-flight values, there was a marked increase in the total EMG activity of the TA and the Sol and no change in the MG EMG activity in-flight. These data indicate that space flight, as occurs on shuttle missions, is a model of elevated activation of both flexor and extensor muscles, probably reflecting the effects of programmed work schedules in flight rather than a direct effect of microgravity.

Health care utilization and charges following the enactment of the 2007 Graduated Drivers Licensing Law in Massachusetts.

PubMed

Sangji, Naveen F; Ramly, Elie P; Kaafarani, Haytham M A; Seethala, Raghu; Raybould, Toby; Camargo, Carlos A; Velmahos, George; Masiakos, Peter T; Lee, Jarone

2015-10-01

Graduated Drivers Licensing (GDL) programs phase in driving privileges for teenagers. In 2007, Massachusetts implemented a stricter version of the 1998 GDL law, with increased fines and education. This study evaluated the impact of the law on motor vehicle crash (MVC)-related health care utilization and charges. Massachusetts government and US Census Bureau data were analyzed to compare the rates of MVC-related emergency department (ED) visits and hospital charges before (2002-2006) and after (2007-2011) the 2007 GDL law. Three driver age groups were studied: 16-17 (evaluating the law effect), 18-20 (evaluating the sustainability of the effect), and 25-29 years old (control group). MVC-related ED visits per population decreased after the law for all three age groups (16-17: 2326 to 713; 18-20: 2110 to 1304; 25-29: 1694 to 1228; per 100,000, p<0.001), but the decrease was greater amongst teenagers (16-17: -69%; 18-20: -38%) compared to the control group (-27%); p<0.001. MVC-related hospital charges per population also decreased for teenagers but increased for the control group (16-17: $2.70 m to $1.45 m; 18-20: $3.52 m to $2.26 m; 25-29: $1.86 m to $1.92 m; per 100,000, p<0.001). The 2007 GDL law in Massachusetts was associated with significant decreases in MVC-related health care utilization and hospital charges among teenage drivers. Copyright © 2015 Elsevier Inc. All rights reserved.

Phase 1 Safety, Pharmacokinetics, and Pharmacodynamics of Dapivirine and Maraviroc Vaginal Rings: A Double-Blind Randomized Trial.

PubMed

Chen, Beatrice A; Panther, Lori; Marzinke, Mark A; Hendrix, Craig W; Hoesley, Craig J; van der Straten, Ariane; Husnik, Marla J; Soto-Torres, Lydia; Nel, Annalene; Johnson, Sherri; Richardson-Harman, Nicola; Rabe, Lorna K; Dezzutti, Charlene S

2015-11-01

Variable adherence limits effectiveness of daily oral and intravaginal tenofovir-containing pre-exposure prophylaxis. Monthly vaginal antiretroviral rings are one approach to improve adherence and drug delivery. MTN-013/IPM 026, a multisite, double-blind, randomized, placebo-controlled trial in 48 HIV-negative US women, evaluated vaginal rings containing dapivirine (DPV) (25 mg) and maraviroc (MVC) (100 mg), DPV only, MVC only, and placebo used continuously for 28 days. Safety was assessed by adverse events. Drug concentrations were quantified in plasma, cervicovaginal fluid (CVF), and cervical tissue. Cervical biopsy explants were challenged with HIV ex vivo to evaluate pharmacodynamics. There was no difference in related genitourinary adverse events between treatment arms compared with placebo. DPV and MVC concentrations rose higher initially before falling more rapidly with the combination ring compared with relatively stable concentrations with the single-drug rings. DPV concentrations in CVF were 1 and 5 log10 greater than cervical tissue and plasma for both rings. MVC was consistently detected only in CVF. DPV and MVC CVF and DPV tissue concentrations dropped rapidly after ring removal. Cervical tissue showed a significant inverse linear relationship between HIV replication and DPV levels. In this first study of a combination microbicide vaginal ring, all 4 rings were safe and well tolerated. Tissue DPV concentrations were 1000 times greater than plasma concentrations and single drug rings had more stable pharmacokinetics. DPV, but not MVC, demonstrated concentration-dependent inhibition of HIV-1 infection in cervical tissue. Because MVC concentrations were consistently detectable only in CVF and not in plasma, improved drug release of MVC rings is needed.

eMontage: An Architecture for Rapid Integration of Situational Awareness Data at the Edge

DTIC Science & Technology

2013-05-01

Request Response Interaction Android Client Dispatcher Servlet Spring MVC Controller Camel Producer Template Camel Route Remote Data Service - REST...8SATURN 2013© 2013 Carnegie Mellon University Publish Subscribe Interaction Android Client Dispatcher Servlet Spring MVC Controller Remote Data...set ..., "’"C oUkRelw•b J’- - ’ ~ ’~------’ ~-------- ’-------~ , Parse XML into a single Java XML Document object. -=--:=’ Software Engineering

Neuromuscular fatigue during high-intensity intermittent exercise in individuals with intellectual disability.

PubMed

Borji, Rihab; Sahli, Sonia; Zarrouk, Nidhal; Zghal, Firas; Rebai, Haithem

2013-12-01

This study examined neuromuscular fatigue after high-intensity intermittent exercise in 10 men with mild intellectual disability (ID) in comparison with 10 controls. Both groups performed three maximal voluntary contractions (MVC) of knee extension with 5 min in-between. The highest level achieved was selected as reference MVC. The fatiguing exercise consists of five sets with a maximal number of flexion-extension cycles at 80% of the one maximal repetition (1RM) for the right leg at 90° with 90 s rest interval between sets. The MVC was tested again after the last set. Peak force and electromyography (EMG) signals were measured during the MVC tests. Root Mean Square (RMS) and Median Frequency (MF) were calculated. Neuromuscular efficiency (NME) was calculated as the ratio of peak force to the RMS. Before exercise, individuals with ID had a lower MVC (p<0.05) and a lower RMS (p<0.05). No significant difference between groups in MF and NME. After exercise, MVC decreases significantly in both groups (p<0.001). Individuals with ID have greater force decline (p<0.001 vs. p<0.01). RMS decreased significantly (p<0.001) whereas the NME increased significantly (p<0.05) in individuals with ID, but both remained unchanged in controls. The MF decreased significantly in both groups (p<0.001). In conclusion, individuals with ID presented a lower peak force than individuals without ID. After a high-intensity intermittent exercise, individuals with ID demonstrated a greater force decline caused by neural activation failure. When rehabilitation and sport train ID individuals, they should consider this nervous system weakness. Copyright © 2013 Elsevier Ltd. All rights reserved.

Relationship between pelvic floor muscle and hormone levels in polycystic ovary syndrome.

PubMed

Micussi, Maria Thereza; Freitas, Rodrigo Pegado; Varella, Larissa; Soares, Elvira Maria; Lemos, Telma Maria; Maranhão, Técia Maria

2016-09-01

To evaluate the electrical activity of the pelvic floor muscles (PFM) in women with polycystic ovary syndrome. Forty-two women with polycystic ovary syndrome (PCOS group) and 13 premenopausal women (control group) were recruited in this cross-sectional study. Total testosterone and estradiol were measured and muscle tone and maximum voluntary contraction (MVC) of PFM were determined by surface electromyography. There was a difference in muscle tone (PCOS = 59.9 µV and Control group = 25.5 µV; P < 0.0001) and MVC (PCOS = 159.7 µV and Control group = 63.7 µV; P < 0.0002) between groups. The concentration of estradiol and testosterone showed a strong correlation with tone (r = 0.9, r = 0.8 respectively) and MVC (r = 0.9, r = 0.9 respectively) in women with PCOS. The control group exhibited a strong correlation between testosterone and muscle tone (r = 0.9) and MVC (r = 0.9). Women with PCOS display higher electromyographic values than those in premenopause. Moreover, electrical activity showed a positive relation with estradiol and testosterone concentrations. Although PCOS is a heterogeneous disorder affecting young women, it is suggested that the hyperandrogenic state associated with PCOS is a protective factor for PFM. Neurourol. Urodynam. 35:780-785, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

The useful field of view assessment predicts simulated commercial motor vehicle driving safety.

PubMed

McManus, Benjamin; Heaton, Karen; Vance, David E; Stavrinos, Despina

2016-10-02

The Useful Field of View (UFOV) assessment, a measure of visual speed of processing, has been shown to be a predictive measure of motor vehicle collision (MVC) involvement in an older adult population, but it remains unknown whether UFOV predicts commercial motor vehicle (CMV) driving safety during secondary task engagement. The purpose of this study is to determine whether the UFOV assessment predicts simulated MVCs in long-haul CMV drivers. Fifty licensed CMV drivers (Mage = 39.80, SD = 8.38, 98% male, 56% Caucasian) were administered the 3-subtest version of the UFOV assessment, where lower scores measured in milliseconds indicated better performance. CMV drivers completed 4 simulated drives, each spanning approximately a 22.50-mile distance. Four secondary tasks were presented to participants in a counterbalanced order during the drives: (a) no secondary task, (b) cell phone conversation, (c) text messaging interaction, and (d) e-mailing interaction with an on-board dispatch device. The selective attention subtest significantly predicted simulated MVCs regardless of secondary task. Each 20 ms slower on subtest 3 was associated with a 25% increase in the risk of an MVC in the simulated drive. The e-mail interaction secondary task significantly predicted simulated MVCs with a 4.14 times greater risk of an MVC compared to the no secondary task condition. Subtest 3, a measure of visual speed of processing, significantly predicted MVCs in the email interaction task. Each 20 ms slower on subtest 3 was associated with a 25% increase in the risk of an MVC during the email interaction task. The UFOV subtest 3 may be a promising measure to identify CMV drivers who may be at risk for MVCs or in need of cognitive training aimed at improving speed of processing. Subtest 3 may also identify CMV drivers who are particularly at risk when engaged in secondary tasks while driving.

Reduction in motor vehicle collisions following treatment of sleep apnoea with nasal CPAP

PubMed Central

George, C

2001-01-01

BACKGROUND—Patients with untreated obstructive sleep apnoea (OSA) have increased motor vehicle collisions (MVCs). When successfully treated, they report improved driving and fewer mishaps, but there are few objective data to confirm this. A study was therefore undertaken to examine actual MVC data in a large group of patients with OSA before and after treatment with continuous positive airway pressure (CPAP) compared with a control group matched for age, sex, and type of driver's licence (commercial or non-commercial).
METHODS—Two hundred and ten patients of mean (SD) age 52 (11) years, body mass index (BMI) 35.5 (10) kg/m2, apnoea/hypopnoea index (AHI) 54 (29) events/h were treated with CPAP for at least 3 years. MVC records were obtained from the Ontario Ministry of Transportation (MTO) database for patients and an equal number of randomly selected control drivers. MVC rates were compared for 3 years before and after CPAP therapy for patients and for the corresponding time frames for controls.
RESULTS—Untreated patients with OSA had more MVCs than controls (mean (SD) MVCs/driver/year 0.18 (0.29) v 0.06 (0.17), p<0.001). Following CPAP treatment the number of MVCs/driver/year fell to normal (0.06(0.17)) while, in controls, the MVC rate was unchanged over time (0.06 (0.17) v 0.07 (0.18), p=NS). Thus, the change in MVCs over time between the groups was very significant (change = -0.12 (95% CI -0.17 to -0.06), p<0.001)). The MVC rate in untreated patients (n=27) remained high over time. Driving exposure was not different following CPAP.
CONCLUSIONS—The risk of MVCs due to OSA is removed when patients are treated with CPAP. As such, any restrictions on driving because of OSA could be safely removed after treatment.

 PMID:11413347

Symmetry of proprioceptive sense in female soccer players.

PubMed

Iwańska, Dagmara; Karczewska, Magdalena; Madej, Anna; Urbanik, Czesław

2015-01-01

The purpose of the study was to assess the symmetry of proprioceptive sense among female soccer players when trying to reproduce isometric knee extensions (right and left) and to analyze the impact of a given level of muscle force on proprioception. The study involved 12 soccer players aged 19.5 ± 2.65 years. Soccer players performed a control measurement of a maximum 3s (knee at the 90°) position in the joint. Subsequently, 70%, 50%, and 30% of the maximum voluntary contraction (MVC) were all calculated and then reproduced by each subject with feedback. Next, the players reproduced the predefined muscle contraction values in three sequences: A - 50%, 70%, 30%; B - 50%, 30%, 70%; C - 70%, 30%, 50% of MVC without visual control. In every sequence, the participants found obtaining the value of 30% of MVC the most difficult. The value they reproduced most accurately was 70% of MVC. Both trial II and trial III demonstrated that the symmetry index SI significantly differed from values considered acceptable (SIRa). In each successive sequence the largest asymmetry occurred while reproducing the lowest values of MVC (30%) (p < 0.05). High level of prioprioceptive sense is important to soccer players due to the extensive overload associated with dynamics stops or changes in direction while running. Special attention should be paid to develop skills in sensing force of varying levels. It was much harder to reproduce the predefined values if there was no feedback.

Adapting hierarchical bidirectional inter prediction on a GPU-based platform for 2D and 3D H.264 video coding

NASA Astrophysics Data System (ADS)

Rodríguez-Sánchez, Rafael; Martínez, José Luis; Cock, Jan De; Fernández-Escribano, Gerardo; Pieters, Bart; Sánchez, José L.; Claver, José M.; de Walle, Rik Van

2013-12-01

The H.264/AVC video coding standard introduces some improved tools in order to increase compression efficiency. Moreover, the multi-view extension of H.264/AVC, called H.264/MVC, adopts many of them. Among the new features, variable block-size motion estimation is one which contributes to high coding efficiency. Furthermore, it defines a different prediction structure that includes hierarchical bidirectional pictures, outperforming traditional Group of Pictures patterns in both scenarios: single-view and multi-view. However, these video coding techniques have high computational complexity. Several techniques have been proposed in the literature over the last few years which are aimed at accelerating the inter prediction process, but there are no works focusing on bidirectional prediction or hierarchical prediction. In this article, with the emergence of many-core processors or accelerators, a step forward is taken towards an implementation of an H.264/AVC and H.264/MVC inter prediction algorithm on a graphics processing unit. The results show a negligible rate distortion drop with a time reduction of up to 98% for the complete H.264/AVC encoder.

Effects of Blood-Flow Restriction Combined With Postactivation Potentiation Stimuli on Jump Performance in Recreationally Active Men.

PubMed

Miller, Ryan M; Keeter, Victoria M; Freitas, Eduardo D S; Heishman, Aaron D; Knehans, Allen W; Bemben, Debra A; Bemben, Michael G

2018-07-01

Miller, RM, Keeter, VM, Freitas, EDS, Heishman, AD, Knehans, AW, Bemben, DA, and Bemben, MG. Effects of blood-flow restriction combined with postactivation potentiation stimuli on jump performance in recreationally active men. J Strength Cond Res 32(7): 1869-1874, 2018-Whole-body vibration (WBV) and maximum voluntary contractions (MVCs) combined with blood-flow restriction (BFR) to augment postactivation potentiation have yet to be examined. Therefore, the purpose of this investigation was to examine the augmented effects of postactivation potentiation when WBV and MVC are combined with BFR. Twenty men (21.8 ± 2.6 years, 180.5 ± 6.2 cm and 84.5 ± 12.1 kg) completed the study. Participants completed 3 testing sessions in a randomized design that included one of the following: (a) control (CON), (b) WBV and WBV combined with BFR (WBV + BFR), or (c) MVC and MVC combined with BFR (MVC + BFR). Jump height and power were recorded for 3 trials, PRE and POST jump height (cm) mean ± SD for each were as follows: CON 58.9 ± 8.6 and 57.9 ± 8.6, WBV 58.2 ± 8.1 and 59.9 ± 8.1, WBV + BFR 58.7 ± 7.6 and 60.2 ± 8.1, MVC 59.7 ± 7.4 and 60.2 ± 8.6, and MVC + BFR 57.7 ± 7.9 and 59.4 ± 8.1. PRE and POST jump power (W) mean ± SD for each were as follows: CON 1,224.3 ± 221.5 and 1,234.3 ± 189.2, WBV 1,251.1 ± 230.4 and 1,266.1 ± 215.7, WBV + BFR 1,265.8 ± 207.9 and 1,259 ± 223.3, MVC 1,264.7 ± 211.9 and 1,263.5 ± 236.5, and MVC + BFR 1,252.3 ± 222.0 and 1,294.6 ± 256.6. Significant differences were revealed in jump height between the 5 interventions (p < 0.01), WBV (p < 0.01), WBV + BFR (p < 0.01), and MVC + BFR (p < 0.01) revealed significant differences in time but no differences in jump power. In conclusion, the results of this study indicate that WBV, WBV + BFR, and MVC + BFR significantly improve jump height and time in air but not jump power.

Substance Abuse among Drivers of Motor Vehicle Collisions

PubMed Central

Derakhshanfar, Hojjat; Kalantari Meibodi, Mohamad; Kariman, Hamid; Arhamidolatabadi, Ali; Safari, Saeed

2012-01-01

Background: Motor vehicle collisions (MVC) comprise a majority cause of referral to the emergency department (ED). A large proportion of MVC appear to be preventable, if more effective measures against driving after substance abuse can be implemented. Objective: This study was aimed to investigate the prevalence of substance abuse among drivers of MVC, following road traffic accidents (RTA). Materials and Methods: This case-control research was conducted from July to October 2007. One hundred MVC drivers admitted in the ED were included as the case group and 110 hospitalized patients, due to nontraumatic causes were used as controls. History of substances abused was obtained and urine samples were tested for opium in both groups. Finally the history and laboratory results of the groups were compared using SPSS 18. Results: Of the 100 patients in the case group, 39 (39%) were positive for substance abuse (100% males). On the other hand, 49 (44.5%) patients in the control group had positive history or laboratory findings of substance abuse (73.9% male). Opioids were the most common agent abused in both groups. There was no significant difference between two groups regarding the prevalence of substance abuse (P = 0.92). Conclusions: The prevalence of substance abuse is high among victims of road traffic injury but in equal proportion to the control group. Health education and counseling is needed to reduce substance abuse in the general population although it was not significantly related to the cause of RTA. PMID:24829889

Medication use and the risk of motor vehicle collisions among licensed drivers: A systematic review

PubMed Central

Rudisill, Toni M.; Zhu, Motao; Kelley, George A.; Pilkerton, Courtney; Rudisill, Brandon R.

2016-01-01

Objectives Driving under the influence of prescription and over-the-counter medication is a growing public health concern. A systematic review of the literature was performed to investigate which specific medications were associated with increased risk of motor vehicle collision (MVC). Methods The a priori inclusion criteria were: 1) studies published from English-language sources on or after January 1, 1960, 2) licensed drivers 15 years of age and older, 3) peer-reviewed publications, master's theses, doctoral dissertations, and conference papers, 4) studies limited to randomized control trials, cohort studies, case-control studies, or case-control type studies 5) outcome measure reported for at least one specific medication, 6) outcome measure reported as the odds or risk of a motor vehicle collision. Fourteen databases were examined along with hand-searching. Independent, dual selection of studies and data abstraction was performed. Results Fifty-three medications were investigated by 27 studies included in the review. Fifteen (28.3%) were associated with an increased risk of MVC. These included Buprenorphine, Codeine, Dihydrocodeine, Methadone, Tramadol, Levocitirizine, Diazepam, Flunitrazepam, Flurazepam, Lorazepam, Temazepam, Triazolam, Carisoprodol, Zolpidem, and Zopiclone. Conclusions Several medications were associated with an increased risk of MVC and decreased driving ability. The associations between specific medication use and the increased risk of MVC and/or affected driving ability are complex. Future research opportunities are plentiful and worthy of such investigation. PMID:27569655

Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study.

PubMed

Jones, David E J; Hollingsworth, Kieren G; Jakovljevic, Djordje G; Fattakhova, Gulnar; Pairman, Jessie; Blamire, Andrew M; Trenell, Michael I; Newton, Julia L

2012-02-01

Chronic fatigue syndrome (CFS) patients frequently describe difficulties with repeat exercise. Here, we explore muscle bioenergetic function in response to three bouts of exercise. A total of 18 CFS (CDC 1994) patients and 12 sedentary controls underwent assessment of maximal voluntary contraction (MVC), repeat exercise with magnetic resonance spectroscopy and cardio-respiratory fitness test to determine anaerobic threshold. Chronic fatigue syndrome patients undertaking MVC fell into two distinct groups: 8 (45%) showed normal PCr depletion in response to exercise at 35% of MVC (PCr depletion >33%; lower 95% CI for controls); 10 CFS patients had low PCr depletion (generating abnormally low MVC values). The CFS whole group exhibited significantly reduced anaerobic threshold, heart rate, VO(2) , VO(2) peak and peak work compared to controls. Resting muscle pH was similar in controls and both CFS patient groups. However, the CFS group achieving normal PCr depletion values showed increased intramuscular acidosis compared to controls after similar work after each of the three exercise periods with no apparent reduction in acidosis with repeat exercise of the type reported in normal subjects. This CFS group also exhibited significant prolongation (almost 4-fold) of the time taken for pH to recover to baseline. When exercising to comparable levels to normal controls, CFS patients exhibit profound abnormality in bioenergetic function and response to it. Although exercise intervention is the logical treatment for patients showing acidosis, any trial must exclude subjects who do not initiate exercise as they will not benefit. This potentially explains previous mixed results in CFS exercise trials. © 2011 The Authors. European Journal of Clinical Investigation © 2011 Stichting European Society for Clinical Investigation Journal Foundation.

Design and Implementation of Harmful Algal Bloom Diagnosis System Based on J2EE Platform

NASA Astrophysics Data System (ADS)

Guo, Chunfeng; Zheng, Haiyong; Ji, Guangrong; Lv, Liang

According to the shortcomings which are time consuming and laborious of the traditional HAB (Harmful Algal Bloom) diagnosis by the experienced experts using microscope, all kinds of methods and technologies to identify HAB emerged such as microscopic images, molecular biology, characteristics of pigments analysis, fluorescence spectra, inherent optical properties, etc. This paper proposes the design and implementation of a web-based diagnosis system integrating the popular methods for HAB identification. This system is designed with J2EE platform based on MVC (Model-View-Controller) model as well as technologies such as JSP, Servlets, EJB and JDBC.

Reduced Radial Displacement of the Gastrocnemius Medialis Muscle After Electrically Elicited Fatigue.

PubMed

Macgregor, Lewis J; Ditroilo, Massimiliano; Smith, Iain J; Fairweather, Malcolm M; Hunter, Angus M

2016-08-01

Assessments of skeletal-muscle functional capacity often necessitate maximal contractile effort, which exacerbates muscle fatigue or injury. Tensiomyography (TMG) has been investigated as a means to assess muscle contractile function after fatigue; however, observations have not been contextualized by concurrent physiological measures. To measure peripheral-fatigue-induced alterations in mechanical and contractile properties of the plantar-flexor muscles through noninvasive TMG concurrently with maximal voluntary contraction (MVC) and passive muscle tension (PMT) to validate TMG as a gauge of peripheral fatigue. Pre- and posttest intervention with control. University laboratory. 21 healthy male volunteers. Subjects' plantar flexors were tested for TMG parameters, along with MVC and PMT, before and after either a 5-min rest period (control) or a 5-min electrical-stimulation intervention (fatigue). Temporal (contraction velocity) and spatial (radial displacement) contractile parameters of the gastrocnemius medialis were recorded through TMG. MVC was measured as an indicator of muscle fatigue, and PMT was measured to assess muscle stiffness. Radial displacement demonstrated a fatigue-associated reduction (3.3 ± 1.2 vs 4.0 ± 1.4 mm, P = .031), while contraction velocity remained unaltered. In addition, MVC significantly declined by 122.6 ± 104 N (P < .001) after stimulation (fatigue). PMT was significantly increased after fatigue (139.8 ± 54.3 vs 111.3 ± 44.6 N, P = .007). TMG successfully detected fatigue, evident from reduced MVC, by displaying impaired muscle displacement accompanied by elevated PMT. TMG could be useful in establishing skeletal-muscle fatigue status without exacerbating the functional decrement of the muscle.

StarView: The object oriented design of the ST DADS user interface

NASA Technical Reports Server (NTRS)

Williams, J. D.; Pollizzi, J. A.

1992-01-01

StarView is the user interface being developed for the Hubble Space Telescope Data Archive and Distribution Service (ST DADS). ST DADS is the data archive for HST observations and a relational database catalog describing the archived data. Users will use StarView to query the catalog and select appropriate datasets for study. StarView sends requests for archived datasets to ST DADS which processes the requests and returns the database to the user. StarView is designed to be a powerful and extensible user interface. Unique features include an internal relational database to navigate query results, a form definition language that will work with both CRT and X interfaces, a data definition language that will allow StarView to work with any relational database, and the ability to generate adhoc queries without requiring the user to understand the structure of the ST DADS catalog. Ultimately, StarView will allow the user to refine queries in the local database for improved performance and merge in data from external sources for correlation with other query results. The user will be able to create a query from single or multiple forms, merging the selected attributes into a single query. Arbitrary selection of attributes for querying is supported. The user will be able to select how query results are viewed. A standard form or table-row format may be used. Navigation capabilities are provided to aid the user in viewing query results. Object oriented analysis and design techniques were used in the design of StarView to support the mechanisms and concepts required to implement these features. One such mechanism is the Model-View-Controller (MVC) paradigm. The MVC allows the user to have multiple views of the underlying database, while providing a consistent mechanism for interaction regardless of the view. This approach supports both CRT and X interfaces while providing a common mode of user interaction. Another powerful abstraction is the concept of a Query Model. This concept allows a single query to be built form a single or multiple forms before it is submitted to ST DADS. Supporting this concept is the adhoc query generator which allows the user to select and qualify an indeterminate number attributes from the database. The user does not need any knowledge of how the joins across various tables are to be resolved. The adhoc generator calculates the joins automatically and generates the correct SQL query.

Development of a real-time clinical decision support system upon the web mvc-based architecture for prostate cancer treatment

PubMed Central

2011-01-01

Background A real-time clinical decision support system (RTCDSS) with interactive diagrams enables clinicians to instantly and efficiently track patients' clinical records (PCRs) and improve their quality of clinical care. We propose a RTCDSS to process online clinical informatics from multiple databases for clinical decision making in the treatment of prostate cancer based on Web Model-View-Controller (MVC) architecture, by which the system can easily be adapted to different diseases and applications. Methods We designed a framework upon the Web MVC-based architecture in which the reusable and extractable models can be conveniently adapted to other hospital information systems and which allows for efficient database integration. Then, we determined the clinical variables of the prostate cancer treatment based on participating clinicians' opinions and developed a computational model to determine the pretreatment parameters. Furthermore, the components of the RTCDSS integrated PCRs and decision factors for real-time analysis to provide evidence-based diagrams upon the clinician-oriented interface for visualization of treatment guidance and health risk assessment. Results The resulting system can improve quality of clinical treatment by allowing clinicians to concurrently analyze and evaluate the clinical markers of prostate cancer patients with instantaneous clinical data and evidence-based diagrams which can automatically identify pretreatment parameters. Moreover, the proposed RTCDSS can aid interactions between patients and clinicians. Conclusions Our proposed framework supports online clinical informatics, evaluates treatment risks, offers interactive guidance, and provides real-time reference for decision making in the treatment of prostate cancer. The developed clinician-oriented interface can assist clinicians in conveniently presenting evidence-based information to patients and can be readily adapted to an existing hospital information system and be easily applied in other chronic diseases. PMID:21385459

Development of a real-time clinical decision support system upon the Web MVC-based architecture for prostate cancer treatment.

PubMed

Lin, Hsueh-Chun; Wu, Hsi-Chin; Chang, Chih-Hung; Li, Tsai-Chung; Liang, Wen-Miin; Wang, Jong-Yi Wang

2011-03-08

A real-time clinical decision support system (RTCDSS) with interactive diagrams enables clinicians to instantly and efficiently track patients' clinical records (PCRs) and improve their quality of clinical care. We propose a RTCDSS to process online clinical informatics from multiple databases for clinical decision making in the treatment of prostate cancer based on Web Model-View-Controller (MVC) architecture, by which the system can easily be adapted to different diseases and applications. We designed a framework upon the Web MVC-based architecture in which the reusable and extractable models can be conveniently adapted to other hospital information systems and which allows for efficient database integration. Then, we determined the clinical variables of the prostate cancer treatment based on participating clinicians' opinions and developed a computational model to determine the pretreatment parameters. Furthermore, the components of the RTCDSS integrated PCRs and decision factors for real-time analysis to provide evidence-based diagrams upon the clinician-oriented interface for visualization of treatment guidance and health risk assessment. The resulting system can improve quality of clinical treatment by allowing clinicians to concurrently analyze and evaluate the clinical markers of prostate cancer patients with instantaneous clinical data and evidence-based diagrams which can automatically identify pretreatment parameters. Moreover, the proposed RTCDSS can aid interactions between patients and clinicians. Our proposed framework supports online clinical informatics, evaluates treatment risks, offers interactive guidance, and provides real-time reference for decision making in the treatment of prostate cancer. The developed clinician-oriented interface can assist clinicians in conveniently presenting evidence-based information to patients and can be readily adapted to an existing hospital information system and be easily applied in other chronic diseases.

Does hip joint positioning affect maximal voluntary contraction in the gluteus maximus, gluteus medius, tensor fasciae latae and sartorius muscles?

PubMed

Bernard, J; Beldame, J; Van Driessche, S; Brunel, H; Poirier, T; Guiffault, P; Matsoukis, J; Billuart, F

2017-11-01

Minimally invasive total hip arthroplasty (THA) is presumed to provide functional and clinical benefits, whereas in fact the literature reveals that gait and posturographic parameters following THA do not recover values found in the general population. There is a significant disturbance of postural sway in THA patients, regardless of the surgical approach, although with some differences between approaches compared to controls: the anterior and anterolateral minimally invasive approaches seem to be more disruptive of postural parameters than the posterior approach. Electromyographic (EMG) study of the hip muscles involved in surgery [gluteus maximus (GMax), gluteus medius (GMed), tensor fasciae latae (TFL), and sartorius (S)] could shed light, the relevant literature involves discordant methodologies. We developed a methodology to assess EMG activity during maximal voluntary contraction (MVC) of the GMax, GMed, TFL and sartorius muscles as a reference for normalization. A prospective study aimed to assess whether hip joint positioning and the learning curve on an MVC test affect the EMG signal during a maximal voluntary contraction. Hip positioning and the learning curve on an MVC test affect EMG signal during MVC of GMax, GMed, TFL and S. Thirty young asymptomatic subjects participated in the study. Each performed 8 hip muscle MVCs in various joint positions recorded with surface EMG sensors. Each MVC was performed 3 times in 1 week, with the same schedule every day, controlling for activity levels in the preceding 24h. EMG activity during MVC was expressed as a ratio of EMG activity during unipedal stance. Non-parametric tests were applied. Statistical analysis showed no difference according to hip position for abductors or flexors in assessing EMG signal during MVC over the 3 sessions. Hip abductors showed no difference between abduction in lateral decubitus with hip straight versus hip flexed: GMax (19.8±13.7 vs. 14.5±7.8, P=0.78), GMed (13.4±9.0 vs. 9.9±6.6, P=0.21) and TFL (69.5±61.7 vs. 65.9±51.3, P=0.50). Flexors showed no difference between hip flexion/abduction/lateral rotation performed in supine or sitting position: TFL (70.6±45.9 vs. 61.6±45.8, P=0.22) and S (101.1±67.9 vs. 72.6±44.6, P=0.21). The most effective tests to assess EMG signal during MVC were for the hip abductors: hip abduction performed in lateral decubitus (36.7% for GMax, 76.7% for GMed), and for hip flexors: hip flexion/abduction/lateral rotation performed in supine decubitus (50% for TFL, 76.7% for S). The study hypothesis was not confirmed, since hip joint positioning and the learning curve on an MVC test did not affect EMG signal during MVC of GMax, GMed, TFL and S muscles. Therefore, a single session and one specific test is enough to assess MVC in hip abductors (abduction in lateral decubitus) and flexors (hip flexion/abduction/lateral rotation in supine position). This method could be applied to assess muscle function after THA, and particularly to compare different approaches. III, case-matched study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Free viewpoint TV and its international standardization

NASA Astrophysics Data System (ADS)

Tanimoto, Masayuki

2009-05-01

We have developed a new type of television named FTV (Free-viewpoint TV). FTV is an innovative visual media that enables us to view a 3D scene by freely changing our viewpoints. We proposed the concept of FTV and constructed the world's first real-time system including the complete chain of operation from image capture to display. We also realized FTV on a single PC and FTV with free listening-point audio. FTV is based on the ray-space method that represents one ray in real space with one point in the ray-space. We have also developed new type of ray capture and display technologies such as a 360-degree mirror-scan ray capturing system and a 360 degree ray-reproducing display. MPEG regarded FTV as the most challenging 3D media and started the international standardization activities of FTV. The first phase of FTV is MVC (Multi-view Video Coding) and the second phase is 3DV (3D Video). MVC was completed in March 2009. 3DV is a standard that targets serving a variety of 3D displays. It will be completed within the next two years.

Improving maraviroc oral bioavailability by formation of solid drug nanoparticles.

PubMed

Savage, Alison C; Tatham, Lee M; Siccardi, Marco; Scott, Trevor; Vourvahis, Manoli; Clark, Andrew; Rannard, Steve P; Owen, Andrew

2018-05-17

Oral drug administration remains the preferred approach for treatment of HIV in most patients. Maraviroc (MVC) is the first in class co-receptor antagonist, which blocks HIV entry into host cells. MVC has an oral bioavailability of approximately 33%, which is limited by poor permeability as well as affinity for CYP3A and several drug transporters. While once-daily doses are now the favoured option for HIV therapy, dose-limiting postural hypotension has been of theoretical concern when administering doses high enough to achieve this for MVC (particularly during coadministration of enzyme inhibitors). To overcome low bioavailability and modify the pharmacokinetic profile, a series of 70 wt% MVC solid drug nanoparticle (SDN) formulations (containing 30 wt% of various polymer/surfactant excipients) were generated using emulsion templated freeze-drying. The lead formulation contained PVA and AOT excipients ( MVC SDN PVA/AOT ), and was demonstrated to be fully water-dispersible to release drug nanoparticles with z-average diameter of 728 nm and polydispersity index of 0.3. In vitro and in vivo studies of MVC SDN PVA/AOT showed increased apparent permeability of MVC, compared to a conventional MVC preparation, with in vivo studies in rats showing a 2.5-fold increase in AUC (145.33 vs. 58.71 ng h ml -1 ). MVC tissue distribution was similar or slightly increased in tissues examined compared to the conventional MVC preparation, with the exception of the liver, spleen and kidneys, which showed statistically significant increases in MVC for MVC SDN PVA/AOT . These data support a novel oral format with the potential for dose reduction while maintaining therapeutic MVC exposure and potentially enabling a once-daily fixed dose combination product. Copyright © 2018. Published by Elsevier B.V.

Effects of 4 weeks of low-load unilateral resistance training, with and without blood flow restriction, on strength, thickness, V wave, and H reflex of the soleus muscle in men.

PubMed

Colomer-Poveda, David; Romero-Arenas, Salvador; Vera-Ibáñez, Antonio; Viñuela-García, Manuel; Márquez, Gonzalo

2017-07-01

To test the effects of 4 weeks of unilateral low-load resistance training (LLRT), with and without blood flow restriction (BFR), on maximal voluntary contraction (MVC), muscle thickness, volitional wave (V wave), and Hoffmann reflex (H reflex) of the soleus muscle. Twenty-two males were randomly distributed into three groups: a control group (CTR; n = 8); a low-load blood flow restriction resistance training group (BFR-LLRT; n = 7), who were an inflatable cuff to occlude blood flow; and a low-load resistance training group without blood flow restriction (LLRT; n = 7). The training consisted of four sets of unilateral isometric LLRT (25% of MVC) three times a week over 4 weeks. MVC increased 33% (P < 0.001) and 22% (P < 0.01) in the trained leg of both BFR-LLRT and LLRT groups, respectively. The soleus thickness increased 9.5% (P < 0.001) and 6.5% (P < 0.01) in the trained leg of both BFR-LLRT and LLRT groups, respectively. However, neither MVC nor thickness changed in either of the legs tested in the CTR group (MVC -1 and -5%, and muscle thickness 1.9 and 1.2%, for the control and trained leg, respectively). Moreover, V wave and H reflex did not change significantly in all the groups studied (V wave /M wave ratio -7.9 and -2.6%, and H max /M max ratio -3.8 and -4%, for the control and trained leg, respectively). Collectively, the present data suggest that in spite of the changes occurring in soleus strength and thickness, 4 weeks of low-load resistance training, with or without BFR, does not cause any change in neural drive or motoneuronal excitability.

On the radiobiological impact of metal artifacts in head-and-neck IMRT in terms of tumor control probability (TCP) and normal tissue complication probability (NTCP).

PubMed

Kim, Yusung; Tomé, Wolfgang A

2007-11-01

To investigate the effects of distorted head-and-neck (H&N) intensity-modulated radiation therapy (IMRT) dose distributions (hot and cold spots) on normal tissue complication probability (NTCP) and tumor control probability (TCP) due to dental-metal artifacts. Five patients' IMRT treatment plans have been analyzed, employing five different planning image data-sets: (a) uncorrected (UC); (b) homogeneous uncorrected (HUC); (c) sinogram completion corrected (SCC); (d) minimum-value-corrected (MVC); and (e) streak-artifact-reduction including minimum-value-correction (SAR-MVC), which has been taken as the reference data-set. The effects on NTCP and TCP were evaluated using the Lyman-NTCP model and the Logistic-TCP model, respectively. When compared to the predicted NTCP obtained using the reference data-set, the treatment plan based on the original CT data-set (UC) yielded an increase in NTCP of 3.2 and 2.0% for the spared parotid gland and the spinal cord, respectively. While for the treatment plans based on the MVC CT data-set the NTCP increased by a 1.1% and a 0.1% for the spared parotid glands and the spinal cord, respectively. In addition, the MVC correction method showed a reduction in TCP for target volumes (MVC: delta TCP = -0.6% vs. UC: delta TCP = -1.9%) with respect to that of the reference CT data-set. Our results indicate that the presence of dental-metal-artifacts in H&N planning CT data-sets has an impact on the estimates of TCP and NTCP. In particular dental-metal-artifacts lead to an increase in NTCP for the spared parotid glands and a slight decrease in TCP for target volumes.

Neuromuscular assessment in elderly workers with and without work related shoulder/neck trouble: the NEW-study design and physiological findings.

PubMed

Sjøgaard, G; Søgaard, K; Hermens, H J; Sandsjö, L; Läubli, T; Thorn, S; Vollenbroek-Hutten, M M R; Sell, L; Christensen, H; Klipstein, A; Kadefors, R; Merletti, R

2006-01-01

Musculoskeletal disorders in the neck and shoulder area are a major occupational concern in the European countries especially among elderly females. The aim was to assess these disorders based on quantitative EMG indicators and functional tests. 252 female computer users (45-68 years) were recruited from four European countries in two contrast groups: (1) 88 neck/shoulder (NS) cases reporting trouble in the neck and/or shoulder region for more than 30 days during the last year, and (2) 164 NS-controls reporting such trouble for no more than 7 days. Questionnaires, functional/clinical tests, and physiological recordings were performed in workplace related field studies. The results showed no differences in anthropometrics but NS-cases reported more strained head positions and more eye problems than controls. The psychosocial working factors were similar, although, NS-controls had slightly better scores on working conditions, general health, and vitality compared to cases. The NS-cases had lower maximal voluntary contraction (MVC) during shoulder elevation (mean (SD) 310 (122) N) compared to the controls (364 (122) N). During 30% MVC electromyography (EMGrms) in the trapezius muscle was lower in NS-cases (194 (105) muV) than in controls (256 (169) muV), while no differences were found regarding endurance time. Estimated conduction velocity was not different between NS-cases and -controls. Four functional computer tests were performed equally well by NS-cases and -controls, and the corresponding EMG variables also did not differ. A major finding in this large-scale epidemiological study is the significantly lower MVC in NS-cases compared with NS-controls together with lower EMGrms value at 30% MVC, while computer tasks were performed at similar relative muscle activation. The study was unable to reveal quantitative EMG indicators and functional tests that could objectively assess disorders in NS-cases.

Influences of Fascicle Length During Isometric Training on Improvement of Muscle Strength.

PubMed

Tanaka, Hiroki; Ikezoe, Tome; Umehara, Jun; Nakamura, Masatoshi; Umegaki, Hiroki; Kobayashi, Takuya; Nishishita, Satoru; Fujita, Kosuke; Araki, Kojiro; Ichihashi, Noriaki

2016-11-01

Tanaka, H, Ikezoe, T, Umehara, J, Nakamura, M, Umegaki, H, Kobayashi, T, Nishishita, S, Fujita, K, Araki, K, and Ichihashi, N. Influences of fascicle length during isometric training on improvement of muscle strength. J Strength Cond Res 30(11): 3249-3255, 2016-This study investigated whether low-intensity isometric training would elicit a greater improvement in maximum voluntary contraction (MVC) at the same fascicle length, rather than the joint angle, adopted during training. Sixteen healthy women (21.8 ± 1.5 years) were randomly divided into an intervention group and a control group. Before (Pre) and after (Post) training, isometric plantarflexion MVCs were measured every 10° through the range of ankle joint position from 20° dorsiflexion to 30° plantarflexion (i.e., 6 ankle angles). Medial gastrocnemius fascicle length was also measured at each position, using B-mode ultrasound under 3 conditions of muscle activation: at rest, 30%MVC at respective angles, and MVC. Plantarflexion resistance training at an angle of 20° plantarflexion was performed 3 days a week for 4 weeks at 30%MVC using 3 sets of twenty 3-second isometric contractions. Maximum voluntary contraction in the intervention group increased at 0 and 10° plantarflexion (0°; Pre: 81.2 ± 26.5 N·m, Post: 105.0 ± 21.6 N·m, 10°; Pre: 63.0 ± 23.6 N·m, Post: 81.3 ± 20.3 N·m), which was not the angle used in training (20°). However, the fascicle length adopted in training at 20° plantarflexion and 30%MVC was similar to the value at 0 or 10° plantarflexion at MVC. Low-intensity isometric training at a shortened muscle length may be effective for improving MVC at a lengthened muscle length because of specificity of the fascicle length than the joint angle.

Object-oriented software design in semiautomatic building extraction

NASA Astrophysics Data System (ADS)

Guelch, Eberhard; Mueller, Hardo

1997-08-01

Developing a system for semiautomatic building acquisition is a complex process, that requires constant integration and updating of software modules and user interfaces. To facilitate these processes we apply an object-oriented design not only for the data but also for the software involved. We use the unified modeling language (UML) to describe the object-oriented modeling of the system in different levels of detail. We can distinguish between use cases from the users point of view, that represent a sequence of actions, yielding in an observable result and the use cases for the programmers, who can use the system as a class library to integrate the acquisition modules in their own software. The structure of the system is based on the model-view-controller (MVC) design pattern. An example from the integration of automated texture extraction for the visualization of results demonstrate the feasibility of this approach.

A Web application for the management of clinical workflow in image-guided and adaptive proton therapy for prostate cancer treatments.

PubMed

Yeung, Daniel; Boes, Peter; Ho, Meng Wei; Li, Zuofeng

2015-05-08

Image-guided radiotherapy (IGRT), based on radiopaque markers placed in the prostate gland, was used for proton therapy of prostate patients. Orthogonal X-rays and the IBA Digital Image Positioning System (DIPS) were used for setup correction prior to treatment and were repeated after treatment delivery. Following a rationale for margin estimates similar to that of van Herk,(1) the daily post-treatment DIPS data were analyzed to determine if an adaptive radiotherapy plan was necessary. A Web application using ASP.NET MVC5, Entity Framework, and an SQL database was designed to automate this process. The designed features included state-of-the-art Web technologies, a domain model closely matching the workflow, a database-supporting concurrency and data mining, access to the DIPS database, secured user access and roles management, and graphing and analysis tools. The Model-View-Controller (MVC) paradigm allowed clean domain logic, unit testing, and extensibility. Client-side technologies, such as jQuery, jQuery Plug-ins, and Ajax, were adopted to achieve a rich user environment and fast response. Data models included patients, staff, treatment fields and records, correction vectors, DIPS images, and association logics. Data entry, analysis, workflow logics, and notifications were implemented. The system effectively modeled the clinical workflow and IGRT process.

Psychological impact of injuries sustained in motor vehicle crashes: systematic review and meta-analysis.

PubMed

Craig, Ashley; Tran, Yvonne; Guest, Rebecca; Gopinath, Bamini; Jagnoor, Jagnoor; Bryant, Richard A; Collie, Alex; Tate, Robyn; Kenardy, Justin; Middleton, James W; Cameron, Ian

2016-09-08

The aim of this meta-analysis was to determine the psychological impact associated with motor vehicle crash (MVC)-related physical injuries. Systematic review and meta-analysis. Multiple search engines included MEDLINE (via OVID), PsycINFO and Embase, and studies were sourced from scientific journals, conference papers and doctoral theses. A high-yield search strategy was employed. Terms like 'psychological distress', 'depression', 'PTSD' and 'motor vehicle accident' were employed. These key words were run primarily and secondary searches were then conducted in association with the major injury types. Studies needed to compare psychological distress in people injured in an MVC with uninjured controls who had not recently experienced an MVC. Searches resulted in the identification of 2537 articles, and after eliminating duplicates and studies not meeting inclusion criteria, 24 studies were selected involving 4502 injured participants. These studies were entered into separate meta-analyses for mild to moderate traumatic brain injury (mTBI), whiplash-associated disorder (WAD) and spinal cord injury (SCI). Elevated psychological distress was associated with MVC-related injuries with a large summary effect size in WAD (0.90), medium to large effect size in SCI (0.69) and small to medium effect size in mTBI (0.23). No studies meeting inclusion criteria were found for burns, fractures and low back injury. Increased psychological distress remains elevated in SCI, mTBI and WAD for at least 3 years post-MVC. Rehabilitation strategies are needed to minimise distress subsequent to MVC-related physical injuries and the scientific robustness of studies requires improvement. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Psychological impact of injuries sustained in motor vehicle crashes: systematic review and meta-analysis

PubMed Central

Tran, Yvonne; Guest, Rebecca; Gopinath, Bamini; Jagnoor, Jagnoor; Bryant, Richard A; Collie, Alex; Tate, Robyn; Kenardy, Justin; Middleton, James W; Cameron, Ian

2016-01-01

Objective The aim of this meta-analysis was to determine the psychological impact associated with motor vehicle crash (MVC)-related physical injuries. Design Systematic review and meta-analysis. Data sources Multiple search engines included MEDLINE (via OVID), PsycINFO and Embase, and studies were sourced from scientific journals, conference papers and doctoral theses. Study selection A high-yield search strategy was employed. Terms like ‘psychological distress’, ‘depression’, ‘PTSD’ and ‘motor vehicle accident’ were employed. These key words were run primarily and secondary searches were then conducted in association with the major injury types. Studies needed to compare psychological distress in people injured in an MVC with uninjured controls who had not recently experienced an MVC. Data extraction Searches resulted in the identification of 2537 articles, and after eliminating duplicates and studies not meeting inclusion criteria, 24 studies were selected involving 4502 injured participants. These studies were entered into separate meta-analyses for mild to moderate traumatic brain injury (mTBI), whiplash-associated disorder (WAD) and spinal cord injury (SCI). Results Elevated psychological distress was associated with MVC-related injuries with a large summary effect size in WAD (0.90), medium to large effect size in SCI (0.69) and small to medium effect size in mTBI (0.23). No studies meeting inclusion criteria were found for burns, fractures and low back injury. Increased psychological distress remains elevated in SCI, mTBI and WAD for at least 3 years post-MVC. Conclusions Rehabilitation strategies are needed to minimise distress subsequent to MVC-related physical injuries and the scientific robustness of studies requires improvement. PMID:27609849

Reflex regulation during sustained and intermittent submaximal contractions in humans

PubMed Central

Duchateau, Jacques; Balestra, Costantino; Carpentier, Alain; Hainaut, Karl

2002-01-01

To investigate whether the intensity and duration of a sustained contraction influences reflex regulation, we compared sustained fatiguing contractions at 25 % and 50 % of maximal voluntary contraction (MVC) force in the human abductor pollicis brevis (APB) muscle. Because the activation of motoneurones during fatigue may be reflexively controlled by the metabolic status of the muscle, we also compared reflex activities during sustained and intermittent (6 s contraction, 4 s rest) contractions at 25 % MVC for an identical duration. The short-latency Hoffmann(H) reflex and the long-latency reflex (LLR) were recorded during voluntary contractions, before, during and after the fatigue tests, with each response normalised to the compound muscle action potential (M-wave). The results showed that fatigue during sustained contractions was inversely related to the intensity, and hence the duration, of the effort. The MVC force and associated surface electromyogram (EMG) declined by 26.2 % and 35.2 %, respectively, after the sustained contraction at 50 % MVC, and by 34.2 % and 44.2 % after the sustained contraction at 25 % MVC. Although the average EMG increased progressively with time during the two sustained fatiguing contractions, the amplitudes of the H and LLR reflexes decreased significantly. Combined with previous data (Duchateau & Hainaut, 1993), the results show that the effect on the H reflex is independent of the intensity of the sustained contraction, whereas the decline in the LLR is closely related to the duration of the contraction. Because there were no changes in the intermittent test at 25 % MVC, the results indicate that the net excitatory spinal and supraspinal reflex-mediated input to the motoneurone pool is reduced. This decline in excitation to the motoneurones, however, can be temporarily compensated by an enhancement of the central drive. PMID:12068054

A randomized controlled trial of the effectiveness of brief-CBT for patients with symptoms of posttraumatic stress following a motor vehicle crash.

PubMed

Wu, Kitty K; Li, Frendi W; Cho, Valda W

2014-01-01

Motor vehicle crashes (MVCs) are leading contributors to the global burden of disease. Patients attending accident and emergency (A&E) after an MVC may develop symptoms of posttraumatic stress disorder (PTSD). There is evidence that brief cognitive behavioural therapy (B-CBT) can be effective in treating PTSD; however, there are few studies of the use of B-CBT to treat PTSD in MVC survivors. This study examined the effects of B-CBT and a self-help program on the severity of psychological symptoms in MVC survivors at risk of developing PTSD. Sixty participants who attended A&E after a MVC were screened for PTSD symptoms and randomized to a 4-weekly session B-CBT or a 4-week self-help program (SHP) booklet treatment conditions. Psychological assessments were completed at baseline (1-month post-MVC) and posttreatment (3- and 6-month follow-ups) by utilizing Impact of Event Scale-Revised (IES-R) and Hospital Anxiety and Depression Scale (HADS). There were significant improvements in the measures of anxiety, depression, and PTSD symptoms over time. Participants treated with B-CBT showed greater reductions in anxiety at 3-month and 6-month follow-ups, and in depression at 6-month follow-up. A comparison of effect size favoured B-CBT for the reduction of anxiety and depression symptoms measured by HADS. A high level of pretreatment anxiety and depression were predictive of negative outcome at 6-month follow-up in the SHP condition. There was no differential effect on PTSD symptoms measured by IES-R. This trial supports the efficacy of providing B-CBT as a preventive strategy to improve psychological symptoms after an MVC.

Local Muscle Metabolic Demand Induced by Neuromuscular Electrical Stimulation and Voluntary Contractions at Different Force Levels: A NIRS Study.

PubMed

Muthalib, Makii; Kerr, Graham; Nosaka, Kazunori; Perrey, Stephane

2016-06-13

Functional Muscle metabolic demand during contractions evoked by neuromuscular electrical stimulation (NMES) has been consistently documented to be greater than voluntary contractions (VOL) at the same force level (10-50% maximal voluntary contraction-MVC). However, we have shown using a near-infrared spectroscopy (NIRS) technique that local muscle metabolic demand is similar between NMES and VOL performed at MVC levels, thus controversy exists. This study therefore compared biceps brachii muscle metabolic demand (tissue oxygenation index-TOI and total hemoglobin volume-tHb) during a 10s isometric contraction of the elbow flexors between NMES (stimulation frequency of 30Hz and current level to evoke 30% MVC) and VOL at 30% MVC (VOL-30%MVC) and MVC (VOL-MVC) level in 8 healthy men (23-33-y). Greater changes in TOI and tHb induced by NMES than VOL-30%MVC confirm previous studies of a greater local metabolic demand for NMES than VOL at the same force level. The same TOI and tHb changes for NMES and VOL-MVC suggest that local muscle metabolic demand and intramuscular pressure were similar between conditions. In conclusion, these findings indicate that NMES induce a similar local muscle metabolic demand as that of maximal VOL.

Local Muscle Metabolic Demand Induced by Neuromuscular Electrical Stimulation and Voluntary Contractions at Different Force Levels: A NIRS Study

PubMed Central

Muthalib, Makii; Kerr, Graham; Nosaka, Kazunori; Perrey, Stephane

2016-01-01

Functional Muscle metabolic demand during contractions evoked by neuromuscular electrical stimulation (NMES) has been consistently documented to be greater than voluntary contractions (VOL) at the same force level (10-50% maximal voluntary contraction-MVC). However, we have shown using a near-infrared spectroscopy (NIRS) technique that local muscle metabolic demand is similar between NMES and VOL performed at MVC levels, thus controversy exists. This study therefore compared biceps brachii muscle metabolic demand (tissue oxygenation index-TOI and total hemoglobin volume-tHb) during a 10s isometric contraction of the elbow flexors between NMES (stimulation frequency of 30Hz and current level to evoke 30% MVC) and VOL at 30% MVC (VOL-30%MVC) and MVC (VOL-MVC) level in 8 healthy men (23-33-y). Greater changes in TOI and tHb induced by NMES than VOL-30%MVC confirm previous studies of a greater local metabolic demand for NMES than VOL at the same force level. The same TOI and tHb changes for NMES and VOL-MVC suggest that local muscle metabolic demand and intramuscular pressure were similar between conditions. In conclusion, these findings indicate that NMES induce a similar local muscle metabolic demand as that of maximal VOL. PMID:27478574

Effect of mobile phone proliferation on crash notification times and fatality rates.

PubMed

Stickles, Jimmy L; Kempema, James M; Brown, Lawrence H

2018-01-01

The purpose of this study was to evaluate whether increased proliferation of mobile telephones has been associated with decreased MVC notification times and/or decreased MVC fatality rates in the United States (US). We used World Bank annual mobile phone market penetration data and US Fatality Analysis Reporting System (FARS) fatal MVC data for 1994-2014. For each year, phone proliferation was measured as mobile phones per 100 population. FARS data were used to calculate MVC notification time (time EMS notified - time MVC occurred) in minutes, and to determine the MVC fatality rate per billion vehicle miles traveled (BVMT). We used basic vector auto-regression modeling to explore relationships between changes in phone proliferation and subsequent changes in median and 90th percentile MVC notification times, as well as MVC fatality rates. From 1994 to 2014, larger year-over-year increases in phone proliferation were associated with larger decreases in 90th percentile notification times for MVCs occurring during daylight hours (p=0.004) and on the national highway system (p=0.046) two years subsequent, and crashes off the national highway system three years subsequent (p=0.023). There were no significant associations between changes in phone proliferation and subsequent changes in median crash notification times, nor with subsequent changes in MVC fatality rates. Between 1994 and 2014 increased mobile phone proliferation in the U.S. was associated with shorter 90th percentile EMS notification times for some subgroups of fatal MVCs, but not with decreases in median notification times or overall MVC fatality rates. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of implicit theories of ability and stereotype-inconsistent information on handgrip strength in older adults: A regulatory fit perspective.

PubMed

Emile, Mélanie; Chalabaev, Aina; Colson, Serge S; Vaulerin, Jerome; Falzon, Charlene; D'Arripe-Longueville, Fabienne

2017-03-01

This study examined whether stereotype-inconsistent information interacts with implicit theories of ability to affect handgrip strength in older adults. Eighty-two retired older adults (13 men and 69 women) from 61 to 89 years old (M age = 75.8 years; SD = 6.9) performed maximum voluntary contractions (MVC) during a handgrip task in a design manipulating implicit theories of ability and stereotype-inconsistent information related to physical decline with aging. Participants were randomly assigned to one of three groups: incremental condition, entity condition, or control group. The results showed that in the incremental condition the stereotype-inconsistent information improved the peak MVC, the average MVC, the peak rate of force development (RFD), and RFD in the initial 50 ms of the MVC. This study therefore demonstrated that individuals with an incremental mindset who are exposed to stereotype-inconsistent information can boost their physical performance. These findings are discussed from the perspective of regulatory fit (i.e., when task framing is congruent with the individual's goal). © 2016 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

Virologic and Serologic Identification of Minute Virus of Canines (Canine Parvovirus Type 1) from Dogs in Japan

PubMed Central

Mochizuki, Masami; Hashimoto, Michiru; Hajima, Takayuki; Takiguchi, Mitsuyoshi; Hashimoto, Akira; Une, Yumi; Roerink, Frank; Ohshima, Takahisa; Parrish, Colin R.; Carmichael, Leland E.

2002-01-01

Minute virus of canines (MVC), also known as canine parvovirus type 1, was initially believed to be a nonpathogenic agent, since it was first isolated from canine fecal specimens in the late 1960s. However, subsequent pathological as well as epidemiological studies suggested that MVC is a pathogen of neonatal puppies and is widely distributed among domestic dogs in the United States. The virus also has been shown to cause fetal deaths. Nevertheless, the virus was not detected in dogs outside the United States until recently, presumably because of a lack of widespread availability of the only susceptible canine cell line, WRCC/3873D, used for MVC isolation. We examined 470 clinical specimens from 346 dogs by PCR and detected MVC-specific gene fragments from four diseased puppies (positive rate, 1.2%). Viruses were recovered from three PCR-positive rectal specimens by using WRCC/3873D and MDCK cells. The isolates possessed antigenic and genomic properties similar to those of the U.S. reference strain GA3 and were identified as MVC. In addition, seroepidemiological evidence that 5.0% of dogs possessed anti-MVC antibodies also indicated the presence of MVC infection among dogs in Japan. From this study and several recent European reports describing MVC field cases, it is evident that MVC is distributed among domestic dogs worldwide. PMID:12409364

FLS tasks can be used as an ergonomic discriminator between laparoscopic and robotic surgery.

PubMed

Zihni, Ahmed M; Ohu, Ikechukwu; Cavallo, Jaime A; Ousley, Jenny; Cho, Sohyung; Awad, Michael M

2014-08-01

Robotic surgery may result in ergonomic benefits to surgeons. In this pilot study, we utilize surface electromyography (sEMG) to describe a method for identifying ergonomic differences between laparoscopic and robotic platforms using validated Fundamentals of Laparoscopic Surgery (FLS) tasks. We hypothesize that FLS task performance on laparoscopic and robotic surgical platforms will produce significant differences in mean muscle activation, as quantified by sEMG. Six right-hand-dominant subjects with varying experience performed FLS peg transfer (PT), pattern cutting (PC), and intracorporeal suturing (IS) tasks on laparoscopic and robotic platforms. sEMG measurements were obtained from each subject's bilateral bicep, tricep, deltoid, and trapezius muscles. EMG measurements were normalized to the maximum voluntary contraction (MVC) of each muscle of each subject. Subjects repeated each task three times per platform, and mean values used for pooled analysis. Average normalized muscle activation (%MVC) was calculated for each muscle group in all subjects for each FLS task. We compared mean %MVC values with paired t tests and considered differences with a p value less than 0.05 to be statistically significant. Mean activation of right bicep (2.7 %MVC lap, 1.3 %MVC robotic, p = 0.019) and right deltoid muscles (2.4 %MVC lap, 1.0 %MVC robotic, p = 0.019) were significantly elevated during the laparoscopic compared to the robotic IS task. The mean activation of the right trapezius muscle was significantly elevated during robotic compared to the laparoscopic PT (1.6 %MVC lap, 3.5 %MVC robotic, p = 0.040) and PC (1.3 %MVC lap, 3.6 %MVC robotic, p = 0.0018) tasks. FLS tasks are validated, readily available instruments that are feasible for use in demonstrating ergonomic differences between surgical platforms. In this study, we used FLS tasks to compare mean muscle activation of four muscle groups during laparoscopic and robotic task performance. FLS tasks can serve as the basis for larger studies to further describe ergonomic differences between laparoscopic and robotic surgery.

Active Ankle Movement May Prevent Deep Vein Thrombosis in Patients Undergoing Lower Limb Surgery.

PubMed

Wang, Zhe; Chen, Qian; Ye, Mao; Shi, Guang-Hui; Zhang, Bo

2016-04-01

Our aim is to investigate the effect of active ankle movement to prevent deep vein thrombosis (DVT) in patients who received lower limb surgery, and to provide a theory of evidence for rehabilitation nursing of patients after orthopedic surgery. Between January 2012 and December 2013, a total of 174 patients were randomized as case group (n = 96) and control group (n = 78). Case group received routine nursing and active ankle movement (30 times/min, 1-7 days after surgery), while control group only received routine nursing. The symptoms and signs of DVT were in real-time observation during the experiment. Thigh and crus circumference, maximum venous outflow (MVO), maximum venous capacity (MVC), and MVO ratio (MVO ratio = MVO/MVC) in the two groups were measured 1-7 days after surgery. Six-month follow-up study was also conducted to observe the occurrence of DVT. Our study revealed that thigh circumference in the case group decreased compared with the control group in 5-7 days (fifth day: 39.98 ± 3.25 vs. 41.01 ± 3.38, P = 0.043; sixth day: 38.21 ± 3.81 vs. 39.49 ± 3.79, P = 0.029; seventh day: 37.13 ± 3.15 vs. 38.76 ± 3.31, P = 0.001), and crus circumference in the case group also decreased compared with the control group in 5-7 days (fifth day: 26.35 ± 2.11 vs. 27.01 ± 2.19, P = 0.045; sixth day: 25.99 ± 2.31 vs. 26.88 ± 3.12, P = 0.032; seventh day: 25.56 ± 1.99 vs. 26.38 ± 2.89, P = 0.028). MVO and MVC in the case group increased compared with the control group 7 days after surgery (MVO: 15.01 ± 2.56 vs. 14.12 ± 2.56, P = 0.024; MVC: 10.18 ± 3.15 vs. 8.91 ± 2.78, P = 0.006). Significant difference in the incidence of thrombus and DVT were found between the case group and the control group 1-7 days after surgery (thrombus: 1.0% and 7.7%, P = 0.027; DVT: 7.6% and 18.4%, P = 0.032). Our result manifested that active ankle movement can relieve the swelling of patients after lower limb surgery, and improve the MVO and MVC of patients to prevent formation of DVT after lower limb surgery. Copyright © 2016 Elsevier Inc. All rights reserved.

Mature Driver Laws and State Predictors of Motor Vehicle Crash Fatality Rates Among the Elderly: A Cross-sectional Ecological Study.

PubMed

Bell, Teresa M; Qiao, Nan; Zarzaur, Ben L

2015-01-01

State-level data have indicated that motor vehicle crash (MVC) fatality rates among the elderly vary widely across states. To date, the majority of states have implemented mature driver laws, which often require more frequent license renewals, in-person renewal, and vision testing for drivers above a certain age. We sought to evaluate the impact of mature driver laws on states' MVC fatality rates among the elderly while examining other state-level determinants of MVC-related deaths. We performed a cross-sectional ecological study and modeled state MVC fatality rates for the population over age 65 as a function of state transportation policies and demographic, health system, population health, travel, and climate characteristics using a general linear model. Principal component analysis was used to reduce dimensionality of the data and overcome multicollinearity of state predictor variables. Higher average temperature, higher gas prices, and a greater number of emergency medicine physicians to population size were significantly associated with lower MVC fatality rates. Positive predictors of MVC fatality rates were percentage of population overweight or obese and percentage with college degree over the age of 65. Having any restriction on elderly drivers was associated with a higher MVC fatality rate and no individual component of mature driver laws (shortened renewal cycle, in-person renewal, and vision testing) was significantly associated with lower fatality MVC rates for adults over 65. Mature driver laws are not associated with lower state MVC fatality rates among the elderly.

Stroke-Related Changes in Neuromuscular Fatigue of the Hip Flexors and Functional Implications

PubMed Central

Hyngstrom, Allison S.; Onushko, Tanya; Heitz, Robert P.; Rutkowski, Anthony; Hunter, Sandra K.; Schmit, Brian D.

2014-01-01

Objective To compare stroke-related changes in hip-flexor neuromuscular fatigue of the paretic leg during a sustained, isometric sub-maximal contraction with the non-paretic leg and controls, and correlate fatigue with clinical measures of function. Design Hip torques were measured during a fatiguing hip-flexion contraction at 20% of the hip flexion maximal voluntary contraction (MVC) in the paretic and non-paretic legs of 13 people with chronic stroke and 10 age-matched controls. In addition, participants with stroke performed a fatiguing contraction of the paretic leg at the absolute torque equivalent to 20% MVC of the non-paretic leg and were tested for self-selected walking speed (Ten-Meter Walk Test) and balance (Berg). Results When matching the non-paretic target torque, the paretic hip flexors had a shorter time to task failure compared with the non-paretic leg and controls (p<0.05). Time to failure of the paretic leg was inversely correlated with the reduction of hip flexion MVC torque. Self-selected walking speed was correlated with declines in torque and steadiness. Berg-Balance scores were inversely correlated with the force fluctuation amplitude. Conclusions Fatigue and precision of contraction are correlated with walking function and balance post stroke. PMID:22157434

Matching of postcontraction perfusion to oxygen consumption across submaximal contraction intensities in exercising humans.

PubMed

Buck, Amanda K W; Elder, Christopher P; Donahue, Manus J; Damon, Bruce M

2015-08-01

Studying the magnitude and kinetics of blood flow, oxygen extraction, and oxygen consumption at exercise onset and during the recovery from exercise can lead to insights into both the normal control of metabolism and blood flow and the disturbances to these processes in metabolic and cardiovascular diseases. The purpose of this study was to examine the on- and off-kinetics for oxygen delivery, extraction, and consumption as functions of submaximal contraction intensity. Eight healthy subjects performed four 1-min isometric dorsiflexion contractions, with two at 20% MVC and two at 40% MVC. During one contraction at each intensity, relative perfusion changes were measured by using arterial spin labeling, and the deoxyhemoglobin percentage (%HHb) was estimated using the spin- and gradient-echo sequence and a previously published empirical calibration. For the whole group, the mean perfusion did not increase during contraction. The %HHb increased from ∼28 to 38% during contractions of each intensity, with kinetics well described by an exponential function and mean response times (MRTs) of 22.7 and 21.6 s for 20 and 40% MVC, respectively. Following contraction, perfusion increased ∼2.5-fold. The %HHb, oxygen consumption, and perfusion returned to precontraction levels with MRTs of 27.5, 46.4, and 50.0 s, respectively (20% MVC), and 29.2, 75.3, and 86.0 s, respectively (40% MVC). These data demonstrate in human subjects the varied recovery rates of perfusion and oxygen consumption, along with the similar rates of %HHb recovery, across these exercise intensities. Copyright © 2015 the American Physiological Society.

Precision grip control while walking down a step in children with unilateral cerebral palsy

PubMed Central

Flament, Benoît; Arnould, Carlyne; Thonnard, Jean-Louis; Bleyenheuft, Yannick

2018-01-01

Aim To compare grip force (GF) and load force (LF) coordination while walking down a step between children with unilateral cerebral palsy (UCP) and typically developing (TD) children. Methods Twenty-five children with UCP (age 9.3±1.7 y) and 25 TD controls (age 9.4±2.1 y) walked down a step while holding a grip-lift manipulandum. Dynamic and temporal variables were analyzed. The maximum voluntary contraction (MVC) was also assessed. Results The temporal course was perturbed mainly in the more affected hand of children with UCP when compared to TD children because the increases in GF and LF onset occurred in a reversed order. Compared with the TD controls, the children with UCP presented higher LF values on both hands and a higher GF on the less affected hand. In children with UCP, the GF to LF adaptation was adequate on the less affected hand but overestimated on the more affected hand. Furthermore, children with UCP presented a lower MVC in the more affected hand, leading to a higher percentage of MVC used during the task. Interpretation Our findings highlight an anticipatory control of precision grip during a stepping down task in children with UCP that is adequate for the less affected hand but altered for the more affected hand. PMID:29390012

Experimental teeth clenching in man.

PubMed

Christensen, L V

1989-01-01

The thesis develops an electromyographic (EMG) method to quantify maximum voluntary teeth clenching (MVC), studies the onset and endurance of jaw muscle fatigue and pain from MVC, and explores the prevention of the discomforts through pharmacological and physical means. MVC, or maximum voluntary static work efforts by the elevator muscles of the mandible, was quantified by continuous (integral) functions of variations in both time and recruitment/rate coding of motor units in the masseter muscle. Fatigue was felt in the masseter muscle after about 30 seconds of MVC; differential calculus suggested that the appearance and disappearance of fatigue was associated with primarily recruitment and decruitment of masseteric motor units, respectively. About 60 seconds of MVC elicited a mild pain in the masseter and temporalis muscles; about 120 seconds of MVC induced a moderate pain and complete exhaustion of the isometrically contracting muscles. Although pain releasing maximum static work efforts are stable variables they cannot predict the pain magnitude of brief and prolonged MVC, probably because of modulations (recruitment/decruitment/rate coding) of masseteric motor units. It is suggested that the modulations begin with the onset of fatigue, are practically complete with the onset of pain, and are absent or negligible with an experience of exhaustion. A single oral dose of 1000 mg of ibuprofen did not affect the onset, endurance, and magnitude of pain from MVC. By contrast, 30 minutes of cooling (ice) of the masseter muscle effectively prevented the onset of pain; it also increased the masseteric EMG, credibly because of modulations of myoelectrical signals and, possibly, increased MVC efforts in the absence of pain.

Comparison of injury mortality risk in motor vehicle crash versus other etiologies.

PubMed

Kilgo, Patrick D; Weaver, Ashley A; Barnard, Ryan T; Love, Timothy P; Stitzel, Joel D

2014-06-01

The mortality risk ratio (MRR), a measure of the proportion of people who died that sustained a given injury, is reported to be among the most powerful discriminators of mortality following trauma. The primary aim was to determine whether mechanistic differences exist and are quantifiable when comparing MRR-based injury severity across two broadly defined etiologies (motor vehicle crash (MVC) versus non-MVC) for the clarification of important injury types that have some room for improvement by emergency treatment and vehicle design. All International Classification of Diseases, 9th revision (ICD-9) coded injuries in the National Trauma Data Bank (NTDB) database were stratified into MVC and non-MVC groups and the MRR for each injury was computed within each group. Injuries were classified as 11 different types for MRR comparison between etiologies. Overall, MRRs for specific injuries were 10-18% lower for MVC compared to non-MVC etiologies. MVCs however produced much higher mean MRRs for crushing injuries (0.184 versus 0.072) and internal injuries to the thorax, abdomen, and pelvis (0.200 versus 0.169). Non-MVCs produced much higher MRRs for intracranial injuries (0.199 versus 0.250). Analysis of the top 95% most frequent MVC injuries revealed higher MVC MRR values for 78% of the injuries with MRR ratios indicating an average 50% increase in a given injury's MRR when MVC was the etiology. Addressing the large differences in MRR in between etiologies for identical injuries could provide a reduction in fatalities and may be important to patient triage and vehicle safety design. Copyright © 2014 Elsevier Ltd. All rights reserved.

Ethanol does not delay muscle recovery but decreases testosterone/cortisol ratio.

PubMed

Haugvad, Anders; Haugvad, Lars; Hamarsland, Håvard; Paulsen, Gøran

2014-11-01

This study investigated the effects of ethanol consumption on recovery from traditional resistance exercise in recreationally trained individuals. Nine recreationally trained volunteers (eight males and one female, 26 ± 4 yr, 81 ± 4 kg) conducted four resistance exercise sessions and consumed a low (0.6 (females) and 0.7 (males) g · kg(-1) body mass) or a high dose (1.2 or 1.4 g · kg(-1) body mass) of ethanol 1-2.5 h after exercise on two occasions. The first session was for familiarization with the tests and exercises and was performed without ethanol consumption. As a control trial, alcohol-free drinks were consumed after the exercise session. The sequence of trials, with low and high ethanol doses and alcohol-free drinks (control), was randomized. Maximal voluntary contractions (MVC) (knee extension), electrically stimulated contractions (knee extension), squat jumps, and hand grip strength were assessed 10-15 min and 12 and 24 h after the ethanol/placebo drinks. In addition to a baseline sample, blood was collected 1, 12, and 24 h after the ethanol/placebo drinks. The exercise session comprised 4 × 8 repetition maximum of squats, leg presses, and knee extensions. MVC were reduced by 13%-15% immediately after the exercise sessions (P < 0.01). MVC, electrically stimulated force, and squat jump performance were recovered 24 h after ethanol drinks. MVC was not fully recovered at 24 h in the control trial. Compared with those in the control, cortisol increased and the free testosterone/cortisol ratio were reduced after the high ethanol dose (P < 0.01). Neither a low nor a high dose of ethanol adversely affected recovery of muscle function after resistance exercise in recreationally strength-trained individuals. However, the increased cortisol levels and reduced testosterone/cortisol ratio after the high ethanol dose could translate into long-term negative effects.

Assessment of eccentric exercise-induced muscle damage of the elbow flexors by tensiomyography.

PubMed

Hunter, Angus M; Galloway, Stuart D R; Smith, Iain J; Tallent, Jamie; Ditroilo, Massimiliano; Fairweather, Malcolm M; Howatson, Glyn

2012-06-01

Exercise induced muscle damage (EIMD) impairs maximal torque production which can cause a decline in athletic performance and/or mobility. EIMD is commonly assessed by using maximal voluntary contraction (MVC), creatine kinase (CK) and muscle soreness. We propose as an additional technique, tensiomyography (TMG), recently introduced to measure mechanical and muscle contractile characteristics. The purpose of this study was to determine the validity of TMG in detecting changes in maximal torque following EIMD. Nineteen participants performed eccentric elbow flexions to achieve EIMD on the non- dominant arm and used the dominant elbow flexor as a control. TMG parameters, MVC and rate of torque development (RTD) were measured prior to EIMD and repeated for another six consecutive days. Creatine kinase, muscle soreness and limb girth were also measured during this period. Twenty four hours after inducing EIMD, MVC torque, RTD and TMG maximal displacement had significantly (p<0.01) declined by 37%, 44% and 31%, respectively. By day 6 MVC, RTD and TMG recovered to 12%, 24% and 17% of respective pre-EIMD values. In conclusion, as hypothesised TMG maximal displacement significantly followed other standard EIMD responses. This could therefore be useful in detecting muscle damage from impaired muscle function and its recovery following EIMD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Is the Sørensen test valid to assess muscle fatigue of the trunk extensor muscles?

PubMed

Demoulin, Christophe; Boyer, Mathieu; Duchateau, Jacques; Grosdent, Stéphanie; Jidovtseff, Boris; Crielaard, Jean-Michel; Vanderthommen, Marc

2016-01-01

Very few studies have quantified the degree of fatigue characterized by the decline in the maximal voluntary contraction (MVC) force of the trunk extensors induced by the widely used Sørensen test. Measure the degree of fatigue of the trunk extensor muscles induced by the Sørensen test. Eighty young healthy subjects were randomly divided into a control group (CG) and an experimental group (EG), each including 50% of the two genders. The EG performed an isometric MVC of the trunk extensors (pre-fatigue test) followed by the Sørensen test, the latter being immediately followed by another MVC (post-fatigue test). The CG performed only the pre- and post-fatigue tests without any exertion in between. The comparison of the pre- and post-fatigue tests revealed a significant (P< 0.05) decrease in MVC force normalized by body mass (-13%) in the EG, whereas a small increase occurred in the CG (+2.7%, P= 0.001). This study shows that the Sørensen test performed until failure in a young healthy population results in a reduced ability of the trunk extensor muscles to generate maximal force, and indicates that this test is valid for the assessment of fatigue in trunk extensor muscles.

Susceptibility to Exercise-Induced Muscle Damage: a Cluster Analysis with a Large Sample.

PubMed

Damas, F; Nosaka, K; Libardi, C A; Chen, T C; Ugrinowitsch, C

2016-07-01

We investigated the responses of indirect markers of exercise-induced muscle damage (EIMD) among a large number of young men (N=286) stratified in clusters based on the largest decrease in maximal voluntary contraction torque (MVC) after an unaccustomed maximal eccentric exercise bout of the elbow flexors. Changes in MVC, muscle soreness (SOR), creatine kinase (CK) activity, range of motion (ROM) and upper-arm circumference (CIR) before and for several days after exercise were compared between 3 clusters established based on MVC decrease (low, moderate, and high responders; LR, MR and HR). Participants were allocated to LR (n=61), MR (n=152) and HR (n=73) clusters, which depicted significantly different cluster centers of 82%, 61% and 42% of baseline MVC, respectively. Once stratified by MVC decrease, all muscle damage markers were significantly different between clusters following the same pattern: small changes for LR, larger changes for MR, and the largest changes for HR. Stratification of individuals based on the magnitude of MVC decrease post-exercise greatly increases the precision in estimating changes in EIMD by proxy markers such as SOR, CK activity, ROM and CIR. This indicates that the most commonly used markers are valid and MVC orchestrates their responses, consolidating the role of MVC as the best EIMD indirect marker. © Georg Thieme Verlag KG Stuttgart · New York.

Effects of training programs based on ipsilateral voluntary and stimulated contractions on muscle strength and monopedal postural control of the contralateral limb.

PubMed

Kadri, Mohamed Abdelhafid; Noé, Frederic; Nouar, Merbouha Boulahbel; Paillard, Thierry

2017-09-01

To compare the effects of unilateral strength training by stimulated and voluntary contractions on muscle strength and monopedal postural control of the contralateral limb. 36 non-active healthy male subjects were recruited and split randomly into three groups. Two groups of 12 subjects took part in a strength-training program (3 sessions a week over 8 weeks) comprising 43 contractions of the quadriceps femoris of the ipsilateral limb (at 20% of the MVC). One group carried out voluntary contractions exclusively (VOL group), while the other group benefited exclusively from electro-induced contractions (NMES group). The other 12 subjects formed the control (CON) group. Assessments of MVC and monopedal postural control in static and dynamic postural tasks were performed with the ipsilateral (ISPI) and contralateral (CONTRA) limbs before (PRE) and after (POST) completion of the training program. After the training program, the MVC of the IPSI and CONTRA limbs increased similarly for both experimental groups (VOL and NMES). There were no significant improvements of monopedal postural control for the IPSI or CONTRA limbs in either the VOL or NMES experimental group. No change was observed for the CON group over the protocol period. The purposed training program with NMES vs VOL contractions induced strength gains but did not permit any improvement of contralateral monopedal postural control in healthy young subjects. This has potential for therapeutic application and allows clinicians to focus their training programs on dynamic and poly-articular exercises to improve the postural control in young subjects.

Protection of rhesus macaques from vaginal infection by vaginally delivered maraviroc, an inhibitor of HIV-1 entry via the CCR5 co-receptor.

PubMed

Veazey, Ronald S; Ketas, Thomas J; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C; Klasse, P J; Moore, John P

2010-09-01

An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small-molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected individuals, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide with use of a stringent model that involves challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/mL). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (half life of approximately 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated postinfection viremia. These findings validate MVC development as a vaginal microbicide for women and should guide clinical programs.

Protection of rhesus macaques from vaginal infection by vaginally delivered Maraviroc, an inhibitor of HIV-1 entry via the CCR5 co-receptor

PubMed Central

Veazey, Ronald S.; Ketas, Thomas J.; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C.; Klasse, P.J.; Moore, John P.

2010-01-01

An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected people, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide, using a stringent model involving challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/ml). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (T1/2 ~ 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated post-infection viremia. These findings validate MVC development as a vaginal microbicide for women, and should guide clinical programs. PMID:20629537

Reliability of surface electromyography activity of gluteal and hamstring muscles during sub-maximal and maximal voluntary isometric contractions.

PubMed

Bussey, Melanie D; Aldabe, Daniela; Adhia, Divya; Mani, Ramakrishnan

2018-04-01

Normalizing to a reference signal is essential when analysing and comparing electromyography signals across or within individuals. However, studies have shown that MVC testing may not be as reliable in persons with acute and chronic pain. The purpose of this study was to compare the test-retest reliability of the muscle activity in the biceps femoris and gluteus maximus between a novel sub-MVC and standard MVC protocols. This study utilized a single individual repeated measures design with 12 participants performing multiple trials of both the sub-MVC and MVC tasks on two separate days. The participant position in the prone leg raise task was standardised with an ultrasonic sensor to improve task precession between trials/days. Day-to-day and trial-to-trial reliability of the maximal muscle activity was examined using ICC and SEM. Day-to-day and trial-to-trial reliability of the EMG activity in the BF and GM were high (0.70-0.89) to very high (≥0.90) for both test procedures. %SEM was <5-10% for both tests on a given day but higher in the day-to-day comparisons. The lower amplitude of the sub-MVC is a likely contributor to increased %SEM (8-13%) in the day-to-day comparison. The findings show that the sub-MVC modified prone double leg raise results in GM and BF EMG measures similar in reliability and precision to the standard MVC tasks. Therefore, the modified prone double leg raise may be a useful substitute for traditional MVC testing for normalizing EMG signals of the BF and GM. Copyright © 2017 Elsevier Ltd. All rights reserved.

Floral Scent Mimicry and Vector-Pathogen Associations in a Pseudoflower-Inducing Plant Pathogen System

PubMed Central

McArt, Scott H.; Miles, Timothy D.; Rodriguez-Saona, Cesar; Schilder, Annemiek; Adler, Lynn S.; Grieshop, Matthew J.

2016-01-01

Several fungal plant pathogens induce ‘pseudoflowers’ on their hosts to facilitate insect-mediated transmission of gametes and spores. When spores must be transmitted to host flowers to complete the fungal life cycle, we predict that pseudoflowers should evolve traits that mimic flowers and attract the most effective vectors in the flower-visiting community. We quantified insect visitation to flowers, healthy leaves and leaves infected with Monilinia vaccinii-corymbosi (Mvc), the causative agent of mummy berry disease of blueberry. We developed a nested PCR assay for detecting Mvc spores on bees, flies and other potential insect vectors. We also collected volatiles from blueberry flowers, healthy leaves and leaves infected with Mvc, and experimentally manipulated specific pathogen-induced volatiles to assess attractiveness to potential vectors. Bees and flies accounted for the majority of contacts with flowers, leaves infected with Mvc and healthy leaves. Flowers were contacted most often, while there was no difference between bee or fly contacts with healthy and infected leaves. While bees contacted flowers more often than flies, flies contacted infected leaves more often than bees. Bees were more likely to have Mvc spores on their bodies than flies, suggesting that bees may be more effective vectors than flies for transmitting Mvc spores to flowers. Leaves infected with Mvc had volatile profiles distinct from healthy leaves but similar to flowers. Two volatiles produced by flowers and infected leaves, cinnamyl alcohol and cinnamic aldehyde, were attractive to bees, while no volatiles manipulated were attractive to flies or any other insects. These results suggest that Mvc infection of leaves induces mimicry of floral volatiles, and that transmission occurs primarily via bees, which had the highest likelihood of carrying Mvc spores and visited flowers most frequently. PMID:27851747

Floral Scent Mimicry and Vector-Pathogen Associations in a Pseudoflower-Inducing Plant Pathogen System.

PubMed

McArt, Scott H; Miles, Timothy D; Rodriguez-Saona, Cesar; Schilder, Annemiek; Adler, Lynn S; Grieshop, Matthew J

2016-01-01

Several fungal plant pathogens induce 'pseudoflowers' on their hosts to facilitate insect-mediated transmission of gametes and spores. When spores must be transmitted to host flowers to complete the fungal life cycle, we predict that pseudoflowers should evolve traits that mimic flowers and attract the most effective vectors in the flower-visiting community. We quantified insect visitation to flowers, healthy leaves and leaves infected with Monilinia vaccinii-corymbosi (Mvc), the causative agent of mummy berry disease of blueberry. We developed a nested PCR assay for detecting Mvc spores on bees, flies and other potential insect vectors. We also collected volatiles from blueberry flowers, healthy leaves and leaves infected with Mvc, and experimentally manipulated specific pathogen-induced volatiles to assess attractiveness to potential vectors. Bees and flies accounted for the majority of contacts with flowers, leaves infected with Mvc and healthy leaves. Flowers were contacted most often, while there was no difference between bee or fly contacts with healthy and infected leaves. While bees contacted flowers more often than flies, flies contacted infected leaves more often than bees. Bees were more likely to have Mvc spores on their bodies than flies, suggesting that bees may be more effective vectors than flies for transmitting Mvc spores to flowers. Leaves infected with Mvc had volatile profiles distinct from healthy leaves but similar to flowers. Two volatiles produced by flowers and infected leaves, cinnamyl alcohol and cinnamic aldehyde, were attractive to bees, while no volatiles manipulated were attractive to flies or any other insects. These results suggest that Mvc infection of leaves induces mimicry of floral volatiles, and that transmission occurs primarily via bees, which had the highest likelihood of carrying Mvc spores and visited flowers most frequently.

Active Ankle Movements Prevent Formation of Lower-Extremity Deep Venous Thrombosis After Orthopedic Surgery

PubMed Central

Li, Ye; Guan, Xiang-Hong; Wang, Rui; Li, Bin; Ning, Bo; Su, Wei; Sun, Tao; Li, Hong-Yan

2016-01-01

Background The aim of this study was to assess the preventive value of active ankle movements in the formation of lower-extremity deep venous thrombosis (DVT), attempting to develop a new method for rehabilitation nursing after orthopedic surgery. Material/Methods We randomly assigned 193 patients undergoing orthopedic surgery in the lower limbs into a case group (n=96) and a control group (n=97). The control group received routine nursing while the case group performed active ankle movements in addition to receiving routine nursing. Maximum venous outflow (MVO), maximum venous capacity (MVC), and blood rheology were measured and the incidence of DVT was recorded. Results On the 11th and 14th days of the experiment, the case group had significantly higher MVO and MVC than the control group (all P<0.05). The whole-blood viscosity at high shear rate and the plasma viscosity were significantly lower in the case group than in the control group on the 14th day (both P<0.05). During the experiment, a significantly higher overall DVT incidence was recorded in the control group (8 with asymptomatic DVT) compared with the case group (1 with asymptomatic DVT) (P=0.034). During follow-up, the case group presented a significantly lower DVT incidence (1 with symptomatic DVT and 4 with asymptomatic DVT) than in the control group (5 with symptomatic DVT and 10 with asymptomatic DVT) (P=0.031). Conclusions Through increasing MVO and MVC and reducing blood rheology, active ankle movements may prevent the formation of lower-extremity DVT after orthopedic surgery. PMID:27600467

Strength Gains by Motor Imagery with Different Ratios of Physical to Mental Practice

PubMed Central

Reiser, Mathias; Büsch, Dirk; Munzert, Jörn

2011-01-01

The purpose of this training study was to determine the magnitude of strength gains following a high-intensity resistance training (i.e., improvement of neuromuscular coordination) that can be achieved by imagery of the respective muscle contraction imagined maximal isometric contraction (IMC training). Prior to the experimental intervention, subjects completed a 4-week standardized strength training program. 3 groups with different combinations of real maximum voluntary contraction (MVC) and mental (IMC) strength training (M75, M50, M25; numbers indicate percentages of mental trials) were compared to a MVC-only training group (M0) and a control condition without strength training (CO). Training sessions (altogether 12) consisted of four sets of two maximal 5-s isometric contractions with 10 s rest between sets of either MVC or IMC training. Task-specific effects of IMC training were tested in four strength exercises commonly used in practical settings (bench pressing, leg pressing, triceps extension, and calf raising). Maximum isometric voluntary contraction force (MVC) was measured before and after the experimental training intervention and again 1 week after cessation of the program. IMC groups (M25, M50, M75) showed slightly smaller increases in MVC (3.0% to 4.2%) than M0 (5.1%), but significantly stronger improvements than CO (−0.2%). Compared to further strength gains in M0 after 1 week (9.4% altogether), IMC groups showed no “delayed” improvement, but the attained training effects remained stable. It is concluded that high-intensity strength training sessions can be partly replaced by IMC training sessions without any considerable reduction of strength gains. PMID:21897826

Differences in the motor unit firing rates and amplitudes in relation to recruitment thresholds during submaximal contractions of the first dorsal interosseous between chronically resistance trained and physically active men.

PubMed

Sterczala, Adam J; Miller, Jonathan D; Trevino, Michael A; Dimmick, Hannah L; Herda, Trent J

2018-02-26

Previous investigations report no changes in motor unit (MU) firing rates during submaximal contractions following resistance training. These investigations did not account for MU recruitment or examine firing rates as a function of recruitment threshold (REC).Therefore, MU recruitment and firing rates in chronically resistance trained (RT) and physically active controls (CON) were examined. Surface electromyography signals were collected from the first dorsal interosseous (FDI) during isometric muscle actions at 40% and 70% maximal voluntary contraction (MVC). For each MU, force at REC, mean firing rate (MFR) during the steady force, and MU action potential amplitude (MUAP_AMP) were analyzed. For each individual and contraction, the MFRs were linearly regressed against REC, whereas, exponential models were applied to the MFR vs. MUAP_AMP and MUAP_AMP vs. REC relationships with the y-intercepts and slopes (linear) and A and B terms (exponential) calculated. For the 40% MVC, the RT group had less negative slopes (p=0.001) and lower y-intercepts (p=0.006) of the MFR vs. REC relationships and lower B terms (p=0.011) of the MUAP_AMP vs. REC relationships. There were no differences in either relationship between groups for the 70% MVC. During the 40% MVC, the RT had a smaller range of MFRs and MUAP_AMPS in comparison to the CON, likely due to reduced MU recruitment. The RT had lower MFRs and recruitment during the 40% MVC that may indicate a leftward shift in the force-frequency relationship, and thus require less excitation to the motoneuron pool to match the same relative force.

Relationship between strength qualities and short track speed skating performance in young athletes.

PubMed

Felser, S; Behrens, M; Fischer, S; Heise, S; Bäumler, M; Salomon, R; Bruhn, S

2016-02-01

This study analyzed the relationships between isometric as well as concentric maximum voluntary contraction (MVC) strength of the leg muscles and the times as well as speeds over different distances in 17 young short track speed skaters. Isometric as well as concentric single-joint MVC strength and multi-joint MVC strength in a stable (without skates) and unstable (with skates) condition were tested. Furthermore, time during maximum skating performances on ice was measured. Results indicate that maximum torques during eversion and dorsal flexion have a significant influence on skating speed. Concentric MVC strength of the knee extensors was higher correlated with times as well as speeds over the different distances than isometric MVC strength. Multi-joint MVC testing revealed that the force loss between measurements without and with skates amounts to 25%, while biceps femoris and soleus showed decreased muscle activity and peroneus longus, tibialis anterior, as well as rectus femoris exhibited increased muscle activity. The results of this study depict evidence that the skating times and speeds are primarily influenced by concentric MVC strength of the leg extensors. To be able to transfer the strength onto ice in an optimal way, it is necessary to stabilize the knee and ankle joints. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Neural adaptations after short-term wingate-based high-intensity interval training

PubMed Central

Vera-Ibañez, Antonio; Colomer-Poveda, David; Romero-Arenas, Salvador; Viñuela-García, Manuel; Márquez, Gonzalo

2017-01-01

Objectives: This study examined the neural adaptations associated with a low-volume Wingate-based High Intensity Interval Training (HIIT). Methods: Fourteen recreationally trained males were divided into an experimental (HIIT) and a control group to determine whether a short-term (4 weeks) Wingate-based HIIT program could alter the Hoffmann (H-) reflex, volitional (V-) wave and maximum voluntary contraction (MVC) of the plantar-flexor muscles, and the peak power achieved during a Wingate test. Results: Absolute and relative peak power increased in the HIIT group (ABS_Ppeak: +14.7%, P=0.001; and REL_Ppeak: +15.0%, P=0.001), but not in the control group (ABS_Ppeak: P=0.466; and REL_Ppeak: P=0.493). However, no significant changes were found in the MVC (P>0.05 for both groups). There was a significant increase in H-reflex size after HIIT (+24.5%, P=0.004), while it remained unchanged in the control group (P=0.134). No significant changes were observed either in the V-wave or in the Vwave/Mwave ratio (P>0.05 for both groups). Conclusion: The Wingate-based training led to an increased peak power together with a higher spinal excitability. However, no changes were found either in the volitional wave or in the MVC, indicating a lack of adaptation in the central motor drive. PMID:29199186

Pharmacodynamic correlations using fresh and cryopreserved tissue following use of vaginal rings containing dapivirine and/or maraviroc in a randomized, placebo controlled trial

PubMed Central

Dezzutti, Charlene S.; Richardson-Harman, Nicola; Rohan, Lisa C.; Marzinke, Mark A.; Hoesley, Craig J.; Panther, Lori; Johnson, Sherri; Nuttall, Jeremy P.; Nel, Annalene; Chen, Beatrice A.

2016-01-01

Abstract Background: The ex vivo challenge assay is a bio-indicator of drug efficacy and was utilized in this randomized, placebo controlled trial as one of the exploratory endpoints. Fresh and cryopreserved tissues were evaluated for human immunodeficiency virus (HIV) infection and pharmacokinetic (PK)/pharmacodynamic (PD) relationships. Methods: HIV-negative women used vaginal rings containing 25 mg dapivirine (DPV)/100 mg maraviroc (MVC) (n = 12), DPV only (n = 12), MVC only (n = 12), or placebo (n = 12) for 28 days. Blood plasma, cervicovaginal fluid (CVF), and cervical biopsies were collected for drug quantification and the ex vivo challenge assay; half (fresh) were exposed immediately to HIV while the other half were cryopreserved, thawed, then exposed to HIV. HIV replication was monitored by p24 enzyme-linked immunosorbent assay from culture supernatant. Data were log-transformed and analyzed by linear least squared regression, nonlinear Emax dose–response model and Satterthwaite t test. Results: HIV replication was greater in fresh compared to cryopreserved tissue (P = 0.04). DPV was detected in all compartments, while MVC was consistently detected only in CVF. Significant negative correlations between p24 and DPV levels were observed in fresh cervical tissue (P = 0.01) and CVF (P = 0.03), but not plasma. CVF MVC levels showed a significant negative correlation with p24 levels (P = 0.03); drug levels in plasma and tissue were not correlated with HIV suppression. p24 levels from cryopreserved tissue did not correlate to either drug from any compartment. Conclusion: Fresh tissue replicated HIV to greater levels and defined PK/PD relationships while cryopreserved tissue did not. The ex vivo challenge assay using fresh tissue could prioritize drugs being considered for HIV prevention. PMID:27428211

Pharmacodynamic correlations using fresh and cryopreserved tissue following use of vaginal rings containing dapivirine and/or maraviroc in a randomized, placebo controlled trial.

PubMed

Dezzutti, Charlene S; Richardson-Harman, Nicola; Rohan, Lisa C; Marzinke, Mark A; Hoesley, Craig J; Panther, Lori; Johnson, Sherri; Nuttall, Jeremy P; Nel, Annalene; Chen, Beatrice A

2016-07-01

The ex vivo challenge assay is a bio-indicator of drug efficacy and was utilized in this randomized, placebo controlled trial as one of the exploratory endpoints. Fresh and cryopreserved tissues were evaluated for human immunodeficiency virus (HIV) infection and pharmacokinetic (PK)/pharmacodynamic (PD) relationships. HIV-negative women used vaginal rings containing 25 mg dapivirine (DPV)/100 mg maraviroc (MVC) (n = 12), DPV only (n = 12), MVC only (n = 12), or placebo (n = 12) for 28 days. Blood plasma, cervicovaginal fluid (CVF), and cervical biopsies were collected for drug quantification and the ex vivo challenge assay; half (fresh) were exposed immediately to HIV while the other half were cryopreserved, thawed, then exposed to HIV. HIV replication was monitored by p24 enzyme-linked immunosorbent assay from culture supernatant. Data were log-transformed and analyzed by linear least squared regression, nonlinear Emax dose-response model and Satterthwaite t test. HIV replication was greater in fresh compared to cryopreserved tissue (P = 0.04). DPV was detected in all compartments, while MVC was consistently detected only in CVF. Significant negative correlations between p24 and DPV levels were observed in fresh cervical tissue (P = 0.01) and CVF (P = 0.03), but not plasma. CVF MVC levels showed a significant negative correlation with p24 levels (P = 0.03); drug levels in plasma and tissue were not correlated with HIV suppression. p24 levels from cryopreserved tissue did not correlate to either drug from any compartment. Fresh tissue replicated HIV to greater levels and defined PK/PD relationships while cryopreserved tissue did not. The ex vivo challenge assay using fresh tissue could prioritize drugs being considered for HIV prevention.

Impact of Connecticut's graduated driver licensing system on teenage motor vehicle crash rates.

PubMed

Rogers, Steven C; Bentley, George C; Campbell, Brendan; Borrup, Kevin; Saleheen, Hassan; Wang, Zhu; Lapidus, Garry

2011-11-01

In response to high rates of teen motor vehicle crashes (MVCs) many states have enacted graduated driver licensing (GDL) systems. GDL delays full licensure and allows beginners to obtain experience under lower risk conditions. The purpose of this study is to evaluate the impact over the past 10 years to determine its effect on teen MVCs. Connecticut MVC data from 1999 to 2008 were analyzed. Percent change (1999 vs. 2008) in MVC rates per 10,000 registered drivers was calculated by age, gender, during the night restriction (11:00 pm and 5:00 am), and MVCs with passengers. Linear regression analysis estimated the decrease of MVC rates each year. The MVC rate decreased by 40% for 16-year-old and 30% for 17-year-old drivers. In comparison, rates among 18-year-old, 19-year-old, 25- to 29-year-old, and 30- to 59-year-old drivers were reduced by 16%, 7%, 8%, and 11%, respectively. The MVC rate for 20- to 24-year-old drivers increased by 1%. During nighttime restricted driving times, MVC rates decreased by 54% among 16-year-old and 49% among 17-year-old drivers. The MVC rate with passengers decreased by 65% for 16-year-old and 53% for 17-year-old drivers. In comparison, rates of nighttime and with passenger MVCs among older drivers were significantly less. Implementation of Connecticut's GDL system has resulted in significant reductions in MVC rates among novice drivers. This analysis provides a method for other states to examine the impact of their GDL system.

Driving with pets and motor vehicle collision involvement among older drivers: a prospective population-based study

PubMed Central

Huisingh, Carrie; Levitan, Emily B.; Irvin, Marguerite R.; Owsley, Cynthia; McGwin, Gerald

2016-01-01

Objective Distracted driving is a major cause of motor vehicle collision (MVC) involvement. Pets have been identified as potential distraction to drivers, particularly in the front. This type of distraction could be worse for those with impairment in the cognitive aspects of visual processing. The purpose of this study is to evaluate the association between driving with pets and rates of motor vehicle collision involvementin a cohort of older drivers. Methods A three-year prospective was conducted in a population-based sample of 2000 licensed drivers aged 70 years and older. At the baseline visit, a trained interviewer asked participants about pet ownership, whether they drive with pets, how frequently, and where the pet sits in the vehicle. Motor vehicle collision (MVC) involvement during the three-year study period was obtained from the Alabama Department of Public Safety. At-fault status was determined by the police officer who arrived on the scene. Participants were followed until the earliest of death, driving cessation, or end of the study period. Poisson regression was used to calculate crude and adjusted rate ratios (RR) examining the association between pet ownership, presence of a pet in a vehicle, frequency of driving with a pet, and location of the pet inside with vehicle with any and at-fault MVC involvement. We examined whether the associations differed by higher order visual processing impairment status, as measured by Useful Field Of View, Trails B, and Motor-free Visual Perception Test. Results Rates of crash involvement were similar for older adults who have ever driven with a pet compared to those who never drove with their pet (RR=1.15, 95% CI 0.76-1.75). Drivers who reported always or sometimes driving with their pet had higherMVC rates compared topet owners who never drive with a pet, but this association was not statistically significant (RR=1.39, 95% CI 0.86-2.24). In terms of location, those reporting having a pet frequently ride in the front of the vehicle had similar rates of MVC involvement compared to those who did not drive with a pet in the front. A similar pattern of results was observed for at-fault MVCs. This association was not modified by visual processing impairment status. Conclusion The current study demonstrates a positive but non-significant association between frequently driving with pets and MVC involvement. More research is needed, particularly on restraint use and whether the pet was in the car at the time of the crash, to help characterize the public safety benefit of regulations on driving with pets. PMID:26774042

Driving with pets and motor vehicle collision involvement among older drivers: A prospective population-based study.

PubMed

Huisingh, Carrie; Levitan, Emily B; Irvin, Marguerite R; Owsley, Cynthia; McGwin, Gerald

2016-03-01

Distracted driving is a major cause of motor vehicle collision (MVC) involvement. Pets have been identified as potential distraction to drivers, particularly in the front. This type of distraction could be worse for those with impairment in the cognitive aspects of visual processing. The purpose of this study is to evaluate the association between driving with pets and rates of motor vehicle collision involvement in a cohort of older drivers. A three-year prospective study was conducted in a population-based sample of 2000 licensed drivers aged 70 years and older. At the baseline visit, a trained interviewer asked participants about pet ownership, whether they drive with pets, how frequently, and where the pet sits in the vehicle. Motor vehicle collision (MVC) involvement during the three-year study period was obtained from the Alabama Department of Public Safety. At-fault status was determined by the police officer who arrived on the scene. Participants were followed until the earliest of death, driving cessation, or end of the study period. Poisson regression was used to calculate crude and adjusted rate ratios (RR) examining the association between pet ownership, presence of a pet in a vehicle, frequency of driving with a pet, and location of the pet inside with vehicle with any and at-fault MVC involvement. We examined whether the associations differed by higher order visual processing impairment status, as measured by Useful Field of View, Trails B, and Motor-free Visual Perception Test. Rates of crash involvement were similar for older adults who have ever driven with a pet compared to those who never drove with their pet (RR=1.15, 95% CI 0.76-1.75). Drivers who reported always or sometimes driving with their pet had higher MVC rates compared to pet owners who never drive with a pet, but this association was not statistically significant (RR=1.39, 95% CI 0.86-2.24). In terms of location, those reporting having a pet frequently ride in the front of the vehicle had similar rates of MVC involvement compared to those who did not drive with a pet in the front. A similar pattern of results was observed for at-fault MVCs. This association was not modified by visual processing impairment status. The current study demonstrates a positive but non-significant association between frequently driving with pets and MVC involvement. More research is needed, particularly on restraint use and whether the pet was in the car at the time of the crash, to help characterize the public safety benefit of regulations on driving with pets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Surgical model-view-controller simulation software framework for local and collaborative applications

PubMed Central

Sankaranarayanan, Ganesh; Halic, Tansel; Arikatla, Venkata Sreekanth; Lu, Zhonghua; De, Suvranu

2010-01-01

Purpose Surgical simulations require haptic interactions and collaboration in a shared virtual environment. A software framework for decoupled surgical simulation based on a multi-controller and multi-viewer model-view-controller (MVC) pattern was developed and tested. Methods A software framework for multimodal virtual environments was designed, supporting both visual interactions and haptic feedback while providing developers with an integration tool for heterogeneous architectures maintaining high performance, simplicity of implementation, and straightforward extension. The framework uses decoupled simulation with updates of over 1,000 Hz for haptics and accommodates networked simulation with delays of over 1,000 ms without performance penalty. Results The simulation software framework was implemented and was used to support the design of virtual reality-based surgery simulation systems. The framework supports the high level of complexity of such applications and the fast response required for interaction with haptics. The efficacy of the framework was tested by implementation of a minimally invasive surgery simulator. Conclusion A decoupled simulation approach can be implemented as a framework to handle simultaneous processes of the system at the various frame rates each process requires. The framework was successfully used to develop collaborative virtual environments (VEs) involving geographically distributed users connected through a network, with the results comparable to VEs for local users. PMID:20714933

Surgical model-view-controller simulation software framework for local and collaborative applications.

PubMed

Maciel, Anderson; Sankaranarayanan, Ganesh; Halic, Tansel; Arikatla, Venkata Sreekanth; Lu, Zhonghua; De, Suvranu

2011-07-01

Surgical simulations require haptic interactions and collaboration in a shared virtual environment. A software framework for decoupled surgical simulation based on a multi-controller and multi-viewer model-view-controller (MVC) pattern was developed and tested. A software framework for multimodal virtual environments was designed, supporting both visual interactions and haptic feedback while providing developers with an integration tool for heterogeneous architectures maintaining high performance, simplicity of implementation, and straightforward extension. The framework uses decoupled simulation with updates of over 1,000 Hz for haptics and accommodates networked simulation with delays of over 1,000 ms without performance penalty. The simulation software framework was implemented and was used to support the design of virtual reality-based surgery simulation systems. The framework supports the high level of complexity of such applications and the fast response required for interaction with haptics. The efficacy of the framework was tested by implementation of a minimally invasive surgery simulator. A decoupled simulation approach can be implemented as a framework to handle simultaneous processes of the system at the various frame rates each process requires. The framework was successfully used to develop collaborative virtual environments (VEs) involving geographically distributed users connected through a network, with the results comparable to VEs for local users.

Relationship of Aortic Wall Distensibility to Mitral and Aortic Valve Calcification: The Multi-Ethnic Study of Atherosclerosis.

PubMed

Cohoon, Kevin P; Criqui, Michael H; Budoff, Matthew J; Lima, Joao A; Blaha, Michael J; Decker, Paul A; Durazo, Ramon; Liu, Kiang; Kramer, Holly

2018-05-01

Data are limited on whether valvular calcification is associated with aortic wall stiffness. We tested whether aortic valve calcification (AVC) and/or mitral valve calcification (MVC) is inversely associated with aortic distensibility (AD). Cross-sectional study conducted in a subset of the Multi-Ethnic Study of Atherosclerosis (MESA) included 3676 MESA participants aged 44 to 84 years with AD measured with magnetic resonance imaging and with AVC and MVC measured with noncontrast cardiac computed tomography scans. Both AVC and MVC were divided into 3 categories: zero, < median values (low), and ≥ median values (high) for patients with nonzero values. Overall, 88% (n = 3256) and 92% (n = 3365) of participants had zero AVC and MVC, while 6% (n = 211) and 4% (n = 156) had low, and 6% (n = 209) and 4% (n = 155) had high values of AVC and MVC, respectively. The AVC was independently associated with AD after adjusting for age, gender, and ethnicity ( P = .035). No association was noted between AVC groups and AD after adjustment for all covariates or MVC groups and AD in any model.

[CLINICAL STUDIES ON EFFECT OF ARTHROSCOPIC INTERCONDYLAR FOSSA ANGIOPLASTY ON ABILITY OF NEUROMUSCULAR CONTROL IN ELDERLY PATIENTS WITH KNEE OSTEOARTHRITIS].

PubMed

Huang, Jingmin; Wang, Haijiao; Wu, Jiang; Li, Dongchao; Li, Yuhong

2015-08-01

To study the effect of arthroscopic intercondylar fossa angioplasty on the ability of neuromuscular control of the knee joint in elderly patients with knee osteoarthritis (KOA). Between June 2012 and March 2013, 20 elderly patients with KOA and in accordance with inclusion and exclusion criteria underwent arthroscopic intercondylar fossa angioplasty (operation group), and 20 healthy elderly people served as control group. There was no significant difference in age, height, weight, and body mass index between 2 groups (P > 0.05). The proprioception capability (using passive regeneration test at measurement angles of 15, 30, and 60°) and quadriceps mobilization [including maximum voluntary contraction (MVC), central activation ratio (CAR), and activation deficit (AD)] were measured to avaluate the neuromuscular control of the knee; the Lysholm score was used to evaluate knee function. The above indexes were measured to assess the knee neuromuscular control and recovery of joint function in patients of operation group at 3, 6, and 9 months after operation. Compared with the control group, MVC, CAR, and Lysholm scores were significantly decreased, and the AD and passive knee angle difference were significantly increased in operation group (P < 0.05) before operation. With the time after operation, the Lysholm score, CAR, and MVC increased gradually, and the AD and the passive knee angle difference decreased gradually. There was no significant difference in the indexes between 2 groups at 9 months after operation (P > 0.05). Arthroscopic intercondylar fossa angioplasty can relieve ACL pressure, abrasion, and impact, which will recover the ability of neuromuscular control, increase proprioception and quadriceps mobilization capacity, and improve the joint function.

Ensemble of shape functions and support vector machines for the estimation of discrete arm muscle activation from external biceps 3D point clouds.

PubMed

Abraham, Leandro; Bromberg, Facundo; Forradellas, Raymundo

2018-04-01

Muscle activation level is currently being captured using impractical and expensive devices which make their use in telemedicine settings extremely difficult. To address this issue, a prototype is presented of a non-invasive, easy-to-install system for the estimation of a discrete level of muscle activation of the biceps muscle from 3D point clouds captured with RGB-D cameras. A methodology is proposed that uses the ensemble of shape functions point cloud descriptor for the geometric characterization of 3D point clouds, together with support vector machines to learn a classifier that, based on this geometric characterization for some points of view of the biceps, provides a model for the estimation of muscle activation for all neighboring points of view. This results in a classifier that is robust to small perturbations in the point of view of the capturing device, greatly simplifying the installation process for end-users. In the discrimination of five levels of effort with values up to the maximum voluntary contraction (MVC) of the biceps muscle (3800 g), the best variant of the proposed methodology achieved mean absolute errors of about 9.21% MVC - an acceptable performance for telemedicine settings where the electric measurement of muscle activation is impractical. The results prove that the correlations between the external geometry of the arm and biceps muscle activation are strong enough to consider computer vision and supervised learning an alternative with great potential for practical applications in tele-physiotherapy. Copyright © 2018 Elsevier Ltd. All rights reserved.

Strength training, but not endurance training, reduces motor unit discharge rate variability.

PubMed

Vila-Chã, Carolina; Falla, Deborah

2016-02-01

This study evaluates and compares the effects of strength and endurance training on motor unit discharge rate variability and force steadiness of knee extensor muscles. Thirty sedentary healthy men (age, 26.0±3.8yrs) were randomly assigned to strength training, endurance training or a control group. Conventional endurance and strength training was performed 3days per week, over a period of 6weeks. Maximum voluntary contraction (MVC), time to task failure (at 30% MVC), coefficient of variation (CoV) of force and of the discharges rates of motor units from the vastus medialis obliquus and vastus lateralis were determined as subjects performed 20% and 30% MVC knee extension contractions before and after training. CoV of motor unit discharges rates was significantly reduced for both muscles following strength training (P<0.001), but did not change in the endurance (P=0.875) or control group (P=0.995). CoV of force was reduced after the strength training intervention only (P<0.01). Strength training, but not endurance training, reduces motor unit discharge rate variability and enhances force steadiness of the knee extensors. These results provide new insights into the neuromuscular adaptations that occur with different training methods. Copyright © 2015 Elsevier Ltd. All rights reserved.

Differential sympathetic neural control of oxygenation in resting and exercising human skeletal muscle.

PubMed Central

Hansen, J; Thomas, G D; Harris, S A; Parsons, W J; Victor, R G

1996-01-01

Metabolic products of skeletal muscle contraction activate metaboreceptor muscle afferents that reflexively increase sympathetic nerve activity (SNA) targeted to both resting and exercising skeletal muscle. To determine effects of the increased sympathetic vasoconstrictor drive on muscle oxygenation, we measured changes in tissue oxygen stores and mitochondrial cytochrome a,a3 redox state in rhythmically contracting human forearm muscles with near infrared spectroscopy while simultaneously measuring muscle SNA with microelectrodes. The major new finding is that the ability of reflex-sympathetic activation to decrease muscle oxygenation is abolished when the muscle is exercised at an intensity > 10% of maximal voluntary contraction (MVC). During high intensity handgrip, (45% MVC), contraction-induced decreases in muscle oxygenation remained stable despite progressive metaboreceptor-mediated reflex increases in SNA. During mild to moderate handgrips (20-33% MVC) that do not evoke reflex-sympathetic activation, experimentally induced increases in muscle SNA had no effect on oxygenation in exercising muscles but produced robust decreases in oxygenation in resting muscles. The latter decreases were evident even during maximal metabolic vasodilation accompanying reactive hyperemia. We conclude that in humans sympathetic neural control of skeletal muscle oxygenation is sensitive to modulation by metabolic events in the contracting muscles. These events are different from those involved in either metaboreceptor muscle afferent activation or reactive hyperemia. PMID:8755671

Reliability of a Novel High Intensity One Leg Dynamic Exercise Protocol to Measure Muscle Endurance

PubMed Central

Lepers, Romuald; Marcora, Samuele M.

2016-01-01

We recently developed a high intensity one leg dynamic exercise (OLDE) protocol to measure muscle endurance and investigate the central and peripheral mechanisms of muscle fatigue. The aims of the present study were to establish the reliability of this novel protocol and describe the isokinetic muscle fatigue induced by high intensity OLDE and its recovery. Eight subjects performed the OLDE protocol (time to exhaustion test of the right leg at 85% of peak power output) three times over a week period. Isokinetic maximal voluntary contraction torque at 60 (MVC60), 100 (MVC100) and 140 (MVC140) deg/s was measured pre-exercise, shortly after exhaustion (13 ± 4 s), 20 s (P20) and 40 s (P40) post-exercise. Electromyographic (EMG) signal was analyzed via the root mean square (RMS) for all three superficial knee extensors. Mean time to exhaustion was 5.96 ± 1.40 min, coefficient of variation was 8.42 ± 6.24%, typical error of measurement was 0.30 min and intraclass correlation was 0.795. MVC torque decreased shortly after exhaustion for all angular velocities (all P < 0.001). MVC60 and MVC100 recovered between P20 (P < 0.05) and exhaustion and then plateaued. MVC140 recovered only at P40 (P < 0.05). High intensity OLDE did not alter maximal EMG RMS of the three superficial knee extensors during MVC. The results of this study demonstrate that this novel high intensity OLDE protocol could be reliably used to measure muscle endurance, and that muscle fatigue induced by high intensity OLDE should be examined within ~ 30 s following exhaustion. PMID:27706196

Motor Vehicle Crash Brain Injury in Infants and Toddlers: A Suitable Model for Inflicted Head Injury?

ERIC Educational Resources Information Center

Shah, Mahim; Vavilala, Monica S.; Feldman, Kenneth W.; Hallam, Daniel K.

2005-01-01

Objective: Children involved in motor vehicle crash (MVC) events might experience angular accelerations similar to those experienced by children with inflicted traumatic brain injury (iTBI). This is a pilot study to determine whether the progression of signs and symptoms and radiographic findings of MVC brain injury (mvcTBI) in children of the age…

Stressor-induced increase in muscle fatigability of young men and women is predicted by strength but not voluntary activation

PubMed Central

Pereira, Hugo M.; Pruse, Jaclyn; Yoon, Tejin; Schlinder-DeLap, Bonnie; Nielson, Kristy A.; Hunter, Sandra K.

2014-01-01

This study investigated mechanisms for the stressor-induced changes in muscle fatigability in men and women. Participants performed an isometric-fatiguing contraction at 20% maximal voluntary contraction (MVC) until failure with the elbow flexor muscles. Study one (n = 55; 29 women) involved two experimental sessions: 1) a high-stressor session that required a difficult mental-math task before and during a fatiguing contraction and 2) a control session with no mental math. For some participants (n = 28; 14 women), cortical stimulation was used to examine mechanisms that contributed to muscle fatigability during the high-stressor and control sessions. Study two (n = 23; nine women) determined the influence of a low stressor, i.e., a simple mental-math task, on muscle fatigability. In study one, the time-to-task failure was less for the high-stressor session than control (P < 0.05) for women (19.4%) and men (9.5%): the sex difference response disappeared when covaried for initial strength (MVC). MVC force, voluntary activation, and peak-twitch amplitude decreased similarly for the control and high-stressor sessions (P < 0.05). In study two, the time-to-task failure of men or women was not influenced by the low stressor (P > 0.05). The greater fatigability, when exposed to a high stressor during a low-force task, was not exclusive to women but involved a strength-related mechanism in both weaker men and women that accelerated declines in voluntary activation and slowing of contractile properties. PMID:24526582

Longitudinal Study of Mental Health and Pain-Related Functioning Following a Motor Vehicle Collision.

PubMed

Valentine, Sarah E; Gerber, Monica W; Nobles, Carrie J; Shtasel, Derri L; Marques, Luana

2016-03-21

Relations between mental and physical health symptoms are well-established in the literature on recovery following motor vehicle collisions (MVCs). To understand the temporal sequencing and evolution of these relations, we examined the bidirectional association between mental and physical health symptoms at 4 and 16 weeks following a MVC. The sample consisted of 103 participants recruited through public MVC police reports. The study included self-report assessments for posttraumatic stress symptoms, depressive symptoms, bodily pain, and role limitations attributable to physical health. A series of multivariable linear regression analyses were conducted to estimate the associations between these mental and physical health outcomes. The analysis revealed that mental health symptoms at 4 weeks post-MVC were associated with higher bodily pain at 16 weeks post-MVC (PTSD symptoms: β = -0.74, 95% CI: -1.06, -0.42; depressive symptoms: β = -1.34, 95% CI: -1.90, -0.78), but not higher health-related role limitations. Physical health symptoms at 4 weeks post-MVC were not associated with PTSD or depressive symptoms at 16 weeks post-MVC. The results indicate the predictive strength of mental health symptoms at 4 weeks post-MVC in identifying individuals at risk for bodily pain at 16 weeks and shed light on the temporal sequencing of how relations between physical and mental health symptoms emerge over time. This suggests that early assessment of mental health symptoms may have significant implications for the treatment of these patients. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

M-wave, H- and V-reflex recruitment curves during maximal voluntary contraction.

PubMed

Racinais, Sebastien; Maffiuletti, Nicola A; Girard, Olivier

2013-08-01

To investigate whether the H reflex-M wave recruitment curves obtained during maximal voluntary contraction (MVC) differ from rest and to determine the stimulation intensities allowing to record stable reflex responses. Full recruitment curves (precision, 2 mA) were obtained from the soleus muscle in 14 volunteers at rest and during plantar flexion MVCs. Maximal M-wave reached significantly larger amplitude during MVC (+2.2 [0.4; 3.9] mV) for a higher stimulation intensity (+7.9 [-0.4; 16] mA). Similarly, maximal H-reflex reached significantly larger amplitude during MVC than at rest (+3.2 [0.9; 5.5] mV) for a much higher stimulation intensity (+17.7 [9.7; 25.7] mA). V-wave amplitude plateaued only when M-wave during MVC plateaued, that is, at higher intensity than M-wave at rest. V-wave was correlated to the maximal H-reflex during MVC (r = 0.79, P < 0.05). Electrically evoked potentials showed a specific recruitment curve during MVC with higher maximal values attained for higher stimulation intensities. Thus, recording reflex responses during MVC based on intensities determined at rest or as a percentage of M-wave may yield inaccurate results. V-wave presented a plateau for stimulation intensity of 1.5 times the onset of the resting M-wave plateau. Evoked potentials obtained during actual contractions should be normalized to M-waves obtained during contractions of the same force level.

The effects of a single session of spinal manipulation on strength and cortical drive in athletes.

PubMed

Christiansen, Thomas Lykke; Niazi, Imran Khan; Holt, Kelly; Nedergaard, Rasmus Wiberg; Duehr, Jens; Allen, Kathryn; Marshall, Paul; Türker, Kemal S; Hartvigsen, Jan; Haavik, Heidi

2018-04-01

The primary purpose of this study was to investigate whether a single session of spinal manipulation (SM) increases strength and cortical drive in the lower limb (soleus muscle) of elite Taekwondo athletes. Soleus-evoked V-waves, H-reflex and maximum voluntary contraction (MVC) of the plantar flexors were recorded from 11 elite Taekwondo athletes using a randomized controlled crossover design. Interventions were either SM or passive movement control. Outcomes were assessed at pre-intervention and at three post-intervention time periods (immediate post, post 30 min and post 60 min). A multifactorial repeated measures ANOVA was conducted to assess within and between group differences. Time and session were used as factors. A post hoc analysis was carried out, when an interactive effect was present. Significance was set at p ≤ 0.05. SM increased MVC force [F(3,30) = 5.95, p < 0.01], and V-waves [F(3,30) = 4.25, p = 0.01] over time compared to the control intervention. Between group differences were significant for all time periods (p < 0.05) except for the post60 force measurements (p = 0.07). A single session of SM increased muscle strength and corticospinal excitability to ankle plantar flexor muscles in elite Taekwondo athletes. The increased MVC force lasted for 30 min and the corticospinal excitability increase persisted for at least 60 min.

Interhemispheric plasticity in humans.

PubMed

Hortobágyi, Tibor; Richardson, Sarah Pirio; Lomarev, Mikhael; Shamim, Ejaz; Meunier, Sabine; Russman, Heike; Dang, Nguyet; Hallett, Mark

2011-07-01

Chronic unimanual motor practice increases the motor output not only in the trained but also in the nonexercised homologous muscle in the opposite limb. We examined the hypothesis that adaptations in motor cortical excitability of the nontrained primary motor cortex (iM1) and in interhemispheric inhibition from the trained to the nontrained M1 mediate this interlimb cross education. Healthy, young volunteers (n=12) performed 1000 submaximal voluntary contractions (MVC) of the right first dorsal interosseus (FDI) at 80% MVC during 20 sessions. Trained FDI's MVC increased 49.9%, and the untrained FDI's MVC increased 28.1%. Although corticospinal excitability in iM1, measured with transcranial magnetic stimulation (TMS) before and after every fifth session, increased 6% at rest, these changes, as those in intracortical inhibition and facilitation, did not correlate with cross education. When weak and strong TMS of iM1 were delivered on a background of a weak and strong muscle contraction, respectively, of the right FDI, excitability of iM1 increased dramatically after 20 sessions. Interhemispheric inhibition decreased 8.9% acutely within sessions and 30.9% chronically during 20 sessions and these chronic reductions progressively became more strongly associated with cross education. There were no changes in force or TMS measures in the trained group's left abductor minimi digiti and there were no changes in the nonexercising control group (n=8). The findings provide the first evidence for plasticity of interhemispheric connections to mediate cross education produced by a simple motor task.

Methodology of AA CRASH: a prospective observational study evaluating the incidence and pathogenesis of adverse post-traumatic sequelae in African-Americans experiencing motor vehicle collision.

PubMed

Linnstaedt, Sarah D; Hu, JunMei; Liu, Andrea Y; Soward, April C; Bollen, Kenneth A; Wang, Henry E; Hendry, Phyllis L; Zimny, Erin; Lewandowski, Christopher; Velilla, Marc-Anthony; Damiron, Kathia; Pearson, Claire; Domeier, Robert; Kaushik, Sangeeta; Feldman, James; Rosenberg, Mark; Jones, Jeffrey; Swor, Robert; Rathlev, Niels; McLean, Samuel A

2016-09-06

A motor vehicle collision (MVC) is one of the most common life-threatening events experienced by individuals living in the USA. While most individuals recover following MVC, a significant proportion of individuals develop adverse post-traumatic sequelae such as post-traumatic stress disorder or persistent musculoskeletal pain. Adverse post-traumatic sequelae are common, morbid and costly public health problems in the USA and other industrialised countries. The pathogenesis of these disorders following MVC remains poorly understood. In the USA, available data suggest that African-Americans experience an increased burden of adverse post-traumatic sequelae after MVC compared to European Americans, but to date no studies examining the pathogenesis of these disorders among African-Americans experiencing MVC have been performed. The African-American CRASH (AA CRASH) study is an NIH-funded, multicentre, prospective study that enrols African-Americans (n=900) who present to the emergency department (ED) within 24 hours of MVC. Participants are enrolled at 13 ED sites in the USA. Individuals who are admitted to the hospital or who report a fracture or tissue injury are excluded. Participants complete a detailed ED interview that includes an assessment of crash history, current post-traumatic symptoms and health status prior to the MVC. Blood samples are also collected in the ED using PAXgene DNA and PAXgene RNA tubes. Serial mixed-mode assessments 6 weeks, 6 months and 1 year after MVC include an assessment of adverse sequelae, general health status and health service utilisation. The results from this study will provide insights into the incidence and pathogenesis of persistent pain and other post-traumatic sequelae in African-Americans experiencing MVC. AA CRASH has ethics approval in the USA, and the results will be published in a peer-reviewed journal. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Effect of a prior bout of preconditioning exercise on muscle damage from downhill walking.

PubMed

Maeo, Sumiaki; Ochi, Yusuke; Yamamoto, Masayoshi; Kanehisa, Hiroaki; Nosaka, Kazunori

2015-03-01

This study investigated whether reduced-duration downhill walking (DW) would confer a protective effect against muscle damage induced by a subsequent bout of longer duration DW performed 1 week or 4 weeks later. Healthy young adults were allocated to a control or one of the preconditioning exercise (PRE-1wk or PRE-4wk) groups (10 men and 4 women per group). PRE-1wk and PRE-4wk groups performed 20-min DW (-28% slope, 5 km/h, 10% body mass added to a backpack) 1 week and 4 weeks before 40-min DW, respectively, and the control group performed 40-min DW only. Maximal voluntary contraction (MVC) knee extension torque, plasma creatine kinase (CK) activity, and muscle soreness (100-mm visual analog scale) were measured before, immediately after, and 24, 48, and 72 h after DW, and the changes in these variables were compared among groups. The control group showed symptoms of muscle damage (e.g., prolonged decrease in MVC: -14% ± 10% at 48 h post-DW) after 40-min DW. Changes in all variables after 40-min DW of PRE-1wk and PRE-4wk groups were 54%-61% smaller (P < 0.05) than the control group, without significant differences between PRE-1wk and PRE-4wk groups for MVC and plasma CK activity. Importantly, changes after the preconditioning exercise (20-min DW) were 67%-69% smaller (P < 0.05) than those after the 40-min DW of the control group. These findings suggest that 20-min DW resulting in minor muscle damage conferred a protective effect against subsequent 40-min DW, and its effect could last for more than 4 weeks.

The effect of exercise hypertrophy and disuse atrophy on muscle contractile properties: a mechanomyographic analysis.

PubMed

Than, Christian; Tosovic, Danijel; Seidl, Laura; Mark Brown, J

2016-12-01

To determine whether mechanomyographic (MMG) determined contractile properties of the biceps brachii change during exercise-induced hypertrophy and subsequent disuse atrophy. Healthy subjects (mean ± SD, 23.7 ± 2.6 years, BMI 21.8 ± 2.4, n = 19) performed unilateral biceps curls (9 sets × 12 repetitions, 5 sessions per week) for 8 weeks (hypertrophic phase) before ceasing exercise (atrophic phase) for the following 8 weeks (non-dominant limb; treatment, dominant limb; control). MMG measures of muscle contractile properties (contraction time; T c , maximum displacement; D max , contraction velocity; V c ), electromyographic (EMG) measures of muscle fatigue (median power frequency; MPF), strength measures (maximum voluntary contraction; MVC) and measures of muscle thickness (ultrasound) were obtained. Two-way repeated measures ANOVA showed significant differences (P < 0.05) between treatment and control limbs. During the hypertrophic phase treatment MVC initially declined (weeks 1-3), due to fatigue (decline in MPF), followed by improvement against control during weeks 6-8. Between weeks 5 and 8 treatment, muscle thickness was greater than control, reflecting gross hypertrophy. MMG variables Dmax (weeks 2, 7) and Vc (weeks 7, 8) declined. During the atrophic phase, MVC (weeks 9-12) and muscle thickness (weeks 9, 10) initially remained high before declining to control levels, reflecting gross atrophy. MMG variables D max (weeks 9, 14) and V c (weeks 9, 14, 15) also declined during the atrophic phase. No change in T c was found throughout the hypertrophic or atrophic phases. MMG detects changes in contractile properties during stages of exercise-induced hypertrophy and disuse atrophy suggesting its applicability as a clinical tool in musculoskeletal rehabilitation.

Data base management system for lymphatic filariasis--a neglected tropical disease.

PubMed

Upadhyayula, Suryanaryana Murty; Mutheneni, Srinivasa Rao; Kadiri, Madhusudhan Rao; Kumaraswamy, Sriram; Nelaturu, Sarat Chandra Babu

2012-01-01

Researchers working in the area of Public Health are being confronted with large volumes of data on various aspects of entomology and epidemiology. To obtain the relevant information out of these data requires particular database management system. In this paper, we have described about the usages of our developed database on lymphatic filariasis. This database application is developed using Model View Controller (MVC) architecture, with MySQL as database and a web based interface. We have collected and incorporated the data on filariasis in the database from Karimnagar, Chittoor, East and West Godavari districts of Andhra Pradesh, India. The importance of this database is to store the collected data, retrieve the information and produce various combinational reports on filarial aspects which in turn will help the public health officials to understand the burden of disease in a particular locality. This information is likely to have an imperative role on decision making for effective control of filarial disease and integrated vector management operations.

Handgrip force steadiness in young and older adults: a reproducibility study.

PubMed

Blomkvist, Andreas W; Eika, Fredrik; de Bruin, Eling D; Andersen, Stig; Jorgensen, Martin

2018-04-02

Force steadiness is a quantitative measure of the ability to control muscle tonus. It is an independent predictor of functional performance and has shown to correlate well with different degrees of motor impairment following stroke. Despite being clinically relevant, few studies have assessed the validity of measuring force steadiness. The aim of this study was to explore the reproducibility of handgrip force steadiness, and to assess age difference in steadiness. Intrarater reproducibility (the degree to which a rating gives consistent result on separate occasions) was investigated in a test-retest design with seven days between sessions. Ten young and thirty older adults were recruited and handgrip steadiness was tested at 5%, 10% and 25% of maximum voluntary contraction (MVC) using Nintendo Wii Balance Board (WBB). Coefficients of variation were calculated from the mean force produced (CVM) and the target force (CVT). Area between the force curve and the target force line (Area) was also calculated. For the older adults we explored reliability using intraclass correlation coefficient (ICC) and agreement using standard error of measurement (SEM), limits of agreement (LOA) and smallest real difference (SRD). A systematic improvement in handgrip steadiness was found between sessions for all measures (CVM, CVT, Area). CVM and CVT at 5% of MVC showed good to high reliability, while Area had poor reliability for all percentages of MVC. Averaged ICC for CVM, CVT and Area was 0.815, 0.806 and 0.464, respectively. Averaged ICC on 5%, 10%, and 25% of MVC was 0.751, 0.667 and 0.668, respectively. Measures of agreement showed similar trends with better results for CVM and CVT than for Area. Young adults had better handgrip steadiness than older adults across all measures. The CVM and CVT measures demonstrated good reproducibility at lower percentages of MVC using the WBB, and could become relevant measures in the clinical setting. The Area measure had poor reproducibility. Young adults have better handgrip steadiness than old adults.

Comparing the occlusal contact area of individual teeth during low-level clenching.

PubMed

Nishimori, Hideta; Iida, Takashi; Kamiyama, Hirona; Komoda, Yoshihiro; Obara, Ryoko; Uchida, Takashi; Kawara, Misao; Komiyama, Osamu

2017-09-14

The aim of this study was to investigate the occlusal contact area (OCA) in individual teeth during low-level tooth clenching in 24 healthy participants. Before measurements were made, the 100% maximum voluntary contraction (MVC) was determined. At baseline, all subjects were instructed to close their mouth and touch the opposing teeth with minimal force. Occlusal contact was recorded during three jaw motor tasks (baseline, 20% MVC, and 40% MVC) using a blue silicone material. OCA thickness was determined from images and defined on five levels: level 1 (0-149 µm), level 2 (0-89 µm), level 3 (0-49 µm), level 4 (0-29 µm), and level 5 (0-4 µm). Premolar and molar OCAs increased significantly from baseline to 20% MVC and 40% MVC. The OCA of each anterior tooth did not change significantly with increasing clenching intensity at all levels. Our findings suggest that premolar and molar OCAs may be altered by low-intensity clenching, affecting the teeth and periodontal tissues.

Stress-related psychological symptoms contribute to axial pain persistence after motor vehicle collision: path analysis results from a prospective longitudinal study.

PubMed

Feinberg, Rose K; Hu, JunMei; Weaver, Mark A; Fillingim, Roger B; Swor, Robert A; Peak, David A; Jones, Jeffrey S; Rathlev, Niels K; Lee, David C; Domeier, Robert M; Hendry, Phyllis L; Liberzon, Israel; McLean, Samuel A

2017-04-01

Posttraumatic stress disorder (PTSD) symptoms and pain after traumatic events such as motor vehicle collision (MVC) have been proposed to be mutually promoting. We performed a prospective multicenter study that enrolled 948 individuals who presented to the emergency department within 24 hours of MVC and were discharged home after evaluation. Follow-up evaluations were completed 6 weeks, 6 months, and 1 year after MVC. Path analysis results supported the hypothesis that axial pain after MVC consistently promotes the maintenance of hyperarousal and intrusive symptoms, from the early weeks after injury through 1 year. In addition, path analysis results supported the hypothesis that one or more PTSD symptom clusters had an influence on axial pain outcomes throughout the year after MVC, with hyperarousal symptoms most influencing axial pain persistence in the initial months after MVC. The influence of hyperarousal symptoms on pain persistence was only present among individuals with genetic vulnerability to stress-induced pain, suggesting specific mechanisms by which hyperarousal symptoms may lead to hyperalgesia and allodynia. Further studies are needed to better understand the specific mechanisms by which pain and PTSD symptoms enhance one another after trauma, and how such mechanisms vary among specific patient subgroups, to better inform the development of secondary preventive interventions.

MR elastography measurement of the effect of passive warmup prior to eccentric exercise on thigh muscle mechanical properties

PubMed Central

Kennedy, Paul; Macgregor, Lewis J.; Barnhill, Eric; Johnson, Curtis L.; Perrins, Michael; Hunter, Angus; Brown, Colin; van Beek, Edwin J.R.

2017-01-01

Purpose To investigate the effect of warmup by application of the thermal agent Deep Heat (DH) on muscle mechanical properties using magnetic resonance elastography (MRE) at 3T before and after exercise‐induced muscle damage (EIMD). Materials and Methods Twenty male participants performed an individualized protocol designed to induce EIMD in the quadriceps. DH was applied to the thigh in 50% of the participants before exercise. MRE, T 2‐weighted MRI, maximal voluntary contraction (MVC), creatine kinase (CK) concentration, and muscle soreness were measured before and after the protocol to assess EIMD effects. Five participants were excluded: four having not experienced EIMD and one due to incidental findings. Results Total workload performed during the EIMD protocol was greater in the DH group than the control group (P < 0.03), despite no significant differences in baseline MVC (P = 0.23). Shear stiffness |G*| increased in the rectus femoris (RF) muscle in both groups (P < 0.03); however, DH was not a significant between‐group factor (P =  0.15). MVC values returned to baseline faster in the DH group (5 days) than the control group (7 days). Participants who displayed hyperintensity on T 2‐weighted images had a greater stiffness increase following damage than those without: RF; 0.61 kPa vs. 0.15 kPa, P < 0.006, vastus intermedius; 0.34 kPa vs. 0.03 kPa, P = 0.06. Conclusion EIMD produces increased muscle stiffness as measured by MRE, with the change in |G*| significantly increased when T 2 hyperintensity was present. DH did not affect CK concentration or soreness; however, DH participants produced greater workload during the EIMD protocol and exhibited accelerated MVC recovery. Level of Evidence: 1 Technical Efficacy: Stage 2 J. Magn. Reson. Imaging 2017;46:1115–1127. PMID:28218814

Multivariate Cryptography Based on Clipped Hopfield Neural Network.

PubMed

Wang, Jia; Cheng, Lee-Ming; Su, Tong

2018-02-01

Designing secure and efficient multivariate public key cryptosystems [multivariate cryptography (MVC)] to strengthen the security of RSA and ECC in conventional and quantum computational environment continues to be a challenging research in recent years. In this paper, we will describe multivariate public key cryptosystems based on extended Clipped Hopfield Neural Network (CHNN) and implement it using the MVC (CHNN-MVC) framework operated in space. The Diffie-Hellman key exchange algorithm is extended into the matrix field, which illustrates the feasibility of its new applications in both classic and postquantum cryptography. The efficiency and security of our proposed new public key cryptosystem CHNN-MVC are simulated and found to be NP-hard. The proposed algorithm will strengthen multivariate public key cryptosystems and allows hardware realization practicality.

Acute changes of hip joint range of motion using selected clinical stretching procedures: A randomized crossover study.

PubMed

Hammer, Adam M; Hammer, Roger L; Lomond, Karen V; O'Connor, Paul

2017-12-01

Hip adductor flexibility and strength is an important component of athletic performance and many activities of daily living. Little research has been done on the acute effects of a single session of stretching on hip abduction range of motion (ROM). The aim of this study was to compare 3 clinical stretching procedures against passive static stretching and control on ROM and peak isometric maximal voluntary contraction (MVC). Using a randomized crossover study design, a total of 40 participants (20 male and 20 female) who had reduced hip adductor muscle length attended a familiarization session and 5 testing sessions on non-consecutive days. Following the warm-up and pre-intervention measures of ROM and MVC, participants were randomly assigned 1 of 3 clinical stretching procedures (modified lunge, multidirectional, and joint mobilization) or a static stretch or control condition. Post-intervention measures of ROM and MVC were taken immediately following completion of the assigned condition. An ANOVA using a repeated measure design with the change score was conducted. All interventions resulted in small but statistically significant (p < 0.05) increases (1.0°-1.7°) in ROM with no inter-condition differences except one. Multidirectional stretching was greater than control (p = 0.031). These data suggest that a single session of stretching has only a minimal effect on acute changes of hip abduction ROM. Although hip abduction is a frontal plane motion, to effectively increase the extensibility of the structures that limit abduction, integrating multi-planar stretches may be indicated. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of barbell deadlift training on submaximal motor unit firing rates for the vastus lateralis and rectus femoris.

PubMed

Stock, Matt S; Thompson, Brennan J

2014-01-01

Previous investigations that have studied motor unit firing rates following strength training have been limited to small muscles, isometric training, or interventions involving exercise machines. We examined the effects of ten weeks of supervised barbell deadlift training on motor unit firing rates for the vastus lateralis and rectus femoris during a 50% maximum voluntary contraction (MVC) assessment. Twenty-four previously untrained men (mean age  = 24 years) were randomly assigned to training (n = 15) or control (n = 9) groups. Before and following the intervention, the subjects performed isometric testing of the right knee extensors while bipolar surface electromyographic signals were detected from the two muscles. The signals were decomposed into their constituent motor unit action potential trains, and motor units that demonstrated accuracy levels less than 92.0% were not considered for analysis. One thousand eight hundred ninety-two and 2,013 motor units were examined for the vastus lateralis and rectus femoris, respectively. Regression analyses were used to determine the linear slope coefficients (pulses per second [pps]/% MVC) and y-intercepts (pps) of the mean firing rate and firing rate at recruitment versus recruitment threshold relationships. Deadlift training significantly improved knee extensor MVC force (Cohen's d = .70), but did not influence force steadiness. Training had no influence on the slopes and y-intercepts for the mean firing rate and firing rate at recruitment versus recruitment threshold relationships. In agreement with previous cross-sectional comparisons and randomized control trials, our findings do not support the notion that strength training affects the submaximal control of motor units.

Manipulation of sensory input can improve stretching outcomes.

PubMed

Capobianco, Robyn A; Almuklass, Awad M; Enoka, Roger M

2018-02-01

The primary purpose of our study was to assess the influence of modulating sensory input with either transcutaneous electrical nerve stimulation (TENS) or self-massage with therapy balls on the maximal range of motion (ROM) about the ankle joint when stretching the calf muscles. We also investigated the influence of these two conditions on the force capacity and force control of plantar flexor muscles. Twenty healthy adults (25 ± 3 yr) performed three sessions of ankle plantar flexor stretching (three stretches of 30 s each): stretching alone (SS), stretching with concurrent TENS (TENS), and stretching after self-massage using therapy balls (SM). TENS was applied for 60 s prior to and during each stretch, and SM was performed for 60 s prior to each of the three stretches. Maximal voluntary contraction (MVC) torque and force steadiness at 20% MVC were recorded before and at 15 min after the final stretch. Ankle dorsiflexion ROM was assessed before, after, and at 5, 10, and 15 min after the last stretch. The increase in ROM was greater after SM (24%) than after SS (13%) and TENS (9%; p < .001). Maximal discomfort level (0-10 VAS) during stretching was similar for all conditions. MVC torque increased after SM only (p < .001, Cohen's D = 1.5): SM, 16%; SS, -1%; TENS, -3%. Force steadiness did not change. The sensory fibres that contribute to stretch tolerance were engaged by self-massage but not by TENS, resulting in greater increases in flexibility and MVC torque after self-massage.

Are repeated single-limb heel raises and manual muscle testing associated with peak plantar-flexor force in people with inclusion body myositis?

PubMed

Harris-Love, Michael O; Shrader, Joseph A; Davenport, Todd E; Joe, Galen; Rakocevic, Goran; McElroy, Beverly; Dalakas, Marinos

2014-04-01

Repeated heel raises have been proposed as a method of ankle plantar-flexor strength testing that circumvents the limitations of manual muscle testing (MMT). The study objective was to examine the relationships among ankle plantar-flexion isometric maximum voluntary contraction (MVC), repeated single-limb heel raises (SLHRs), and MMT in people with myositis. This was a cross-sectional study with a between-group design. The ability to complete 1 SLHR determined group assignment (SLHR group, n=24; no-SLHR group, n=19). Forty-three participants with myositis (13 women; median age=64.9 years) participated. Outcome measures included MVC, predicted MVC, Kendall MMT, and Daniels-Worthingham MMT. The Kendall MMT was unable to detect significant ankle plantar-flexor weakness established by quantitative methods and was unable to discriminate between participants who could and those who could not perform the SLHR task. Ankle plantar-flexion MVC was not associated with the number of heel-raise repetitions in the SLHR group (pseudo R(2)=.13). No significant relationship was observed between MVC values and MMT grades in the SLHR and no-SLHR groups. However, a moderate relationship between MVC values and MMT grades was evident in a combined-group analysis (ρ=.50-.67). The lower half of both MMT grading scales was not represented in the study despite the profound weakness of the participants. Both Kendall MMT and Daniels-Worthingham MMT had limited utility in the assessment of ankle plantar-flexor strength. Repeated SLHRs should not be used as a proxy measure of ankle plantar-flexion MVC in people with myositis.

Post-Traumatic Stress Disorder among Older Adults Experiencing Motor Vehicle Collision: A Multicenter Prospective Cohort Study.

PubMed

Platts-Mills, Timothy F; Nebolisa, Bo C; Flannigan, Sean A; Richmond, Natalie L; Domeier, Robert M; Swor, Robert A; Hendry, Phyllis L; Peak, David A; Rathlev, Niels K; Jones, Jeffrey S; Lee, David C; Jones, Christopher W; McLean, Samuel A

2017-09-01

To characterize risk factors for and consequences of post-traumatic stress disorder (PTSD) among older adults evaluated in the emergency department (ED) following motor vehicle collision (MVC). Prospective multicenter longitudinal study (2011-2015). 9 EDs across the United States. Adults aged 65 years and older who presented to an ED after MVC without severe injuries. PTSD symptoms were assessed 6 months after the ED visit using the Impact of Event Scale-Revised. Of 223 patients, clinically significant PTSD symptoms at 6 months were observed in 21% (95% CI 16%-26%). PTSD symptoms were more common in patients who did not have a college degree, had depressive symptoms prior to the MVC, perceived the MVC as life-threatening, had severe ED pain, and expected their physical or emotional recovery time to be greater than 30 days. Three factors (ED pain severity [0-10 scale], perceived life-threatening MVC [0-10 scale], and pre-MVC depressive symptoms [yes to either of two questions]), predicted 6-month PTSD symptoms with an area under the curve of 0.76. Compared to patients without PTSD symptoms, those with PTSD symptoms were at higher risk for persistent pain (72% versus 30%), functional decline (67% versus 42%), and new disability (49% versus 18%). Among older adults treated in the ED following MVC, clinically significant PTSD symptoms at 6 months were present in 21% of patients and were associated with adverse health outcomes. Increased risk for PTSD development can be identified with moderate accuracy using information readily available in the ED. Copyright © 2017 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

The direct and indirect effects of corruption on motor vehicle crash deaths.

PubMed

Hua, Law Teik; Noland, Robert B; Evans, Andrew W

2010-11-01

Recent empirical research has found that there is an inverted U-shaped or Kuznets relationship between income and motor vehicle crash (MVC) deaths, such that MVC deaths increase as national income increases and decrease after reaching a critical level. Corruption has been identified as one of the underlying factors that could affect this relationship, primarily by undermining institutional development and effective enforcement schemes. The total effect of corruption can be decomposed into two components, a direct and an indirect effect. The direct effect measures the immediate impact of corruption on MVC deaths by undermining effective enforcement and regulations, while the indirect effect captures the impact of corruption on hindering increases in per capita income and the consequent impact of reduced income on MVC deaths. By influencing economic growth, corruption can lead to an increase or decrease in MVC deaths depending on the income level. Using data from 60 countries between 1982 and 2003, these effects are estimated using linear panel and fixed effects negative binomial models. The estimation results suggest that corruption has different direct effects for less developed and highly developed countries. It has a negative (decreasing) effect on MVC deaths for less developed countries and a positive (increasing) effect on MVC deaths for highly developed countries. For highly developed countries, the total effect is positive at lower per capita income levels, but decreases with per capita income and becomes negative at per capita income levels of about US$ 38,248. For less developed countries, the total effect is negative within the sample range and decreases with increased per capita income. In summary, the results of this study suggest that reduction of corruption is likely a necessary condition to effectively tackle road safety problems. 2010 Elsevier Ltd. All rights reserved.

Incidence and predictors of neck and widespread pain after motor vehicle collision among US litigants and nonlitigants.

PubMed

McLean, Samuel A; Ulirsch, Jacob C; Slade, Gary D; Soward, April C; Swor, Robert A; Peak, David A; Jones, Jeffrey S; Rathlev, Niels K; Lee, David C; Domeier, Robert M; Hendry, Phyllis L; Bortsov, Andrey V; Bair, Eric

2014-02-01

Debate continues regarding the influence of litigation on pain outcomes after motor vehicle collision (MVC). In this study we enrolled European Americans presenting to the emergency department (ED) in the hours after MVC (n=948). Six weeks later, participants were interviewed regarding pain symptoms and asked about their participation in MVC-related litigation. The incidence and predictors of neck pain and widespread pain 6weeks after MVC were compared among those engaged in litigation (litigants) and those not engaged in litigation (nonlitigants). Among the 859 of 948 (91%) participants completing 6-week follow-up, 711 of 849 (83%) were nonlitigants. Compared to nonlitigants, litigants were less educated and had more severe neck pain and overall pain, and a greater extent of pain at the time of ED evaluation. Among individuals not engaged in litigation, persistent pain 6weeks after MVC was common: 199 of 711 (28%) had moderate or severe neck pain, 92 of 711 (13%) had widespread pain, and 29 of 711 (4%) had fibromyalgia-like symptoms. Incidence of all 3 outcomes was significantly higher among litigants. Initial pain severity in the ED predicted pain outcomes among both litigants and nonlitigants. Markers of socioeconomic disadvantage predicted worse pain outcomes in litigants but not nonlitigants, and individual pain and psychological symptoms were less predictive of pain outcomes among those engaged in litigation. These data demonstrate that persistent pain after MVC is common among those not engaged in litigation, and provide evidence for bidirectional influences between pain outcomes and litigation after MVC. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

Maraviroc Observational Study: The Impact of Expanded Resistance Testing and Clinical Considerations for Antiretroviral Regimen Selection in Treatment-Experienced Patients

PubMed Central

Wilkins, Sara-Anne; Tamhane, Ashutosh; Nevin, Christa R.; Mugavero, Michael J.; Raper, James L.; Napolitano, Laura A.; Saag, Michael S.

2013-01-01

Abstract Maraviroc (MVC) use has trailed that of other post-2006 antiretroviral therapy (ART) options for treatment-experienced patients. We explored the impact of free tropism testing on MVC utilization in our cohort and explored barriers to MVC utilization. The Maraviroc Outcomes Study (MOS) is an investigator-initiated industry-sponsored trial where consecutive ART-experienced patients receiving routine care with viral loads ≥1,000 copies/ml, and whose provider requested resistance testing and received standardized resistance testing (SRT; phenotype, genotype, coreceptor/tropism). Sociodemographic, clinical, and ART characteristics of those receiving SRT were compared to a historical cohort (HC). Subsequently, providers were surveyed regarding factors influencing selection of salvage ART therapy. The HC (n=165) had resistance testing 7/08–9/09, while prospective SRT (n=83) patients were enrolled 9/09–8/10. In the HC, 92% had genotypes, 2% had tropism assays, and 62% (n=102) changed ART after resistance testing (raltegravir 37%, etravirine 25%, darunavir 24%, MVC 1%). In the SRT cohort, 57% (n=48) changed regimens after standardized resistance testing (darunavir 48%, raltegravir 40%, and etravirine 19%). CCR5-tropic virus was identified in 43% of the SRT group, and MVC was used in 10% [or 20% of R5 tropic patients who underwent a subsequent regimen change (n=25)], a statistically significant (p=0.01) increase in utilization. The factors most strongly influencing utilization were unique patient circumstances (60%), clinical experience (55%), and potential side effects (40%). The addition of routine tropism testing to genotypic/phenotypic testing was associated with increased MVC utilization, raising the possibility that tropism testing may present a barrier to MVC use; however, additional barriers exist, and merit further evaluation. PMID:22881368

Test-retest reliability of muscle fiber conduction velocity and fractal dimension of surface EMG during isometric contractions.

PubMed

Beretta-Piccoli, Matteo; D'Antona, Giuseppe; Zampella, Cristian; Barbero, Marco; Clijsen, Ron; Cescon, Corrado

2017-04-01

The aim of this study was to determine the test-retest reliability of muscle fiber conduction velocity (CV) and fractal dimension (FD) obtained from multichannel surface electromyographic (sEMG) recordings. Forty healthy recreationally active subjects (20 men and 20 women) performed two elbow flexions on two trials with a 1 week interval. The first was a 20% maximal voluntary contraction (MVC) of 120 s, and the second at 60% MVC held until exhaustion. sEMG signals were detected from the biceps brachii, using bi-dimensional arrays. Initial values and slope of CV and FD were used for the reliability analysis. The intraclass correlation coefficient (ICC) values for the isometric contraction at 20% MVC were (-0.09) and 0.67 for CV and FD respectively; whereas the ICC values at 60% MVC were 0.78 and 0.82 for CV and FD respectively. The Bland Altman plots for the two isometric contractions showed a mean difference close to zero, with no evident outliers between the repeated measurements: at 20% MVC 0.001 53 for FD and  -0.0277 for CV, and at 60% MVC 0.006 66 for FD and 0.009 07 for CV. Overall, our findings suggest that during isometric fatiguing contractions, CV and FD slopes are reliable variables, with potential application in clinical populations.

Driver seat belt use indicates decreased risk for child passengers in a motor vehicle crash.

PubMed

Olsen, Cody S; Cook, Lawrence J; Keenan, Heather T; Olson, Lenora M

2010-03-01

We examined the association between driver restraint use and child emergency department (ED) evaluation following a motor vehicle crash (MVC). This cohort study included child passengers aged 0-12 years riding with an adult driver aged 21 years or older involved in a MVC in Utah from 1999 to 2004. The 6 years of Utah MVC records were probabilistically linked to statewide Utah ED records. We estimated the relative risk of ED evaluation following a MVC for children riding with restrained versus unrestrained drivers. Generalized estimating equations were used to calculate relative risks adjusted for child, driver, and crash characteristics. Six percent (6%) of children riding with restrained adult drivers were evaluated in the ED compared to twenty-two percent (22%) of children riding with unrestrained adult drivers following a MVC (relative risk 0.29, 95% confidence interval 0.26-0.32). After adjusting for child, vehicle, and crash characteristics, the relative risk of child ED evaluation associated with driver restraint remained significant (relative risk 0.82, 95% confidence interval 0.72-0.94). Driver restraint use was associated with child restraint use, less alcohol/drug involvement, and lower relative risk of severe collision types (head-on, rollover). Driver seat belt use is associated with decreased risk of ED evaluation for child passengers in the event of a MVC. Copyright 2009 Elsevier Ltd. All rights reserved.

Pharmacodynamic Activity of Dapivirine and Maraviroc Single Entity and Combination Topical Gels for HIV-1 Prevention.

PubMed

Dezzutti, Charlene S; Yandura, Sarah; Wang, Lin; Moncla, Bernard; Teeple, Elizabeth A; Devlin, Brid; Nuttall, Jeremy; Brown, Elizabeth R; Rohan, Lisa C

2015-11-01

Dapivirine (DPV), a non-nucleoside reverse transcriptase inhibitor, and maraviroc (MVC), a CCR5 antagonist, were formulated into aqueous gels designed to prevent mucosal HIV transmission. 0.05% DPV, 0.1% MVC, 0.05% DPV/0.1% MVC and placebo gels were evaluated for pH, viscosity, osmolality, and in vitro release. In vitro assays and mucosal tissues were used to evaluate anti-HIV activity. Viability (Lactobacilli only) and epithelial integrity in cell lines and mucosal tissues defined safety. The gels were acidic and viscous. DPV gel had an osmolality of 893 mOsm/kg while the other gels had an osmolality of <100 mOsm/kg. MVC release was similar from the single and combination gels (~5 μg/cm(2)/min(1/2)), while DPV release was 10-fold less from the single as compared to the combination gel (0.4331 μg/cm(2)/min(1/2)). Titrations of the gels showed 10-fold more drug was needed to protect ectocervical than colonic tissue. The combination gel showed ~10- and 100-fold improved activity as compared to DPV and MVC gel, respectively. All gels were safe. The DPV/MVC gel showed a benefit blocking HIV infection of mucosal tissue compared to the single entity gels. Combination products with drugs affecting unique steps in the viral replication cycle would be advantageous for HIV prevention.

Analysis of surface EMG spike shape across different levels of isometric force.

PubMed

Gabriel, David A; Lester, Steven M; Lenhardt, Sean A; Cambridge, Edward D J

2007-01-15

This research evaluated changes in surface electromyographic (SEMG) spike shape across different levels of isometric force. Ninety-six subjects generated three 5-s isometric step contractions of the elbow flexors at 40, 60, 80, and 100% of maximal voluntary contraction (MVC). Force and bipolar SEMG activity were monitored concurrently. The mean spike amplitude (MSA) exhibited a linear increase across the four levels of force. The mean spike frequency (MSF) remained stable from 40 to 80% of MVC; it then decreased from 80 to 100% of MVC. There was a concomitant increase in mean spike slope (MSS) that indicates that the biceps brachii (BB) relied on the recruitment of higher threshold motor units (MUs) from 40 to 80% of MVC. However, there progressive decrease in the mean number of peaks per spike (MNPPS) that suggests that MU synchronization was additionally required to increase force from 80 to 100% of MVC. The spike shape measures, taken together, indicate that the decrease in frequency content of the signal was due to synchronization, not an increased probability of temporal overlap due an increase in rate-coding.

Neuromuscular Electrical Stimulation for Mobility Support of Elderly

PubMed Central

2015-01-01

The stimulator for neuromuscular electrical stimulation for mobility support of elderly is not very complicated, but for application within “MOBIL” we have some additional demands to fulfill. First we have specific safety issues for this user group. A powerful compliance management system is crucial not only to guide daily application, but for creating hard data for the scientific outcome. We also need to assure easy handling of the stimulator, because the subjects are generally not able to cope with too difficult and complex motor skills. So, we developed five generations of stimulators and optimizing solutions after field tests. We are already planning the sixth generation with wireless control of the stimulation units by the central main handheld control unit. In a prototype, we have implemented a newly available high capacity memory, a breakthrough in “compliance data storage” as they offer the necessary high storage capacity and fast data handling for an affordable prize. The circuit also contains a 3D accelerometer sensor which acts as a further important safety features: if the control unit drops, this event is detected automatically by the sensor and activates an emergency switch-off that disables the stimulation to avoid associated risks. Further, we have implemented a hardware emergence shutdown and other safety measures. Finally, in the last example muscle torque measurements are referenced with compliance data. In the study normalized maximum voluntary contraction (MVC) and maximum stimulation induced contraction (MSC) were assessed in regular check-ups along the training period. With additional consideration of adjusted stimulation intensity for training out of the compliance data records we are able to estimate the induced contraction strength, which turned out to amount in average 11% of MVC. This value may seem on a first sight rather low, and ought to be considered in relation to the results at the end of the training period. Therefore the correlation between normalized MVC and normalized MSC was calculated. It is obvious that MVC can increase to strongly variable extent (3 to 65 %), but in few cases also decrease (-4 to 15 %) over the study period. The correlation suggests that an increase of roughly 1 % of normalized MSC can lead to an increase of about 10 % in MVC in the given training conditions. Overall, we can say that we have a stimulator that has turned out to work sufficiently. The most important feature is the integrated compliance recording because this is very useful for interpretation of the study outcome. The electrical stimulation training has shown that even with relatively small induced contraction intensity we still get some increase in the achievable voluntary extension torque. PMID:26913167

Neuromuscular Electrical Stimulation for Mobility Support of Elderly.

PubMed

Mayr, Winfried

2015-08-24

The stimulator for neuromuscular electrical stimulation for mobility support of elderly is not very complicated, but for application within "MOBIL" we have some additional demands to fulfill. First we have specific safety issues for this user group. A powerful compliance management system is crucial not only to guide daily application, but for creating hard data for the scientific outcome. We also need to assure easy handling of the stimulator, because the subjects are generally not able to cope with too difficult and complex motor skills. So, we developed five generations of stimulators and optimizing solutions after field tests. We are already planning the sixth generation with wireless control of the stimulation units by the central main handheld control unit. In a prototype, we have implemented a newly available high capacity memory, a breakthrough in "compliance data storage" as they offer the necessary high storage capacity and fast data handling for an affordable prize. The circuit also contains a 3D accelerometer sensor which acts as a further important safety features: if the control unit drops, this event is detected automatically by the sensor and activates an emergency switch-off that disables the stimulation to avoid associated risks. Further, we have implemented a hardware emergence shutdown and other safety measures. Finally, in the last example muscle torque measurements are referenced with compliance data. In the study normalized maximum voluntary contraction (MVC) and maximum stimulation induced contraction (MSC) were assessed in regular check-ups along the training period. With additional consideration of adjusted stimulation intensity for training out of the compliance data records we are able to estimate the induced contraction strength, which turned out to amount in average 11% of MVC. This value may seem on a first sight rather low, and ought to be considered in relation to the results at the end of the training period. Therefore the correlation between normalized MVC and normalized MSC was calculated. It is obvious that MVC can increase to strongly variable extent (3 to 65 %), but in few cases also decrease (-4 to 15 %) over the study period. The correlation suggests that an increase of roughly 1 % of normalized MSC can lead to an increase of about 10 % in MVC in the given training conditions. Overall, we can say that we have a stimulator that has turned out to work sufficiently. The most important feature is the integrated compliance recording because this is very useful for interpretation of the study outcome. The electrical stimulation training has shown that even with relatively small induced contraction intensity we still get some increase in the achievable voluntary extension torque.

Explosive Strength of the Knee Extensors: The Influence of Criterion Trial Detection Methodology on Measurement Reproducibility.

PubMed

Dirnberger, Johannes; Wiesinger, Hans-Peter; Wiemer, Nicolas; Kösters, Alexander; Müller, Erich

2016-04-01

The present study was conducted to assess test-retest reproducibility of explosive strength measurements during single-joint isometric knee extension using the IsoMed 2000 dynamometer. Thirty-one physically active male subjects (mean age: 23.7 years) were measured on two occasions separated by 48-72 h. The intraclass correlation coefficient (ICC 2,1) and the coefficient of variation (CV) were calculated for (i) maximum torque (MVC), (ii) the peak rate of torque development (RTD peak ) as well as for (iii) the average rate of torque development (RTD) and the impulse taken at several predefined time intervals (0-30 to 0-300 ms); thereby explosive strength variables were derived in two conceptually different versions: on the one hand from the MVC-trial (version I), on the other hand from the trial showing the RTD peak (version II). High ICC-values (0.80-0.99) and acceptable CV-values (1.9-8.7%) could be found for MVC as well as for the RTD and the impulse taken at time intervals of ≥100 ms, regardless of whether version I or II was used. In contrast, measurements of the RTD peak as well as the RTD and the impulse taken during the very early contraction phase (i.e. RTD/impulse 0-30ms and RTD/impulse 0-50ms ) showed clearly weaker reproducibility results (ICC: 0.53-0.84; CV: 7.3-16.4%) and gave rise to considerable doubts as to clinical usefulness, especially when derived using version I. However, if there is a need to measure explosive strength for earlier time intervals in practice, it is, in view of stronger reproducibility results, recommended to concentrate on measures derived from version II, which is based on the RTD peak -trial.

Relationship between leg extensor muscle strength and knee joint loading during gait before and after total knee arthroplasty.

PubMed

Vahtrik, Doris; Gapeyeva, Helena; Ereline, Jaan; Pääsuke, Mati

2014-01-01

The aim of the present study was to evaluate an isometric maximal voluntary contraction (MVC) force of the leg extensor muscles and its relationship with knee joint loading during gait prior and after total knee arthroplasty (TKA). Custom-made dynamometer was used to assess an isometric MVC force of the leg extensor muscles and 3-D motion analysis system was used to evaluate the knee joint loading during gait in 13 female patients (aged 49-68 years) with knee osteoarthritis. Patients were evaluated one day before, and three and six months following TKA in the operated and non-operated leg. Six months after TKA, MVC force of the leg extensor muscles for the operated leg did not differ significantly as compared to the preoperative level, whereas it remained significantly lower for the non-operated leg and controls. The knee flexion moment and the knee joint power during mid stance of gait was improved six months after TKA, remaining significantly lowered compared with controls. Negative moderate correlation between leg extensor muscles strength and knee joint loading for the operated leg during mid stance was noted three months after TKA. The correlation analysis indicates that due to weak leg extensor muscles, an excessive load is applied to knee joint during mid stance of gait in patients, whereas in healthy subjects stronger knee-surrounding muscles provide stronger knee joint loading during gait. III (correlational study). Copyright © 2013 Elsevier B.V. All rights reserved.

Blackcurrant Alters Physiological Responses and Femoral Artery Diameter during Sustained Isometric Contraction

PubMed Central

Cook, Matthew David; Myers, Stephen David; Gault, Mandy Lucinda; Willems, Mark Elisabeth Theodorus

2017-01-01

Blackcurrant is rich in anthocyanins that may affect exercise-induced physiological responses. We examined tissue oxygen saturation, muscle activity, cardiovascular responses and femoral artery diameter during a submaximal sustained isometric contraction. In a randomised, double-blind, crossover design, healthy men (n = 13, age: 25 ± 4 years, BMI: 25 ± 3 kg·m−2, mean ± SD) ingested New Zealand blackcurrant (NZBC) extract (600 mg∙day−1 CurraNZ™) or placebo (PL) for 7-days separated by 14-days washout. Participants produced isometric maximal voluntary contractions (iMVC) and a 120-s 30%iMVC of the quadriceps with electromyography (EMG), near-infrared spectroscopy, hemodynamic and ultrasound recordings. There was no effect of NZBC extract on iMVC (NZBC: 654 ± 73, PL: 650 ± 78 N). During the 30%iMVC with NZBC extract, total peripheral resistance, systolic, diastolic, and mean arterial pressure were lower with increased cardiac output and stroke volume. With NZBC extract, EMG root mean square of the vastus medialis and muscle oxygen saturation were lower with higher total haemoglobin. During the 30%iMVC, femoral artery diameter was increased with NZBC extract at 30 (6.9%), 60 (8.2%), 90 (7.7%) and 120 s (6.0%). Intake of NZBC extract for 7-days altered cardiovascular responses, muscle oxygen saturation, muscle activity and femoral artery diameter during a 120-s 30%iMVC of the quadriceps. The present study provides insight into the potential mechanisms for enhanced exercise performance with intake of blackcurrant. PMID:28555052

SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication

PubMed Central

Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi

2013-01-01

Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434

Effect of high-intensity intermittent cycling sprints on neuromuscular activity.

PubMed

Billaut, F; Basset, F A; Giacomoni, M; Lemaître, F; Tricot, V; Falgairette, G

2006-01-01

High-intensity intermittent sprints induce changes in metabolic and mechanical parameters. However, very few data are available about electrical manifestations of muscle fatigue following such sprints. In this study, quadriceps electromyographic (EMG) responses to repeated all-out exercise bouts of short duration were assessed from maximal voluntary isometric contractions (MVC) performed before and after sprints. Twelve men performed ten 6-s maximal cycling sprints, separated by 30-s rest. The MVC were performed pre-sprints ( pre), post-sprints ( post), and 5 min post-sprints ( post5). Values of root-mean-square (RMS) and median frequency (MF) of vastus lateralis (VL) and vastus medialis (VM) were recorded during each MVC. During sprints, PPO decreased significantly in sprints 8, 9, and 10, compared to sprint 1 (- 8 %, - 10 %, and - 11 %, respectively, p < 0.05). Significant decrements were found in MVC post (- 13 %, p < 0.05) and MVC post5 (- 10.5 %, p < 0.05) compared to MVC pre. The RMS value of VL muscle increased significantly after sprints (RMS pre vs. RMS post: + 15 %, p < 0.05). Values of MF decreased significantly in both VL and VM after sprints. In conclusion, our results indicate that the increase in quadriceps EMG amplitude following high-intensity intermittent short sprints was not sufficient to maintain the required force output. The concomitant decrease in frequency components would suggest a modification in the pattern of muscle fiber recruitment, and a decrease in conduction velocity of active fibers.

Pharmacodynamic activity of Dapivirine and Maraviroc single entity and combination topical gels for HIV-1 prevention

PubMed Central

Dezzutti, Charlene S.; Yandura, Sarah; Wang, Lin; Moncla, Bernard; Teeple, Elizabeth A.; Devlin, Brid; Nuttall, Jeremy; Brown, Elizabeth R.; Rohan, Lisa C.

2015-01-01

Purpose Dapivirine (DPV), a non-nucleoside reverse transcriptase inhibitor, and maraviroc (MVC), a CCR5 antagonist, were formulated into aqueous gels designed to prevent mucosal HIV transmission. Methods 0.05% DPV, 0.1% MVC, 0.05% DPV/0.1% MVC and placebo gels were evaluated for pH, viscosity, osmolality, and in vitro release. In vitro assays and mucosal tissues were used to evaluate anti-HIV activity. Viability (Lactobacilli only) and epithelial integrity in cell lines and mucosal tissues defined safety. Results The gels were acidic and viscous. DPV gel had an osmolality of 893 mOsm/kg while the other gels had an osmolality of <100 mOsm/kg. MVC release was similar from the single and combination gels (~5 μg/cm2/min1/2), while DPV release was 10-fold less from the single as compared to the combination gel (0.4331 μg/cm2/min1/2). Titrations of the gels showed 10-fold more drug was needed to protect ectocervical than colonic tissue. The combination gel showed ~10- and 100-fold improved activity as compared to DPV and MVC gel, respectively. All gels were safe. Conclusions The DPV/MVC gel showed a benefit blocking HIV infection of mucosal tissue compared to the single entity gels. Combination products with drugs affecting unique steps in the viral replication cycle would be advantageous for HIV prevention. PMID:26078001

Radial pulse waveform and parameters in different types of athletes

PubMed Central

Wang, An-Ran; Su, Jun; Zhang, Song; Yang, Lin

2016-01-01

Objective: To classify the sports events by the maximal oxygen uptake (MaxO2) and the maximal muscular voluntary contraction (MVC) and to collect the radial pulse wave of different sports events and discuss the pulse waveform and characteristic parameters. Patients or other participants: 304 professional athletes were enrolled from Beijing Muxiyuan Sports Technical School. Main outcome measure(s): Normalize each radial pulse waveform and let the waveform cycle and amplitude distribute in the range of 0-100. Analyze the relative time of the maximum point Tm, the abscissa X and ordinate Y of dicrotic notch, the pulse waveform area K and the pulse wave age index SDPTG. Results: According to the different degree of MaxO2 and MVC, the radial descending curves have the distinctive downtrend. The characteristic parameters of MaxO2 and MVC groups, such as Tm, X, Y, K and SDPTG are as well as different. Conclusions: The pulse waveform changing trend of MVC (< 50%) group and MVC (> 50%) group are different while the sports have the same MaxO2. And the pulse waveform changing trend of MaxO2 (< 40%) group, MaxO2 (40-70%) group and MaxO2 (> 70%) group are as well as different while the sports have the same MVC. The various parameters of the most specific group F are the smallest suggests the sports in group F are the most benefit for the cardiovascular. PMID:27158404

Digging navigable waterways through lagoon tidal flats: which short and long-term impacts on groundwater dynamics and quality?

NASA Astrophysics Data System (ADS)

Teatini, Pietro; Isotton, Giovanni; Nardean, Stefano; Ferronato, Massimiliano; Tosi, Luigi; Da Lio, Cristina; Zaggia, Luca; Bellafiore, Debora; Zecchin, Massimo; Baradello, Luca; Corami, Fabiana; Libralato, Giovanni; Morabito, Elisa; Broglia, Riccardo; Zaghi, Stefano

2017-04-01

Coastal lagoons are highly valued ephemeral habitats that have experienced in many cases the pressure of human activities since the development of urbanisation and economic activities within or around their boundaries. One typical intervention is dredging of canals to increase the exchange of water with the sea or for navigation purposes. In order to divert the route of large cruise liners from the historic center of Venice, Italy, the Venice Port Authority has recently proposed a project for the dredging of a new 3-km long and 10-m deep navigation canal (called Marghera-Venice Canal, MVC, in the sequel) through the shallows of the Venice Lagoon. The MVC will connect the passenger terminal located in the southwestern part of the historic center to a main channel that reaches the industrial area on the western lagoon margin. Can the new MVC facilitate saltwater intrusion below the lagoon bottom? Can the release into the lagoon of the chemicals detected in the groundwater around the industrial site be favoured by the MVC excavation? Can the depression waves generated by the ship transit (known as ship-wakes) along the MVC affect the flow and contaminant exchange between the subsurface and surficial systems? A response to these questions has been provided by the use of uncoupled and coupled density-dependent groundwater flow and transport simulators. The hydrogeological modelling has been supported by an in-depth characterization of the Venice lagoon subsurface along the MVC. Geophysical surveys, laboratory analyses on groundwater and sediment samples, in-situ measurements through piezometers and pressure sensors, and the outcome of 3D hydrodynamic and computational fluid dynamic (CFD) models have been used to set-up and calibrate the subsurface multi-model approach. The modelling results can be summarized as follows: i) the MVC has a negligible effect in relation to the propagation of the tidal regime into the subsoil; ii) the depression caused by the ship transit along the MVC is responsible of a groundwater efflux from the canal bottom into the lagoon ranging up to 100 m3 per ship; iii) ship-wakes enhance the release of anthropogenic contaminants (As, Se, Cd, Hg, Pb, Cu, Cr) from the subsoil into the lagoon over few years after the canal excavation; iv) the MVC excavation cut the over-consolidated clay layer marking the Holocene-Pleistocene limit, thus favouring a localized salt contamination of the almost fresh-water aquifers located in the uppermost part of the Pleistocene series.

Unexpected factors affecting the excitability of human motoneurones in voluntary and stimulated contractions

PubMed Central

Khan, Serajul I.; Taylor, Janet L.

2016-01-01

Key points The output of human motoneurone pools decreases with fatiguing exercise, but the mechanisms involved are uncertain. We explored depression of recurrent motoneurone discharges (F‐waves) after sustained maximal voluntary contractions (MVCs).MVC depressed the size and frequency of F‐waves in a hand muscle but a submaximal contraction (at 50% MVC) did not.Surprisingly, activation of the motoneurones antidromically by stimulation of the ulnar nerve (at 20 or 40 Hz) did not depress F‐wave area or persistence.Furthermore, a sustained (3 min) MVC of a hand muscle depressed F‐waves in its antagonist but not in a remote hand muscle.Our findings suggest that depression of F‐waves after voluntary contractions is not simply due to repetitive activation of the motoneurones but requires descending voluntary drive.  Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools. Abstract There are major spinal changes induced by repetitive activity and fatigue that could contribute to ‘central’ fatigue but the mechanisms involved are poorly understood in humans. Here we confirmed that the recurrent motoneuronal discharge (F‐wave) is reduced during relaxation immediately after a sustained maximal voluntary contraction (MVC) of an intrinsic hand muscle (abductor digiti minimi, ADM) and explored the relationship between motoneurone firing and the depression of F‐waves in three ways. First, the depression (in both F‐wave area and F‐wave persistence) was present after a 10 s MVC (initial decrease 36.4 ± 19.1%; mean ± SD) but not after a submaximal voluntary contraction at 50% maximum. Second, to evoke motoneurone discharge without volitional effort, 10 s tetanic contractions were produced by supramaximal ulnar nerve stimulation at the elbow at physiological frequencies of 25 and 40 Hz. Surprisingly, neither produced depression of F‐waves in ADM to test supramaximal stimulation of the ulnar nerve at the wrist. Finally, a sustained MVC (3 min) of the antagonist to ADM (4th palmar interosseous) depressed F‐waves in the anatomically close ADM (20 ± 18.2%) but not in the more remote first dorsal interosseous on the radial side of the hand. We argue that depression of F‐waves after voluntary contractions may not be due to repetitive activation of the motoneurones but requires descending voluntary drive. Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools and it reveals potentially novel mechanisms controlling the output of human motoneurones. PMID:26940402

Unexpected factors affecting the excitability of human motoneurones in voluntary and stimulated contractions.

PubMed

Khan, Serajul I; Taylor, Janet L; Gandevia, Simon C

2016-05-15

The output of human motoneurone pools decreases with fatiguing exercise, but the mechanisms involved are uncertain. We explored depression of recurrent motoneurone discharges (F-waves) after sustained maximal voluntary contractions (MVCs). MVC depressed the size and frequency of F-waves in a hand muscle but a submaximal contraction (at 50% MVC) did not. Surprisingly, activation of the motoneurones antidromically by stimulation of the ulnar nerve (at 20 or 40 Hz) did not depress F-wave area or persistence. Furthermore, a sustained (3 min) MVC of a hand muscle depressed F-waves in its antagonist but not in a remote hand muscle. Our findings suggest that depression of F-waves after voluntary contractions is not simply due to repetitive activation of the motoneurones but requires descending voluntary drive.  Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools. There are major spinal changes induced by repetitive activity and fatigue that could contribute to 'central' fatigue but the mechanisms involved are poorly understood in humans. Here we confirmed that the recurrent motoneuronal discharge (F-wave) is reduced during relaxation immediately after a sustained maximal voluntary contraction (MVC) of an intrinsic hand muscle (abductor digiti minimi, ADM) and explored the relationship between motoneurone firing and the depression of F-waves in three ways. First, the depression (in both F-wave area and F-wave persistence) was present after a 10 s MVC (initial decrease 36.4 ± 19.1%; mean ± SD) but not after a submaximal voluntary contraction at 50% maximum. Second, to evoke motoneurone discharge without volitional effort, 10 s tetanic contractions were produced by supramaximal ulnar nerve stimulation at the elbow at physiological frequencies of 25 and 40 Hz. Surprisingly, neither produced depression of F-waves in ADM to test supramaximal stimulation of the ulnar nerve at the wrist. Finally, a sustained MVC (3 min) of the antagonist to ADM (4th palmar interosseous) depressed F-waves in the anatomically close ADM (20 ± 18.2%) but not in the more remote first dorsal interosseous on the radial side of the hand. We argue that depression of F-waves after voluntary contractions may not be due to repetitive activation of the motoneurones but requires descending voluntary drive. Furthermore, this effect may depress nearby, but not distant, spinal motoneurone pools and it reveals potentially novel mechanisms controlling the output of human motoneurones. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

High-threshold motor unit firing reflects force recovery following a bout of damaging eccentric exercise.

PubMed

Macgregor, Lewis J; Hunter, Angus M

2018-01-01

Exercise-induced muscle damage (EIMD) is associated with impaired muscle function and reduced neuromuscular recruitment. However, motor unit firing behaviour throughout the recovery period is unclear. EIMD impairment of maximal voluntary force (MVC) will, in part, be caused by reduced high-threshold motor unit firing, which will subsequently increase to recover MVC. Fourteen healthy active males completed a bout of eccentric exercise on the knee extensors, with measurements of MVC, rate of torque development and surface electromyography performed pre-exercise and 2, 3, 7 and 14 days post-exercise, on both damaged and control limb. EIMD was associated with decreased MVC (235.2 ± 49.3 Nm vs. 161.3 ± 52.5 Nm; p <0.001) and rate of torque development (495.7 ± 136.9 Nm.s-1 vs. 163.4 ± 163.7 Nm.s-1; p <0.001) 48h post-exercise. Mean motor unit firing rate was reduced (16.4 ± 2.2 Hz vs. 12.6 ± 1.7 Hz; p <0.01) in high-threshold motor units only, 48h post-exercise, and common drive was elevated (0.36 ± 0.027 vs. 0.56 ± 0.032; p< 0.001) 48h post-exercise. The firing rate of high-threshold motor units was reduced in parallel with impaired muscle function, whilst early recruited motor units remained unaltered. Common drive of motor units increased in offset to the firing rate impairment. These alterations correlated with the recovery of force decrement, but not of pain elevation. This study provides fresh insight into the central mechanisms associated with EIMD recovery, relative to muscle function. These findings may in turn lead to development of novel management and preventative procedures.

Upper limb discomfort profile due to intermittent isometric pronation torque at different postural combinations of the shoulder-arm system.

PubMed

Mukhopadhyay, Prabir; O'Sullivan, Leonard W; Gallwey, Timothy J

2009-05-01

Twenty-seven right-handed male university students participated in this study, which comprised a full factorial model consisting of three forearm rotation angles (60% prone and supine and neutral range of motion), three elbow angles (45 degrees , 90 degrees and 135 degrees ), three upper arm angles (45 degrees flexion/extension and neutral), one exertion frequency (15 per min) and one level of pronation torque (20% maximum voluntary contraction (MVC) relative to MVC at each articulation). Discomfort rating after the end of each 5 min treatment was recorded on a visual analogue scale. Results of a repeated measures analysis of covariance on discomfort score, with torque endurance time as covariate, indicated that none of the factors was significant including torque endurance time (p = 0.153). An initial data collection phase preceded the main experiment in order to ensure that participants exerted exactly 20% MVC of the particular articulation. In this phase MVC pronation torque was measured at each articulation. The data revealed a significant forearm rotation angle effect (p = 0.001) and participant effect (p = 0.001). Of the two-way interactions, elbow*participant (p = 0.004), forearm*participant (p = 0.001) and upper arm*participant (p = 0.005) were the significant factors. Electromyographic activity of the pronator teres and biceps brachii muscles revealed no significant change in muscle activity in most of the articulations. Industrial jobs involving deviated upper arm postures are typical in industry but have a strong association with injury. Data from this study will enable better understanding of the effects of deviated upper arm postures on musculoskeletal disorders and can also be used to identify and control high-risk tasks in industry.

Does photobiomodulation therapy is better than cryotherapy in muscle recovery after a high-intensity exercise? A randomized, double-blind, placebo-controlled clinical trial.

PubMed

De Marchi, Thiago; Schmitt, Vinicius Mazzochi; Machado, Guilherme Pinheiro; de Sene, Juliane Souza; de Col, Camila Dallavechia; Tairova, Olga; Salvador, Mirian; Leal-Junior, Ernesto Cesar Pinto

2017-02-01

This study aimed to determine the effectiveness of photobiomodulation therapy (PBMT) and cryotherapy, in isolated and combined forms, as muscle recovery techniques after muscle fatigue-inducing protocol. Forty volunteers were randomly divided into five groups: a placebo group (PG); a PBMT group (PBMT); a cryotherapy group (CG); a cryotherapy-PBMT group (CPG); and a PBMT-cryotherapy group (PCG). All subjects performed four sessions at 24-h intervals, during which they submitted to isometric assessment (MVC) and blood collection in the pre-exercise period, and 5 and 60 min post-exercise, while the muscle fatigue induction protocol occurred after the pre-exercise collections. In the remaining sessions performed 24, 48, and 72 h later, only blood collections and MVCs were performed. A single treatment with PBMT and/or cryotherapy was applied after only 2 min of completing the post-5-min MVC test at the first session. In the intragroup comparison, it was found that exercise led to a significant decrease (p < 0.05) in the production of MVC in all groups. Comparing the results of MVCs between groups, we observed significant increases in the MVC capacity of the PBMT, CPG, and PCG volunteers in comparison with both PG and CG (p < 0.05). We observed a significant decrease in the concentrations of the biochemical markers of oxidative damage (TBARS and PC) in all groups and muscle damage (creatine kinase-CK) in the PBMT, PCG, and CPG compared with the PG (p < 0.01). The clinical impact of these findings is clear because they demonstrate that the use of phototherapy is more effective than the use of cryotherapy for muscle recovery, additionally cryotherapy decreases PBMT efficacy.

High-threshold motor unit firing reflects force recovery following a bout of damaging eccentric exercise

PubMed Central

Macgregor, Lewis J.

2018-01-01

Exercise-induced muscle damage (EIMD) is associated with impaired muscle function and reduced neuromuscular recruitment. However, motor unit firing behaviour throughout the recovery period is unclear. EIMD impairment of maximal voluntary force (MVC) will, in part, be caused by reduced high-threshold motor unit firing, which will subsequently increase to recover MVC. Fourteen healthy active males completed a bout of eccentric exercise on the knee extensors, with measurements of MVC, rate of torque development and surface electromyography performed pre-exercise and 2, 3, 7 and 14 days post-exercise, on both damaged and control limb. EIMD was associated with decreased MVC (235.2 ± 49.3 Nm vs. 161.3 ± 52.5 Nm; p <0.001) and rate of torque development (495.7 ± 136.9 Nm.s-1 vs. 163.4 ± 163.7 Nm.s-1; p <0.001) 48h post-exercise. Mean motor unit firing rate was reduced (16.4 ± 2.2 Hz vs. 12.6 ± 1.7 Hz; p <0.01) in high-threshold motor units only, 48h post-exercise, and common drive was elevated (0.36 ± 0.027 vs. 0.56 ± 0.032; p< 0.001) 48h post-exercise. The firing rate of high-threshold motor units was reduced in parallel with impaired muscle function, whilst early recruited motor units remained unaltered. Common drive of motor units increased in offset to the firing rate impairment. These alterations correlated with the recovery of force decrement, but not of pain elevation. This study provides fresh insight into the central mechanisms associated with EIMD recovery, relative to muscle function. These findings may in turn lead to development of novel management and preventative procedures. PMID:29630622

Hiking physiology and the "quasi-isometric" concept.

PubMed

Spurway, Neil C

2007-08-01

The literature indicates that the heart rate of a planing-dinghy sailor, in winds of 4 - 5 m . s(-1), is in the range seen in aerobic athletes, yet oxygen consumption (VO(2)) is roughly half that of the same individual cycling at that heart rate. Thus, although upper-body dynamic activity is a contributing factor, the dominant physiological demand must be the "quasi-isometric" stress on the lower-body anterior muscles - especially the quadriceps, which appears to impose 40 - 50% of the total oxygen demand in a typical hiking posture. Therefore, a non-trivial part of the sailor's fitness training should involve sustained quadriceps stress. Estimates of this stress on water vary widely in the literature, but about 25 - 30% maximal voluntary contraction (MVC) tallies with endurance times recorded both in the literature and in an outline of new work reported here. Muscle blood flow is restricted under such a load, but not occluded. Laser Doppler measurements of femoral blood flow on a leg-extension ergometer found similar values during 10 - 30% MVC, much less at 40%, and marked hyperaemia on relaxation from 20% MVC or more - implying metabolic debt. Adding low-amplitude alternating leg movements while holding the same overall load stationary, and therefore increasing only internal not external work, further elevates blood flow and VO(2) both during and after exercise. Femoral-vein lactate concentration is also higher after these movements. Speculations that unusually dynamic lower-body movements by elite sailors might assist hiking endurance are not supported by these findings. Nevertheless, afloat or ashore, capillary lactate concentrations hardly ever exceed 5 mmol . l(-1), even during the post-exercise surge - challenging assumptions that the quadriceps had been profoundly anaerobic while under load. On the contrary, it appears that aerobic metabolism contributes substantially, if not completely, to energy supply. A preliminary comparison of elite sailors with aerobic athletes suggests that isometric endurance at a given percentage MVC does not differ between the two groups, but the sailors have higher MVCs. In individuals not highly strength-trained, greater electromyogram activity immediately before capitulation than in an MVC performed while fresh indicates that physiological (not just volitional) limits have been reached. It is concluded that the literature and the outline of my recent work with colleagues support the view that the predominant physiological load during single-handed dinghy sailing is quasi-isometric in form and accounts for roughly half of the metabolic demand. Any more complete account of the physiology of hiking will require simultaneous on-water measurement of electromyographic, cardiovascular, and metabolic indicators in sailors extending from club to Gold Medal standard.

Parametric optimization of the MVC desalination plant with thermomechanical compressor

NASA Astrophysics Data System (ADS)

Blagin, E. V.; Biryuk, V. V.; Anisimov, M. Y.; Shimanov, A. A.; Gorshkalev, A. A.

2018-03-01

This article deals with parametric optimization of the Mechanical Vapour Compression (MVC) desalination plant with thermomechanical compressor. In this plants thermocompressor is used instead of commonly used centrifugal compressor. Influence of two main parameters was studied. These parameters are: inlet pressure and number of stages. Analysis shows that it is possible to achieve better plant performance in comparison with traditional MVC plant. But is required reducing the number of stages and utilization of low or high initial pressure with power consumption maximum at approximately 20-30 kPa.

Effects of Barbell Deadlift Training on Submaximal Motor Unit Firing Rates for the Vastus Lateralis and Rectus Femoris

PubMed Central

Stock, Matt S.; Thompson, Brennan J.

2014-01-01

Previous investigations that have studied motor unit firing rates following strength training have been limited to small muscles, isometric training, or interventions involving exercise machines. We examined the effects of ten weeks of supervised barbell deadlift training on motor unit firing rates for the vastus lateralis and rectus femoris during a 50% maximum voluntary contraction (MVC) assessment. Twenty-four previously untrained men (mean age  = 24 years) were randomly assigned to training (n = 15) or control (n = 9) groups. Before and following the intervention, the subjects performed isometric testing of the right knee extensors while bipolar surface electromyographic signals were detected from the two muscles. The signals were decomposed into their constituent motor unit action potential trains, and motor units that demonstrated accuracy levels less than 92.0% were not considered for analysis. One thousand eight hundred ninety-two and 2,013 motor units were examined for the vastus lateralis and rectus femoris, respectively. Regression analyses were used to determine the linear slope coefficients (pulses per second [pps]/% MVC) and y-intercepts (pps) of the mean firing rate and firing rate at recruitment versus recruitment threshold relationships. Deadlift training significantly improved knee extensor MVC force (Cohen's d = .70), but did not influence force steadiness. Training had no influence on the slopes and y-intercepts for the mean firing rate and firing rate at recruitment versus recruitment threshold relationships. In agreement with previous cross-sectional comparisons and randomized control trials, our findings do not support the notion that strength training affects the submaximal control of motor units. PMID:25531294

Calibration of EMG to force for knee muscles is applicable with submaximal voluntary contractions.

PubMed

Doorenbosch, Caroline A M; Joosten, Annemiek; Harlaar, Jaap

2005-08-01

In this study, the influence of using submaximal isokinetic contractions about the knee compared to maximal voluntary contractions as input to obtain the calibration of an EMG-force model for knee muscles is investigated. Isokinetic knee flexion and extension contractions were performed by healthy subjects at five different velocities and at three contraction levels (100%, 75% and 50% of MVC). Joint angle, angular velocity, joint moment and surface EMG of five knee muscles were recorded. Individual calibration values were calculated according to [C.A.M. Doorenbosch, J. Harlaar, A clinically applicable EMG-force model to quantify active stabilization of the knee after a lesion of the anterior cruciate ligament, Clinical Biomechanics 18 (2003) 142-149] for each contraction level. First, the output of the model, calibrated with the 100% MVC was compared to the actually exerted net knee moment at the dynamometer. Normalized root mean square errors were calculated [A.L. Hof, C.A.N. Pronk, J.A. van Best, Comparison between EMG to force processing and kinetic analysis for the calf muscle moment in walking and stepping, Journal of Biomechanics 20 (1987) 167-187] to compare the estimated moments with the actually exerted moments. Mean RMSD errors ranged from 0.06 to 0.21 for extension and from 0.12 to 0.29 for flexion at the 100% trials. Subsequently, the calibration results of the 50% and 75% MVC calibration procedures were used. A standard signal, representing a random EMG level was used as input in the EMG force model, to compare the three models. Paired samples t-tests between the 100% MVC and the 75% MVC and 50% MVC, respectively, showed no significant differences (p>0.05). The application of submaximal contractions of larger than 50% MVC is suitable to calibrate a simple EMG to force model for knee extension and flexion. This means that in clinical practice, the EMG to force model can be applied by patients who cannot exert maximal force.

Surface electromyographic evaluation of jaw muscles in children with unilateral crossbite and lateral shift in the early mixed dentition. Sexual dimorphism

PubMed Central

Lenguas, Leticia; Alarcón, José-Antonio; Venancio, Filipa; Kassem, Marta

2012-01-01

Objectives: To examine the activity of jaw muscles at rest and during maximal voluntary clenching (MVC) in children with unilateral posterior crossbite (UPXB) and functional lateral shift in the early mixed dentition and to evaluate sex differences. Material and Methods: The sample included 30 children (15 males, 15 females) aged 6 to 10 years old, with UPXB and functional mandibular lateral shift (≥1.5 mm) in the early mixed dentition. sEMG activity coming from the muscle areas (anterior temporalis [AT], posterior temporalis [PT], masseter [MA] and suprahyoid [SH]) were obtained from both the crossbite (XB) and noncrossbite (NONXB) sides at mandibular rest position. sEMG acti-vity of the bilateral AT and MA muscles sides was obtained during MVC. Asymmetry and activity indexes were calculated for each muscle area at rest and during MVC; the MA/TA ratio during MVC was also determined. Results: At rest, no differences were found between sexes for any muscle areas or asymmetry and activity indexes. No differences were found between XB and NONXB sides. During MVC, however, significant sex differences were found in AT and MA activity, with higher sEMG values in males than in females, on both XB and NONXB sides. Asymmetry indexes, activity indexes and MA/AT ratios did not show significant differences between the sexes. Activity was symmetric both in males and in females. Conclusions: At rest, no sex differences were found, but during MVC males showed higher activity than did females in both XB and NONXB AT and MA muscle areas. Muscular activity was symmetrical at rest and during MVC in both sexes. Sexual dimorphism should be considered in the diagnosis and treatment of UPXB and lateral shift in the early mixed dentition. Key words:Unilateral crossbite, mandibular shift, jaw muscles, sEMG, early mixed dentition. PMID:22926468

Building tribal traffic safety capacity

DOT National Transportation Integrated Search

2007-12-01

Nationally, the annual motor vehicle crash (MVC) mortality rates for American Indians per 100,000 persons have been three to four times greater than the general public. This trend has also been consistently evident in Arizona. The annual MVC mortalit...

Using emergency department-based inception cohorts to determine genetic characteristics associated with long term patient outcomes after motor vehicle collision: methodology of the CRASH study.

PubMed

Platts-Mills, Timothy F; Ballina, Lauren; Bortsov, Andrey V; Soward, April; Swor, Robert A; Jones, Jeffrey S; Lee, David C; Peak, David A; Domeier, Robert M; Rathlev, Niels K; Hendry, Phyllis L; McLean, Samuel A

2011-09-26

Persistent musculoskeletal pain and psychological sequelae following minor motor vehicle collision (MVC) are common problems with a large economic cost. Prospective studies of pain following MVC have demonstrated that demographic characteristics, including female gender and low education level, and psychological characteristics, including high pre-collision anxiety, are independent predictors of persistent pain. These results have contributed to the psychological and social components of a biopsychosocial model of post-MVC pain pathogenesis, but the biological contributors to the model remain poorly defined. Recent experimental studies indicate that genetic variations in adrenergic system function influence the vulnerability to post-traumatic pain, but no studies have examined the contribution of genetic factors to existing predictive models of vulnerability to persistent pain. The Project CRASH study is a federally supported, multicenter, prospective study designed to determine whether variations in genes affecting synaptic catecholamine levels and alpha and beta adrenergic receptor function augment social and psychological factors in a predictive model of persistent musculoskeletal pain and posttraumatic stress disorder (PTSD) following minor MVC. The Project CRASH study will assess pain, pain interference and PTSD symptoms at 6 weeks, 6 months, and 1 year in approximately 1,000 patients enrolled from 8 Emergency Departments in four states with no-fault accident laws. The results from this study will provide insights into the pathophysiology of persistent pain and PTSD following MVC and may serve to improve the ability of clinicians and researchers to identify individuals at high risk for adverse outcomes following minor MVC.

The effects of accumulated muscle fatigue on the mechanomyographic waveform: implications for injury prediction.

PubMed

Tosovic, D; Than, C; Brown, J M M

2016-08-01

Muscle fatigue has been identified as a risk factor for spontaneous muscle injuries in sport. However, few studies have investigated the accumulated effects of muscle fatigue on human muscle contractile properties. This study aimed to determine whether repeated bouts of exercise inducing acute fatigue leads to longer-term fatigue-related changes in muscle contractile properties. Maximum voluntary contraction (MVC), electromyographic (EMG) and mechanomyographic (MMG) measures were recorded in the biceps brachii of 11 participants for 13 days, before and after a maximally fatiguing exercise protocol. The exercise protocol involved participants repetitively lifting a weight (concentric contractions only) equal to 40 % MVC, until failure. A significant (p < 0.05) acute pre- to post-exercise decline of biceps brachii MVC and median power frequency (MPF) was observed each day, whilst no difference existed between pre-exercise MVC or MPF values on subsequent days (days 2-13). However, decreases in number of lift repetitions and in pre-exercise MMG values of muscle belly displacement, contraction velocity and half-relaxation velocity were observed through to day 13. Whilst MVC and MPF measures resolved by the following day's test session, MMG measures indicated an ongoing decrement in muscle performance through days 2-13 consistent with the decline in lift repetitions observed. These results suggest that MMG may be more sensitive in detecting accumulated muscle fatigue than the 'gold standard' measures of MVC/MPF. Considering that muscle fatigue leads to injury, the on-going monitoring of MMG derived contractile properties of muscles in athletes may aid in the prediction of fatigued-induced muscle injury.

A Comparison of a Maximum Exertion Method and a Model-Based, Sub-Maximum Exertion Method for Normalizing Trunk EMG

PubMed Central

Cholewicki, Jacek; van Dieën, Jaap; Lee, Angela S.; Reeves, N. Peter

2011-01-01

The problem with normalizing EMG data from patients with painful symptoms (e.g. low back pain) is that such patients may be unwilling or unable to perform maximum exertions. Furthermore, the normalization to a reference signal, obtained from a maximal or sub-maximal task, tends to mask differences that might exist as a result of pathology. Therefore, we presented a novel method (GAIN method) for normalizing trunk EMG data that overcomes both problems. The GAIN method does not require maximal exertions (MVC) and tends to preserve distinct features in the muscle recruitment patterns for various tasks. Ten healthy subjects performed various isometric trunk exertions, while EMG data from 10 muscles were recorded and later normalized using the GAIN and MVC methods. The MVC method resulted in smaller variation between subjects when tasks were executed at the three relative force levels (10%, 20%, and 30% MVC), while the GAIN method resulted in smaller variation between subjects when the tasks were executed at the three absolute force levels (50 N, 100 N, and 145 N). This outcome implies that the MVC method provides a relative measure of muscle effort, while the GAIN-normalized EMG data gives an estimate of the absolute muscle force. Therefore, the GAIN-normalized EMG data tends to preserve the EMG differences between subjects in the way they recruit their muscles to execute various tasks, while the MVC-normalized data will tend to suppress such differences. The appropriate choice of the EMG normalization method will depend on the specific question that an experimenter is attempting to answer. PMID:21665489

The interactive effect of cooling and hypoxia on forearm fatigue development.

PubMed

Lloyd, Alex; Hodder, Simon; Havenith, George

2015-09-01

To examine the effect of separate and combined exposure to hypoxia [normoxia (FIO2 = 0.21) vs. moderate altitude (FIO2 = 0.13)] and temperature [thermoneutral (22 °C) vs. cold (5 °C)] on muscle fatigue development in the forearm, after repeated low-resistance contractions. Eight males were exposed for 70 min to four separate conditions in a balanced order. Conditions were normoxic-thermoneutral (N), hypoxic-thermoneutral, normoxic-cold and hypoxic-cold. After 15-min seated rest, participants carried out intermittent dynamic forearm exercise at 15 % maximal isometric voluntary contraction (MVC) for eight consecutive, 5-min work bouts. Each bout was separated by 110 s rest during which MVC force was collected. When exposed to hypoxia and cold independently, the exercise protocol decreased MVC force of the finger flexors by 8.1 and 13.9 %, respectively, compared to thermoneutral normoxia. When hypoxia and cold were combined, the decrease in MVC force was 21.4 % more than thermoneutral normoxia, reflecting an additive effect and no interaction. EMG relative to force produced during MVC, increased by 2 and 1.2 μV per kg (36 and 23 % of N) for cold and hypoxia, respectively. When the stressors were combined the effect was additive, increasing to 3.1 μV per kg (56 % of N). When compared to exercise in thermoneutral normoxic conditions, both cold and hypoxia significantly reduce brief MVC force output. This effect appears to be of mechanical origin, not a failure in muscle fibre recruitment per se. Additionally, the reduction in force is greater when the stressors are combined, showing an additive effect.

Gender differences in the circadian variations in muscle strength assessed with and without superimposed electrical twitches.

PubMed

Giacomoni, Magali; Edwards, Ben; Bambaeichi, Effat

The circadian rhythm in muscle strength was analysed in 12 males (28 +/- 4 years, 79.6 +/- 12.3 kg, 1.80 +/- 0.05 m) and eight females (28 +/- 4 years, 60.3 +/- 5.5 kg, 1.61 +/- 0.08 m). After two familiarization sessions, participants were tested at six different times of the day (02:00, 06:00, 10:00, 14:00, 18:00 and 22:00 hours), the order of which was randomly assigned over 3-4 days. Rectal temperature (T(rec)) was measured over 30 min before each test. Peak isokinetic torques (PT) of knee extensors and flexors were then measured at 1.05 rad s(-1) and 3.14 rad s(-1) through a 90 degrees range of motion. Maximal isometric voluntary contraction (MVC) of knee extensors and flexors was measured at 60 degrees of knee flexion and the MVC of knee extensors was also assessed with superimposed electrical twitches (50 Hz, 250 V, 200 mus pulse width) in order to control for motivational effects. Three trials were performed in each condition, separated by 3 min recovery, and the highest values were retained for subsequent analyses. A significant circadian rhythm was observed for T(rec) in both males and females (acrophase, Phi, 17:29 and 16:40 hours; mesor, Me, 37.0 and 36.8 degrees C; amplitude, A, 0.28 and 0.33 degrees C for males and females, respectively). The mesor of T(rec) was higher in males than in females (p < 0.05). Significant circadian rhythms were observed for knee extensor PT at 3.14 rad s(-1) in males (Phi, 17:06 hours; Me, 178.2 N m; A, 4.7 N m) and for knee extensor PT at 1.05 rad s(-1) in females (Phi, 15:35 hours; Me, 128.7 N m; A, 3.7 N m). In males, the MVC of knee extensors demonstrated a significant circadian rhythm, but only when electrical twitches were superimposed (Phi, 16:17 h; Me, 302.1 N m; A, 13.6 N m). Acrophases of all indices of muscle strength were not statistically different between the two groups and were located in the afternoon (12:47 < Phi < 17:16 hours). The amplitude (percentage of mesor) of extensors MVC (electrically stimulated) was higher in males (6.4%) than in females (4.2%; p < 0.05). Significant circadian rhythms were not consistently observed for all indices of muscle strength whatever the gender. Our group of female subjects tended to show lower circadian amplitudes than the males. In males, maximal voluntary contraction of electrically stimulated muscles followed a circadian curve, which was not significant without the superimposed twitches. These results suggest that motivation could have a masking effect on the circadian rhythm in muscle performance and strengthen the view that peripheral factors are implicated in this rhythm.

Muscle activity and spine load during anterior chain whole body linkage exercises: the body saw, hanging leg raise and walkout from a push-up.

PubMed

McGill, Stuart; Andersen, Jordan; Cannon, Jordan

2015-01-01

This study examined anterior chain whole body linkage exercises, namely the body saw, hanging leg raise and walkout from a push-up. Investigation of these exercises focused on which particular muscles were challenged and the magnitude of the resulting spine load. Fourteen males performed the exercises while muscle activity, external force and 3D body segment motion were recorded. A sophisticated and anatomically detailed 3D model used muscle activity and body segment kinematics to estimate muscle force, and thus sensitivity to each individual's choice of motor control for each task. Gradations of muscle activity and spine load characteristics were observed across tasks. On average, the hanging straight leg raise created approximately 3000 N of spine compression while the body saw created less than 2500 N. The hanging straight leg raise created the highest challenge to the abdominal wall (>130% MVC in rectus abdominis, 88% MVC in external oblique). The body saw resulted in almost 140% MVC activation of the serratus anterior. All other exercises produced substantial abdominal challenge, although the body saw did so in the most spine conserving way. These findings, along with consideration of an individual's injury history, training goals and current fitness level, should assist in exercise choice and programme design.

Obesity decreases both whole muscle and fascicle strength in young females but only exacerbates the aging‐related whole muscle level asthenia

PubMed Central

Tomlinson, David J.; Erskine, Robert M.; Winwood, Keith; Morse, Christopher Ian; Onambélé, Gladys L.

2014-01-01

Abstract Obesity has previously been associated with greater muscle strength. Aging, on the other hand, reduces muscle specific force (the force per unit physiological cross‐sectional area [PCSA] of muscle). However, neither the effect of obesity on skeletal muscle specific force nor the combined effects of aging and obesity on this parameter are known. This study aimed to describe the interplay between body mass index (BMI)/adiposity, aging, and skeletal muscle specific force. Ninety‐four untrained healthy women categorized by age into young (Y; mean ± SD: 25.5 ± 9.0 years) versus old (O; 64.8 ± 7.2 years) were assessed for body composition, gastrocnemius medialis (GM) muscle volume (V), net maximum voluntary contraction (nMVC), and specific force (SF). The young obese, while demonstrating 71% and 29% (P < 0.001) higher V and nMVC compared to normal BMI individuals, were in fact 26% (P = 0.007) weaker than these, where V was used to scale nMVC (i.e., nMVC/V). The weakness associated with obesity was further exemplified in the 34% (P < 0.001) lower SF relative to normal BMI individuals. Similarly, ≥40% body fat was associated with 60% and 27% (P < 0.001) higher V and nMVC, but 11% and 25% (P < 0.01) lower nMVC/V and SF than <40% body fat. The aging‐related rates of decline in V (−2 cm3/year P < 0.05) and nMVC (−1.2 cm3/year P < 0.05) were highest in obesity defined by BMI. This effect was also seen when segregating by >40% adiposity. Interestingly, however, obesity appeared advantageous to the aging‐related changes in nMVC/V (P < 0.001) and SF (P < 0.001). Unlike previous reports of greater strength in the obese compared with leaner age‐matched counterparts, we in fact demonstrate that the young sedentary obese, are substantially weaker, where the volume of skeletal muscle is used to scale the maximal torque output, or forces are quantified at the fascicular level. The seemingly positive impact of obesity on rate of aging, however, is complex and warrants further investigations. PMID:24963030

Obesity decreases both whole muscle and fascicle strength in young females but only exacerbates the aging-related whole muscle level asthenia.

PubMed

Tomlinson, David J; Erskine, Robert M; Winwood, Keith; Morse, Christopher Ian; Onambélé, Gladys L

2014-06-24

Obesity has previously been associated with greater muscle strength. Aging, on the other hand, reduces muscle specific force (the force per unit physiological cross-sectional area [PCSA] of muscle). However, neither the effect of obesity on skeletal muscle specific force nor the combined effects of aging and obesity on this parameter are known. This study aimed to describe the interplay between body mass index (BMI)/adiposity, aging, and skeletal muscle specific force. Ninety-four untrained healthy women categorized by age into young (Y; mean ± SD: 25.5 ± 9.0 years) versus old (O; 64.8 ± 7.2 years) were assessed for body composition, gastrocnemius medialis (GM) muscle volume (V), net maximum voluntary contraction (nMVC), and specific force (SF). The young obese, while demonstrating 71% and 29% (P < 0.001) higher V and nMVC compared to normal BMI individuals, were in fact 26% (P = 0.007) weaker than these, where V was used to scale nMVC (i.e., nMVC/V). The weakness associated with obesity was further exemplified in the 34% (P < 0.001) lower SF relative to normal BMI individuals. Similarly, ≥40% body fat was associated with 60% and 27% (P < 0.001) higher V and nMVC, but 11% and 25% (P < 0.01) lower nMVC/V and SF than <40% body fat. The aging-related rates of decline in V (-2 cm(3)/year P < 0.05) and nMVC (-1.2 cm(3)/year P < 0.05) were highest in obesity defined by BMI. This effect was also seen when segregating by >40% adiposity. Interestingly, however, obesity appeared advantageous to the aging-related changes in nMVC/V (P < 0.001) and SF (P < 0.001). Unlike previous reports of greater strength in the obese compared with leaner age-matched counterparts, we in fact demonstrate that the young sedentary obese, are substantially weaker, where the volume of skeletal muscle is used to scale the maximal torque output, or forces are quantified at the fascicular level. The seemingly positive impact of obesity on rate of aging, however, is complex and warrants further investigations. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Analysis and visualization of Arabidopsis thaliana GWAS using web 2.0 technologies.

PubMed

Huang, Yu S; Horton, Matthew; Vilhjálmsson, Bjarni J; Seren, Umit; Meng, Dazhe; Meyer, Christopher; Ali Amer, Muhammad; Borevitz, Justin O; Bergelson, Joy; Nordborg, Magnus

2011-01-01

With large-scale genomic data becoming the norm in biological studies, the storing, integrating, viewing and searching of such data have become a major challenge. In this article, we describe the development of an Arabidopsis thaliana database that hosts the geographic information and genetic polymorphism data for over 6000 accessions and genome-wide association study (GWAS) results for 107 phenotypes representing the largest collection of Arabidopsis polymorphism data and GWAS results to date. Taking advantage of a series of the latest web 2.0 technologies, such as Ajax (Asynchronous JavaScript and XML), GWT (Google-Web-Toolkit), MVC (Model-View-Controller) web framework and Object Relationship Mapper, we have created a web-based application (web app) for the database, that offers an integrated and dynamic view of geographic information, genetic polymorphism and GWAS results. Essential search functionalities are incorporated into the web app to aid reverse genetics research. The database and its web app have proven to be a valuable resource to the Arabidopsis community. The whole framework serves as an example of how biological data, especially GWAS, can be presented and accessed through the web. In the end, we illustrate the potential to gain new insights through the web app by two examples, showcasing how it can be used to facilitate forward and reverse genetics research. Database URL: http://arabidopsis.usc.edu/

Chronic widespread pain after motor vehicle collision typically occurs through immediate development and nonrecovery: results of an emergency department-based cohort study.

PubMed

Hu, JunMei; Bortsov, Andrey V; Ballina, Lauren; Orrey, Danielle C; Swor, Robert A; Peak, David; Jones, Jeffrey; Rathlev, Niels; Lee, David C; Domeier, Robert; Hendry, Phyllis; Parry, Blair A; McLean, Samuel A

2016-02-01

Motor vehicle collision (MVC) can trigger chronic widespread pain (CWP) development in vulnerable individuals. Whether such CWP typically develops through the evolution of pain from regional to widespread or through the early development of widespread pain with nonrecovery is currently unknown. We evaluated the trajectory of CWP development (American College of Rheumatology criteria) among 948 European-American individuals who presented to the emergency department (ED) for care in the early aftermath of MVC. Pain extent was assessed in the ED and 6 weeks, 6 months, and 1 year after MVC on 100%, 91%, 89%, and 91% of participants, respectively. Individuals who reported prior CWP at the time of ED evaluation (n = 53) were excluded. Trajectory modeling identified a 2-group solution as optimal, with the Bayes Factor value (138) indicating strong model selection. Linear solution plots supported a nonrecovery model. Although the number of body regions with pain in the non-CWP group steadily declined, the number of body regions with pain in the CWP trajectory group (192/895, 22%) remained relatively constant over time. These data support the hypothesis that individuals who develop CWP after MVC develop widespread pain in the early aftermath of MVC, which does not remit.

Muscular activity and torque of the foot dorsiflexor muscles during decremental isometric test: A cross-sectional study.

PubMed

Ruiz-Muñoz, Maria; González-Sánchez, Manuel; Martín-Martín, Jaime; Cuesta-Vargas, Antonio I

2017-06-01

To analyse the torque variation level that could be explained by the muscle activation (EMG) amplitude of the three major foot dorsiflexor muscles (tibialis anterior (TA), extensor digitorum longus (EDL), extensor hallucis longus (EHL)) during isometric foot dorsiflexion at different intensities. In a cross-sectional study, forty-one subjects performed foot dorsiflexion at 100%, 75%, 50% and 25% of maximal voluntary contractions (MVC) with the hip and knee flexed 90° and the ankle in neutral position (90° between leg and foot). Three foot dorsiflexions were performed for each intensity. Outcome variables were: maximum (100% MVC) and relative torque (75%, 50%, 25% MVC), maximum and relative EMG amplitude. A linear regression analysis was calculated for each intensity of the isometric foot dorsiflexion. The degree of torque variation (dependent variable) from the independent variables explain (EMG amplitude of the three major foot dorsiflexor muscles) the increases when the foot dorsiflexion intensity is increased, with values of R 2 that range from 0.194 (during 25% MVC) to 0.753 (during 100% MVC). The reliability of the outcome variables was excellent. The EMG amplitude of the three main foot dorsiflexors exhibited more variance in the dependent variable (torque) when foot dorsiflexion intensity increases. Copyright © 2016 Elsevier Ltd. All rights reserved.

[The relevance of core muscles in ice hockey players: a feasibility study].

PubMed

Rogan, S; Blasimann, A; Nyffenegger, D; Zimmerli, N; Radlinger, L

2013-12-01

Good core strength is seen as a condition for high performance in sports. In general, especially maximum voluntary contraction (MVC) and strength endurance (SE) measurements of the core muscles are used. In addition, a few studies can be found that examine the core muscles in terms of MVC, rate of force development (RFD) and SE. Primary aims of this feasibility study were to investigate the feasibility regarding recruiting process, compliance and safety of the testing conditions and raise the force capabilities MVC, RFD and SE of the core muscles in amateur ice hockey players. Secondarily, tendencies of correlations between muscle activity and either shot speed and sprint time shall be examined. In this feasibility study the recruitment process has been approved by 29 ice hockey players, their adherence to the study measurements of trunk muscles, and safety of the measurements was evaluated. To determine the MVC, RFD and SE for the ventral, lateral and dorsal core muscles a dynamic force measurement was performed. To determine the correlation between core muscles and shot speed and 40-m sprint, respectively, the rank correlation coefficient (rho) from Spearman was used. The recruited number of eight field players and one goal-keeper was not very high. The compliance with 100 % was excellent. The players reported no adverse symptoms or injuries after the measurements. The results show median values for the ventral core muscles for MVC with 46.5 kg for RFD with 2.23 m/s2 and 96 s for the SE. For lateral core muscle median values of the lateral core muscles for MVC with 71.10 kg, RFD with 2.59 m/s2 and for SE over 66 s were determined. The dorsal core muscles shows values for MVC 69.7 kg, for RFD 3.39 m/s2 and for SE of 75 s. High correlations between MVC of the ventral core muscles (rho = -0.721, p = 0.021), and between the SE of the ventral core muscles (rho = 0.787, p = 0.012), and the shot velocity rate were determined. Another high correlation between SE of the ventral core muscles and sprint over 40 m (rho = 0.717, p = 0.030) could be demonstrated. This feasibility study has shown that the implementation of the selected design is adapted for future studies. Further studies are needed to better understand the relationship between the velocity rate and the MVC, and the SE respectively, as well as between the sprint and the SE. © Georg Thieme Verlag KG Stuttgart · New York.

Design and development of an IoT-based web application for an intelligent remote SCADA system

NASA Astrophysics Data System (ADS)

Kao, Kuang-Chi; Chieng, Wei-Hua; Jeng, Shyr-Long

2018-03-01

This paper presents a design of an intelligent remote electrical power supervisory control and data acquisition (SCADA) system based on the Internet of Things (IoT), with Internet Information Services (IIS) for setting up web servers, an ASP.NET model-view- controller (MVC) for establishing a remote electrical power monitoring and control system by using responsive web design (RWD), and a Microsoft SQL Server as the database. With the web browser connected to the Internet, the sensing data is sent to the client by using the TCP/IP protocol, which supports mobile devices with different screen sizes. The users can provide instructions immediately without being present to check the conditions, which considerably reduces labor and time costs. The developed system incorporates a remote measuring function by using a wireless sensor network and utilizes a visual interface to make the human-machine interface (HMI) more instinctive. Moreover, it contains an analog input/output and a basic digital input/output that can be applied to a motor driver and an inverter for integration with a remote SCADA system based on IoT, and thus achieve efficient power management.

Effects of lymphatic drainage and local cryo exposition regeneration after high-intensive exercises

PubMed Central

Behringer, Michael; Jedlicka, Diana; McCourt, Molly; Ring, Matthias; Mester, Joachim

2016-01-01

Summary Background Recovery from exercise and competition is important in sports medicine, particularly when rest periods are short. The objective is to determine the efficacy of cryo exposition (CRY) and manual lymphatic drainage (MLD) to hasten short term recovery of muscle performance after eccentric contractions. Methods In a randomized controlled trial, 30 healthy sport students (21 males, 9 females; age: 25.7±2.8 years) performed 4×20 eccentric contractions of knee extensors, followed by 30 min MLD, CRY, or rest (RST) under controlled laboratory environment. Maximal voluntary contractions (MVC), electrically induced muscle fatigue (FI), and electrically induced tetani (EIT) at low (T2: 20 Hz) and high frequencies were tested. Results Force decline and recovery kinetics regarding MVC, FI, and EIT did not differ significantly (p<0.05) between groups. That is, 24 h after the intervention, MVC (MLD: 80.9±5.5%; CRY: 81.1±8.5%; RST: 83.5±7.3%), FI (MLD: 83.2±23.7%; CRY: 81.2±38.8%; RST: 93.2±22.9%), and EIT (T1: MLD: 53.0±29.5%; CRY: 39.0±32.9%; RST: 46.3±26.1%; T2: MLD: 84.2±27.2%; CRY: 64.2±24.2%; RST: 66.6±22.3%) were similarly depressed irrespective of applied treatments. Conclusion Neither CRY nor MLD hastened the recovery of muscle performance, when applied for 30 min. Identification number of the Primary Registry Network: DRKS00007608. PMID:27900297

Comparison of sympathetic nerve responses to neck and forearm isometric exercise

NASA Technical Reports Server (NTRS)

Steele, S. L. Jr; Ray, C. A.

2000-01-01

PURPOSE: Although the autonomic and cardiovascular responses to arm and leg exercise have been studied, the sympathetic adjustments to exercise of the neck have not. The purpose of the present study was twofold: 1) to determine sympathetic and cardiovascular responses to isometric contractions of the neck extensors and 2) to compare sympathetic and cardiovascular responses to isometric exercise of the neck and forearm. METHODS: Muscle sympathetic nerve activity (MSNA), mean arterial pressure (MAP), and heart rate were measured in nine healthy subjects while performing isometric neck extension (INE) and isometric handgrip (IHG) in the prone position. After a 3-min baseline period, subjects performed three intensities of INE for 2.5 min each: 1) unloaded (supporting head alone), 2) 10% maximal voluntary contraction (MVC), and 3) 30% MVC, then subjects performed two intensities (10% and 30% MVC) of IHG for 2.5 min. RESULTS: Supporting the head by itself did not significantly change any of the variables. During [NE, MAP significantly increased by 10 +/- 2 and 31 +/- 4 mm Hg and MSNA increased by 67 +/- 46 and 168 +/- 36 units/30 s for 10% and 30% MVC, respectively. IHG and INE evoked similar responses at 10% MVC, but IHG elicited higher peak MAP and MSNA at 30% MVC (37 +/- 7 mm Hg (P < 0.05) and 300 +/- 48 units/30 s (P < 0.01) for IHG, respectively). CONCLUSIONS: The data indicate that INE can elicit marked increases in MSNA and cardiovascular responses but that it evokes lower peak responses as compared to IHG. We speculate that possible differences in muscle fiber type composition, muscle mass, and/or muscle architecture of the neck and forearm are responsible for these differences in peak responses.

Factors Associated with Pediatric Mortality from Motor Vehicle Crashes in the United States: A State-Based Analysis.

PubMed

Wolf, Lindsey L; Chowdhury, Ritam; Tweed, Jefferson; Vinson, Lori; Losina, Elena; Haider, Adil H; Qureshi, Faisal G

2017-08-01

To examine geographic variation in motor vehicle crash (MVC)-related pediatric mortality and identify state-level predictors of mortality. Using the 2010-2014 Fatality Analysis Reporting System, we identified passengers <15 years of age involved in fatal MVCs, defined as crashes on US public roads with ≥1 death (adult or pediatric) within 30 days. We assessed passenger, driver, vehicle, crash, and state policy characteristics as factors potentially associated with MVC-related pediatric mortality. Our outcomes were age-adjusted, MVC-related mortality rate per 100 000 children and percentage of children who died of those in fatal MVCs. Unit of analysis was US state. We used multivariable linear regression to define state characteristics associated with higher levels of each outcome. Of 18 116 children in fatal MVCs, 15.9% died. The age-adjusted, MVC-related mortality rate per 100 000 children varied from 0.25 in Massachusetts to 3.23 in Mississippi (mean national rate of 0.94). Predictors of greater age-adjusted, MVC-related mortality rate per 100 000 children included greater percentage of children who were unrestrained or inappropriately restrained (P < .001) and greater percentage of crashes on rural roads (P = .016). Additionally, greater percentages of children died in states without red light camera legislation (P < .001). For 10% absolute improvement in appropriate child restraint use nationally, our risk-adjusted model predicted >1100 pediatric deaths averted over 5 years. MVC-related pediatric mortality varied by state and was associated with restraint nonuse or misuse, rural roads, vehicle type, and red light camera policy. Revising state regulations and improving enforcement around these factors may prevent substantial pediatric mortality. Copyright © 2017 Elsevier Inc. All rights reserved.

Prehospital injury severity of children evacuated by helicopters from combat zones: a retrospective report.

PubMed

Samuel, Nir; Hirschhorn, Gil; Chen, Jacob; Steiner, Ivan P; Shavit, Itai

2013-03-01

In Israel, the Airborne Rescue and Evacuation Unit (AREU) provides prehospital trauma care in times of peace and during times of armed conflict. In peacetime, the AREU transports children who were involved in motor vehicle collisions (MVC) and those who fall off cliffs (FOC). During armed conflict, the AREU evacuates children who sustain firearm injuries (FI) from the fighting zones. To report on prehospital injury severity of children who were evacuated by the AREU from combat zones. A retrospective comparative analysis was conducted on indicators of prehospital injury severity for patients who had MVC, FOC, and FI. It included the National Advisory Committee for Aeronautics (NACA) score, the Glasgow Coma Scale (GCS) score on scene, and the number of procedures performed by emergency medical personnel and by the AREU air-crew. From January 2003 to December 2009, 36 MVC, 25 FOC, and 17 FI children were transported from the scene by the AREU. Five patients were dead at the scene: 1 (2.8%) MVC, 1 (4%) FOC, and 3 (17.6%) FI. Two (11.7%) FI patients were dead on arrival at the hospital. MVC, FOC, and FI patients had mean (±SD) NACA scores of 4.4 ± 1.2, 3.6 ± 1.2, and 5 ± 0.7, respectively. Mean (±SD) GCS scores were 8.9 ± 5.6, 13.6 ± 4, and 6.9 ± 5.3, respectively. Life support interventions were required by 29 (80.6%) MVC, 3 (12%) FOC, and 15 (88.2%) FI patients. In the prehospital setting, children evacuated from combat zones were more severely injured than children who were transported from the scene during peacetime. Copyright © 2013 Elsevier Inc. All rights reserved.

Obesity and trauma mortality: Sizing up the risks in motor vehicle crashes.

PubMed

Joseph, Bellal; Hadeed, Steven; Haider, Ansab A; Ditillo, Michael; Joseph, Aly; Pandit, Viraj; Kulvatunyou, Narong; Tang, Andrew; Latifi, Rifat; Rhee, Peter

Protective effects of safety devices in obese motorists in motor vehicle collisions (MVC) remain unclear. Aim of our study is to assess the association between morbid obesity and mortality in MVC, and to determine the efficacy of protective devices. We hypothesised that patients with morbid obesity will be at greater risk of death after MVC. A retrospective analysis of MVC patients (age ≥16 y.o.) was performed using the National Trauma Data Bank from 2007 to 2010. Patients with recorded comorbidity of morbid obesity (BMI≥40) were identified. Patients dead on arrival, with isolated traumatic brain injury, or incomplete data were excluded. The primary outcome was in-hospital mortality. Multivariate logistic regression was performed. Our sample of 214,306 MVC occupants included 10,260 (4.8%) morbidly obese patients. Mortality risk was greatest among occupants with morbid obesity (OR crude 1.74 [1.54-1.98]). After adjusting for patient demographics, safety device and physiological severity, odds of death was 1.52 [1.33-1.74] times greater in motorists with morbid obesity. Motorists with morbid obesity were at greater risk of death if no restraint (OR 1.84 [1.47-2.31]), seatbelt only (OR 1.48 [1.17-1.86]), or both seatbelt and airbag were present (OR 1.49 [1.13-1.97]). No significant differences in the odds of death exist between drivers with morbid obesity and non-morbidly obese drivers with only airbag deployment (OR 0.99 [0.65-1.51]). Motorists with morbid obesity are at greater risk of MVC. Regardless of safety device use, occupants with morbid obesity remained at greater risk of death. Further research examining the effectiveness of vehicle restraints in drivers with morbid obesity is warranted. Copyright © 2016. Published by Elsevier Ltd.

Scapular muscle activity in a variety of plyometric exercises.

PubMed

Maenhout, Annelies; Benzoor, Maya; Werin, Maria; Cools, Ann

2016-04-01

Plyometric shoulder exercises are commonly used to progress from slow analytical strength training to more demanding high speed power training in the return to play phase after shoulder injury. The aim of this study was first, to investigate scapular muscle activity in plyometric exercises to support exercise selection in practice and second, to enhance understanding of how scapular muscles are recruited during the back and forth movement phase of these exercises. Thirty-two healthy subjects performed 10 plyometric exercises while surface EMG-activity of the scapular muscles (upper (UT), middle (MT) and lower trapezius (LT) and serratus anterior (SA)) was registered. A high speed camera tracked start and end of the back and forth movement. Mean scapular EMG activity during the 10 exercises ranged from 14.50% to 76.26%MVC for UT, from 15.19% to 96.55%MVC for MT, from 13.18% to 94.35%MVC for LT and from 13.50% to 98.50%MVC for SA. Anova for repeated measures showed significant differences in scapular muscle activity between exercises (p<0.001) and between the back and forth movement (p<0.001) within exercises. Plyometric shoulder exercises require moderate (31-60%MVC) to high (>60%MVC) scapular muscle activity. Highest MT/LT activity was present in prone plyometric external rotation and flexion. Highest SA activity was found in plyometric external rotation and flexion with Xco and plyometric push up on Bosu. Specific exercises can be selected that recruit minimal levels of UT activity (<15%): side lying plyometric external rotation and horizontal abduction or plyometric push up on the Bosu. The results of this study support exercise selection for clinical practice. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development of the Strength Level on Arm for Indonesian People in Lifting Activity

NASA Astrophysics Data System (ADS)

Soewardi, H.; Prabaswari, A. D.; Muzakiroh, H. A.

2017-12-01

Lifting is one of manual material handling activity that involves the whole part of a body. This activity is significant to contribute musculoskeletal disorder specifically on arms. It is because the arms are a major strength to lift objects. However, many people do not know the capability of their arm so that the task designed does not comply with the limitation of workers. Thus, it is required to determine a level of strength on arms. The objective of this study is to develop the strength level of arms for Indonesian people based on musculoskeletal contraction. An experimental study is conducted in the ergonomics laboratory. 24 males and 24 females was participated in this study which consists of three different ethnics. They are sixteen participants of Ethnic A, sixteen participants of Ethnic B and sixteen participants of Ethnic C. A case study of lifting consists of 4 positions of object. They are 38 cm in height, 50 cm in height, 85 - 115 cm in height for forming 90 degrees of the elbow and 100 cm in height. Back lift technique was implemented. An Electromyography is used to investigate muscle contraction on arms. Statistical analysis is done to test the hypothesis. The result of this study shows that the arm strength level for Indonesian workers has significant differences between males and females among difference Ethnic. For male, Ethnic A has 28.82% - 79.28% of MVC, Ethnic B has 17.74% - 58.67% of MVC, and Ethnic C has 22.13% - 68.67% of MVC. For female, Ethnic A has 28.28% - 84.63% of MVC, Ethnic B has 24.47% - 70.98% of MVC, and Ethnic C has 24.24% - 75.67% of MVC.

The repeated-bout effect: influence on biceps brachii oxygenation and myoelectrical activity.

PubMed

Muthalib, Makii; Lee, Hoseong; Millet, Guillaume Y; Ferrari, Marco; Nosaka, Kazunori

2011-05-01

This study investigated biceps brachii oxygenation and myoelectrical activity during and following maximal eccentric exercise to better understand the repeated-bout effect. Ten men performed two bouts of eccentric exercise (ECC1, ECC2), consisting of 10 sets of 6 maximal lengthening contractions of the elbow flexors separated by 4 wk. Tissue oxygenation index minimum amplitude (TOI(min)), mean and maximum total hemoglobin volume by near-infrared spectroscopy, torque, and surface electromyography root mean square (EMG(RMS)) during exercise were compared between ECC1 and ECC2. Changes in maximal voluntary isometric contraction (MVC) torque, range of motion, plasma creatine kinase activity, muscle soreness, TOI(min), and EMG(RMS) during sustained (10-s) and 30-repeated isometric contraction tasks at 30% (same absolute force) and 100% MVC (same relative force) for 4 days postexercise were compared between ECC1 and ECC2. No significant differences between ECC1 and ECC2 were evident for changes in torque, TOI(min), mean total hemoglobin volume, maximum total hemoglobin volume, and EMG(RMS) during exercise. Smaller (P < 0.05) changes and faster recovery of muscle damage markers were evident following ECC2 than ECC1. During 30% MVC tasks, TOI(min) did not change, but EMG(RMS) increased 1-4 days following ECC1 and ECC2. During 100% MVC tasks, EMG(RMS) did not change, but torque and TOI(min) decreased 1-4 days following ECC1 and ECC2. TOI(min) during 100% MVC tasks and EMG(RMS) during 30% MVC tasks recovered faster (P < 0.05) following ECC2 than ECC1. We conclude that the repeated-bout effect cannot be explained by altered muscle activation or metabolic/hemodynamic changes, and the faster recovery in muscle oxygenation and activation was mainly due to faster recovery of force.

Selective recruitment of single motor units in human flexor digitorum superficialis muscle during flexion of individual fingers.

PubMed

Butler, T J; Kilbreath, S L; Gorman, R B; Gandevia, S C

2005-08-15

Flexor digitorum superficialis (FDS) is an extrinsic multi-tendoned muscle which flexes the proximal interphalangeal joints of the four fingers. It comprises four digital components, each with a tendon that inserts onto its corresponding finger. To determine the degree to which these digital components can be selectively recruited by volition, we recorded the activity of a single motor unit in one component via an intramuscular electrode while the subject isometrically flexed each of the remaining fingers, one at a time. The finger on which the unit principally acted was defined as the 'test finger' and that which flexed isometrically was the 'active' finger. Activity in 79 units was recorded. Isometric finger flexion forces of 50% maximum voluntary contraction (MVC) activated less than 50% of single units in components of FDS acting on fingers that were not voluntarily flexed. With two exceptions, the median recruitment threshold for all active-test finger combinations involving the index, middle, ring and little finger test units was between 49 and 60% MVC (60% MVC being the value assigned to those not recruited). The exceptions were flexion of the little finger while recording from ring finger units (median: 40% MVC), and vice versa (median: 2% MVC). For all active-test finger combinations, only 35/181 units were activated when the active finger flexed at less than 20% MVC, and the fingers were adjacent for 28 of these. Functionally, to recruit FDS units during grasping and lifting, relatively heavy objects were required, although systematic variation occurred with the width of the object. In conclusion, FDS components can be selectively activated by volition and this may be especially important for grasping at high forces with one or more fingers.

Static postural sway, proprioception, and maximal voluntary quadriceps contraction in patients with knee osteoarthritis and normal control subjects

PubMed Central

Hassan, B; Mockett, S; Doherty, M

2001-01-01

OBJECTIVES—To investigate whether subjects with knee osteoarthritis (OA) have reduced static postural control, knee proprioceptive acuity, and maximal voluntary contraction (MVC) of the quadriceps compared with normal controls, and to determine possible independent predictors of static postural sway.
METHODS—77 subjects with symptomatic and radiographic knee OA (58 women, 19 men; mean age 63.4 years, range 36-82) and 63 controls with asymptomatic and clinically normal knees (45 women, 18 men; mean age 63 years, range 46-85) underwent assessment of static postural sway. 108 subjects (59 patients, 49 controls) also underwent assessment of knee proprioceptive activity and MVC (including calculation of quadriceps activation). In patients with knee OA knee pain, stiffness, and functional disability were assessed using the WOMAC Index. The height (m) and weight (kg) of all subjects was assessed.
RESULTS—Compared with controls, patients with knee OA were heavier (mean difference 15.3 kg, p<0.001), had increased postural lateral sway (controls: median 2.3, interquartile (IQ) range 1.8-2.9; patients: median 4.7, IQ range 1.9-4.7, p<0.001), reduced proprioceptive acuity (controls: mean 7.9, 95% CI 6.9 to 8.9; patients: mean 12.0, 95% CI 10.5 to 13.6, p<0.001), weaker quadriceps strength (controls: mean 22.5, 95% CI 19.9 to 24.6; patients: mean 14.7, 95% CI 12.5 to 16.9, p<0.001), and less percentage activation of quadriceps (controls: mean 87.4, 95% CI 80.7 to 94.2; patients: mean 66.0, 95% CI 58.8 to 73.2, p<0.001). The significant predictors of postural sway were knee pain and the ratio of MVC/body weight.
CONCLUSIONS—Compared with age and sex matched controls, subjects with symptomatic knee OA have quadriceps weakness, reduced knee proprioception, and increased postural sway. Pain and muscle strength may particularly influence postural sway. The interaction between physiological, structural, and functional abnormalities in knee OA deserves further study.

 PMID:11350851

Variability of quadriceps femoris motor neuron discharge and muscle force in human aging.

PubMed

Welsh, Seth J; Dinenno, Devin V; Tracy, Brian L

2007-05-01

The purpose was to determine the contribution of visual feedback and the effect of aging on the variability of knee extensor (KE) muscle force and motor unit (MU) discharge. Single MUs were recorded during two types of isometric trials, (1) visual feedback provided (VIS) and then removed (NOVIS) during the trial (34 MUs from young, 32 from elderly), and (2) only NOVIS (66 MUs from young, 77 from elderly) during the trial. Recruitment threshold (RT) ranged from 0-37% MVC. Standard deviation (SD) and coefficient of variation (CV) of muscle force and MU interspike interval (ISI) was measured during steady contractions at target forces ranging from 0.3 to 54% MVC. Force drift (<0.5 Hz) was removed before analysis. VIS/NOVIS trials: the decrease in the CV of ISI from VIS to NOVIS was greater for MUs from elderly (12.5 +/- 4.1 to 9.94 +/- 2.6%) than young (10.6 +/- 3.3 to 10.3 +/- 2.8%, age group x vision interaction, P = 0.006). The change in CV of force from VIS to NOVIS was significantly greater for elderly (1.45 to 1.05%) than young (1.42 to 1.41%). NOVIS only trials: for all MUs, the average RT (6.6 +/- 7.7 % MVC), target force above RT (1.20 +/- 2.7% MVC), SD of ISI (0.012 +/- 0.005 s), and CV of ISI (11.1 +/- 3.3%) were similar for young and elderly MUs. The CV of force was similar between age groups for trials between 0 and 3% MVC (1.74 +/- 0.74%) and was greater for young subjects from 3 to 10% MVC (1.47 +/- 0.5 vs. 1.21 +/- 0.4%) and >10% MVC (1.44 +/- 0.6 vs. 1.01 +/- 0.3%). The CV of ISI was similar between age groups for MUs in 0-3, 3-10, and >10% bins of RT. Thus, the contribution of visuomotor correction to the variability of motor unit discharge and force is greater for elderly adults. The presence of visual feedback appears to be necessary to find greater discharge variability in motor units from the knee extensors of elderly adults.

Child–adult differences in the kinetics of torque development

PubMed Central

DOTAN, RAFFY; MITCHELL, CAMERON; COHEN, ROTEM; GABRIEL, DAVID; KLENTROU, PANAGIOTA; FALK, BAREKET

2013-01-01

Children have lower size-normalised maximal voluntary force, speed, and power than adults. It has been hypothesised that these and other age-related performance differences are due to lesser type-II motor-unit utilisation in children. This should be manifested as slower force kinetics in explosive muscle contractions. The purpose of this study was to investigate the nature of child–adult force-kinetics differences and whether the latter could support that hypothesis. Untrained boys (n = 20) and men (n = 20) (10.1 ± 1.3 and 22.9 ± 4.4 years, respectively), performed maximal, explosive, isometric elbow flexions and knee extensions on a Biodex dynamometer. Peak torque (MVC), times to 10–100% MVC, and other kinetics parameters were determined. The boys’ body-mass-normalised knee extension MVC, peak rate of torque development, and %MVC at 100 ms were 26, 17 and 23% lower compared with the men and their times to 30% and 80% MVC were 24 and 48% longer, respectively. Elbow flexion kinetics showed similar or greater differences. The findings illuminate boys’ inherent disadvantage in tasks requiring speed or explosive force. It is demonstrated that the extent of the boys–men kinetics disparity cannot be explained by muscle-composition and/or musculo-tendinous-stiffness differences. We suggest therefore that the findings indirectly support children’s lower utilisation of type-II motor units. PMID:23320937

Associations between motor vehicle crashes and mental health problems: data from the National Survey of Adolescents-Replication.

PubMed

Williams, Joah L; Rheingold, Alyssa A; Knowlton, Alice W; Saunders, Benjamin E; Kilpatrick, Dean G

2015-02-01

Motor vehicle crashes (MVCs) are a leading cause of physical injuries and mortality among children and adolescents in the United States. The purpose of this study was to examine associations between having an MVC and mental health outcomes, including posttraumatic stress disorder (PTSD), depression, and drug and alcohol misuse in a nationally representative sample of adolescents. A sample of 3,604 adolescents, aged 12-17 years, was assessed as part of the 2005 National Survey of Adolescents-Replication (NSA-R) study. Data were weighted according to the 2005 U.S. Census estimates. Within this sample, 10.2% of adolescents reported having at least 1 serious MVC. The prevalence of current PTSD and depression among adolescents having an MVC was 7.4% and 11.2%, respectively. Analyses revealed that an MVC among adolescents aged 15 years and younger was independently associated with depression (OR = 2.17) and alcohol abuse (OR = 2.36) after adjusting for other risk factors, including a history of interpersonal violence. Among adolescents aged 16 years and older, an MVC was associated only with alcohol abuse (OR = 2.08). This study was the first attempt to explore adverse mental health outcomes associated with MVCs beyond traumatic stress symptoms among adolescents in a nationally representative sample. Copyright © 2015 International Society for Traumatic Stress Studies.

Comparison between electrically evoked and voluntary isometric contractions for biceps brachii muscle oxidative metabolism using near-infrared spectroscopy.

PubMed

Muthalib, Makii; Jubeau, Marc; Millet, Guillaume Y; Maffiuletti, Nicola A; Nosaka, Kazunori

2009-09-01

This study compared voluntary (VOL) and electrically evoked isometric contractions by muscle stimulation (EMS) for changes in biceps brachii muscle oxygenation (tissue oxygenation index, DeltaTOI) and total haemoglobin concentration (DeltatHb = oxygenated haemoglobin + deoxygenated haemoglobin) determined by near-infrared spectroscopy. Twelve men performed EMS with one arm followed 24 h later by VOL with the contralateral arm, consisting of 30 repeated (1-s contraction, 1-s relaxation) isometric contractions at 30% of maximal voluntary contraction (MVC) for the first 60 s, and maximal intensity contractions thereafter (MVC for VOL and maximal tolerable current at 30 Hz for EMS) until MVC decreased approximately 30% of pre-exercise MVC. During the 30 contractions at 30% MVC, DeltaTOI decrease was significantly (P < 0.05) greater and DeltatHb was significantly (P < 0.05) lower for EMS than VOL, suggesting that the metabolic demand for oxygen in EMS is greater than VOL at the same torque level. However, during maximal intensity contractions, although EMS torque (approximately 40% of VOL) was significantly (P < 0.05) lower than VOL, DeltaTOI was similar and tHb was significantly (P < 0.05) lower for EMS than VOL towards the end, without significant differences between the two sessions in the recovery period. It is concluded that the oxygen demand of the activated biceps brachii muscle in EMS is comparable to VOL at maximal intensity.

A brief tailored family-centered seat belt intervention for hospitalized trauma patients.

DOT National Transportation Integrated Search

2010-11-01

"Among children 5-19 years, the commonest cause of unintentional injury-related death is : being an occupant/driver in a motor vehicle crash (MVC). In 2006 in the United States, there : were 568,188 injuries among children (0-18) due to MVC. Of these...

Effects of Ramadan intermittent fasting on middle-distance running performance in well-trained runners.

PubMed

Brisswalter, Jeanick; Bouhlel, Ezzedine; Falola, Jean Marie; Abbiss, Christopher R; Vallier, Jean Marc; Hausswirth, Christophe; Hauswirth, Christophe

2011-09-01

To assess whether Ramadan intermittent fasting (RIF) affects 5000-m running performance and physiological parameters classically associated with middle-distance performance. Two experimental groups (Ramadan fasting, n = 9, vs control, n = 9) participated in 2 experimental sessions, one before RIF and the other at the last week of fasting. For each session, subjects completed 4 tests in the same order: a maximal running test, a maximal voluntary contraction (MVC) of knee extensor, 2 rectangular submaximal exercises on treadmill for 6 minutes at an intensity corresponding to the first ventilatory threshold (VT1), and a running performance test (5000 m). Eighteen, well-trained, middle-distance runners. Maximal oxygen consumption, MVC, running performance, running efficiency, submaximal VO(2) kinetics parameters (VO(2), VO(2)b, time constant τ, and amplitude A1) and anthropometric parameters were recorded or calculated. At the end of Ramadan fasting, a decrease in MVC was observed (-3.2%; P < 0.00001; η, 0.80), associated with an increase in the time constant of oxygen kinetics (+51%; P < 0.00007; η, 0.72) and a decrease in performance (-5%; P < 0.0007; η, 0.51). No effect was observed on running efficiency or maximal aerobic power. These results suggest that Ramadan changes in muscular performance and oxygen kinetics could affect performance during middle-distance events and need to be considered to choose training protocols during RIF.

Effect of kinesthetic illusion induced by visual stimulation on muscular output function after short-term immobilization.

PubMed

Inada, Toru; Kaneko, Fuminari; Hayami, Tatsuya

2016-04-01

Kinesthetic illusions by visual stimulation (KiNVIS) enhances corticomotor excitability and activates motor association areas. The purpose of this study was to investigate the effect of KiNVIS induction on muscular output function after short-term immobilization. Thirty subjects were assigned to 3 groups: an immobilization group, with the left hand immobilized for 12h (immobilization period); an illusion group, with the left hand immobilized and additionally subjected to KiNVIS of the immobilized part during the immobilization period; and a control group with no manipulation. The maximum voluntary contraction (MVC), fluctuation of force (force fluctuation) during a force modulation task, and twitch force were measured both before (pre-test) and after (post-test) the immobilization period. Data were analyzed by performing two-way (TIME×GROUP) repeated measures ANOVA. The MVC decreased in the immobilization group only (pre-test; 37.8±6.1N, post-test; 32.8±6.9N, p<0.0005) after the immobilization period. The force fluctuation increased only in the immobilization group (pre-test; 2.19±0.54%, post-test; 2.78±0.87%, p=0.007) after the immobilization period. These results demonstrate that induction of KiNVIS prevents negative effect on MVC and force fluctuation after 12h of immobilization. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparison of the effects of whole-body cooling during fatiguing exercise in males and females.

PubMed

Solianik, Rima; Skurvydas, Albertas; Pukėnas, Kazimieras; Brazaitis, Marius

2015-08-01

The effects of cold stress on exercise performance and fatigue have been thoroughly investigated only in males, and thus the general understanding of these effects relates only to males. The aim of this study was to determine whether whole-body cooling has different effects on performance during fatiguing exercise in males and females. Thirty-two subjects (18 males and 14 females) were exposed to acute cold stress by intermittent immersion in 14°C water until their rectal temperature reached 35.5°C or for a maximum of 170 min. Thermal responses and motor performance were monitored before and after whole-body cooling. Whole-body cooling decreased rectal, muscle and mean skin temperatures in all subjects (p<0.05), and these changes did not differ between males and females. Cold stress decreased the fatigue index (FI) of a sustained 2-min maximal voluntary contraction (MVC) only in males (p<0.05). There were no sex differences in central and peripheral fatigability, or muscle electromyographic activity. This observed sex difference (i.e., body cooling-induced decrease in the FI of a sustained MVC in males but not in females) supports the view of sex effects on performance during fatiguing exercise after whole-body cooling. Copyright © 2015 Elsevier Inc. All rights reserved.

The effect of temperature on amount and structure of motor variability during 2-minute maximum voluntary contraction.

PubMed

Brazaitis, Marius; Skurvydas, Albertas; Pukėnas, Kazimieras; Daniuseviciūtė, Laura; Mickevicienė, Dalia; Solianik, Rima

2012-11-01

In this study, we questioned whether local cooling of muscle or heating involving core and muscle temperatures are the main indicators for force variability. Ten volunteers performed a 2-min maximum voluntary contraction (MVC) of the knee extensors under control (CON) conditions after passive heating (HT) and cooling (CL) of the lower body. HT increased muscle and rectal temperatures, whereas CL lowered muscle temperature but did not affect rectal temperature. During 2-min MVC, peak force decreased to a lower level in HT compared with CON and CL experiments. Greater central fatigue was found in the HT experiment, and there was less in the CL experiment than in the CON experiment. Increased core and muscle temperature increased physiological tremor and the amount and structural complexity of force variability of the exercising muscles, whereas local muscle cooling decreased all force variability variables measured. Copyright © 2012 Wiley Periodicals, Inc.

Neural blockade during exercise augments central command's contribution to carotid baroreflex resetting

NASA Technical Reports Server (NTRS)

Querry, R. G.; Smith, S. A.; Stromstad, M.; Ide, K.; Raven, P. B.; Secher, N. H.

2001-01-01

This investigation was designed to determine central command's role on carotid baroreflex (CBR) resetting during exercise. Nine volunteer subjects performed static and rhythmic handgrip exercise at 30 and 40% maximal voluntary contraction (MVC), respectively, before and after partial axillary neural blockade. Stimulus-response curves were developed using the neck pressure-neck suction technique and a rapid pulse train protocol (+40 to -80 Torr). Regional anesthesia resulted in a significant reduction in MVC. Heart rate (HR) and ratings of perceived exertion (RPE) were used as indexes of central command and were elevated during exercise at control force intensity after induced muscle weakness. The CBR function curves were reset vertically with a minimal lateral shift during control exercise and exhibited a further parallel resetting during exercise with neural blockade. The operating point was progressively reset to coincide with the centering point of the CBR curve. These data suggest that central command was a primary mechanism in the resetting of the CBR during exercise. However, it appeared that central command modulated the carotid-cardiac reflex proportionately more than the carotid-vasomotor reflex.

An ontology-based semantic configuration approach to constructing Data as a Service for enterprises

NASA Astrophysics Data System (ADS)

Cai, Hongming; Xie, Cheng; Jiang, Lihong; Fang, Lu; Huang, Chenxi

2016-03-01

To align business strategies with IT systems, enterprises should rapidly implement new applications based on existing information with complex associations to adapt to the continually changing external business environment. Thus, Data as a Service (DaaS) has become an enabling technology for enterprise through information integration and the configuration of existing distributed enterprise systems and heterogonous data sources. However, business modelling, system configuration and model alignment face challenges at the design and execution stages. To provide a comprehensive solution to facilitate data-centric application design in a highly complex and large-scale situation, a configurable ontology-based service integrated platform (COSIP) is proposed to support business modelling, system configuration and execution management. First, a meta-resource model is constructed and used to describe and encapsulate information resources by way of multi-view business modelling. Then, based on ontologies, three semantic configuration patterns, namely composite resource configuration, business scene configuration and runtime environment configuration, are designed to systematically connect business goals with executable applications. Finally, a software architecture based on model-view-controller (MVC) is provided and used to assemble components for software implementation. The result of the case study demonstrates that the proposed approach provides a flexible method of implementing data-centric applications.

Surface EMG characteristics of people with multiple sclerosis during static contractions of the knee extensors.

PubMed

Scott, Sasha M; Hughes, Adrienne R; Galloway, Stuart D R; Hunter, Angus M

2011-01-01

This study was designed to determine whether any alterations existed in surface electromyography (sEMG) in people with multiple sclerosis (MS) during isometric contractions of the knee extensors. Fifteen people with MS and 14 matched controls (mean ± SD age and body mass index 53·7 ± 10·5 versus 54·6 ± 9·6 years and 27·7 ± 6·1 versus 26·5 ± 4, respectively) completed 20%, 40%, 60% and 80% of their maximal voluntary contraction (MVC) of the knee extensors. sEMG was recorded from the vastus lateralis where muscle fibre conduction velocity (MFCV) and sEMG amplitude (RMS) were assessed. Body composition was determined using dual-energy X-ray absorptiometry and physical activity with the use of accelerometry. People with MS showed significantly (P<0·05) faster MFCV during MVC (6·6 ± 2·7 versus 4·7 ± 1·4 m s(-1) ) and all submaximal contractions, while RMS was significantly (P<0·05) less (0·11 ± 0·03 versus 0·24 ± 0·06 mV) in comparison with the controls. MVC along with specific thigh lean mass to torque, rate of force development and mean physical activity were significantly (P<0·01) less in PwMS. People with MS have elevated MFCV alongside reduced RMS during isometric contraction. This elevation in MFCV should be accounted for when interpreting sEMG from people with MS. © 2010 University of Stirling. Clinical physiology and Functional Imaging © 2010 Scandinavian Society of Clinical Physiology and Nuclear Medicine.

Tennis players show a lower coactivation of the elbow antagonist muscles during isokinetic exercises.

PubMed

Bazzucchi, Ilenia; Riccio, Maria Elena; Felici, Francesco

2008-10-01

Previous studies have suggested that muscle coactivation could be reduced by a recurrent activity (training, daily activities). If this was correct, skilled athletes should show a specific muscle activation pattern with a low level of coactivation of muscles which are typically involved in their discipline. In particular, the aim of this study was to verify the hypothesis that the amount of antagonist activation of biceps brachii (BB) and triceps brachii (TB) is different between tennis players and non-players individuals during maximal isokinetic contractions. Ten young healthy men and eight male tennis players participated in the study. The surface electromyographic signals (sEMG) were recorded from the BB and TB muscles during three maximal voluntary isometric contractions (MVC) of elbow flexors and extensors and a set of three maximal elbow flexions and extensions at 15 degrees , 30 degrees , 60 degrees , 120 degrees , 180 degrees and 240 degrees /s. Normalized root mean square (RMS) of sEMG was calculated as an index of sEMG amplitude. Antagonist activation (%RMSmax) of TB was significantly lower in tennis players (from 14.0+/-7.9% at MVC to 16.3+/-8.9% at 240 degrees /s) with respect to non-players (from 27.7+/-19.7% at MVC to 38.7+/-17.6% at 240 degrees /s) at all angular velocities. Contrary to non-players, tennis players did not show any difference in antagonist activation between BB and TB muscles. Tennis players, with a constant practice in controlling forces around the elbow joint, learn how to reduce coactivation of muscles involved in the control of this joint. This has been shown by the lower antagonist muscular activity of triceps brachii muscle during isokinetic elbow flexion found in tennis players with respect to non-players.

Co-contraction behaviour of masticatory and neck muscles during tooth grinding.

PubMed

Giannakopoulos, N N; Schindler, H J; Hellmann, D

2018-07-01

The objective of this study was to analyse the co-contraction behaviour of jaw and neck muscles during force-controlled experimental grinding in the supine position. Twelve symptom-free subjects were enrolled in the experimental study. Electromyographic (EMG) activity of semispinalis capitis, splenius capitis and levator scapulae muscles was recorded bilaterally with intramuscular fine-wire electrodes, whereas that of sternocleidomastoideus, infrahyoidal, suprahyoidal, masseter and anterior temporalis muscles were registered with surface electrodes. EMG and force measurements were performed during tasks simulating tooth grinding on custom-made intraoral metal splints. The mean EMG activity normalised by maximum voluntary contraction (% MVC) of each of the neck muscles studied during grinding was analysed and compared with previous data from jaw clenching at identical force (100 N) and (supine) position. The occurrence of low-level, long-lasting tonic activation (LLTA) of motor units was also documented. The mean three-dimensional force vector of the grinding forces was 106 ± 74 N. In the frontal plane, the incline to the midsagittal plane ranged between 10° and 15°. In the midsagittal plane, the incline to the frontal plane was negligibly small. Posterior neck muscle activity during grinding ranged between 4.5% and 12% MVC and during clenching with 100 N between 1.8% and 9.9% MVC. Masticatory muscle activity during grinding ranged between 17% and 21% MVC for contralateral masseter and ipsilateral temporalis and between 4% and 6.5% for ipsilateral masseter and contralateral temporalis. LLTA had an average duration of 195 ± 10 seconds. The findings from this study do not support pathophysiological muscle chain theories postulating simple biomechanical coupling of neck and jaw muscles. Co-contractions of neck and masticatory muscles may instead occur as a result of complex neurophysiological interactions. © 2018 John Wiley & Sons Ltd.

Isometric parameters in the monitoring of maximal strength, power, and hypertrophic resistance-training.

PubMed

Peltonen, Heikki; Walker, Simon; Lähitie, Anuliisa; Häkkinen, Keijo; Avela, Janne

2018-02-01

This study monitored strength-training adaptations via isometric parameters throughout 2 × 10 weeks of hypertrophic (HYP I-II) or 10 weeks maximum strength (MS) followed by 10 weeks power (P) training with untrained controls. Trainees performed bilateral isometric leg press tests analyzed for peak force (maximal voluntary contraction (MVC)) and rate of force development (RFD) every 3.5 weeks. These parameters were compared with dynamic performance, voluntary and electrically induced isometric contractions, muscle activity, and cross-sectional area (CSA) in the laboratory before and after 10 and 20 weeks. RFD increased similarly during the first 7 weeks (HYP I, 44% ± 53%; MS, 48% ± 55%, P < 0.05), but RFD continued to increase up to 65% ± 61% from baseline (P < 0.01) only during P. These increases were concomitant with enhanced dynamic performances of 1-repetition maximum (1RM) (HYP I, 8% ± 6%; MS, 11% ± 6%, P < 0.001), and explosive repetitions during P (11% ± 15%, P < 0.05). Time to reach peak RFD differed (P < 0.001) between HYP (mean 42 ± 20 ms) and MS-P (mean 31 ± 12 ms) groups because of training. The changes in MVC correlated with the changes in CSA during weeks 1-20 (HYP I-II, r = 0.664; MS-P, r = 0.595, P ≤ 0.05), as well as changes in 1RM (r = 0.724, P < 0.05) during weeks 11-20 (HYP II). Muscle activity increased during MS and P only. Both MVC and RFD improvements reflected combinations of central and peripheral adaptations. RFD parameters may be effective tools to evaluate adaptations, particularly during maximal strength/power training, while MVC cannot distinguish between strength or muscle mass changes. Monitoring RFD provided important information regarding plateaus in RFD improvement, which were observed in dynamic explosive performances after HYP II compared with P.

An Acute Exposure to Muscle Vibration Decreases Knee Extensors Force Production and Modulates Associated Central Nervous System Excitability

PubMed Central

Souron, Robin; Besson, Thibault; McNeil, Chris J.; Lapole, Thomas; Millet, Guillaume Y.

2017-01-01

Local vibration (LV) has been recently validated as an efficient training method to improve muscle strength. Understanding the acute effects may help elucidate the mechanism(s). This study aimed to investigate the effects of a single bout of prolonged LV on knee extensor force production and corticospinal responsiveness of vastus lateralis (VL) and rectus femoris (RF) muscles in healthy young and old adults. Across two visits, 23 adult subjects (20–75 years old) performed pre- and post-test measurements, separated by 30-min of either rest (control; CON) or LV. Maximal voluntary contraction (MVC) force was assessed and transcranial magnetic stimulation (TMS) was used to evaluate cortical voluntary activation (VATMS) as well as the motor evoked potential (MEP) and silent period (SP). In 11 young adults, thoracic electrical stimulation was used to assess the thoracic motor evoked potential (TMEP). Although MVC decreased after both CON (−6.3 ± 4.4%, p = 0.01) and LV (−12.9 ± 7.7%, p < 0.001), the MVC loss was greater after LV (p = 0.001). Normalized maximal electromyographic (EMG) activity decreased after LV for both VL (−25.1 ± 10.7%) and RF (−20.9 ± 16.5%; p < 0.001), while it was unchanged after CON (p = 0.32). For RF, the TMEP and MEP/TMEP ratio decreased (p = 0.01) and increased (p = 0.01) after LV, respectively. Both measures were unchanged for VL (p = 0.27 and p = 0.15, respectively). No changes were reported for TMS-related parameters. These results confirm our hypothesis that modulations within the central nervous system would accompany the significant reduction of maximal voluntary force. A reduced motoneuron excitability seems to explain the decreased MVC after prolonged LV, as suggested by reductions in maximal EMG (all subjects) and TMEP area (data from 11 young subjects). A concomitant increased cortical excitability seems to compensate for lower excitability at the spinal level. PMID:29118698

Low-frequency oscillations of the neural drive to the muscle are increased with experimental muscle pain

PubMed Central

Negro, Francesco; Gizzi, Leonardo; Falla, Deborah

2012-01-01

We investigated the influence of nociceptive stimulation on the accuracy of task execution and motor unit spike trains during low-force isometric contractions. Muscle pain was induced by infusion of hypertonic saline into the abductor digiti minimi muscle of 11 healthy men. Intramuscular EMG signals were recorded from the same muscle during four isometric contractions of 60-s duration at 10% of the maximal force [maximal voluntary contraction (MVC)] performed before injection (baseline), after injection of isotonic (control) or hypertonic saline (pain), and 15 min after pain was no longer reported. Each contraction was preceded by three 3-s ramp contractions from 0% to 10% MVC. The low-frequency oscillations of motor unit spike trains were analyzed by the first principal component of the low-pass filtered spike trains [first common component (FCC)], which represents the effective neural drive to the muscle. Pain decreased the accuracy of task performance [coefficient of variation (CoV) for force: baseline, 2.8 ± 1.8%, pain, 3.9 ± 1.8%; P < 0.05] and reduced motor unit discharge rates [11.6 ± 2.3 pulses per second (pps) vs. 10.7 ± 1.7 pps; P < 0.05]. Motor unit recruitment thresholds (2.2 ± 1.2% MVC vs. 2.4 ± 1.6% MVC), interspike interval variability (18.4 ± 4.9% vs. 19.1 ± 5.4%), strength of motor unit short-term synchronization [common input strength (CIS) 1.02 ± 0.44 vs. 0.83 ± 0.22], and strength of common drive (0.47 ± 0.08 vs. 0.47 ± 0.06) did not change across conditions. The FCC signal was correlated with force (R = 0.45 ± 0.06), and the CoV for FCC increased in the painful condition (5.69 ± 1.29% vs. 7.83 ± 2.61%; P < 0.05). These results indicate that nociceptive stimulation increased the low-frequency variability in synaptic input to motoneurons. PMID:22049336

Explosive Strength of the Knee Extensors: The Influence of Criterion Trial Detection Methodology on Measurement Reproducibility

PubMed Central

Wiesinger, Hans-Peter; Wiemer, Nicolas; Kösters, Alexander; Müller, Erich

2016-01-01

Abstract The present study was conducted to assess test-retest reproducibility of explosive strength measurements during single-joint isometric knee extension using the IsoMed 2000 dynamometer. Thirty-one physically active male subjects (mean age: 23.7 years) were measured on two occasions separated by 48–72 h. The intraclass correlation coefficient (ICC 2,1) and the coefficient of variation (CV) were calculated for (i) maximum torque (MVC), (ii) the peak rate of torque development (RTDpeak) as well as for (iii) the average rate of torque development (RTD) and the impulse taken at several predefined time intervals (0–30 to 0–300 ms); thereby explosive strength variables were derived in two conceptually different versions: on the one hand from the MVC-trial (version I), on the other hand from the trial showing the RTDpeak (version II). High ICC-values (0.80–0.99) and acceptable CV-values (1.9–8.7%) could be found for MVC as well as for the RTD and the impulse taken at time intervals of ≥100 ms, regardless of whether version I or II was used. In contrast, measurements of the RTDpeak as well as the RTD and the impulse taken during the very early contraction phase (i.e. RTD/impulse0–30ms and RTD/impulse0–50ms) showed clearly weaker reproducibility results (ICC: 0.53–0.84; CV: 7.3–16.4%) and gave rise to considerable doubts as to clinical usefulness, especially when derived using version I. However, if there is a need to measure explosive strength for earlier time intervals in practice, it is, in view of stronger reproducibility results, recommended to concentrate on measures derived from version II, which is based on the RTDpeak-trial. PMID:28149337

Effect of red bull energy drink on auditory reaction time and maximal voluntary contraction.

PubMed

Goel, Vartika; Manjunatha, S; Pai, Kirtana M

2014-01-01

The use of "Energy Drinks" (ED) is increasing in India. Students specially use these drinks to rejuvenate after strenuous exercises or as a stimulant during exam times. The most common ingredient in EDs is caffeine and a popular ED available and commonly used is Red Bull, containing 80 mg of caffeine in 250 ml bottle. The primary aim of this study was to investigate the effects of Red Bull energy drink on Auditory reaction time and Maximal voluntary contraction. A homogeneous group containing twenty medical students (10 males, 10 females) participated in a crossover study in which they were randomized to supplement with Red Bull (2 mg/kg body weight of caffeine) or isoenergetic isovolumetric noncaffeinated control drink (a combination of Appy Fizz, Cranberry juice and soda) separated by 7 days. Maximal voluntary contraction (MVC) was recorded as the highest of the 3 values of maximal isometric force generated from the dominant hand using hand grip dynamometer (Biopac systems). Auditory reaction time (ART) was the average of 10 values of the time interval between the click sound and response by pressing the push button using hand held switch (Biopac systems). The energy and control drinks after one hour of consumption significantly reduced the Auditory reaction time in males (ED 232 ± 59 Vs 204 ± 34 s and Control 223 ± 57 Vs 210 ± 51 s; p < 0.05) as well as in females (ED 227 ± 56 Vs 214 ± 48 s and Control 224 ± 45 Vs 215 ± 36 s; p < 0.05) but had no effect on MVC in either sex (males ED 381 ± 37 Vs 371 ± 36 and Control 375 ± 61 Vs 363 ± 36 Newton, females ED 227 ± 23 Vs 227 ± 32 and Control 234 ± 46 Vs 228 ± 37 Newton). When compared across the gender groups, there was no significant difference between males and females in the effects of any of the drinks on the ART but there was an overall significantly lower MVC in females compared to males. Both energy drink and the control drink significantly improve the reaction time but may not have any effect on muscular performance. Energy drink per se is no better than control drink, which may indicate that there is no role of caffeine in the beneficial effect seen after the drinks.

Depth assisted compression of full parallax light fields

NASA Astrophysics Data System (ADS)

Graziosi, Danillo B.; Alpaslan, Zahir Y.; El-Ghoroury, Hussein S.

2015-03-01

Full parallax light field displays require high pixel density and huge amounts of data. Compression is a necessary tool used by 3D display systems to cope with the high bandwidth requirements. One of the formats adopted by MPEG for 3D video coding standards is the use of multiple views with associated depth maps. Depth maps enable the coding of a reduced number of views, and are used by compression and synthesis software to reconstruct the light field. However, most of the developed coding and synthesis tools target linearly arranged cameras with small baselines. Here we propose to use the 3D video coding format for full parallax light field coding. We introduce a view selection method inspired by plenoptic sampling followed by transform-based view coding and view synthesis prediction to code residual views. We determine the minimal requirements for view sub-sampling and present the rate-distortion performance of our proposal. We also compare our method with established video compression techniques, such as H.264/AVC, H.264/MVC, and the new 3D video coding algorithm, 3DV-ATM. Our results show that our method not only has an improved rate-distortion performance, it also preserves the structure of the perceived light fields better.

Moderate alcohol intake and motor vehicle crashes: the conflict between health advantage and at-risk use.

PubMed

Heng, Kenneth; Hargarten, Stephen; Layde, Peter; Craven, Andy; Zhu, Shankuan

2006-01-01

To review the evidence on moderate alcohol intake and motor vehicle crash (MVC) risk, and discuss the possible public health tension in balancing risk reduction and increment with respect to moderate alcohol intake. A Medline review was conducted on moderate alcohol intake, MVC, and cardiovascular disease (CVD) risks. Moderate alcohol intake (24 g ethanol, two US standard drinks, or less a day) is associated with 20% reduction in risk of CVD. Public awareness of this may contribute to why rates of driving with blood alcohol content (BAC) <0.08 g/dl in the United States are static. Studies show 3- to 17-fold increased risk of a fatal MVC with BAC < 0.08 g/dl compared to sober drivers. The United States has 0.08 g/dl BAC laws, higher than that reached by a driver drinking two drinks per day or less. The public should be educated that although moderate alcohol drinking may not violate BAC laws, it still carries significant risk of MVC. Current BAC laws in some countries needs re-evaluation.

Maximal force and tremor changes across the menstrual cycle.

PubMed

Tenan, Matthew S; Hackney, Anthony C; Griffin, Lisa

2016-01-01

Sex hormones have profound effects on the nervous system in vitro and in vivo. The present study examines the effect of the menstrual cycle on maximal isometric force (MVC) and tremor during an endurance task. Nine eumenorrheic females participated in five study visits across their menstrual cycle. In each menstrual phase, an MVC and an endurance task to failure were performed. Tremor across the endurance task was quantified as the coefficient of variation in force and was assessed in absolute time and relative percent time to task failure. MVC decreases 23% from ovulation to the mid luteal phase of the menstrual cycle. In absolute time, the mid luteal phase has the highest initial tremor, though the early follicular phase has substantially higher tremor than other phases after 150 s of task performance. In relative time, the mid luteal phase has the highest level of tremor throughout the endurance task. Both MVC and tremor during an endurance task are modified by the menstrual cycle. Performance of tasks and sports which require high force and steadiness to exhaustion may be decreased in the mid luteal phase compared to other menstrual phases.

Explosive sport training and torque kinetics in children.

PubMed

Dotan, Raffy; Mitchell, Cameron J; Cohen, Rotem; Gabriel, David; Klentrou, Panagiota; Falk, Bareket

2013-07-01

A high rate of force development (RFD) is often more important than maximal force in daily and sports activities. In children, resistance training has been shown to increase maximal force. It is unclear whether, or to what extent, can children improve RFD and force kinetics. For this study, we compared strength and force kinetics of boy gymnasts with those of untrained boys and untrained men. Eight boy gymnasts (age, 9.5 ± 1.2 y), 20 untrained boys (age, 10.1 ± 1.3 y), and 20 untrained men (age, 22.9 ± 4.4 y) performed maximal, explosive, isometric elbow flexions (EF) and knee flexions (KF). Peak torque (maximal voluntary contraction (MVC)), elapsed times to 10%-100% MVC, peak rate of torque development (RTDpk), and other kinetics parameters were determined. When gymnasts were compared with untrained boys, size-normalized EF MVC was 11%-20% higher, RTDpk was 32% higher, and times to 30% and 80% MVC were 16% and 55% shorter, respectively (p < 0.05). No corresponding differences were observed in KF. Furthermore, although the normalized EF MVC was 28% lower in gymnasts than in men (p < 0.001), their torque kinetics parameters were similar. These findings highlight the specificity of gymnastics training, which markedly elevated the torque kinetics of young, prepubertal boys to adult levels, but only moderately affected peak torque. It is suggested that neurologic adaptations, such as enhanced firing and activation rates or increased type II motor-unit recruitment, as well as changes in musculotendinous stiffness, could explain these findings.

Effect of salbutamol on neuromuscular function in endurance athletes.

PubMed

Decorte, Nicolas; Bachasson, Damien; Guinot, Michel; Flore, Patrice; Levy, Patrick; Verges, Samuel; Wuyam, Bernard

2013-10-01

The potential ergogenic effects of therapeutic inhaled salbutamol doses in endurance athletes have been controversially discussed for decades. We hypothesized that salbutamol inhalation may increase peripheral muscle contractility, reduce fatigability, and improve force recovery after a localized exercise in endurance athletes. Eleven healthy, nonasthmatic male athletes with high aerobic capacities were recruited to be compared in a double-blinded, randomized crossover study of two dose levels of salbutamol (200 and 800 μg) and a placebo administered by inhalation before a quadriceps fatigue test. Subjects performed an incremental exercise protocol consisting in sets of 10 intermittent isometric contractions starting at 20% of maximum voluntary contraction (MVC) with 10% MVC increment until exhaustion. Femoral nerve magnetic stimulation was used during and after MVC to evaluate neuromuscular fatigue after each set, at task failure, and after 10 and 30 min of recovery. Initial MVC and evoked muscular responses were not modified with salbutamol (P > 0.05). The total number of submaximal contractions until task failure significantly differed between treatments (placebo, 72 ± 7; 200 µg, 78 ± 8; and 800 µg, 82 ± 7; P < 0.01). MVC and evoked muscular responses were similarly reduced with all treatments during the fatiguing task (all P > 0.05). Voluntary activation was unaffected by the fatiguing task and treatments (P > 0.05). Supratherapeutic inhaled doses of β2-agonists increased quadriceps endurance during an incremental and localized fatiguing task in healthy endurance-trained athletes without significant effect on neuromuscular fatigue. Further studies are needed to clarify the underlying mechanisms.

Torque-onset determination: Unintended consequences of the threshold method.

PubMed

Dotan, Raffy; Jenkins, Glenn; O'Brien, Thomas D; Hansen, Steve; Falk, Bareket

2016-12-01

Compared with visual torque-onset-detection (TOD), threshold-based TOD produces onset bias, which increases with lower torques or rates of torque development (RTD). To compare the effects of differential TOD-bias on common contractile parameters in two torque-disparate groups. Fifteen boys and 12 men performed maximal, explosive, isometric knee-extensions. Torque and EMG were recorded for each contraction. Best contractions were selected by peak torque (MVC) and peak RTD. Visual-TOD-based torque-time traces, electromechanical delays (EMD), and times to peak RTD (tRTD) were compared with corresponding data derived from fixed 4-Nm- and relative 5%MVC-thresholds. The 5%MVC TOD-biases were similar for boys and men, but the corresponding 4-Nm-based biases were markedly different (40.3±14.1 vs. 18.4±7.1ms, respectively; p<0.001). Boys-men EMD differences were most affected, increasing from 5.0ms (visual) to 26.9ms (4Nm; p<0.01). Men's visually-based torque kinetics tended to be faster than the boys' (NS), but the 4-Nm-based kinetics erroneously depicted the boys as being much faster to any given %MVC (p<0.001). When comparing contractile properties of dissimilar groups, e.g., children vs. adults, threshold-based TOD methods can misrepresent reality and lead to erroneous conclusions. Relative-thresholds (e.g., 5% MVC) still introduce error, but group-comparisons are not confounded. Copyright © 2016 Elsevier Ltd. All rights reserved.

Density of surgeons is significantly associated with reduced risk of deaths from motor vehicle crashes in US counties.

PubMed

Chang, David C; Eastman, Brent; Talamini, Mark A; Osen, Hayley B; Tran Cao, Hop S; Coimbra, Raul

2011-05-01

The concept of surgery and public health has been introduced in recent years, highlighting the impact of surgeons on improving public health outcomes, a relationship that has traditionally been ascribed to general practitioners. The purpose of this study is to quantify the effect of surgeon availability on deaths from motor vehicle crashes (MVC). Retrospective analysis of the Area Resource File from 2006 was performed. The primary outcome variable was the three-year (2001-2003) average in MVC deaths per 1 million population for each county. The primary independent variable was the density of surgeons per 1 million population in year 2003. Multiple linear regression analysis was performed, adjusting for density of general practitioners, urbanicity of the county, and socioeconomic status of the county. A total of 3,225 counties were analyzed. The median number of MVC deaths per million population was 226 (IQR 158-320). The median number of surgeon per million population was 55 (IQR 0-105), while the median number of general practitioners per million population was 424 (IQR 274-620). On unadjusted analysis, each increase of one surgeon per million population was associated with 0.38 fewer MVC deaths per million population (p < 0.001). On multivariate analysis, each increase of one surgeon per million population was significantly associated with 0.16 fewer MVC deaths per million population (p < 0.001). Rural location, persistent poverty, and low educational level were all associated with significant increases in MVC deaths. Higher density of surgeons is associated with significant reduction in deaths from MVCs. This highlights the need for 1) consideration of surgery as primary care and 2) development of inclusive surgical systems designed to provide care commensurate with patients' degree of injury. Copyright © 2011 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Restraint use in motor vehicle crash fatalities in children 0 year to 9 years old.

PubMed

Lee, Lois K; Farrell, Caitlin A; Mannix, Rebekah

2015-09-01

Despite improvements in child passenger safety legislation and equipment, motor vehicle crashes (MVCs) continue to be the leading cause of death in children younger than 10 years. The objective of this study was to describe factors associated with restraint use in fatal MVC in children 0 year to 9 years old. The Fatality Analysis Reporting System, maintained by the National Highway Transportation Safety Administration, was used to obtain data on MVC fatalities from 2001 to 2010 in children 0 year to 9 years old. The main outcome was restraint use. Demographic information (age, sex, and race) and crash characteristics including vehicle type (sedan, van, truck, sports utility vehicle) and seat position in the vehicle were analyzed with the χ statistic to evaluate these factors for any restraint use compared with no restraint use in MVC fatalities. There were 7,625 MVC fatalities in children 0 year to 9 years old from 2001 to 2010.Among these fatalities, 4,041 (53%) had any restraint use. Front seat passengers accounted for 20.9% (1,595 of 7,625) of the fatalities. Children 0 year to 3 years old had a higher proportion of restraint use than children 4 years to 9 years old (p < 0.001). White children compared with black children had higher use of restraints (p < 0.001). Children riding in sedans/vans compared with sport utility vehicles/trucks and those riding in the rear seats of the vehicle compared with those in front seats were significantly more likely to use restraints (p < 0.001). Overall, only half of children 0 year to 9 years old who died in an MVC were wearing any child restraint in the vehicle, and 20% were sitting in the front seat. Continued efforts must be made to enforce legislation and educate the public about best practices regarding child passenger safety to improve proper restraint use and to decrease MVC fatalities in children. Prognostic/epidemiologic study, level II.

77 FR 50508 - Change in Bank Control Notices; Formations of, Acquisitions by, and Mergers of Bank Holding...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-21

..., Cando, North Dakota; Timothy Dodd and Bradley Fey, both of Bismarck, North Dakota; Jeffrey Topp, Grace City, North Dakota; Janet Topp, Grace City, North Dakota; and Roger Kenner, Leeds, North Dakota; as a... (Jacqueline G. King, Community Affairs Officer) 90 Hennepin Avenue, Minneapolis, Minnesota 55480-0291: 1. MVC...

Effect of foot type on knee valgus, ground reaction force, and hip muscle activation in female soccer players.

PubMed

Rath, Meghan E; Stearne, David J; Walker, Cameron R; Cox, Jaime C

2016-05-01

The purpose of this study was to determine the degree to which subtalar joint pronation resulting from a supple planus foot affects knee alignment, hip muscle activation and ground reaction force attenuation in female athletes during a broad jump-to-cut maneuver. Twelve National Collegiate Athletic Association (NCAA) Division II female soccer players (age=19.4±1.4 years, height=1.64±0.05 m, mass=64.10±4.8 kg) were identified as having either supple planus (SP) or rigid feet (RF). Participants completed three broad jump-to-cut trials onto a force plate while EMG and motion data were collected. Muscle activation levels (percentage of maximal voluntary contraction [%MVC]) in the gluteus maximus, gluteus medius, biceps femoris, and rectus femoris were calculated, and peak vertical and medial shear force, rate of loading, and valgus angle were collected for each trial. Mann-Whitney U tests revealed no statistical significance between foot-type groups, however, effect size statistics revealed practical significance for between-group %MVC biceps femoris (d=1.107), %MVC gluteus maximus (d=1.069), and vertical ground reaction force (d=1.061). Athletes with a SP foot type may experience decreased hip muscle activation associated with increased vertical ground reaction force during a broad jump-to-cut maneuver. This might result in reduced dynamic stability and neuromuscular control during deceleration, potentially increasing the risk of non-contact ACL injury in female soccer players.

Haemodynamic kinetics and intermittent finger flexor performance in rock climbers.

PubMed

Fryer, S; Stoner, L; Lucero, A; Witter, T; Scarrott, C; Dickson, T; Cole, M; Draper, N

2015-02-01

Currently it is unclear whether blood flow (BF) or muscle oxidative capacity best governs performance during intermittent contractions to failure. The aim of this study was to determine oxygenation kinetics and BF responses during intermittent (10 s contraction: 3 s release) contractions at 40% of MVC in rock climbers of different ability (N=38). Total forearm BF, as well as de-oxygenation and re-oxygenation of the flexor digitorum profundus (FDP) and the flexor carpi radialis (FCR) were assessed. Compared to the control, intermediate and advanced groups, the elite climbers had a significantly (p<0.05) greater force time integral (FTI), MVC and MVC/kg. Furthermore, the elite climbers de-oxygenated the FDP significantly more during the first (7.8, 11.9, 12.4 vs. 15.7 O2%) and middle (7.3, 8.8, 10.4 vs.15.3 O2%) phases of contractions as well as for the FCR during the first phase only (8.3, 7, 11.7 vs. 13.3 O2%). They also had a significantly higher BF upon release of the contractions (656, 701, 764 vs. 971 mL ∙ min(-1)). The higher FTI seen in elite climbers may be attributable to a greater blood delivery, and an enhanced O2 recovery during the 3 s release periods, as well as a superior muscle oxidative capacity associated with the greater de-oxygenation during the 10 s contractions. © Georg Thieme Verlag KG Stuttgart · New York.

Changes in tibialis anterior corticospinal properties after acute prolonged muscle vibration.

PubMed

Farabet, Adrien; Souron, Robin; Millet, Guillaume Y; Lapole, Thomas

2016-06-01

Prolonged local vibration is known to impair muscle performance. While involved mechanisms were previously evidenced at the spinal level, changes at the cortical level were also hypothesized. The aims of the present study were to investigate the effects of 30 min of 100-Hz tibialis anterior muscle vibration on force production capacities and to further identify the respective changes in spinal loop properties, descending voluntary drive and corticospinal properties. Thirteen subjects were tested before and after a vibration condition, and before and after a resting control condition. Maximal voluntary contraction (MVC) in dorsiflexion was measured. Transcranial magnetic stimulation was superimposed during MVCs to assess cortical voluntary activation (VATMS), motor-evoked potential amplitude (MEP) and cortical silent period length (CSP). MEP and CSP were also measured during 50 and 75 % MVC contractions. Spinal excitability was investigated by mean of H-reflex. There were no vibration effects on MVC (p = 0.805), maximal EMG activity (p = 0.653), VATMS (p = 1), and CSP (p = 0.877). Vibration tended to decrease MEP amplitude (p = 0.117). H-reflex amplitude was depressed following vibration (p = 0.008). Dorsiflexion maximal force production capacities were unaffected by 30 min of tibialis anterior muscle vibration, despite spinal loop and corticospinal excitabilities being reduced. These findings suggest that acute prolonged vibration has the potential to modulate corticospinal excitability of lower limb muscles without a concomitant functional consequence.

Driving with Pets as a Risk Factor for Motor Vehicle Collisions among Older Drivers

PubMed Central

Blunck, Hallie; Owsley, Cynthia; MacLennan, Paul A.; McGwin, Gerald

2015-01-01

Increasing rates of distraction-related motor vehicle collisions (MVCs) continue to raise concerns regarding driving safety. This study sought to evaluate a novel driving-related distraction, driving with a pet, as a risk factor for MVCs among older, community dwelling adults. Two thousand licensed drivers aged 70 and older were identified, of whom 691 reported pet ownership. Comparing pet owners who did and did not drive with their pets, neither overall MVC rates (rate ratio [RR] 0.97 95% confidence interval [CI] 0.75–1.26) nor at-fault MVC rates (RR 0.84 95% CI 0.57–1.24) were elevated. However, those who reported always driving with a pet in the vehicle had an elevated MVC rate (RR 1.89 95% CI 1.10–3.25), as compared to those who did not drive with a pet. The MVC rate was not increased for those reporting only sometimes or rarely driving with a pet in the vehicle. The current study demonstrates an increased risk of MVC involvement in those older drivers who always take a pet with them when they drive a vehicle. When confronted with an increased cognitive or physical workload while driving, elderly drivers in prior studies have exhibited slower cognitive performance and delayed response times in comparison to younger age groups. Further study of pet-related distracted driving behaviors among older drivers as well as younger populations with respect to driver safety and performance is warranted to appropriately inform the need for policy regulation on this issue. PMID:23708755

Driving with pets as a risk factor for motor vehicle collisions among older drivers.

PubMed

Blunck, Hallie; Owsley, Cynthia; MacLennan, Paul A; McGwin, Gerald

2013-09-01

Increasing rates of distraction-related motor vehicle collisions (MVCs) continue to raise concerns regarding driving safety. This study sought to evaluate a novel driving-related distraction, driving with a pet, as a risk factor for MVCs among older, community dwelling adults. Two thousand licensed drivers aged 70 and older were identified, of whom 691 reported pet ownership. Comparing pet owners who did and did not drive with their pets, neither overall MVC rates (rate ratio [RR] 0.97, 95% confidence interval [CI] 0.75-1.26) nor at-fault MVC rates (RR 0.84, 95% CI 0.57-1.24) were elevated. However, those who reported always driving with a pet in the vehicle had an elevated MVC rate (RR 1.89, 95% CI 1.10-3.25), as compared to those who did not drive with a pet. The MVC rate was not increased for those reporting only sometimes or rarely driving with a pet in the vehicle. The current study demonstrates an increased risk of MVC involvement in those older drivers who always take a pet with them when they drive a vehicle. When confronted with an increased cognitive or physical workload while driving, elderly drivers in prior studies have exhibited slower cognitive performance and delayed response times in comparison to younger age groups. Further study of pet-related distracted driving behaviors among older drivers as well as younger populations with respect to driver safety and performance is warranted to appropriately inform the need for policy regulation on this issue. Published by Elsevier Ltd.

Warfarin use and the risk of valvular calcification.

PubMed

Lerner, R G; Aronow, W S; Sekhri, A; Palaniswamy, C; Ahn, C; Singh, T; Sandhu, R; McClung, J A

2009-12-01

Warfarin affects the synthesis and function of the matrix Gla-protein, a vitamin K-dependent protein, which is a potent inhibitor of tissue calcification. To investigate the incidence of mitral valve calcium (MVC), mitral annular calcium (MAC) and aortic valve calcium (AVC) in patients with non-valvular atrial fibrillation (AF) treated with warfarin vs. no warfarin. Of 1155 patients, mean age 74 years, with AF, 725 (63%) were treated with warfarin and 430 (37%) without warfarin. The incidence of MVC, MAC and AVC was investigated in these 1155 patients with two-dimensional echocardiograms. Unadjusted logistic regression analysis was conducted to examine the association between the use of warfarin and the incidence of MVC, MAC or AVC. Logistic regression analyses were also conducted to investigate whether the relationship stands after adjustment for confounding risk factors such as age, sex, race, ejection fraction, smoking, hypertension, diabetes, dyslipidemia, coronary artery disease (CAD), glomerular filtration rate, calcium, phosphorus, calcium-phosphorus product, alkaline phosphatase, use of aspirin, beta blockers, angiotensin-converting enzyme inhibitors or angiotensin receptor blockers, and statins. There was a significant association between the use of warfarin and the risk of calcification [unadjusted odds ratio = 1.71, 95% CI = (1.34-2.18)]. The association still stands after adjustment for confounding risk factors. MVC, MAC or AVC was present in 473 of 725 patients (65%) on warfarin vs. 225 of 430 patients (52%) not on warfarin (P < 0.0001). Whether this is a causal relationship remains unknown. Use of warfarin in patients with AF is associated with an increased prevalence of MVC, MAC or AVC.

[A field study on the work load and muscle fatigue at neck-shoulder in female sewing machine operators by using surface electromyography].

PubMed

Zhang, Fei-ruo; Wang, Sheng; He, Li-hua; Zhang, Ying; Wu, Shan-shan; Li, Jing-yun; Hu, Guang-yi; Ye, Kang-ping

2011-03-01

To study neck and shoulder work-related muscle fatigue of female sewing machine operators. 18 health female sewing machine operators without musculoskeletal disorders work in Beijing garment industry factory as volunteers in participate of this study. The maximal voluntary contraction (MVC) and 20% MVC of bilateral upper trapezium and cervical erectors spinae was tested before sewing operations, then the whole 20 time windows (1 time window = 10 min) sewing machine operations was monitored and the surface electromyography (sEMG) signals simultaneously was recorded after monitoring the 20%MVC was tested. Use amplitude analysis method to reduction recorded EMG signals. During work, the median load for the left cervical erector spinae (LCES), right cervical erector spinae (RCES), left upper trapezium (LUT) and right upper trapezium (RUT) respectively was 6.78 ± 1.05, 6.94 ± 1.12, 5.68 ± 2.56 and 6.47 ± 3.22, work load of right is higher than the left; static load analysis indicated the value of RMS(20%MVC) before work was higher than that value after work, the increase of right CES and UT RMS(20%MVC) was more; the largest 20%MVE of bilateral CES occurred at 20th time window, and that of bilateral UT happened at 16th. The work load of female sewing machine operators is sustained "static" load, and work load of right neck-shoulder is higher than left, right neck-shoulder muscle is more fatigable and much serious once fatigued.

Recruitment of motor units in two fascicles of the semispinalis cervicis muscle.

PubMed

Schomacher, Jochen; Dideriksen, Jakob Lund; Farina, Dario; Falla, Deborah

2012-06-01

This study investigated the behavior of motor units in the semispinalis cervicis muscle. Intramuscular EMG recordings were obtained unilaterally at levels C2 and C5 in 15 healthy volunteers (8 men, 7 women) who performed isometric neck extensions at 5%, 10%, and 20% of the maximal force [maximum voluntary contraction (MVC)] for 2 min each and linearly increasing force contractions from 0 to 30% MVC over 3 s. Individual motor unit action potentials were identified. The discharge rate and interspike interval variability of the motor units in the two locations did not differ. However, the recruitment threshold of motor units detected at C2 (n = 16, mean ± SD: 10.3 ± 6.0% MVC) was greater than that of motor units detected at C5 (n = 92, 6.9 ± 4.3% MVC) (P < 0.01). A significant level of short-term synchronization was identified in 246 of 307 motor unit pairs when computed within one spinal level but only in 28 of 110 pairs of motor units between the two levels. The common input strength, which quantifies motor unit synchronization, was greater for pairs within one level (0.47 ± 0.32) compared with pairs between levels (0.09 ± 0.07) (P < 0.05). In a second experiment on eight healthy subjects, interference EMG was recorded from the same locations during a linearly increasing force contraction from 0 to 40% MVC and showed significantly greater EMG amplitude at C5 than at C2. In conclusion, synaptic input is distributed partly independently and nonuniformly to different fascicles of the semispinalis cervicis muscle.

The effect of rolling massage on the excitability of the corticospinal pathway.

PubMed

Aboodarda, Saied J; Greene, Rebecca M; Philpott, Devin T; Jaswal, Ramandeep S; Millet, Guillaume Y; Behm, David G

2018-04-01

The aim of the present study was to investigate the alterations of corticospinal excitability (motor evoked potential, MEP) and inhibition (silent period, SP) following rolling massage of the quadriceps muscles. Transcranial magnetic and femoral nerve electrical stimuli were used to elicit MEPs and compound muscle action potential (Mmax) in the vastus lateralis and vastus medialis muscles prior to and following either (i) 4 sets of 90-s rolling massage (ROLLING) or (ii) rest (CONTROL). One series of neuromuscular evaluations, performed after each set of ROLLING or CONTROL, included 3 MEPs and 1 Mmax elicited every 4 s during 15-s submaximal contractions at 10% (experiment 1, n = 16) and 50% (experiment 2, n = 10) of maximal voluntary knee extensions (MVC). The MEP/Mmax ratio and electromyographic activity recorded from vastus lateralis at 10% MVC demonstrated significantly lower values during ROLLING than CONTROL (P < 0.05). The ROLLING did not elicit any significant changes in muscle excitability (Mmax area) and duration of transcranial magnetic stimulation-induced SP recorded from any muscle or level of contraction (P > 0.05). The findings suggest that rolling massage can modulate the central excitability of the circuitries innervating the knee extensors; however, the observed effects are dependent on the background contraction intensity during which the neuromuscular measurements are recorded.

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2011 CFR

2011-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2013 CFR

2013-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2012 CFR

2012-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... a flare. 0.001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement... average. MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 pounds per square inch... (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf/kg-mole at 68 °F and 14.7 psia or 836.6...

Muscle enzyme release does not predict muscle function impairment after triathlon.

PubMed

Margaritis, I; Tessier, F; Verdera, F; Bermon, S; Marconnet, P

1999-06-01

We sought to determine the effects of a long distance triathlon (4 km swim, 120 km bike-ride, and 30 km run) on the four-day kinetics of the biochemical markers of muscle damage, and whether they were quantitatively linked with muscle function impairment and soreness. Data were collected from 2 days before until 4 days after the completion of the race. Twelve triathletes performed the triathlon and five did not. Maximal voluntary contraction (MVC), muscle soreness (DOMS) and total serum CK, CK-MB, LDH, AST and ALT activities were assessed. Significant changes after triathlon completion were found for all muscle damage indirect markers over time (p < 0.0001). MVC of the knee extensor and flexor muscles decreased over time (p < 0.05). There is disparity in the time point at which peak values where reached for DOMS, MVC and enzyme leakage. There is no correlation between serum enzyme leakage, DOMS and MVC impairment which occur after triathlon. Long distance triathlon race caused muscle damage, but extent, as well as muscle recovery cannot be evaluated by the magnitude of changes in serum enzyme activities. Muscle enzyme release cannot be used to predict the magnitude of the muscle function impairment caused by muscle damage.

The Association of Gasoline Prices With Hospital Utilization and Costs for Motorcycle and Nonmotorcycle Motor Vehicle Injuries in the United States.

PubMed

Zhu, He; Wilson, Fernando A; Stimpson, Jim P; Araz, Ozgur M; Kim, Jungyoon; Chen, Baojiang; Wu, Li-Tzy

2016-09-01

This study examined the association between gasoline prices and hospitalizations for motorcycle and nonmotorcycle motor vehicle crash (MVC) injuries. Data on inpatient hospitalizations were obtained from the 2001 to 2010 Nationwide Inpatient Sample. Panel feasible generalized least squares models were used to estimate the effects of monthly inflation-adjusted gasoline prices on hospitalization rates for MVC injuries and to predict the impact of increasing gasoline taxes. On the basis of the available data, a $1.00 increase in the gasoline tax was associated with an estimated 8348 fewer annual hospitalizations for nonmotorcycle MVC injuries, and reduced hospital costs by $143 million. However, the increase in the gasoline tax was also associated with an estimated 3574 more annual hospitalizations for motorcycle crash injuries, and extended hospital costs by $73 million. This analysis of some existing data suggest that the increased utilization and costs of hospitalization from motorcycle crash injuries associated with an increase in the price of gasoline are likely to substantially offset reductions in nonmotorcycle MVC injuries. A policy decision to increase the gasoline tax could improve traffic safety if the increased tax is paired with public health interventions to improve motorcycle safety.

Voluntary muscle activation and evoked volitional-wave responses as a function of torque.

PubMed

Hight, Robert E; Quarshie, Alwyn T; Black, Christopher D

2018-08-01

This study employed a unique stimulation paradigm which allowed for the simultaneous assessment of voluntary activation levels (VA) via twitch-interpolation, and the evoked V-wave responses of the plantar flexors during submaximal and maximal contractions. Test-retest reliability was also examined. Fourteen participants repeated a stimulation protocol over four visits to assess VA and evoked V-wave amplitude across torque levels ranging from 20% to 100% MVC. MVC torque and EMG amplitude were also measured. VA increased nonlinearly with torque production and plateaued by 80% MVC. V-wave amplitude increased linearly from 20% to 100% MVC. There were no differences in any dependent variable across visits (p > 0.05). VA demonstrated moderate to substantial reliability across all torque levels (ICC = 0.76-0.91) while V-wave amplitude exhibited fair to moderate reliability from 40% to 100% (ICC = 0.48-0.74). We were able to reliably collect VA and the V-wave simultaneously in the plantar flexors. Collection of VA and V-wave during the same contraction provides distinct information regarding the contribution of motor-unit recruitment and descending cortico-spinal drive/excitability to force production. Copyright © 2018 Elsevier Ltd. All rights reserved.

Applying an MVC Framework for The System Development Life Cycle with Waterfall Model Extended

NASA Astrophysics Data System (ADS)

Hardyanto, W.; Purwinarko, A.; Sujito, F.; Masturi; Alighiri, D.

2017-04-01

This paper describes the extension of the waterfall model using MVC architectural pattern for software development. The waterfall model is the based model of the most widely used in software development, yet there are still many problems in it. The general issue usually happens on data changes that cause the delays on the process itself. On the other hand, the security factor on the software as well as one of the major problems. This study uses PHP programming language for implementation. Although this model can be implemented in several programming languages with the same concept. This study is based on MVC architecture so that it can improve the performance of both software development and maintenance, especially concerning security, validation, database access, and routing.

Genetic relationships between carcass cut weights predicted from video image analysis and other performance traits in cattle.

PubMed

Pabiou, T; Fikse, W F; Amer, P R; Cromie, A R; Näsholm, A; Berry, D P

2012-09-01

The objective of this study was to quantify the genetic associations between a range of carcass-related traits including wholesale cut weights predicted from video image analysis (VIA) technology, and a range of pre-slaughter performance traits in commercial Irish cattle. Predicted carcass cut weights comprised of cut weights based on retail value: lower value cuts (LVC), medium value cuts (MVC), high value cuts (HVC) and very high value cuts (VHVC), as well as total meat, fat and bone weights. Four main sources of data were used in the genetic analyses: price data of live animals collected from livestock auctions, live-weight data and linear type collected from both commercial and pedigree farms as well as from livestock auctions and weanling quality recorded on-farm. Heritability of carcass cut weights ranged from 0.21 to 0.39. Genetic correlations between the cut traits and the other performance traits were estimated using a series of bivariate sire linear mixed models where carcass cut weights were phenotypically adjusted to a constant carcass weight. Strongest positive genetic correlations were obtained between predicted carcass cut weights and carcass value (min r g(MVC) = 0.35; max r(g(VHVC)) = 0.69), and animal price at both weaning (min r(g(MVC)) = 0.37; max r(g(VHVC)) = 0.66) and post weaning (min r(g(MVC)) = 0.50; max r(g(VHVC)) = 0.67). Moderate genetic correlations were obtained between carcass cut weights and calf price (min r g(HVC) = 0.34; max r g(LVC) = 0.45), weanling quality (min r(g(MVC)) = 0.12; max r (g(VHVC)) = 0.49), linear scores for muscularity at both weaning (hindquarter development: min r(g(MVC)) = -0.06; max r(g(VHVC)) = 0.46), post weaning (hindquarter development: min r(g(MVC)) = 0.23; max r(g(VHVC)) = 0.44). The genetic correlations between total meat weight were consistent with those observed with the predicted wholesale cut weights. Total fat and total bone weights were generally negatively correlated with carcass value, auction prices and weanling quality. Total bone weight was, however, positively correlated with skeletal scores at weaning and post weaning. These results indicate that some traits collected early in life are moderate-to-strongly correlated with carcass cut weights predicted from VIA technology. This information can be used to improve the accuracy of selection for carcass cut weights in national genetic evaluations.

Genotypic tropism testing of proviral DNA to guide maraviroc initiation in aviraemic subjects: 48-week analysis of results from the PROTEST study.

PubMed

Poveda, E; Hernández-Quero, J; Pérez-Elías, M J; Ribas, M A; Martínez-Madrid, O J; Flores, J; Navarro, J; Gutiérrez, F; García-Deltoro, M; Imaz, A; Ocampo, A; Artero, A; Blanco, F; Bernal, E; Pasquau, J; Mínguez-Gallego, C; Pérez, N; Aiestaran, A; García, F; Paredes, R

2017-08-01

Maraviroc (MVC) is a suitable drug for aviraemic subjects on antiretroviral treatment (ART) developing toxicity. Its prescription requires prior tropism testing. It is unknown if proviral DNA genotypic tropism testing is reliable for guiding MVC initiation in aviraemic subjects, so this study was carried out to address this issue. PROTEST was a phase 4, prospective, single-arm clinical trial carried out in 24 HIV care centres in Spain. MVC-naïve HIV-1-infected patients with HIV-1 RNA < 50 copies/mL on stable ART during the previous 6 months who required an ART change because of toxicity and who had R5 HIV, as determined by proviral DNA genotypic tropism testing, initiated MVC with two nucleoside reverse transcriptase inhibitors (NRTIs) and were followed for 48 weeks. Virological failure was defined as two consecutive viral load measurements > 50 copies/mL. Tropism results were available for 141 of 175 (80.6%) subjects screened: 60% had R5 and 85% of these (n = 74) were finally included in the study. Previous ART included protease inhibitors (PIs) in 62% of subjects, nonnucleoside reverse transcriptase inhibitors (NNRTIs) in 36%, and integrase inhibitors (INIs) in 2%. Main reasons for treatment change were dyslipidaemia (42%), gastrointestinal symptoms (22%) and liver toxicity (15%). MVC was given alongside tenofovir (TDF)/emtricitabine (FTC) (54%) and abacavir (ABC)/lamivudine (3TC) (40%) in most patients. Eighty-four per cent of patients maintained a viral load < 50 copies/mL to week 48, whereas 16% discontinued treatment: two withdrew informed consent, one had an R5 to X4 shift between screening and baseline, one was lost to follow-up, one developed an adverse event (rash), two died from non-study-related causes, and five developed protocol-defined virological failure. Initiation of MVC plus two NRTIs in aviraemic subjects based on genotypic tropism testing of proviral HIV-1 DNA is associated with low rates of virological failure for up to 1 year. © 2016 British HIV Association.

Relationship between isometric contraction intensity and muscle hardness assessed by ultrasound strain elastography.

PubMed

Inami, Takayuki; Tsujimura, Toru; Shimizu, Takuya; Watanabe, Takemasa; Lau, Wing Yin; Nosaka, Kazunori

2017-05-01

Ultrasound elastography is used to assess muscle hardness or stiffness; however, no previous studies have validated muscle hardness measures using ultrasound strain elastography (SE). This study investigated the relationship between plantar flexor isometric contraction intensity and gastrocnemius hardness assessed by SE. We hypothesised that the muscle would become harder linearly with an increase in the contraction intensity of the plantar flexors. Fifteen young women (20.1 ± 0.8 years) performed isometric contractions of the ankle plantar flexors at four different intensities (25, 50, 75, 100% of maximal voluntary contraction force: MVC) at 0° plantar flexion. Using SE images, the strain ratio (SR) between the muscle and an acoustic coupler (elastic modulus 22.6 kPa) placed over the skin was calculated (muscle/coupler); pennation angle and muscle thickness were measured for the resting and contracting conditions. SR decreased with increasing contraction intensity from rest (1.28 ± 0.20) to 25% (0.99 ± 0.21), 50% (0.61 ± 0.15), 75% (0.34 ± 0.1) and 100% MVC (0.20 ± 0.05). SR decreased linearly (P < 0.05) with increasing MVC from rest to 75% MVC, but levelled off from 75 and 100% MVC. SR was negatively correlated with pennation angle (r = -0.80, P < 0.01) and muscle thickness ( r= -0.78,  P< 0.01). SR appears to represent muscle hardness changes in response to contraction intensity changes, in the assumption that the gastrocnemius muscle contraction intensity is proportional to the plantar flexion intensity. We concluded that gastrocnemius muscle hardness changes could be validly assessed by SR, and the force-hardness relationship was not linear.

Changes in Achilles tendon moment arm from rest to maximum isometric plantarflexion: in vivo observations in man

PubMed Central

Maganaris, Constantinos N; Baltzopoulos, Vasilios; Sargeant, Anthony J

1998-01-01

The purpose of the present study was to examine the effect of a plantarflexor maximum voluntary contraction (MVC) on Achilles tendon moment arm length. Sagittal magnetic resonance (MR) images of the right ankle were taken in six subjects both at rest and during a plantarflexor MVC in the supine position at a knee angle of 90 deg and at ankle angles of -30 deg (dorsiflexed direction), -15 deg, 0 deg (neutral ankle position), +15 deg (plantarflexed direction), +30 deg and +45 deg. A system of mechanical stops, support triangles and velcro straps was used to secure the subject in the above positions. Location of a moving centre of rotation was calculated for ankle rotations from -30 to 0 deg, -15 to +15 deg, 0 to +30 deg and +15 to +45 deg. All instant centres of rotation were calculated both at rest and during MVC. Achilles tendon moment arms were measured at ankle angles of -15, 0, +15 and +30 deg. At any given ankle angle, Achilles tendon moment arm length during MVC increased by 1-1.5 cm (22-27%, P < 0.01) compared with rest. This was attributed to a displacement of both Achilles tendon by 0.6-1.1 cm (P < 0.01) and all instant centres of rotation by about 0.3 cm (P < 0.05) away from their corresponding resting positions. The findings of this study have important implications for estimating loads in the musculoskeletal system. Substantially unrealistic Achilles tendon forces and moments generated around the ankle joint during a plantarflexor MVC would be calculated using resting Achilles tendon moment arm measurements. PMID:9660906

Changes in Achilles tendon moment arm from rest to maximum isometric plantarflexion: in vivo observations in man.

PubMed

Maganaris, C N; Baltzopoulos, V; Sargeant, A J

1998-08-01

1. The purpose of the present study was to examine the effect of a plantarflexor maximum voluntary contraction (MVC) on Achilles tendon moment arm length. 2. Sagittal magnetic resonance (MR) images of the right ankle were taken in six subjects both at rest and during a plantarflexor MVC in the supine position at a knee angle of 90 deg and at ankle angles of -30 deg (dorsiflexed direction), -15 deg, 0 deg (neutral ankle position), +15 deg (plantarflexed direction), +30 deg and +45 deg. A system of mechanical stops, support triangles and velcro straps was used to secure the subject in the above positions. Location of a moving centre of rotation was calculated for ankle rotations from -30 to 0 deg, -15 to +15 deg, 0 to +30 deg and +15 to +45 deg. All instant centres of rotation were calculated both at rest and during MVC. Achilles tendon moment arms were measured at ankle angles of -15, 0, +15 and +30 deg. 3. At any given ankle angle, Achilles tendon moment arm length during MVC increased by 1-1.5 cm (22-27 %, P < 0.01) compared with rest. This was attributed to a displacement of both Achilles tendon by 0.6-1.1 cm (P < 0.01) and all instant centres of rotation by about 0.3 cm (P < 0.05) away from their corresponding resting positions. 4. The findings of this study have important implications for estimating loads in the musculoskeletal system. Substantially unrealistic Achilles tendon forces and moments generated around the ankle joint during a plantarflexor MVC would be calculated using resting Achilles tendon moment arm measurements.

A Maraviroc-Resistant HIV-1 with Narrow Cross-Resistance to Other CCR5 Antagonists Depends on both N-Terminal and Extracellular Loop Domains of Drug-Bound CCR5▿

PubMed Central

Tilton, John C.; Wilen, Craig B.; Didigu, Chukwuka A.; Sinha, Rohini; Harrison, Jessamina E.; Agrawal-Gamse, Caroline; Henning, Elizabeth A.; Bushman, Frederick D.; Martin, Jeffrey N.; Deeks, Steven G.; Doms, Robert W.

2010-01-01

CCR5 antagonists inhibit HIV entry by binding to a coreceptor and inducing changes in the extracellular loops (ECLs) of CCR5. In this study, we analyzed viruses from 11 treatment-experienced patients who experienced virologic failure on treatment regimens containing the CCR5 antagonist maraviroc (MVC). Viruses from one patient developed high-level resistance to MVC during the course of treatment. Although resistance to one CCR5 antagonist is often associated with broad cross-resistance to other agents, these viruses remained sensitive to most other CCR5 antagonists, including vicriviroc and aplaviroc. MVC resistance was dependent upon mutations within the V3 loop of the viral envelope (Env) protein and was modulated by additional mutations in the V4 loop. Deep sequencing of pretreatment plasma viral RNA indicated that resistance appears to have occurred by evolution of drug-bound CCR5 use, despite the presence of viral sequences predictive of CXCR4 use. Envs obtained from this patient before and during MVC treatment were able to infect cells expressing very low CCR5 levels, indicating highly efficient use of a coreceptor. In contrast to previous reports in which CCR5 antagonist-resistant viruses interact predominantly with the N terminus of CCR5, these MVC-resistant Envs were also dependent upon the drug-modified ECLs of CCR5 for entry. Our results suggest a model of CCR5 cross-resistance whereby viruses that predominantly utilize the N terminus are broadly cross-resistant to multiple CCR5 antagonists, whereas viruses that require both the N terminus and antagonist-specific ECL changes demonstrate a narrow cross-resistance profile. PMID:20702642

Under the influence with a child in the car: implications for child safety and caregiver intervention.

PubMed

Lawson, Karla A; Yuma-Guerrero, Paula J; von Sternberg, Kirk; Duzinski, Sarah V; Garcia, Nilda M; Brown, Carlos V; Wakefield, Sarah M; Crawford, Natalie M; Velasquez, Mary M; Maxson, R Todd

2011-11-01

Injury is the leading cause of death for those aged 1 year to 44 years in the United States, with motor vehicle collisions (MVCs) the leading cause of injury-related deaths. Little data exist on the relationship between caregiver alcohol and drug use at the time of MVC and child passenger outcomes. We examined the relationship between caregiver substance use in MVCs and a number of demographic, crash severity, and medical outcomes for caregivers and children. We identified family groups treated in the emergency department of a regional Level II trauma center after an MVC in a 1-year period from July 1, 2005, to June 30, 2006. The distribution and means of characteristics for substance and nonsubstance users were compared using χ analysis and Student's t tests, respectively. One in 10 vehicles contained an intoxicated caregiver at the time of MVC. In 363 identified caregivers, intoxication was associated with being male (p < 0.001), lack of safety device use (p = 0.003), rollover (p = 0.008), and ejection (p = 0.016). In the 278 family groups, intoxicated caregivers were related to child ejection (p = 0.009), the need for child hospital admission (p < 0.001), and driver intoxication was related to child lack of restraint (p = 0.045). These findings suggest a substantial number of child MVC victims arrive at the emergency room after riding with an intoxicated caregiver. Findings support the need for prevention programs focusing on substance use and driving for male caregivers, and further investigation on the need for screening and intervention for caregivers' risky alcohol and drug use after a child's MVC.

Properties of tonic episodes of masseter muscle activity during waking hours and sleep in subjects with and without history of orofacial pain.

PubMed

Mude, Acing Habibie; Kawakami, Shigehisa; Kato, Seiya; Minagi, Shogo

2018-04-01

To provide a scientific data related to the tonic activity of masseter muscle in subjects with and without history of orofacial pain during their normal daily life. Thirty-three subjects were divided into two groups, a pain history group (PHG) and a non-pain history group (non-PHG), based on their responses to the Research Diagnostic Criteria for Temporomandibular Disorders questionnaire. After excluding four subjects with incomplete recordings, full-day masseter muscle surface EMGs of 29 subjects (10 men, 19 women; mean age 24.1 years) were analyzed. Tonic episode (TE) was defined as continuous EMG activity with a duration at least 2s with intensities above twice the baseline noise level. TEs were classified into 6 strength categories (<7.5%, 7.5-10%, 10-15%, 15-25%, 25-40% and >40% of the maximum voluntary clenching (MVC)). The mean duration of activity observed in the non-PHG+2 SD was adopted as a cutoff for identifying sustained TE. During waking hours, the incidence of sustained TEs was significantly higher in the PHG than in the non-PHG (p<0.05). The incidence and total duration of sustained TEs were significantly higher in the PHG than in the non-PHG at intensities of 7.5-10% MVC, 10-15% MVC, and 15-25% MVC (p<0.05). No significant difference was observed during sleep. Within the limitations of this study, it would be concluded that sustained TEs may have a correlation with orofacial pain and the intensity range of 7.5-25% MVC would be an important range for future clenching studies. Copyright © 2017. Published by Elsevier Ltd.

Cold water immersion recovery following intermittent-sprint exercise in the heat.

PubMed

Pointon, Monique; Duffield, Rob; Cannon, Jack; Marino, Frank E

2012-07-01

This study examined the effects of cold water immersion (CWI) on recovery of neuromuscular function following simulated team-sport exercise in the heat. Ten male team-sport athletes performed two sessions of a 2 × 30-min intermittent-sprint exercise (ISE) in 32°C and 52% humidity, followed by a 20-min CWI intervention or passive recovery (CONT) in a randomized, crossover design. The ISE involved a 15-m sprint every minute separated by bouts of hard running, jogging and walking. Voluntary and evoked neuromuscular function, ratings of perceived muscle soreness (MS) and blood markers for muscle damage were measured pre- and post-exercise, immediately post-recovery, 2-h and 24-h post-recovery. Measures of core temperature (Tcore), heart rate (HR), capillary blood and perceptions of exertion, thermal strain and thirst were also recorded at the aforementioned time points. Post-exercise maximal voluntary contraction (MVC) and activation (VA) were reduced in both conditions and remained below pre-exercise values for the 24-h recovery (P < 0.05). Increased blood markers of muscle damage were observed post-exercise in both conditions and remained elevated for the 24-h recovery period (P < 0.05). Comparative to CONT, the post-recovery rate of reduction in Tcore, HR and MS was enhanced with CWI whilst increasing MVC and VA (P < 0.05). In contrast, 24-h post-recovery MVC and activation were significantly higher in CONT compared to CWI (P = 0.05). Following exercise in the heat, CWI accelerated the reduction in thermal and cardiovascular load, and improved MVC alongside increased central activation immediately and 2-h post-recovery. However, despite improved acute recovery CWI resulted in an attenuated MVC 24-h post-recovery.

Epidemiology of alcohol and other drug use among motor vehicle crash victims admitted to a trauma center.

PubMed

Walsh, J Michael; Flegel, Ron; Cangianelli, Leo A; Atkins, Randolph; Soderstrom, Carl A; Kerns, Timothy J

2004-09-01

The objectives of this research were to (1) determine the incidence and prevalence of alcohol and other drug use among motor vehicle crash (MVC) victims admitted to a regional Level-I trauma center, and (2) to examine the utility of using a rapid point-of-collection (POC) drug-testing device to identify MVC patients with drug involvement. Blood and urine specimens were routinely collected per clinical protocol for each MVC victim at the time of admission. Blood alcohol concentration (BAC) levels were determined per standard clinical protocol. Clinical urine specimens were routinely split so that a POC drug-testing device for the detection of commonly abused drugs (Marijuana, Cocaine, Amphetamines, Methamphetamines, and Opiates) could be compared to that of the standard hospital laboratory analysis of each urine specimen (which also included Barbiturates and Benzodiazepines). In the six-month period of this study, nearly two-thirds of trauma center admissions were victims of motor vehicle crashes. During this time, blood and urine was collected from 322 MVC victims. Toxicology results indicated that 59.3% of MVC victims tested positive for either commonly abused drugs or alcohol. More patients tested positive for drug use than tested positive for alcohol, with 33.5% testing positive for drug use only, 15.8% testing positive for alcohol use only, and 9.9% testing positive for both drugs and alcohol. Less than half (45.2%) of the substance-abusing patients in this study would have been identified by an alcohol test alone. After alcohol, marijuana and benzodiazepines were the most frequently detected drugs. Point of collection (POC) test results correlated well with laboratory results and provide important information to initiate rapid intervention/treatment for substance use problems among injured patients.

High Virologic Failure Rates with Maraviroc-Based Salvage Regimens Among Indian Patients: A Preliminary Analysis-Maraviroc Effectiveness in HIV-1 Subtype C.

PubMed

Pujari, Sanjay; Gaikwad, Sunil; Bele, Vivek; Joshi, Kedar; Dabhade, Digamber

2018-01-01

There is no information on the clinical effectiveness of Maraviroc (MVC) amongst People Living with HIV (PLHIV) in India infected with HIV-1 Subtype C viruses. We conducted a retrospective chart review of adult PLHIV on MVC based Antiretroviral (ARV) regimens for at least 6 months. Maraviroc was initiated amongst PLHIV with documented R5 tropic viruses (determined by in-house population sequencing of the V3 loop in triplicate and interpreted using the Geno2Pheno algorithm) in combination with an Optimized Background regimen (designed using genotypic resistance testing and past ARV history). Plasma viral loads (PVL) are performed 6 months post-initiation and annually thereafter. Primary outcome d. Median duration on MVC treatment was 1.8 years (range 1-2.9 years) while median duration of ART prior to switching to MVC was 13 years. Maraviroc was combined with Darunavir/ritonavir (DRV/r) (n=10), Atazanavir/r (ATV/r) (n=2) and Lopinavir/r (LPV/r) (n=1). All PLHIV were infected with HIV-1 Subtype C. Only 23.3% PLHIV achieved virologic suppression at 6 months and sustained it for 2.3 years. Median CD4 count change from baseline was +117 (n=13), +228 (n=10), +253 (n=9), and +331 (n=4) at 6, 12, 18 and 24 months respectively. Repeat tropism among patients with virologic failure demonstrated R5 virus. High rates of virologic failure was seen when MVC was used amongst treatment experienced PLHIV infected with HIV-1 Subtype C in India. was the proportion of PLHIV with virologic success (PVL<50 copies/ml) at last follow up visit. Data on 13 PLHIV were analyze.

Obesity and non-fatal motor vehicle crash injuries: sex difference effects.

PubMed

Ma, X; Laud, P W; Pintar, F; Kim, J-E; Shih, A; Shen, W; Heymsfield, S B; Allison, D B; Zhu, S

2011-09-01

Obesity and motor vehicle crash (MVC) injuries are two parallel epidemics in the United States. An important unanswered question is whether there are sex differences in the associations between the presence of obesity and non-fatal MVC injuries. To further understand the association between obesity and non-fatal MVC injuries, particularly the sex differences in these relations. We examined this question by analyzing data from the 2003 to 2007 National Automotive Sampling System Crashworthiness Data System (NASS CDS). A total of 10,962 drivers who were aged 18 years or older and who survived frontal collision crashes were eligible for the study. Male drivers experienced a lower rate of overall non-fatal MVC injuries than did female drivers (38.1 versus 52.2%), but experienced a higher rate of severe injuries (0.7 versus 0.2%). After adjusting for change in velocity (ΔV) during the crashes, obese male drivers showed a much higher risk (logistic coefficients of body mass index (BMI) for moderate, serious and severe injury are 0.0766, 0.1470 and 0.1792, respectively; all P<0.05) of non-fatal injuries than did non-obese male drivers and these risks increased with injury severity. Non-fatal injury risks were not found to be increased in obese female drivers. The association between obesity and risk of non-fatal injury was much stronger for male drivers than for female drivers. The higher risk of non-fatal MVC injuries in obese male drivers might result from their different body shape and fat distribution compared with obese female drivers. Our findings should be considered for obesity reduction, traffic safety evaluation and vehicle design for obese male drivers and provide testable hypotheses for future studies.

Simultaneous Measurement of Etravirine, Maraviroc and Raltegravir in Pigtail Macaque Plasma, Vaginal Secretions and Vaginal Tissue using a LC-MS/MS Assay

PubMed Central

Blakney, Anna K.; Jiang, Yonghou; Whittington, Dale; Woodrow, Kim A.

2016-01-01

Etravirine (ETR), maraviroc (MVC) and raltegravir (RAL) are promising antiretroviral drugs being used in HIV treatment and may be interesting for prevention applications such as oral or topical pre-exposure prophylaxis. Here we describe a sensitive and accurate method for the simultaneous detection of ETR, MVC and RAL from pigtail macaque plasma, vaginal secretions, and vaginal tissue. This method is characterized by a straightforward precipitation extraction method, a limit of quantification <0.5 ng mL−1 for all three antiretrovirals bolstered by a corresponding internal standard for each drug analyte, and short run time. Quantification is performed using positive ion electrospray triple quadrupole mass spectrometry. This method was validated over clinically relevant ranges for the three ARV drugs in all three matrices: 0.1–100 ng mL−1 for ETR, 0.05–100 ng mL−1 for MVC and 1–100 ng mL−1 for RAL. Our method is accurate and precise, with measured mean inter-assay precision (%CV) and accuracy (% bias) of 5.08% and 1.96%, respectively, while the mean intra-assay precision and accuracy were 3.44% and 1.08 %. The overall post-extraction recovery for ETR, MVC and RAL was >94% in all cases. We also show that extracted biological samples are stable after storage at room temperature or 4 °C and after three freeze/thaw cycles. This is the first analytical method capable of quantifying ETR, MVC and RAL in biological matrices relevant for pre-clinical testing of oral or topical HIV prevention methods in pigtailed macaques. PMID:27236000

Recruitment of motor units in two fascicles of the semispinalis cervicis muscle

PubMed Central

Schomacher, Jochen; Dideriksen, Jakob Lund; Farina, Dario

2012-01-01

This study investigated the behavior of motor units in the semispinalis cervicis muscle. Intramuscular EMG recordings were obtained unilaterally at levels C2 and C5 in 15 healthy volunteers (8 men, 7 women) who performed isometric neck extensions at 5%, 10%, and 20% of the maximal force [maximum voluntary contraction (MVC)] for 2 min each and linearly increasing force contractions from 0 to 30% MVC over 3 s. Individual motor unit action potentials were identified. The discharge rate and interspike interval variability of the motor units in the two locations did not differ. However, the recruitment threshold of motor units detected at C2 (n = 16, mean ± SD: 10.3 ± 6.0% MVC) was greater than that of motor units detected at C5 (n = 92, 6.9 ± 4.3% MVC) (P < 0.01). A significant level of short-term synchronization was identified in 246 of 307 motor unit pairs when computed within one spinal level but only in 28 of 110 pairs of motor units between the two levels. The common input strength, which quantifies motor unit synchronization, was greater for pairs within one level (0.47 ± 0.32) compared with pairs between levels (0.09 ± 0.07) (P < 0.05). In a second experiment on eight healthy subjects, interference EMG was recorded from the same locations during a linearly increasing force contraction from 0 to 40% MVC and showed significantly greater EMG amplitude at C5 than at C2. In conclusion, synaptic input is distributed partly independently and nonuniformly to different fascicles of the semispinalis cervicis muscle. PMID:22402657

Role of α-adrenergic vasoconstriction in regulating skeletal muscle blood flow and vascular conductance during forearm exercise in ageing humans

PubMed Central

Richards, Jennifer C; Luckasen, Gary J; Larson, Dennis G; Dinenno, Frank A

2014-01-01

In healthy humans, ageing is typically associated with reduced skeletal muscle blood flow and vascular conductance during exercise. Further, there is a marked increase in resting sympathetic nervous system (SNS) activity with age, yet whether augmented SNS-mediated α-adrenergic vasoconstriction contributes to the age-associated impairment in exercising muscle blood flow and vascular tone in humans is unknown. We tested the hypothesis that SNS-mediated vasoconstriction is greater in older than young adults and limits muscle (forearm) blood flow (FBF) during graded handgrip exercise (5, 15, 25% maximal voluntary contraction (MVC)). FBF was measured (Doppler ultrasound) and forearm vascular conductance (FVC) was calculated in 11 young (21 ± 1 years) and 12 older (62 ± 2 years) adults in control conditions and during combined local α- and β-adrenoreceptor blockade via intra-arterial infusions of phentolamine and propranolol, respectively. Under control conditions, older adults exhibited significantly lower FBF and FVC at 15% MVC exercise (22.6 ± 1.3 vs. 29 ± 3.3 ml min−1 100 g forearm fat-free mass (FFM)−1 and 21.7 ± 1.2 vs. 33.6 ± 4.0 ml min−1 100 g FFM−1 100 mmHg−1; P < 0.05) and 25% MVC exercise (37.4 ± 1.4 vs. 46.0 ± 4.9 ml min−1 100 g FFM−1 and 33.7 ± 1.4 vs. 49.0 ± 5.7 ml min−1 100 g FFM−1 100 mmHg−1; P < 0.05), whereas there was no age group difference at 5% MVC exercise. Local adrenoreceptor blockade increased FBF and FVC at rest and during exercise in both groups, although the increase in FBF and FVC from rest to steady-state exercise was similar in young and older adults across exercise intensities, and thus the age-associated impairment in FBF and FVC persisted. Our data indicate that during graded intensity handgrip exercise, the reduced FVC and subsequently lower skeletal muscle blood flow in older healthy adults is not due to augmented sympathetic vasoconstriction, but rather due to impairments in local signalling or structural limitations in the peripheral vasculature with advancing age. PMID:25194040

Reliability of near-infrared spectroscopy for measuring biceps brachii oxygenation during sustained and repeated isometric contractions.

PubMed

Muthalib, Makii; Millet, Guillaume Y; Quaresima, Valentina; Nosaka, Kazunori

2010-01-01

We examine the test-retest reliability of biceps brachii tissue oxygenation index (TOI) parameters measured by near-infrared spectroscopy during a 10-s sustained and a 30-repeated (1-s contraction, 1-s relaxation) isometric contraction task at 30% of maximal voluntary contraction (30% MVC) and maximal (100% MVC) intensities. Eight healthy men (23 to 33 yr) were tested on three sessions separated by 3 h and 24 h, and the within-subject reliability of torque and each TOI parameter were determined by Bland-Altman+/-2 SD limits of agreement plots and coefficient of variation (CV). No significant (P>0.05) differences between the three sessions were found for mean values of torque and TOI parameters during the sustained and repeated tasks at both contraction intensities. All TOI parameters were within+/-2 SD limits of agreement. The CVs for torque integral were similar between the sustained and repeated task at both intensities (4 to 7%); however, the CVs for TOI parameters during the sustained and repeated task were lower for 100% MVC (7 to 11%) than for 30% MVC (22 to 36%). It is concluded that the reliability of the biceps brachii NIRS parameters during both sustained and repeated isometric contraction tasks is acceptable.

Physical Fatigue, Fitness, and Muscle Function in Patients With Antineutrophil Cytoplasmic Antibody-Associated Vasculitis.

PubMed

McClean, Andrew; Morgan, Matthew D; Basu, Neil; Bosch, Jos A; Nightingale, Peter; Jones, David; Harper, Lorraine

2016-09-01

This study investigated differences in cardiorespiratory fitness, muscular function, perceived exertion, and anxiety/depression between patients and healthy controls (HCs) and assessed which of these variables may account for the fatigue experienced by patients. Fatigue was measured in 48 antineutrophil cytoplasmic antibody-associated vasculitis patients and 41 healthy controls using the Multidimensional Fatigue Inventory (MFI-20), focusing on the physical component. Quality of life, anxiety/depression, and sleep quality were assessed by validated questionnaires. Muscle mass was measured by dual-energy x-ray absorptiometry scan, strength as the maximal voluntary contraction (MVC) force, and endurance as sustained isometric contraction at 50% MVC of the quadriceps. Voluntary activation was assessed by superimposed electrical stimulation. Cardiorespiratory fitness ( ˙Vo2 max and oxygen pulse [O2 pulse]) and perceived exertion (Borg scale) were measured during progressive submaximal exercise. Patients reported elevated physical fatigue scores compared to HCs (patients MFI-20 physical 13 [interquartile range (IQR) 8-16], HCs MFI-20 physical 5.5 [IQR 4-8]; P < 0.001). Muscle mass was the same in both groups, but MVC and time to failure in the endurance test were lower due to reduced voluntary activation in patients. Estimated ˙Vo2 max and O2 pulse were the same in both groups. For the same relative workload, patients reported higher ratings of perceived exertion, which correlated with reports of MFI-20 physical fatigue (R(2)  = 0.2). Depression (R(2)  = 0.6), anxiety (R(2)  = 0.3), and sleep disturbance (R(2)  = 0.3) were all correlated with MFI-20 physical fatigue. These observations suggest that fatigue in patients is of a central rather than peripheral origin, supported by associations of fatigue with heightened perception of exertion, depression, anxiety, and sleep disturbance but normal muscle and cardiorespiratory function. © 2016, American College of Rheumatology.

Photobiomodulation therapy (PBMT) and/or cryotherapy in skeletal muscle restitution, what is better? A randomized, double-blinded, placebo-controlled clinical trial.

PubMed

de Paiva, Paulo Roberto Vicente; Tomazoni, Shaiane Silva; Johnson, Douglas Scott; Vanin, Adriane Aver; Albuquerque-Pontes, Gianna Móes; Machado, Caroline Dos Santos Monteiro; Casalechi, Heliodora Leão; de Carvalho, Paulo de Tarso Camillo; Leal-Junior, Ernesto Cesar Pinto

2016-12-01

Cryotherapy for post-exercise recovery remains widely used despite the lack of quality evidence. Photobiomodulation therapy (PBMT) studies (with both low-level laser therapy and light-emitting diode therapy) have demonstrated positive scientific evidence to suggest its use. The study aims to evaluate PBMT and cryotherapy as a single or combined treatment on skeletal muscle recovery after eccentric contractions of knee extensors. Fifty healthy male volunteers were recruited and randomized into five groups (PBMT, cryotherapy, cryotherapy + PBMT, PMBT + cryotherapy, or placebo) for a randomized, double-blinded, placebo-controlled trial that evaluated exercise performance (maximum voluntary contraction (MVC)), delayed onset muscle soreness (DOMS), and muscle damage (creatine kinase (CK)). Assessments were performed at baseline; immediately after; and at 1, 24, 48, 72, and 96 h. Comparator treatments was performed 3 min after exercise and repeated at 24, 48, and 72 h. PBMT was applied employing a cordless, portable GameDay ™ device (combination of 905 nm super-pulsed laser and 875- and 640-nm light-emitting diodes (LEDs); manufactured by Multi Radiance Medical ™ , Solon - OH, USA), and cryotherapy by flexible rubber ice packs. PBMT alone was optimal for post-exercise recovery with improved MVC, decreased DOMS, and CK activity (p < 0.05) from 24 to 96 h compared to placebo, cryotherapy, and cryotherapy + PBMT. In the PBMT + cryotherapy group, the effect of PBMT was decreased (p > 0.05) but demonstrated significant improvement in MVC, decreased DOMS, and CK activity (p < 0.05). Cryotherapy as single treatment and cryotherapy + PBMT were similar to placebo (p > 0.05). We conclude that PBMT used as single treatment is the best modality for enhancement of post-exercise restitution, leading to complete recovery to baseline levels from 24 h after high-intensity eccentric contractions.

Investigating the Effects of Peripheral Electrical Stimulation on Corticomuscular Functional Connectivity Stroke Survivors.

PubMed

Lai, Meei-I; Pan, Li-Ling; Tsai, Mei-Wun; Shih, Yi-Fen; Wei, Shun-Hwa; Chou, Li-Wei

2016-06-01

Electrical stimulation (ES) in the periphery can induce brain plasticity and has been used clinically to promote motor recovery in patients with central nervous system lesion. Electroencephalogram (EEG) and electromyogram (EMG) are readily applicable in clinical settings and can detect real-time functional connectivity between motor cortex and muscles with EEG-EMG (corticomuscular) coherence. The purpose of this study was to determine whether EEG-EMG coherence can detect changes in corticomuscular control induced by peripheral ES. Fifteen healthy young adults and 15 stroke survivors received 40-min electrical stimulation session on median nerve. The stimulation (1-ms rectangular pulse, 100 Hz) was delivered with a 20-s on-20-s off cycle, and the intensity was set at the subjects' highest tolerable level without muscle contraction or pain. Both before and after the stimulation session, subjects performed a 20-s steady-hold thumb flexion at 50% maximal voluntary contraction (MVC) while EEG and EMG were collected. Our results demonstrated that after ES, EEG-EMG coherence in gamma band increased significantly for 22.1 and 48.6% in healthy adults and stroke survivors, respectively. In addition, after ES, force steadiness was also improved in both groups, as indicated by the decrease in force fluctuation during steady-hold contraction (-1.7% MVC and -3.9%MVC for healthy and stroke individuals, respectively). Our results demonstrated that EEG-EMG coherence can detect ES-induced changes in the neuromuscular system. Also, because gamma coherence is linked to afferent inputs encoding, improvement in motor performance is likely related to ES-elicited strong sensory input and enhanced sensorimotor integration.

MVC for Content Management on the Cloud

DTIC Science & Technology

2011-09-01

Windows, Linux , MacOS, PalmOS and other customized ones (Qiu). Figure 20 illustrates implementation of MVC architecture. Qiu examines a “universal...Listing of Unzipped Text Document (From O’Reilly & Associates, Inc, 2005) Figure 37 shows the results of unzipping this file in Linux . The contents of the...ODF Adoption TC, and the ODF Alliance include members from Adobe, BBC, Bristol City Council, Bull, Corel, EDS, EMC, GNOME, IBM, Intel, KDE , MySQL

Recovery Effect of the Muscle Fatigue by the Magnetic Stimulation

NASA Astrophysics Data System (ADS)

Uchida, Kousuke; Nuruki, Atsuo; Tsujimura, Sei-Ichi; Tamari, Youzou; Yunokuchi, Kazutomo

The purpose of this study is to investigate the effect of magnetic stimulation for muscle fatigue. The six healthy subjects participated in the experiment with the repetition grasp using a hand dynamometer. The measurement of EMG (electromyography) and MMG (mechanomyography) is performed on the left forearm. All subjects performed MVC (maximum voluntary contraction), and repeated exercise in 80%MVC after the MVC measurement. The repetition task was entered when display muscular strength deteriorated. We used an EMG and MMG for the measurement of the muscle fatigue. Provided EMG and MMG waves were calculated integral calculus value (iEMG, and iMMG). The result of iEMG and iMMG were divided by muscular strength, because we calculate integral calculus value per the unit display muscular strength. The result of our study, we found recovery effect by the magnetic stimulation in voluntarily muscular strength and iEMG. However, we can not found in a figure of iMMG.

Predicting significant torso trauma.

PubMed

Nirula, Ram; Talmor, Daniel; Brasel, Karen

2005-07-01

Identification of motor vehicle crash (MVC) characteristics associated with thoracoabdominal injury would advance the development of automatic crash notification systems (ACNS) by improving triage and response times. Our objective was to determine the relationships between MVC characteristics and thoracoabdominal trauma to develop a torso injury probability model. Drivers involved in crashes from 1993 to 2001 within the National Automotive Sampling System were reviewed. Relationships between torso injury and MVC characteristics were assessed using multivariate logistic regression. Receiver operating characteristic curves were used to compare the model to current ACNS models. There were a total of 56,466 drivers. Age, ejection, braking, avoidance, velocity, restraints, passenger-side impact, rollover, and vehicle weight and type were associated with injury (p < 0.05). The area under the receiver operating characteristic curve (83.9) was significantly greater than current ACNS models. We have developed a thoracoabdominal injury probability model that may improve patient triage when used with ACNS.

Traumatic subarachnoid hemorrhage due to motor vehicle crash versus fall from height: a 4-year epidemiologic study.

PubMed

Parchani, Ashok; El-Menyar, Ayman; Al-Thani, Hassan; El-Faramawy, Ahmed; Zarour, Ahmad; Asim, Mohammad; Latifi, Rifat

2014-11-01

Traumatic brain injury (TBI) is a common cause of morbidity and mortality worldwide. It is difficult to estimate the real incidence of traumatic subarachnoid hemorrhage (TSAH). Although TSAH after trauma is associated with poor prognoses, the impact of mechanism of injury (MOI) and the pathophysiology remains unknown. We hypothesized that outcome of TSAH caused by motor vehicle crash (MVC) or fall from height (FFH) varies based on the MOI. Data were collected retrospectively from a prospectively created database registry in the section of Trauma Surgery at Hamad General Hospital between January 2008 and July 2012. All patients presented with head trauma and TSAH were included. Patient data included age, gender, nationality, mechanism of injury, injury severity score (ISS), types of head injuries, and associated injuries. Ventilator days, intensive care unit length of stay, pneumonia, and mortality were also studied. A total of 1665 patients with TBI were identified, of them 403 had TSAH with a mean age of 35 ± 15 years. Of them 93% were male patients and 86% were expatriates. MVC (53%) and FFH (35%) were the major mechanisms of injury. The overall mean ISS and head abbreviated injury score were 19 ± 10.6 and 3.4 ± 0.96, respectively. Patients in MVC group sustained severe TSAH, had significantly greater head abbreviated injury score (3.5 ± 0.9 vs. 3.2 ± 0.9; P = 0.009) and ISS (21.6 ± 10.6 vs. 15.9 ± 9.5; P = 0.001), and lower scene Glasgow coma scale (10.8 ± 4.8 vs. 13.2 ± 3.4; P = 0.001) compared with the FFH group. In addition, the MVC group sustained more intraventricular hemorrhage (4.7 vs. 0.7; P = 0.001) and diffuse axonal injury (4.2 vs. 2.9; P = 0.001). In contrast, extradural hemorrhage (14.3% vs. 11.6%; P = 0.008) was higher in the FFH group. Lower extremities (14% vs. 4.3%; P = 0.004) injury was mainly associated with the MVC group. The overall mortality was 19 % among patients with TSAH. The mortality rate was higher in the MVC group when compared with the FFH group (24% vs. 10%; P = 0.001). In both groups, ISS and Glasgow coma scale at the scene were independent predictors of mortality. Patients with TSAH have a higher mortality rate. In this population, MVCs are associated with a 3-fold increased risk of mortality. Therefore, prevention of MVC and fall can reduce the incidence and severity of TBI in Qatar. Copyright © 2014 Elsevier Inc. All rights reserved.

Has the incidence of thoracolumbar spine injuries increased in the United States from 1998 to 2011?

PubMed

Doud, Andrea N; Weaver, Ashley A; Talton, Jennifer W; Barnard, Ryan T; Meredith, J Wayne; Stitzel, Joel D; Miller, Preston; Miller, Anna N

2015-01-01

While most motor vehicle crash (MVC)-related injuries have been decreasing, one study showed increases in MVC-related spinal fractures from 1994 to 2002 in Wisconsin. To our knowledge, no studies evaluating nationwide trends of MVC-related thoracolumbar spine injuries have been published. Such fractures can cause pain, loss of functionality or even death. If the incidence of such injuries is increasing, it may provide a motive for reassessment of current vehicle safety design. We questioned whether the incidence of thoracolumbar spine injuries increased in the United States population with time (between 1998 and 2011), and if there was an increased incidence of thoracolumbar injuries, whether there were identifiable compensatory "trade-off injury" patterns, such as reductions in sacropelvic injuries. Institutional review board approval was obtained for retrospective review of three national databases: the National Trauma Databank® (NTDB®), 2002-2006, National Automotive Sampling System (NASS), 2000-2011, and National Inpatient Sample (NIS), 1998-2007. In each database, the total number of MVC-related injuries and the number of MVC-related thoracolumbar injuries per year were identified using appropriate Abbreviated Injury Scale (AIS) or ICD-9 codes. Sacropelvic injuries also were identified to evaluate their potential as trade-off injuries. Poisson regression models adjusting for age were used to analyze trends in the data with time. All databases showed increases in MVC-related thoracolumbar spine injuries when adjusting for age with time. These age-adjusted relative annual percent increases ranged from 8.22% (95% CI, 5.77%-10.72%; p<0.001) using AIS of 2 or more (AIS2 +) injury codes in the NTDB®, 8.59% (95% CI, 5.88%-11.37%; p<0.001) using ICD-9 codes in the NTDB®, 8.12% (95% CI, 7.20%-9.06%; p<0.001) using ICD-9 codes in the NIS, and 8.10 % (95% CI 5.00%-11.28%; p<0.001) using AIS2+ injury codes in the NASS. As these thoracolumbar injuries have increased, there has been no consistent trend toward a compensatory reduction in terms of sacropelvic injuries. While other studies have shown that rates of many MVC-related injuries are declining with time, our data show increases in the incidence of thoracolumbar injury. Although more sensitive screening tools likely have resulted in earlier and increased recognition of these injuries, it cannot be stated for certain that this is the only driver of the increased incidence observed in this study. As seatbelt use has continued to increase, this trend may be the result of thoracolumbar injuries as trade-offs for other injuries, although in our study we did not see a compensatory decrease in sacropelvic injuries. Investigation evaluating the root of this pattern is warranted.

Self-reported vs state-recorded motor vehicle collisions among older community dwelling individuals.

PubMed

Singletary, B A; Do, A N; Donnelly, J P; Huisingh, C; Mefford, M T; Modi, R; Mondesir, F L; Ye, Y; Owsley, C; McGwin, G

2017-04-01

Motor vehicle collisions (MVCs) continue to place an increased burden on both individuals and health care systems. Self-reported and state-recorded police reports are the most common methods for MVC evaluation in epidemiologic studies, with varying degrees of agreement of information when compared in previous studies. The objective of the current study is to address the differences in MVC reporting and provide a more robust measure of the agreement between self-reported and state-recorded MVCs in a community dwelling population of older adults. A three-year prospective study was conducted in a population-based sample of 2000 licensed drivers aged 70 and older. At annual visits, participants were asked to self-report information on any MVC that occurred over the prior year where police were called to the scene. Information on police-reported MVCs was also ascertained from Alabama official state-recorded databases. The kappa coefficient was calculated to determine overall agreement between any self-reported and state-recorded crashes, as well as the raw number of crashes reported. In addition, agreement was stratified by demographics, health status, medication use, functional status (i.e. vision, cognition), and driving habits. 1747 participants who completed three years of follow up were involved in 225 state-recorded MVCs and 208 self-reported MVCs yielding overall substantial agreement between any self-report and state-recorded MVC (kappa=0.64). Cumulative number of self-reported and state-recorded MVCs was also compared, with agreement slightly reduced (kappa=0.55). The clinical characteristic resulting in the greatest variation in agreement with drivers was impaired contrast sensitivity showing better agreement between self-reported and state-recorded MVCs (kappa=0.9) than those with non-impaired contrast sensitivity (kappa=0.6). Study results showed substantial agreement between self-reported and state-recorded MVCs for any MVC involvement among the study population. When examining the reporting of the total number of MVCs over the three year period, agreement was reduced to a moderate level. There was consistency in agreement across MVC risk factors except among individuals with contrast sensitivity. These findings have implications for the design and analytic planning of epidemiologic and clinical research focused on MVCs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Prevalence and psychometric screening for the detection of major depressive disorder and post-traumatic stress disorder in adults injured in a motor vehicle crash who are engaged in compensation.

PubMed

Guest, Rebecca; Tran, Yvonne; Gopinath, Bamini; Cameron, Ian D; Craig, Ashley

2018-02-21

Physical injury and psychological disorder following a motor vehicle crash (MVC) is a public health concern. The objective of this research was to determine rates of major depressive disorder (MDD) and post-traumatic stress disorder (PTSD) in adults with MVC-related injury engaged in compensation, and to determine the capacity (e.g. sensitivity and specificity) of two psychometric scales for estimating the presence of MDD and PTSD. Participants included 109 adults with MVC-related injury engaged in compensation during 2015 to 2017, in Sydney, Australia. The mean time from MVC to baseline assessment was 11 weeks. Comprehensive assessment was conducted at baseline, and the Depression Anxiety Stress Scales (DASS-21) and the Impact of Event Scale-Revised (IES-R) were administered to determine probable MDD and PTSD. An online psychiatric interview, based on Diagnostic and Statistical Manual for Mental Disorders (DSM-5), was used to diagnose actual MDD and PTSD, acknowledged as gold standard diagnostic criteria. One-way multivariate analyses of variance established criterion validity of the DASS-21 and IES-R, and sensitivity and specificity analyses were conducted to determine the most sensitive cut-off points for detecting probable MDD and PTSD. Substantial rates of MDD (53.2%) and PTSD (19.3%) were found. The DASS-21 and IES-R were shown to have excellent criterion validity for detecting MDD and PTSD in injured participants. A range of cut-off points were investigated and shown to have acceptable sensitivity and specificity for detecting MDD and PTSD in an injured population engaged in compensation. The preferred cut-off points based on this study are: to detect MDD, a DASS-21 total score of 30 and/or a DASS-21 depression score of 10; to detect PTSD, IES-R scores of 33-40 and/or a DASS-21 anxiety score of 7-8. Major psychological disorder is prevalent following a MVC. Results suggest the DASS-21 and IES-R are suitable for use in clinical/compensation settings to detect probable MDD and PTSD soon after a MVC in physically injured people engaged in compensation. These results provide positive direction in the public health arena for improving mental health outcomes. Clinical Trials registration number: ANZCTR - ACTRN12615000326594 (9th April 2015).

Postactivation potentiation biases maximal isometric strength assessment.

PubMed

Lima, Leonardo Coelho Rabello; Oliveira, Felipe Bruno Dias; Oliveira, Thiago Pires; Assumpção, Claudio de Oliveira; Greco, Camila Coelho; Cardozo, Adalgiso Croscato; Denadai, Benedito Sérgio

2014-01-01

Postactivation potentiation (PAP) is known to enhance force production. Maximal isometric strength assessment protocols usually consist of two or more maximal voluntary isometric contractions (MVCs). The objective of this study was to determine if PAP would influence isometric strength assessment. Healthy male volunteers (n = 23) performed two five-second MVCs separated by a 180-seconds interval. Changes in isometric peak torque (IPT), time to achieve it (tPTI), contractile impulse (CI), root mean square of the electromyographic signal during PTI (RMS), and rate of torque development (RTD), in different intervals, were measured. Significant increases in IPT (240.6 ± 55.7 N·m versus 248.9 ± 55.1 N·m), RTD (746 ± 152 N·m·s(-1) versus 727 ± 158 N·m·s(-1)), and RMS (59.1 ± 12.2% RMSMAX  versus 54.8 ± 9.4% RMSMAX) were found on the second MVC. tPTI decreased significantly on the second MVC (2373 ± 1200 ms versus 2784 ± 1226 ms). We conclude that a first MVC leads to PAP that elicits significant enhancements in strength-related variables of a second MVC performed 180 seconds later. If disconsidered, this phenomenon might bias maximal isometric strength assessment, overestimating some of these variables.

Assessment of H reflex sensitivity with M wave alternation consequent to fatiguing contractions.

PubMed

Hwang, Ing-Shiou; Huang, Cheng-Ya; Wu, Pei-Shan; Chen, Yi-Ching; Wang, Chun-Hou

2008-09-01

The objective of this study was to examine the changes in H reflex sensitivity after neuromuscular fatigue associated with fluctuations of the M wave. In the maximal and submaximal voluntary contraction (MVC and SMVC) paradigms, subjects performed voluntary plantarflexion at 100% MVC and 40% MVC respectively until the limit of torque maintenance was reached. In the submaximal electrical stimulation (SMES) paradigm, the tricep surae was exhausted with sustained electrical stimulation of 40% of the maximal tolerable intensity at a 40-Hz stimulus rate. The H reflexes and maximal M waves (M(max)) of the soleus were recorded before and after the three fatigue paradigms, and the H reflex was standardized with M(max) to minimize possible bias due to fatigue-induced M wave fluctuation. The results showed a significant increase in the standardized H reflex due to the SMES paradigm in spite of M(max) potentiation. The SMVC paradigm led to a reduction in size of the standardized H reflex without modification of M(max), whereas the standardized H reflex was not mediated by the MVC paradigm, which contributed to a noticeable M(max) potentiation. The present study underscored the fact that the H reflex sensitivity and M wave amplitude were not necessarily suppressed consequent to neuromuscular fatigue, but varied with the activation history of a muscle for size-dependent efficacy of the Ia transmission pathways and postactivation potentiation.

Acoustic myography as an indicator of force during sustained contractions of a small hand muscle.

PubMed

Goldenberg, M S; Yack, H J; Cerny, F J; Burton, H W

1991-01-01

To test the hypothesis that muscle sound amplitudes would remain constant during sustained submaximal isometric contractions, we recorded acoustic myograms from the abductor digiti minimi muscle in 12 subjects at 15, 25, 50, and 75% of a maximum voluntary contraction (MVC). Muscle sounds were detected with an omni-directional electret microphone encased in closed-cell foam and attached to the skin over the muscle. Acoustic amplitudes from the middle and end of the sustained contractions were compared with the amplitudes from the beginning of contractions to determine whether acoustic amplitudes varied in magnitude as force remained constant. Physiological tremor was eliminated from the acoustic signal by use of a Fourier truncation at 14 Hz. The amplitudes of the acoustic signal at a contraction intensity of 75% MVC remained constant, reflecting force production over time. At 50% MVC, the root-mean-square amplitude decreased from the beginning to the end of the contraction (P less than 0.05). Acoustic amplitudes increased over time at 15 and 25% MVC and were significantly higher at the end of the contractions than at the beginning (P less than 0.05). Alterations in the acoustic amplitude, which reflect changes in the lateral vibrations of the muscle, may be indicative of the different recruitment strategies used to maintain force during sustained isometric contractions.

Effect of angular velocity on soleus and medial gastrocnemius H-reflex during maximal concentric and eccentric muscle contraction.

PubMed

Duclay, Julien; Robbe, Alice; Pousson, Michel; Martin, Alain

2009-10-01

At rest, the H-reflex is lower during lengthening than shortening actions. During passive lengthening, both soleus (SOL) and medial gastrocnemius (MG) H-reflex amplitudes decrease with increasing angular velocity. This study was designed to investigate whether H-reflex amplitude is affected by angular velocity during concentric and eccentric maximal voluntary contraction (MVC). Experiments were performed on nine healthy men. At a constant angular velocity of 60 degrees /s and 20 degrees /s, maximal H-reflex and M-wave potentials were evoked at rest (i.e., H(max) and M(max), respectively) and during concentric and eccentric MVC (i.e., H(sup) and M(sup), respectively). Regardless of the muscle, H(max)/M(max) was lower during lengthening than shortening actions and the H(sup)/M(sup) ratio was higher than H(max)/M(max) during lengthening actions. Whereas no action type and angular velocity effects on the MG H(sup)/M(sup) were found, the SOL H(sup)/M(sup) was lower during eccentric than concentric MVC and this depression was increased with higher angular velocity. Our findings indicate that the depression of the H-reflex amplitude during eccentric compared to concentric MVC depends mainly on the amount of inhibition induced by lengthening action. In conclusion, H-reflex should be evoked during both passive and active dynamic trials to evaluate the plasticity of the spinal loop.

Effects of a Finger Tapping Fatiguing Task on M1-Intracortical Inhibition and Central Drive to the Muscle.

PubMed

Madrid, Antonio; Madinabeitia-Mancebo, Elena; Cudeiro, Javier; Arias, Pablo

2018-06-19

The central drive to the muscle reduces when muscle force wanes during sustained MVC, and this is generally considered the neurophysiological footprint of central fatigue. The question is if force loss and the failure of central drive to the muscle are responsible mechanisms of fatigue induced by un-resisted repetitive movements. In various experimental blocks, we validated a 3D-printed hand-fixation system permitting the execution of finger-tapping and maximal voluntary contractions (MVC). Subsequently, we checked the suitability of the system to test the level of central drive to the muscle and developed an algorithm to test it at the MVC force plateau. Our main results show that the maximum rate of finger-tapping dropped at 30 s, while the excitability of inhibitory M1-intracortical circuits and corticospinal excitability increased (all by approximately 15%). Furthermore, values obtained immediately after finger-tapping showed that MVC force and the level of central drive to the muscle remained unchanged. Our data suggest that force and central drive to the muscle are not determinants of fatigue induced by short-lasting un-resisted repetitive finger movements, even in the presence of increased inhibition of the motor cortex. According to literature, this profile might be different in longer-lasting, more complex and/or resisted repetitive movements.

Neck muscle biomechanics and neural control.

PubMed

Fice, Jason Bradley; Siegmund, Gunter P; Blouin, Jean-Sebastien

2018-04-18

The mechanics, morphometry, and geometry of our joints, segments and muscles are fundamental biomechanical properties intrinsic to human neural control. The goal of our study was to investigate if the biomechanical actions of individual neck muscles predicts their neural control. Specifically, we compared the moment direction & variability produced by electrical stimulation of a neck muscle (biomechanics) to their preferred activation direction & variability (neural control). Subjects sat upright with their head fixed to a 6-axis load cell and their torso restrained. Indwelling wire electrodes were placed into the sternocleidomastoid (SCM), splenius capitis (SPL), and semispinalis capitis (SSC) muscles. The electrically stimulated direction was defined as the moment direction produced when a current (2-19mA) was passed through each muscle's electrodes. Preferred activation direction was defined as the vector sum of the spatial tuning curve built from RMS EMG when subjects produced isometric moments at 7.5% and 15% of their maximum voluntary contraction (MVC) in 26 3D directions. The spatial tuning curves at 15% MVC were well-defined (unimodal, p<0.05) and their preferred directions were 23, 39, & 21{degree sign} different from their electrically stimulated directions for the SCM, SPL, and SSC respectively (p<0.05). Intra-subject variability was smaller in electrically stimulated moment directions when compared to voluntary preferred directions, and intra-subject variability decreased with increased activation levels. Our findings show that the neural control of neck muscles is not based solely on optimizing individual muscle biomechanics but, as activation increases, biomechanical constraints in part dictate the activation of synergistic neck muscles.

Hemodynamic responses to small muscle mass exercise in heart failure patients with reduced ejection fraction

PubMed Central

Barrett-O'Keefe, Zachary; Lee, Joshua F.; Berbert, Amanda; Witman, Melissa A. H.; Nativi-Nicolau, Jose; Stehlik, Josef; Richardson, Russell S.

2014-01-01

To better understand the mechanisms responsible for exercise intolerance in heart failure with reduced ejection fraction (HFrEF), the present study sought to evaluate the hemodynamic responses to small muscle mass exercise in this cohort. In 25 HFrEF patients (64 ± 2 yr) and 17 healthy, age-matched control subjects (64 ± 2 yr), mean arterial pressure (MAP), cardiac output (CO), and limb blood flow were examined during graded static-intermittent handgrip (HG) and dynamic single-leg knee-extensor (KE) exercise. During HG exercise, MAP increased similarly between groups. CO increased significantly (+1.3 ± 0.3 l/min) in the control group, but it remained unchanged across workloads in HFrEF patients. At 15% maximum voluntary contraction (MVC), forearm blood flow was similar between groups, while HFrEF patients exhibited an attenuated increase at the two highest intensities compared with controls, with the greatest difference at the highest workload (352 ± 22 vs. 492 ± 48 ml/min, HFrEF vs. control, 45% MVC). During KE exercise, MAP and CO increased similarly across work rates between groups. However, HFrEF patients exhibited a diminished leg hyperemic response across all work rates, with the most substantial decrement at the highest intensity (1,842 ± 64 vs. 2,675 ± 81 ml/min; HFrEF vs. control, 15 W). Together, these findings indicate a marked attenuation in exercising limb perfusion attributable to impairments in peripheral vasodilatory capacity during both arm and leg exercise in patients with HFrEF, which likely plays a role in limiting exercise capacity in this patient population. PMID:25260608

MODIS NDVI Change Detection Techniques and Products Used in the Near Real Time ForWarn System for Detecting, Monitoring, and Analyzing Regional Forest Disturbances

NASA Technical Reports Server (NTRS)

Spruce, Joseph P.; Hargrove, William; Gasser, Jerry; Smoot, James; Kuper, Philip D.

2014-01-01

This presentation discusses MODIS NDVI change detection methods and products used in the ForWarn Early Warning System (EWS) for near real time (NRT) recognition and tracking of regionally evident forest disturbances throughout the conterminous US (CONUS). The latter has provided NRT forest change products to the forest health protection community since 2010, using temporally processed MODIS Aqua and Terra NDVI time series data to currently compute and post 6 different forest change products for CONUS every 8 days. Multiple change products are required to improve detectability and to more fully assess the nature of apparent disturbances. Each type of forest change product reports per pixel percent change in NDVI for a given 24 day interval, comparing current versus a given historical baseline NDVI. EMODIS 7 day expedited MODIS MOD13 data are used to obtain current and historical NDVIs, respectively. Historical NDVI data is processed with Time Series Product Tool (TSPT); and 2) the Phenological Parameters Estimation Tool (PPET) software. While each change products employ maximum value compositing (MVC) of NDVI, the design of specific products primarily differs in terms of the historical baseline. The three main change products use either 1, 3, or all previous years of MVC NDVI as a baseline. Another product uses an Adaptive Length Compositing (ALC) version of MVC to derive an alternative current NDVI that is the freshest quality NDVI as opposed to merely the MVC NDVI across a 24 day time frame. The ALC approach can improve detection speed by 8 to 16 days. ForWarn also includes 2 change products that improve detectability of forest disturbances in lieu of climatic fluctuations, especially in the spring and fall. One compares current MVC NDVI to the zonal maximum under the curve NDVI per pheno-region cluster class, considering all previous years in the MODIS record. The other compares current maximum NDVI to the mean of maximum NDVI for all previous MODIS years.

Reducing Older Driver Motor Vehicle Collisions via Earlier Cataract Surgery

PubMed Central

Mennemeyer, Stephen T.; Owsley, Cynthia; McGwin, Gerald

2013-01-01

Older adults who undergo cataract extraction have roughly half the rate of motor vehicle collision (MVC) involvement per mile driven compared to cataract patients who do not elect cataract surgery. Currently in the U.S., most insurers do not allow payment for cataract surgery based upon the findings of a vision exam unless accompanied by an individual’s complaint of visual difficulties that seriously interfere with driving or other daily activities and individuals themselves may be slow or reluctant to complain and seek relief. As a consequence, surgery tends to occur after significant vision problems have emerged. We hypothesize that a proactive policy encouraging cataract surgery earlier for a lesser level of complaint would significantly reduce MVCs among older drivers. We used a Monte Carlo model to simulate the MVC experience of the U.S. population from age 60 to 89 under alternative protocols for the timing of cataract surgery which we call “Current Practice” (CP) and “Earlier Surgery” (ES). Our base model finds, from a societal perspective with undiscounted 2010 dollars, that switching to ES from CP reduces by about 21% the average number of MVCs, fatalities, and MVC cost per person. The net effect on total cost – all MVC costs plus cataract surgery expenditures -- is a reduction of about 16%. Quality Adjusted Life Years would increase by about 5%. From the perspective of payers for healthcare, the switch would increase cataract surgery expenditure for ages 65+ by about 8% and for ages 60 to 64 by about 47% but these expenditures are substantially offset after age 65 by reductions in the medical and emergency services component of MVC cost. Similar results occur with discounting at 3% and with various sensitivity analyses. We conclude that a policy of ES would significantly reduce MVCs and their associated consequences. PMID:23369786

The influence of bar diameter on neuromuscular strength and activation: inferences from an isometric unilateral bench press.

PubMed

Fioranelli, Douglas; Lee, C Matthew

2008-05-01

The purpose of this study was to examine the influence of two different bar diameters on neuromuscular activation and strength. The bar diameters used reflected a standard Olympic bar (28 mm (1.1 inch); THIN) and a larger fat bar (51 mm [2 inch]; THICK). Eighteen healthy men (age 25.0 +/- 1 years) were assessed for their maximal voluntary contraction (MVC) during a unilateral isometric bench press exercise with the 2 bar types at 2 different joint angles (angle 1 and angle 2; elbow joint at approximately 45 and 90 degrees , respectively). Additionally, on a separate day, subjects performed three 10-second isometric repetitions at an intensity of 80% MVC using the 2 different bars at angle 1 and angle 2. Electromyographic recordings were collected in the pectoralis major and the muscles of the forearm flexor region at a sampling rate of 1000 Hz during the second day of testing. Analysis of variance was used to examine differences in MVC between bars and also examine between bar differences in electromyographic activity for each muscle group at each joint angle. A significance level of 0.05 was used for all tests. MVC was not different between bar types, although there was a main effect of joint angle on MVC such that it was greater at angle 2. There was a main effect of bar at both angles for the forearm muscles and at angle 1 for the pectoralis such that electromyographic activity was greater with THIN. Our data do not support the hypothesis that bar diameter influences performance during an isometric bench press exercise. However, higher electromyographic activity with THIN suggests greater neuromuscular activation with a standard Olympic bar as opposed to a larger diameter "fat" bar. Although our data do not support the use of a fat bar for increasing neuromuscular activation, these findings should be confirmed in other resistance training exercises.

Fatigue-related firing of distal muscle nociceptors reduces voluntary activation of proximal muscles of the same limb.

PubMed

Kennedy, David S; McNeil, Chris J; Gandevia, Simon C; Taylor, Janet L

2014-02-15

With fatiguing exercise, firing of group III/IV muscle afferents reduces voluntary activation and force of the exercised muscles. These afferents can also act across agonist/antagonist pairs, reducing voluntary activation and force in nonfatigued muscles. We hypothesized that maintained firing of group III/IV muscle afferents after a fatiguing adductor pollicis (AP) contraction would decrease voluntary activation and force of AP and ipsilateral elbow flexors. In two experiments (n = 10) we examined voluntary activation of AP and elbow flexors by measuring changes in superimposed twitches evoked by ulnar nerve stimulation and transcranial magnetic stimulation of the motor cortex, respectively. Inflation of a sphygmomanometer cuff after a 2-min AP maximal voluntary contraction (MVC) blocked circulation of the hand for 2 min and maintained firing of group III/IV muscle afferents. After a 2-min AP MVC, maximal AP voluntary activation was lower with than without ischemia (56.2 ± 17.7% vs. 76.3 ± 14.6%; mean ± SD; P < 0.05) as was force (40.3 ± 12.8% vs. 57.1 ± 13.8% peak MVC; P < 0.05). Likewise, after a 2-min AP MVC, elbow flexion voluntary activation was lower with than without ischemia (88.3 ± 7.5% vs. 93.6 ± 3.9%; P < 0.05) as was torque (80.2 ± 4.6% vs. 86.6 ± 1.0% peak MVC; P < 0.05). Pain during ischemia was reported as Moderate to Very Strong. Postfatigue firing of group III/IV muscle afferents from the hand decreased voluntary drive and force of AP. Moreover, this effect decreased voluntary drive and torque of proximal unfatigued muscles, the elbow flexors. Fatigue-sensitive group III/IV muscle nociceptors act to limit voluntary drive not only to fatigued muscles but also to unfatigued muscles within the same limb.

Patterns in deer-related traffic injuries over a decade: the Mayo clinic experience

PubMed Central

2010-01-01

Background Our American College of Surgeons Level 1 Trauma Center serves a rural population. As a result, there is a unique set of accidents that are not present in an urban environment such as deer related motor vehicle crashes (dMVC). We characterized injury patterns between motorcycle/all-terrain vehicles (MCC) and automobile (MVC) crashes related to dMVC (deer motor vehicle crash) with the hypotheses that MCC will present with higher Injury Severity Score (ISS) and that it would be related to whether the driver struck the deer or swerved. Methods The records of 157 consecutive patients evaluated at our institution for injury related to dMVC from January 1st, 1997 to December 31st, 2006 were reviewed from our prospectively collected trauma database. Demographic, clinical, and crash specific parameters were abstracted. Injury severity was analyzed by the Abbreviated Injury Scale score for each body region as well as the overall Injury Severity Score (ISS). Results Motorcycle crashes presented with a higher median ISS than MVCs (14 vs 5, p < 0.001). Median Abbreviated Injury Score (AIS) of the spine for MCC riders was higher (3 vs 0, p < 0.001) if they swerved rather than collided. Seventy-seven percent of riders were not wearing a helmet which did not result in a statistically significant increase in median ISS (16 vs 10), head AIS (2 vs 0) or spine AIS (0 vs 0). Within the MVC group, there was no difference between swerving and hitting the deer in any AIS group. Forty-seven percent of drivers were not wearing seat belts which resulted in similar median ISS (6 vs 5) and AIS of all body regions. Conclusions Motorcycle operators suffered higher ISS. There were no significant differences in median ISS if a driver involved in a deer-related motor vehicle crash swerved rather than collided, was helmeted, or restrained. PMID:20716341

Patterns in deer-related traffic injuries over a decade: the Mayo Clinic experience.

PubMed

Smoot, Dustin L; Zielinski, Martin D; Cullinane, Daniel C; Jenkins, Donald H; Schiller, Henry J; Sawyer, Mark D

2010-08-17

Our American College of Surgeons Level 1 Trauma Center serves a rural population. As a result, there is a unique set of accidents that are not present in an urban environment such as deer related motor vehicle crashes (dMVC). We characterized injury patterns between motorcycle/all-terrain vehicles (MCC) and automobile (MVC) crashes related to dMVC (deer motor vehicle crash) with the hypotheses that MCC will present with higher Injury Severity Score (ISS) and that it would be related to whether the driver struck the deer or swerved. The records of 157 consecutive patients evaluated at our institution for injury related to dMVC from January 1st, 1997 to December 31st, 2006 were reviewed from our prospectively collected trauma database. Demographic, clinical, and crash specific parameters were abstracted. Injury severity was analyzed by the Abbreviated Injury Scale score for each body region as well as the overall Injury Severity Score (ISS). Motorcycle crashes presented with a higher median ISS than MVCs (14 vs 5, p < 0.001). Median Abbreviated Injury Score (AIS) of the spine for MCC riders was higher (3 vs 0, p < 0.001) if they swerved rather than collided. Seventy-seven percent of riders were not wearing a helmet which did not result in a statistically significant increase in median ISS (16 vs 10), head AIS (2 vs 0) or spine AIS (0 vs 0).Within the MVC group, there was no difference between swerving and hitting the deer in any AIS group. Forty-seven percent of drivers were not wearing seat belts which resulted in similar median ISS (6 vs 5) and AIS of all body regions. Motorcycle operators suffered higher ISS. There were no significant differences in median ISS if a driver involved in a deer-related motor vehicle crash swerved rather than collided, was helmeted, or restrained.

ACE ID genotype and the muscle strength and size response to unilateral resistance training.

PubMed

Pescatello, Linda S; Kostek, Matthew A; Gordish-Dressman, Heather; Thompson, Paul D; Seip, Richard L; Price, Thomas B; Angelopoulos, Theodore J; Clarkson, Priscilla M; Gordon, Paul M; Moyna, Niall M; Visich, Paul S; Zoeller, Robert F; Devaney, Joseph M; Hoffman, Eric P

2006-06-01

To examine associations among the angiotensin I-converting enzyme (ACE) insertion (I)/deletion (D) polymorphism and the response to a 12-wk (2 d.wk) unilateral, upper-arm resistance training (RT) program in the trained (T, nondominant) and untrained (UT, dominant) arms. Subjects were 631 (mean+/-SEM, 24.2+/-0.2 yr) white (80%) men (42%) and women (58%). The ACE ID genotype was in Hardy-Weinberg equilibrium with frequencies of 23.1, 46.1, and 30.8% for ACE II, ID, and DD, respectively (chi=1.688, P=0.430). Maximum voluntary contraction (MVC) and one-repetition maximum (1RM) assessed peak elbow flexor muscle strength. Magnetic resonance imaging measured biceps muscle cross-sectional area (CSA). Multiple variable and repeated-measures ANCOVA tested whether muscle strength and size differed at baseline and pre- to post-RT among T and UT and ACE ID genotype. Baseline muscle strength and size were greater in UT than T (P<0.001) and did not differ among ACE ID genotype in either arm (P >or= 0.05). In T, MVC increases were greater for ACE II/ID (22%) than DD (17%) (P<0.05), whereas 1RM (51%) and CSA (19%) gains were not different among ACE ID genotype pre- to post-RT (P >or= 0.05). In UT, MVC increased among ACE II/ID (7%) (P<0.001) but was similar among ACE DD (2%) pre- to post-RT (P >or= 0.05). In UT, 1RM (11%) and CSA (2%) increases were greater for ACE DD/ID than ACE II (1RM, 7%; CSA, -0.1%) (P<0.05). ACE ID genotype explained approximately 1% of the MVC response to RT in T and approximately 2% of MVC, 2% of 1RM, and 4% of CSA response in UT (P<0.05). ACE ID genotype is associated with the contralateral effects of unilateral RT, perhaps more so than with the muscle strength and size adaptations that result from RT.

Ergonomic analysis of primary and assistant surgical roles.

PubMed

Zihni, Ahmed M; Cavallo, Jaime A; Ray, Shuddhadeb; Ohu, Ikechukwu; Cho, Sohyung; Awad, Michael M

2016-06-15

Laparoscopic surgery is associated with a high degree of ergonomic stress. However, the stress associated with surgical assisting is not known. In this study, we compare the ergonomic stress associated with primary and assistant surgical roles during laparoscopic surgery. We hypothesize that higher ergonomic stress will be detected in the primary operating surgeon when compared with the surgical assistant. One right-hand dominant attending surgeon performed 698 min of laparoscopic surgery over 13 procedures (222 min primary and 476 min assisting), whereas electromyography data were collected from bilateral biceps, triceps, deltoids, and trapezius muscles. Data were analyzed in 1-min segments. Average muscle activation as quantified by maximal voluntary contraction (%MVC) was calculated for each muscle group during primary surgery and assisting. We compared mean %MVC values with unpaired t-tests. Activation of right (R) biceps and triceps muscle groups is significantly elevated while operating when compared with assisting (R biceps primary: 5.47 ± 0.21 %MVC, assistant: 3.93 ± 0.11, P < 0.001; R triceps primary: 6.53 ± 0.33 %MVC, assistant: 5.48 ± 0.18, P = 0.002). Mean activation of the left trapezius muscle group is elevated during assisting (primary: 4.33 ± 0.26 %MVC, assistant: 5.70 ± 0.40, P = 0.024). No significance difference was noted in the other muscle groups (R deltoid, R trapezius, left [L] biceps, L triceps, and L deltoid). We used surface electromyography to quantify ergonomic differences between operating and assisting. Surgical assisting was associated with similar and occasionally higher levels of muscle activation compared with primary operating. These findings suggest that surgical assistants face significant ergonomic stress, just as operating surgeons do. Steps must be taken to recognize and mitigate this stress in both operating surgeons and assistants. Copyright © 2016 Elsevier Inc. All rights reserved.

Eccentric muscle damage has variable effects on motor unit recruitment thresholds and discharge patterns in elbow flexor muscles.

PubMed

Dartnall, Tamara J; Rogasch, Nigel C; Nordstrom, Michael A; Semmler, John G

2009-07-01

The purpose of this study was to determine the effect of eccentric muscle damage on recruitment threshold force and repetitive discharge properties of low-threshold motor units. Ten subjects performed four tasks involving isometric contraction of elbow flexors while electromyographic (EMG) data were recorded from human biceps brachii and brachialis muscles. Tasks were 1) maximum voluntary contraction (MVC); 2) constant-force contraction at various submaximal targets; 3) motor unit recruitment threshold task; and 4) minimum motor unit discharge rate task. These tasks were performed on three separate days before, immediately after, and 24 h after eccentric exercise of elbow flexor muscles. MVC force declined (42%) immediately after exercise and remained depressed (29%) 24 h later, indicative of muscle damage. Mean motor unit recruitment threshold for biceps brachii was 8.4+/-4.2% MVC, (n=34) before eccentric exercise, and was reduced by 41% (5.0+/-3.0% MVC, n=34) immediately after and by 39% (5.2+/-2.5% MVC, n=34) 24 h after exercise. No significant changes in motor unit recruitment threshold were observed in the brachialis muscle. However, for the minimum tonic discharge rate task, motor units in both muscles discharged 11% faster (10.8+/-2.0 vs. 9.7+/-1.7 Hz) immediately after (n=29) exercise compared with that before (n=32). The minimum discharge rate variability was greater in brachialis muscle immediately after exercise (13.8+/-3.1%) compared with that before (11.9+/-3.1%) and 24 h after exercise (11.7+/-2.4%). No significant changes in minimum discharge rate variability were observed in the biceps brachii motor units after exercise. These results indicate that muscle damage from eccentric exercise alters motor unit recruitment thresholds for >or=24 h, but the effect is not the same in the different elbow flexor muscles.

Change in muscle fascicle length influences the recruitment and discharge rate of motor units during isometric contractions.

PubMed

Pasquet, Benjamin; Carpentier, Alain; Duchateau, Jacques

2005-11-01

This study examines the effect of fascicle length change on motor-unit recruitment and discharge rate in the human tibialis anterior (TA) during isometric contractions of various intensities. The torque produced during dorsiflexion and the surface and intramuscular electromyograms (EMGs) from the TA were recorded in eight subjects. The behavior of the same motor unit (n = 59) was compared at two ankle joint angles (+10 and -10 degrees around the ankle neutral position). Muscle fascicle length of the TA was measured noninvasively using ultrasonography recordings. When the ankle angle was moved from 10 degrees plantarflexion to 10 degrees dorsiflexion, the torque produced during maximal voluntary contraction (MVC) was significantly reduced [35.2 +/- 3.3 vs. 44.3 +/- 4.2 (SD) Nm; P < 0.001] and the average surface EMG increased (0.47 +/- 0.08 vs. 0.43 +/- 0.06 mV; P < 0.05). At reduced ankle joint angle, muscle fascicle length declined by 12.7% (P < 0.01) at rest and by 18.9% (P < 0.001) during MVC. Motor units were activated at a lower recruitment threshold for short compared with long muscle fascicle length, either when expressed in absolute values (2.1 +/- 2.5 vs. 3.6 +/- 3.7 Nm; P < 0.001) or relative to their respective MVC (5.2 +/- 6.1 vs. 8.8 +/- 9.0%). Higher discharge rate and additional motor-unit recruitment were observed at a given absolute or relative torque when muscle fascicles were shortened. However, the data indicate that increased rate coding was mainly present at low torque level (<10% MVC), when the muscle-tendon complex was compliant, whereas recruitment of additional motor units played a dominant role at higher torque level and decreased compliance (10-35% MVC). Taken together, the results suggest that the central command is modulated by the afferent proprioceptive information during submaximal contractions performed at different muscle fascicle lengths.

Pelvic floor muscle training to improve urinary incontinence in young, nulliparous sport students: a pilot study.

PubMed

Da Roza, Thuane; de Araujo, Maíta Poli; Viana, Rui; Viana, Sara; Jorge, Renato Natal; Bø, Kari; Mascarenhas, Teresa

2012-08-01

Urinary incontinence (UI) is prevalent in sport students. We hypothesized that pelvic floor muscle training (PFMT) can improve pelvic floor muscle (PFM) strength and symptoms of UI in this group of physically active women. Sixteen sport students with UI participated in this pre-post test pilot study. However, only seven of them, mean age 20.0 ± 0.8 years, completed the 8-week program. Activity level was measured by the International Physical Activity Questionnaire-Short Form (IPAQ-SF). The outcome measure was the International Consultation on Incontinence Questionnaire-Short Form (ICIQ UI SF). PFM strength was measured by manometry as maximum voluntary contraction (MVC). Vaginal resting pressure improved by 17.4 cmH(2)O (SD 6.7), p = 0.04 and MVC by 16.4 cmH(2)O (SD 5.8), p = 0.04. ICIQ UI SF score, frequency, and amount of leakage showed statistically significant improvement. PFMT increased PFM strength and reduced frequency and amount of UI episodes in sport students that completed an 8-week PFMT program. Randomized controlled trials are warranted to confirm these results.

Changes in H reflex and neuromechanical properties of the trapezius muscle after 5 weeks of eccentric training: a randomized controlled trial.

PubMed

Vangsgaard, Steffen; Taylor, Janet L; Hansen, Ernst A; Madeleine, Pascal

2014-06-15

Trapezius muscle Hoffman (H) reflexes were obtained to investigate the neural adaptations induced by a 5-wk strength training regimen, based solely on eccentric contractions of the shoulder muscles. Twenty-nine healthy subjects were randomized into an eccentric training group (n = 15) and a reference group (n = 14). The eccentric training program consisted of nine training sessions of eccentric exercise performed over a 5-wk period. H-reflex recruitment curves, the maximal M wave (Mmax), maximal voluntary contraction (MVC) force, rate of force development (RFD), and electromyographic (EMG) voluntary activity were recorded before and after training. H reflexes were recorded from the middle part of the trapezius muscle by electrical stimulation of the C3/4 cervical nerves; Mmax was measured by electrical stimulation of the accessory nerve. Eccentric strength training resulted in significant increases in the maximal trapezius muscle H reflex (Hmax) (21.4% [5.5-37.3]; P = 0.01), MVC force (26.4% [15.0-37.7]; P < 0.01), and RFD (24.6% [3.2-46.0]; P = 0.025), while no significant changes were observed in the reference group. Mmax remained unchanged in both groups. A significant positive correlation was found between the change in MVC force and the change in EMG voluntary activity in the training group (r = 0.57; P = 0.03). These results indicate that the net excitability of the trapezius muscle H-reflex pathway increased after 5 wk of eccentric training. This is the first study to investigate and document changes in the trapezius muscle H reflex following eccentric strength training. Copyright © 2014 the American Physiological Society.

Motor unit behaviour and contractile changes during fatigue in the human first dorsal interosseus

PubMed Central

Carpentier, Alain; Duchateau, Jacques; Hainaut, Karl

2001-01-01

In 67 single motor units, the mechanical properties, the recruitment and derecruitment thresholds, and the discharge rates were recorded concurrently in the first dorsal interosseus (FDI) of human subjects during intermittent fatiguing contractions. The task consisted of isometric ramp-and-hold contractions performed at 50% of the maximal voluntary contraction (MVC). The purpose of this study was to examine the influence of fatigue on the behaviour of motor units with a wide range of activation thresholds. For low-threshold (< 25% MVC) motor units, the mean twitch force increased with fatigue and the recruitment threshold either did not change or increased. In contrast, the twitch force and the activation threshold decreased for the high-threshold (> 25% MVC) units. The observation that in low-threshold motor units a quick stretch of the muscle at the end of the test reset the unit force and recruitment threshold to the prefatigue value suggests a significant role for fatigue-related changes in muscle stiffness but not twitch potentiation or motor unit synchronization. Although the central drive intensified during the fatigue test, as indicated by an increase in surface electromyogram (EMG), the discharge rate of the motor units during the hold phase of each contraction decreased progressively over the course of the task for motor units that were recruited at the beginning of the test, especially the low-threshold units. In contrast, the discharge rates of newly activated units first increased and then decreased. Such divergent behaviour of low- and high-threshold motor units could not be individually controlled by the central drive to the motoneurone pool. Rather, the different behaviours must be the consequence of variable contributions from motoneurone adaptation and afferent feedback from the muscle during the fatiguing contraction. PMID:11483719

Individual responses to combined endurance and strength training in older adults.

PubMed

Karavirta, Laura; Häkkinen, Keijo; Kauhanen, Antti; Arija-Blázquez, Alfredo; Sillanpää, Elina; Rinkinen, Niina; Häkkinen, Arja

2011-03-01

A combination of endurance and strength training is generally used to seek further health benefits or enhanced physical performance in older adults compared with either of the training modes alone. The mean change within a training group, however, may conceal a wide range of individual differences in the responses. The purpose, therefore, was to examine the individual trainability of aerobic capacity and maximal strength, when endurance and strength training are performed separately or concurrently. For this study, 175 previously untrained volunteers, 89 men and 86 women between the ages of 40 and 67 yr, completed a 21-wk period of either strength training (S) twice a week, endurance training (E) twice a week, combined training (ES) four times per week, or served as controls. Training adaptations were quantified as peak oxygen uptake (VO2peak) in a bicycle ergometer test to exhaustion and maximal isometric bilateral leg extension force (MVC) in a dynamometer. A large range in training responses, similar to endurance or strength training alone, was also observed with combined endurance and strength training in both ΔVO2peak (from -8% to 42%) and ΔMVC (from -12% to 87%). There were no significant correlations between the training responses in VO2peak and MVC in the E, S, or especially in the ES group, suggesting that the same subjects did not systematically increase both aerobic capacity and maximal strength. The goal of combined endurance and strength training--increasing both aerobic capacity and maximal strength simultaneously--was only achieved by some of the older subjects. New means are needed to personalize endurance, strength, and especially combined endurance and strength training programs for optimal individual adaptations.

Understanding the Delay in Onset of Paget’s Disease of Bone

DTIC Science & Technology

2014-09-01

Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

A review of serious injuries and deaths among car occupants after motor vehicle crashes in Sweden from 1987 to 1994.

PubMed

Boström, L; Wladis, A; Nilsson, B

2001-01-01

Car occupants injured in motor vehicle crashes (MVC) are a common problem in emergency departments. The aims of this study were to determine the incidence over time, according to the type of injury, age and sex distribution, mortality rate and geographical differences among all patients admitted to Swedish hospitals because of MVC injuries. Between 1987 and 1994, Swedish hospitals admitted 37,871 persons (51,348 admissions) who had been involved in MVC as drivers or passengers. There were 23,369 men and 14,502 women. The annual frequency of hospital admissions ranged from 5,943 to 7,175. There were 74.8 injured persons admitted per 100,000 of the population each year. Males between 16 and 24 years of age were more commonly involved. Injuries to the head and neck were particularly frequent (39%). Older persons, males, and passengers had a poor survival outcome. The incidence of injured car occupants was significantly higher in sparsly populated areas of Sweden.

QUADRICEPS LOW FREQUENCY FATIGUE AND MUSCLE PAIN ARE CONTRACTION TYPE DEPENDENT

PubMed Central

Iguchi, Masaki; Shields, Richard K.

2010-01-01

Introduction Eccentric contractions are thought to induce greater low frequency fatigue (LFF) and delayed onset muscle soreness (DOMS) than concentric contractions. This study induced a similar amount of eccentric quadriceps muscle fatigue during either a concentric or eccentric fatigue task to compare LFF and DOMS. Methods Subjects (n=22) performed concentric or eccentric fatigue tasks using 75% of the pre-fatigue maximal voluntary contraction (MVC) torque, and both tasks ended when the MVC eccentric torque decreased by 25% pre-fatigue. Results When subjects reached the failure criterion during the eccentric and concentric tasks, the concentric MVC was 78 ± 9.8% and 64 ± 8.4% of initial, respectively. LFF was greater after the concentric than the eccentric protocols (22 ± 12.4% and 15 ± 7.6% increase, respectively; p < 0.01). DOMS was over 100% greater for the eccentric protocol. Discussion These results indicate that DOMS is not dependent on the events that contribute to LFF. PMID:20544933

Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

PubMed Central

Borges, Andrew Rosa; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne

2010-01-01

Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3’-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC50s ranging from 0.1 – 7.4 µg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. PMID:20880566

Reorganization of muscle activity in patients with chronic temporomandibular disorders.

PubMed

Mapelli, Andrea; Zanandréa Machado, Bárbara Cristina; Giglio, Lucia Dantas; Sforza, Chiarella; De Felício, Cláudia Maria

2016-12-01

To investigate whether reorganization of muscle activity occurs in patients with chronic temporomandibular disorders (TMD) and, if so, how it is affected by symptomatology severity. Surface electromyography (sEMG) of masticatory muscles was made in 30 chronic TMD patients, diagnosed with disc displacement with reduction (DDR) and pain. Two 15-patient subgroups, with moderate (TMDmo) and severe (TMDse) signs and symptoms, were compared with a control group of 15 healthy subjects matched by age. The experimental tasks were: a 5s inter-arch maximum voluntary clench (MVC); right and left 15s unilateral gum chewing tests. Standardized sEMG indices characterizing masseter and temporalis muscles activity were calculated, and a comprehensive functional index (FI) was introduced to quantitatively summarize subjects' overall performance. Mastication was also clinically evaluated. During MVC, TMDse patients had a significantly larger asymmetry of temporalis muscles contraction. Both TMD groups showed reduced coordination between masseter and temporalis muscles' maximal contraction, and their muscular activity distribution shifted significantly from masseter to temporalis muscles. During chewing, TMDse patients recruited the balancing side muscles proportionally more than controls, specifically the masseter muscle. When comparing right and left side chewing, the muscles' recruitment pattern resulted less symmetric in TMD patients, especially in TMDse. Overall, the functional index of both TMDmo and TMDse patients was significantly lower than that obtained by controls. Chronic TMD patients, specifically those with severe symptomatology, showed a reorganized activity, mainly resulting in worse functional performances. Copyright © 2016 Elsevier Ltd. All rights reserved.

Evaluation of Central and Peripheral Fatigue in the Quadriceps Using Fractal Dimension and Conduction Velocity in Young Females

PubMed Central

Beretta-Piccoli, Matteo; D’Antona, Giuseppe; Barbero, Marco; Fisher, Beth; Dieli-Conwright, Christina M.; Clijsen, Ron; Cescon, Corrado

2015-01-01

Purpose Over the past decade, linear and non-linear surface electromyography descriptors for central and peripheral components of fatigue have been developed. In the current study, we tested fractal dimension (FD) and conduction velocity (CV) as myoelectric descriptors of central and peripheral fatigue, respectively. To this aim, we analyzed FD and CV slopes during sustained fatiguing contractions of the quadriceps femoris in healthy humans. Methods A total of 29 recreationally active women (mean age±standard deviation: 24±4 years) and two female elite athletes (one power athlete, age 24 and one endurance athlete, age 30 years) performed two knee extensions: (1) at 20% maximal voluntary contraction (MVC) for 30 s, and (2) at 60% MVC held until exhaustion. Surface EMG signals were detected from the vastus lateralis and vastus medialis using bidimensional arrays. Results Central and peripheral fatigue were described as decreases in FD and CV, respectively. A positive correlation between FD and CV (R=0.51, p<0.01) was found during the sustained 60% MVC, probably as a result of simultaneous motor unit synchronization and a decrease in muscle fiber CV during the fatiguing task. Conclusions Central and peripheral fatigue can be described as changes in FD and CV, at least in young, healthy women. The significant correlation between FD and CV observed at 60% MVC suggests that a mutual interaction between central and peripheral fatigue can arise during submaximal isometric contractions. PMID:25880369

Prediction of maximal surface electromyographically based voluntary contractions of erector spinae muscles from sonographic measurements during isometric contractions.

PubMed

Cuesta-Vargas, Antonio I; González-Sánchez, Manuel

2014-03-01

Currently, there are no studies combining electromyography (EMG) and sonography to estimate the absolute and relative strength values of erector spinae (ES) muscles in healthy individuals. The purpose of this study was to establish whether the maximum voluntary contraction (MVC) of the ES during isometric contractions could be predicted from the changes in surface EMG as well as in fiber pennation and thickness as measured by sonography. Thirty healthy adults performed 3 isometric extensions at 45° from the vertical to calculate the MVC force. Contractions at 33% and 100% of the MVC force were then used during sonographic and EMG recordings. These measurements were used to observe the architecture and function of the muscles during contraction. Statistical analysis was performed using bivariate regression and regression equations. The slope for each regression equation was statistically significant (P < .001) with R(2) values of 0.837 and 0.986 for the right and left ES, respectively. The standard error estimate between the sonographic measurements and the regression-estimated pennation angles for the right and left ES were 0.10 and 0.02, respectively. Erector spinae muscle activation can be predicted from the changes in fiber pennation during isometric contractions at 33% and 100% of the MVC force. These findings could be essential for developing a regression equation that could estimate the level of muscle activation from changes in the muscle architecture.

Newspaper media reporting of motor vehicle crashes in Singapore: an opportunity lost for injury prevention education?

PubMed

Heng, Kenneth W J; Vasu, Alicia

2010-06-01

Newspaper media advocacy can help steer public attention away from motor vehicle crash (MVC) injuries as a personal problem to that of a social and public health issue. If used properly, newspaper media is potentially a powerful mass educator on MVC prevention. However, there is often a conflict of interest in which newspapers, in an attempt to boost readership and revenue, may over-emphasize and sensationalize the human-interest aspect of an MVC story. The aim of this study is to examine newspaper articles of MVCs in Singapore to assess how our newspaper media coverage portray MVCs and identify factors that mitigate injury and educate the public on injury prevention measures. Details of the MVC were extracted from 12 months of newspaper coverage in Singapore. Two independent coders were used to establish inter-rater reliability. From 1 January to 31 December 2007, 201 articles about MVCs were published. About 74.1% of articles assigned blame to a particular road user, negligence on either road user was implied in 56.7% of articles, and road safety messages were mentioned in 8% of the articles. The mainstream communication tone used was positive for law enforcement (71.1%) and neutral towards injury prevention or road safety messages (89.1%). Newspaper media reporting of MVCs in Singapore generally does not include injury prevention messages or highlight injury-mitigating measures. This is a lost opportunity for public education. Collaboration between public health practitioners and newspaper media is required to address this issue.

Accuracy of the surface electromyography RMS processing for the diagnosis of myogenous temporomandibular disorder.

PubMed

Berni, Kelly Cristina dos Santos; Dibai-Filho, Almir Vieira; Pires, Paulo Fernandes; Rodrigues-Bigaton, Delaine

2015-08-01

Due to the multifactor etiology of temporomandibular disorder (TMD), the precise diagnosis remains a matter of debate and validated diagnostic tools are needed. The aim was to determine the accuracy of surface electromyography (sEMG) activity, assessed in the amplitude domain by the root mean square (RMS), in the diagnosis of TMD. One hundred twenty-three volunteers were evaluated using the Research Diagnostic Criteria for Temporomandibular Disorders and distributed into two groups: women with myogenous TMD (n=80) and women without TMD (n=43). The volunteers were then submitted to sEMG evaluation of the anterior temporalis, masseter and suprahyoid muscles at rest and during maximum voluntary teeth clenching (MVC) on parafilm. The accuracy, sensitivity and specificity of the muscle activity were analyzed. Differences between groups were found in all muscles analyzed at rest as well as in the masseter and suprahyoid muscles during MVC on parafilm. Moderate accuracy (AUC: 0.74-0.84) of the RMS sEMG was found in all muscles regarding the diagnosis of TMD at rest and in the suprahyoid muscles during MVC on parafilm. Moreover, sensitivity ranging from 71.3% to 80% and specificity from 60.5% to 76.6%. In contrast, RMS sEMG did not exhibit acceptable degrees of accuracy in the other masticatory muscles during MVC on parafilm. It was concluded that the RMS sEMG is a complementary tool for clinical diagnosis of the myogenous TMD. Copyright © 2015 Elsevier Ltd. All rights reserved.

Reduced firing rates of high threshold motor units in response to eccentric overload.

PubMed

Balshaw, Tom G; Pahar, Madhu; Chesham, Ross; Macgregor, Lewis J; Hunter, Angus M

2017-01-01

Acute responses of motor units were investigated during submaximal voluntary isometric tasks following eccentric overload (EO) and constant load (CL) knee extension resistance exercise. Ten healthy resistance-trained participants performed four experimental test sessions separated by 5 days over a 20 day period. Two sessions involved constant load and the other two used eccentric overload. EO and CL used both sessions for different target knee eccentric extension phases; one at 2 sec and the other at 4 sec. Maximal voluntary contractions (MVC) and isometric trapezoid efforts for 10 sec at 70% MVC were completed before and after each intervention and decomposed electromyography was used to measure motor unit firing rate. The firing rate of later recruited, high-threshold motor units declined following the 2-sec EO but was maintained following 2sec CL (P < 0.05), whereas MUFR for all motor units were maintained for both loading types following 4-sec extension phases. MVC and rate of force development where maintained following both EO and CL and 2 and 4 sec phases. This study demonstrates a slower firing rate of high-threshold motor units following fast eccentric overload while MVC was maintained. This suggests that there was a neuromuscular stimulus without cost to the force-generating capacity of the knee extensors. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Attenuation of muscle damage by preconditioning with muscle hyperthermia 1-day prior to eccentric exercise.

PubMed

Nosaka, K; Muthalib, M; Lavender, A; Laursen, P B

2007-01-01

This study investigated the hypothesis that muscle damage would be attenuated in muscles subjected to passive hyperthermia 1 day prior to exercise. Fifteen male students performed 24 maximal eccentric actions of the elbow flexors with one arm; the opposite arm performed the same exercise 2-4 weeks later. The elbow flexors of one arm received a microwave diathermy treatment that increased muscle temperature to over 40 degrees C, 16-20 h prior to the exercise. The contralateral arm acted as an untreated control. Maximal voluntary isometric contraction strength (MVC), range of motion (ROM), upper arm circumference, muscle soreness, plasma creatine kinase activity and myoglobin concentration were measured 1 day prior to exercise, immediately before and after exercise, and daily for 4 days following exercise. Changes in the criterion measures were compared between conditions (treatment vs. control) using a two-way repeated measures ANOVA with a significance level of P < 0.05. All measures changed significantly following exercise, but the treatment arm showed a significantly faster recovery of MVC, a smaller change in ROM, and less muscle soreness compared with the control arm. However, the protective effect conferred by the diathermy treatment was significantly less effective compared with that seen in the second bout performed 4-6 weeks after the initial bout by a subgroup of the subjects (n = 11) using the control arm. These results suggest that passive hyperthermia treatment 1 day prior to eccentric exercise-induced muscle damage has a prophylactic effect, but the effect is not as strong as the repeated bout effect.

Is home-based pelvic floor muscle training effective in treatment of urinary incontinence after birth in primiparous women? A randomized controlled trial.

PubMed

Ahlund, Susanne; Nordgren, Birgitta; Wilander, Eva-Lotta; Wiklund, Ingela; Fridén, Cecilia

2013-08-01

To assess the effect of pelvic floor muscle training (PFMT) on pelvic floor muscle strength and urinary incontinence (UI) in primiparous women who underwent a home training program between three and 9 months after delivery. Randomized controlled trial. One hundred primiparous women were consecutively recruited from four different antenatal clinics in the urban area of Stockholm, Sweden. Women with UI who had undergone normal term singleton vaginal delivery, 10-16 weeks postpartum were randomly allocated to either intervention or control group. Maximally voluntary contraction (MVC) and endurance were measured with a perionometer. The Oxford grading scale was used to manually estimate the strength of the pelvic floor muscle and self-reported symptoms of UI was registered through the Bristol Female Lower Urinary Tract Symptoms Module (ICIQ FLUTS) questionnaire. Maximally voluntary contraction of the pelvic floor muscle measured with a perionometer. Maximally voluntary contraction increased significantly in both groups between baseline and follow up (p < 0.05). The median MVC in cmHg for the intervention and control group was 16.2 and 12.1 at baseline and 26.0 and 18.2 at follow up, respectively. The median endurance, in seconds, for the intervention and control group was 9.6 and 12.0 at baseline and 26.7 and 23.4 at follow up, respectively. Pelvic floor muscle strength measured with the Oxford Scale increased significantly in both groups between baseline and follow up (p < 0.05). The results indicate that home-based PFMT is effective. However, written training instructions were as efficient as home-based training with follow up visits every sixth week. © 2013 Nordic Federation of Societies of Obstetrics and Gynecology.

Isometric handgrip training reduces arterial pressure at rest without changes in sympathetic nerve activity

NASA Technical Reports Server (NTRS)

Ray, C. A.; Carrasco, D. I.

2000-01-01

The purpose of this study was to determine whether isometric handgrip (IHG) training reduces arterial pressure and whether reductions in muscle sympathetic nerve activity (MSNA) mediate this drop in arterial pressure. Normotensive subjects were assigned to training (n = 9), sham training (n = 7), or control (n = 8) groups. The training protocol consisted of four 3-min bouts of IHG exercise at 30% of maximal voluntary contraction (MVC) separated by 5-min rest periods. Training was performed four times per week for 5 wk. Subjects' resting arterial pressure and heart rate were measured three times on 3 consecutive days before and after training, with resting MSNA (peroneal nerve) recorded on the third day. Additionally, subjects performed IHG exercise at 30% of MVC to fatigue followed by muscle ischemia. In the trained group, resting diastolic (67 +/- 1 to 62 +/- 1 mmHg) and mean arterial pressure (86 +/- 1 to 82 +/- 1 mmHg) significantly decreased, whereas systolic arterial pressure (116 +/- 3 to 113 +/- 2 mmHg), heart rate (67 +/- 4 to 66 +/- 4 beats/min), and MSNA (14 +/- 2 to 15 +/- 2 bursts/min) did not significantly change following training. MSNA and cardiovascular responses to exercise and postexercise muscle ischemia were unchanged by training. There were no significant changes in any variables for the sham training and control groups. The results indicate that IHG training is an effective nonpharmacological intervention in lowering arterial pressure.

Week 96 results of the randomized, multicentre Maraviroc Switch (MARCH) study.

PubMed

Pett, S L; Amin, J; Horban, A; Andrade-Villanueva, J; Losso, M; Porteiro, N; Madero, J S; Belloso, W; Tu, E; Silk, D; Kelleher, A; Harrigan, R; Clark, A; Sugiura, W; Wolff, M; Gill, J; Gatell, J; Clarke, A; Ruxrungtham, K; Prazuck, T; Kaiser, R; Woolley, I; Alberto Arnaiz, J; Cooper, D; Rockstroh, J K; Mallon, P; Emery, S

2018-01-01

The Maraviroc Switch (MARCH) study week 48 data demonstrated that maraviroc, a chemokine receptor-5 (CCR5) inhibitor, was a safe and effective switch for the ritonavir-boosted protease inhibitor (PI/r) component of a two nucleos(t)ide reverse transcriptase inhibitor [N(t)RTI] plus PI/r-based antiretroviral regimen in patients with R5-tropic virus. Here we report the durability of this finding. MARCH, an international, multicentre, randomized, 96-week open-label switch study, enrolled HIV-1-infected adults with R5-tropic virus who were stable (> 24 weeks) and virologically suppressed [plasma viral load (pVL) < 50 HIV-1 RNA copies/mL]. Participants were randomized to continue their current PI/r-based regimen (PI/r) or to switch to MVC plus two N(t)RTIs (MVC) (1:2 randomization). The primary endpoint was the difference in the proportion with pVL < 200 copies/mL at 96 weeks. The switch arm was defined as noninferior if the lower limit of the 95% confidence interval (CI) for the difference was < -12% in the intention-to-treat (ITT) population. Safety endpoints (the difference in the mean change from baseline or a comparison of proportions) were analysed as key secondary endpoints. Eighty-two (PI/r) and 156 (MVC) participants were randomized and included in the ITT analysis; 71 (87%) and 130 (83%) were in follow-up and on therapy at week 96. At week 96, 89.0% and 90.4% in the PI/r and MVC arms, respectively, had pVL < 50 copies/mL (95% CI -6.6, 10.2). Moreover, in those switching away from PI/r, there were significant reductions in mean total cholesterol (differences 0.31 mmol/L; P = 0.02) and triglycerides (difference 0.44 mmol/L; P < 0.001). Changes in CD4 T-cell count, renal function, and serious and nonserious adverse events were similar in the two arms. MVC as a switch for a PI/r is safe and effective at maintaining virological suppression while having significant lipid benefits over 96 weeks. © 2017 British HIV Association.

Psychological distress following a motor vehicle crash: evidence from a statewide retrospective study examining settlement times and costs of compensation claims.

PubMed

Guest, Rebecca; Tran, Yvonne; Gopinath, Bamini; Cameron, Ian D; Craig, Ashley

2017-09-05

To determine whether psychological distress associated with musculoskeletal injuries sustained in a motor vehicle crash (MVC), regardless of time of onset, impacts compensation outcomes such as claim settlement times and costs. Second, to identify factors routinely collected by insurance companies that contribute to psychological distress during the compensation process. Statewide retrospective study. Analysis of the New South Wales statewide (Australia) injury register for MVC survivors who lodged a compensation claim from 2011 to 2013. 6341 adults who sustained a musculoskeletal injury and who settled a claim for injury after an MVC. Participants included those diagnosed with psychological distress (n=607) versus those not (n=5734). Time to settlement and total costs of claims, as well as socio-demographic and injury characteristics that may contribute to elevated psychological distress, such as socio-economic disadvantage, and injury severity. Psychological distress in those with a musculoskeletal injury was associated with significantly longer settlement times (an additional 17 weeks) and considerably higher costs (an additional $A41 575.00 or 4.3 times more expensive). Multivariate logistic regression analysis identified risk factors for psychological distress including being female, social disadvantage, unemployment prior to the claim, not being at fault in the MVC, requiring ambulance transportation and rehabilitation as part of recovery. Results provide compelling evidence that psychological distress has an adverse impact on people with musculoskeletal injury as they progress through compensation. Findings suggest that additional resources should be directed toward claimants who are at risk (eg, the socially disadvantaged or those unemployed prior to the claim), the major aim being to reduce risk of psychological distress, such as post-traumatic stress disorder, and associated risk of increased settlement times and claim costs. Prospective studies are now required that investigate treatment strategies for those at risk of psychological distress associated with an MVC. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Association of RAGE gene polymorphism with circulating AGEs level and paraoxonase activity in relation to macro-vascular complications in Indian type 2 diabetes mellitus patients.

PubMed

Bansal, Savita; Chawla, Diwesh; Banerjee, Basu Dev; Madhu, Sri Venkata; Tripathi, Ashok Kumar

2013-09-10

Sustained interaction of advanced glycation end products (AGEs) with their receptor RAGE and subsequent signaling plays an important role in the development of diabetic complications. Genetic variation of RAGE gene may be associated with the development of vascular complications in type 2 diabetes mellitus (T2DM). The present study aimed to explore the possible association of RAGE gene polymorphisms namely -374T/A, -429T/C and G82S with serum level of AGEs, paraoxonase (PON1) activity and macro-vascular complications (MVC) in Indian type 2 diabetes mellitus patients (T2DM). A total of 265 diabetic patients, including DM without any complications (n=135), DM-MVC (n=130) and 171 healthy individuals were enrolled. Genotyping of RAGE variants were assessed by polymerase chain reaction-restriction fragment length polymorphism. Serum AGEs were estimated by ELISA and fluorometrically. and PON1 activity was assessed spectrophotometrically. Of the three examined SNPs, association of -429T/C polymorphism with MVC in T2DM was observed (OR=3.001, p=0.001) in the dominant model. Allele 'A' of -374T/A polymorphism seems to confer better cardiac outcome in T2DM. Patients carrying C allele (-429T/C) and S allele (G82S) had significantly higher AGEs levels. -429T/C polymorphism was also found to be associated with low PON1 activity. Interaction analysis revealed that the risk of development of MVC was higher in T2DM patients carrying both a CC genotype of -429T/C polymorphism and a higher level of AGEs (OR=1.343, p=0.040). RAGE gene polymorphism has a significant effect on AGEs level and PON1 activity in diabetic subjects compared to healthy individuals. Diabetic patients with a CC genotype of -429T/C are prone to develop MVC, more so if AGEs levels are high and PON1 activity is low. Copyright © 2013 Elsevier B.V. All rights reserved.

Trends in Alabama teen driving death and injury.

PubMed

Monroe, Kathy; Irons, Elizabeth; Crew, Marie; Norris, Jesse; Nichols, Michele; King, William D

2014-09-01

Motor vehicle crashes (MVCs) are a leading cause of morbidity and mortality in teens. Alabama has been in the Top 5 states for MVC fatality rate among teens in the United States for several years. Twelve years of teen MVC deaths and injuries were evaluated. Our hypothesis is that the teen driving motor vehicle-related deaths and injuries have decreased related to legislative and community awareness activities. A retrospective analysis of Alabama teen MVC deaths and injury for the years 2000 to 2011 was conducted. MVC data were obtained from a Fatality Analysis Reporting System data set managed by the Center for Advanced Public Safety at the University of Alabama. A Lowess regression-scattergram analysis was used to identify period specific changes in deaths and injury over time. Statistical analysis was conducted using True Epistat 5.0 software. When the Lowess regression was applied, there was an obvious change in the trend line in 2007. To test that observation, we then compared medians in the pre-2007 and post-2007 periods, which validated our observation. Moreover, it provided a near-even number of observations for comparison. The Spearman rank correlation was used to test for correlation of deaths and injury over time. The Mann-Whitney U-test was used to evaluate median differences in deaths and injury comparing pre-2007 and post-2007 data. Alabama teen MVC deaths and injury demonstrated a significant negative correlation over the 12-year period (Rs for deaths and injury, -0.87 [p < 0.001] and -0.92 [p < 0.001], respectively). Lowess regression identified a notable decline in deaths and injury after the year 2006. Median deaths and injury for the pre-2007 period were significantly higher than the post-2007 period, (U = 35.0, p = 0.003). Alabama teen driver deaths and injury have decreased during the 12-year study period, most notably after 2006. Factors that may have contributed to this trend may include stricter laws for teen drivers (enacted in 2002 and updated in 2010), less teen driving because of a nationwide economic downturn, delayed licensing in teens, steady improvements in overall seat belt use, and heightened public awareness of risky behaviors in teen driving.

An examination of traffic-related traumatic injuries among children at a Level-1 pediatric trauma center, 2005-2014.

PubMed

Ma, Ping; Hussain, Nazia; Abbe, Marisa

2017-11-01

Traffic-related injuries are the leading fatal injury among children in the United States, but no published study compares the different types of traffic-related pediatric injuries to date. Thus, this study was aimed at examining the10-year trend of traffic-related injury among children at a pediatric hospital and to assess if there were differences in injury mechanism. All data were drawn from a Level-1 pediatric trauma center in North Texas in 2005-2014. Demographic characteristics, length of hospitalization, and patient type were included. Severity of injury outcome was assessed by injury severity score and fatality. The traffic-related injury mechanism included motor vehicle collision (MVC), motor-pedestrian collision (MPC), and motorcycle/moped collision (MMC). Description analyses and multinominal logistic regressions were applied to examine the factors associated with the type of motor-related injuries adjusting for covariates. All analyses were conducted by STATA version 14.0. A total of 3,742 traffic-related pediatric injuries were identified. The mean (SD) age was 6.4 (4.0) years; most patients were boys (59%) and Hispanic (40%). There was a waving trend of the number of traffic-related injuries over the 10-year period. Compared with MVC, demographic disparities exist with children experiencing an MPC injury. Hispanic and African American children were more likely to have an MPC but less likely to have a motorcycle/moped collision injury (relative risk [RR], 1.6; 95% confidence interval, 1.3-1.9; RR, 2.0; 95% confidence interval, 1.9-2.4, respectively). Children with an MPC injury had a more severe outcome than those with an MVC injury, but no difference was found in fatality. The MCC injuries did not significantly differ from MVC in injury severity. Although efforts have been made to prevent MVC-related pediatric injuries, the trend of MVCs was stable in the most recent years. The MPC-related injury continues to be a higher likelihood of severe pediatric trauma. Thus, continuing efforts and innovative intervention programs are still needed to prevent traffic-related pediatric injuries. Epidemiologic study, level III.

Intramuscular pressures in antigravity muscles using gravity-independent, pneumatic hardware.

PubMed

Macias, Brandon R; Minocha, Ranjeet; Cutuk, Adnan A; Hill, James; Shiau, Jonathon; Hargens, Alan R

2008-08-01

Resistive exercise helps prevent muscle atrophy in microgravity, but better exercise equipment is needed. Therefore, the purpose of this study was to determine if a pneumatic, gravity-independent leg-press device (LPD) provides sufficient force to leg musculature. We hypothesized that intramuscular pressure (IMP), a quantitative index of muscle force, is greater in the antigravity superficial posterior and deep posterior compartments than in the non-antigravity anterior compartment during bilateral leg-press exercise. Millar pressure transducers were inserted into the anterior, lateral, superficial posterior, and deep posterior muscle compartments of the left leg of eight healthy subjects (three women, five men). Subjects were supine on the Keiser SX-1, a pneumatic LPD. Then maximal voluntary contraction (MVC) was determined; each subject performed three consecutive voluntary contractions at approximately 18%, 50%, and 100% MVC while continuously measuring IMP. Repeated measures ANOVA were used to determine differences of IMPs between compartments and loads. The magnitudes of IMP (mean +/- SEM) at 18 - 3% (abbreviated approximately 18%), 50%, and 100% MVC in the superficial and deep posterior compartments were significantly greater than that in the anterior compartment during exercise (P < 0.05). Additionally, IMPs in all four compartments significantly rose as resistance increased at approximately 18%, 50%, and 100% MVC (P < 0.05). The LPD provides significantly increased resistance to all four compartments, but with greater loading of the antigravity compartments as compared to the non-antigravity compartment. Since antigravity muscles of the leg are contained primarily in the superficial and deep posterior compartments, the LPD may help prevent muscle atrophy associated with microgravity.

Impaired hip muscle strength in patients with femoroacetabular impingement syndrome.

PubMed

Kierkegaard, Signe; Mechlenburg, Inger; Lund, Bent; Søballe, Kjeld; Dalgas, Ulrik

2017-12-01

Patients with femoroacetabular impingement (FAI) experience hip pain as well as decreased function and lowered quality of life. The aim was to compare maximal isometric and isokinetic muscle strength (MVC) during hip flexion and extension and rate of force development (RFD) during extension between patients with FAI and a matched reference group. Secondary, the aim was to compare patient hips and subgroups defined by gender and age as well as to investigate associations between hip muscle strength and self-reported outcomes. Design Cross-sectional, comparative study Methods Sixty patients (36±9 years, 63% females) and 30 age and gender matched reference persons underwent MVC tests in an isokinetic dynamometer. During hip flexion and extension, patients' affected hip showed a strength deficit of 15-21% (p<0.001) and 10-25% (p<0.03) compared with reference MVC, respectively. The affected hip of the patients was significantly weaker than their contralateral hip. RFD was significantly decreased for both patient hips compared to the reference group (p<0.05). While age had less effect on MVC, female patients were more affected than male patients. Self-reported measures were associated with isometric hip muscle strength. Patients with FAI demonstrate decreased hip flexion and extension strength when compared to (1) reference persons and (2) their contralateral hip. There seems to be a gender specific affection which should be investigated further and addressed when planning training protocols. Furthermore, self-reported measures were associated with isometric muscle strength, which underlines the clinical importance of the reduced muscle strength. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Is Borg's perceived exertion scale a useful indicator of muscular and cardiovascular load in blue-collar workers with lifting tasks? A cross-sectional workplace study.

PubMed

Jakobsen, Markus Due; Sundstrup, Emil; Persson, Roger; Andersen, Christoffer H; Andersen, Lars L

2014-02-01

To investigate associations between perceived exertion and objectively assessed muscular and cardiovascular load during a full working day among workers with manual lifting tasks. A total of 159 men and 41 women from 14 workplaces with manual lifting tasks participated. Participants reported perceived exertion (BORG-CR10) at midday and after work. Surface electromyography of the thigh, lower back and neck muscles were normalized to isometric voluntary contractions (MVC) to express relative muscle load during the day. Cardiovascular load was measured with electrocardiography and calculated as the average percentage of the heart rate reserve capacity (((heart rate during work - resting heart rate) / (maximum heart rate - resting heart rate)) * 100) during the day. Using linear regression, significant but weak associations (β < 0.23) were observed between perceived exertion and (1) high muscle activity (>60% of MVC) of the neck muscles and (2) inactivity (<1% of MVC) of the thigh muscles and (3) cardiovascular load, respectively. Using logistic regression, perceived exertion ≥4 (high exertion), referencing <4 (low-to-moderate exertion), was related to high activity of the trapezius muscle [OR 18 (95% CI 2-143)], i.e., the odds for experiencing high exertion during work increased 18-fold for each percentage increase in time above 60% MVC. During a full working day among blue-collar workers with lifting tasks, high neck muscle activity increases the odds for experiencing high perceived physical exertion. Perceived exertion of at least 4 on the BORG CR10 scale appears to be a good indicator that high muscular loading occurs.

The physical demands of Olympic yacht racing.

PubMed

Mackie, H; Sanders, R; Legg, S

1999-12-01

The primary purpose of this study was to quantify the up wards forces of the feet on the hiking strap and the forces in the mainsheet of four Olympic classes of racing dinghies (Europe, Laser. Finn and 470) during realistic on-water sailing in varying wind conditions. The secondary aim of the study was to measure the joint angles adopted by the sailors and boat heel angles. The tertiary aim was to identify events and sailing conditions associated with large or patterned force production. Forces in the hiking strap and mainsheet of four classes of Olympic sailing dinghies were measured on eleven New Zealand sailors during simulated on-water racing in a range of wind conditions. Up-wind hiking strap forces reached an average of 73-87% of predicted maximal voluntary contraction (pred MVC), with peak forces exceeding 100% pred MVC. Mainsheet forces reached 25-35% pred MVC, with peak forces reaching 40-50% pred MVC. Off-wind hiking strap and mainsheet forces were considerably lower than up-wind forces. Ankle and hip joint angles increased and knee joint angles decreased with increasing wind speed during up-wind sailing. Large forces occurred in the hiking strap and mainsheet when boats reached the tops of wave during up-wind sailing in high wind speeds and when a gust of wind hit the boat. During off-wind sailing large forces were observed in the mainsheet when surfing down waves. It is recommended that the intensities and joint angles found in this study be used as a basis for the development of class specific off-water physical conditioning programmes.

Objective assessment of actual chewing side by measurement of bilateral masseter muscle electromyography.

PubMed

Yamasaki, Yo; Kuwatsuru, Rika; Tsukiyama, Yoshihiro; Matsumoto, Hiroshi; Oki, Kyosuke; Koyano, Kiyoshi

2015-12-01

The aim of this study was to examine the validity of objective assessment of actual chewing side by measurement of electromyographic (EMG) activity of the bilateral masseter muscles upon chewing test foods. The sample consisted of 19 healthy, dentate individuals. The subjects were asked to chew three types of test foods (peanuts, beef jerky, and chewing gum) for 10 strokes on the right side and then on the left side, and instructed to perform maximum voluntary clenching for 3s, three times. EMG activity from the bilateral masseter muscles was recorded. The data were collected in three different days. The root mean square EMG amplitude obtained from the maximum clenching task was used as the maximum voluntary contraction (MVC). Then, the level of amplitude against the MVC (%MVC) was calculated for the right and left sides on each stroke. The side with the larger %MVC value was judged as the chewing side, and the concordance rates (CRs) for the instructed chewing side (ICS) and the judged chewing side (JCS) were calculated. Intraclass correlation coefficients (ICCs) of the CRs were calculated to evaluate the reproducibility of the method. High CRs between the ICS and JCS for each test food were recognized. There were significant ICCs for beef jerky (R=0.761, P<0.001) and chewing gum (R=0.785, P<0.001). The results suggested that the measurement of EMG activity from the bilateral masseter muscles may be a useful method for the objective determination of the actual chewing side during mastication. Copyright © 2015 Elsevier Ltd. All rights reserved.

Immunoexpression of vascular endothelial growth factor in periapical granulomas, radicular cysts, and residual radicular cysts.

PubMed

Nonaka, Cassiano Francisco Weege; Maia, Alexandre Pinto; Nascimento, George João Ferreira do; de Almeida Freitas, Roseana; Batista de Souza, Lélia; Galvão, Hébel Cavalcanti

2008-12-01

Our aim was to assess and compare the immunoexpression of vascular endothelial growth factor (VEGF) in periapical granulomas (PGs), radicular cysts (RCs), and residual radicular cysts (RRCs), relating it to the angiogenic index and the intensity of the inflammatory infiltrate. Twenty PGs, 20 RCs, and 10 RRCs were evaluated by immunohistochemistry using anti-VEGF antibody. Angiogenic index was determined by microvessel count (MVC) using anti-von Willebrand factor antibody. The PGs and RCs showed higher expression of VEGF than the RRCs. Lesions presenting few inflammatory infiltrate revealed the lowest immunoexpression of VEGF (P < .05). Irrespective of the intensity of the inflammatory infiltrate, most of the RCs and RRCs showed moderate to strong epithelial expression of VEGF. Lesions showing dense inflammatory infiltrate presented higher MVC indices (P < .05). VEGF expression and MVC did not reveal a significant correlation (P > .05). VEGF is present in periapical inflammatory lesions but at a lower level in RRCs. The expression of this proangiogenic factor is closely related to the intensity of the inflammatory infiltrate in these lesions.

Conflicting effects of fatigue and potentiation on voluntary force.

PubMed

Behm, David G; Button, Duane C; Barbour, Glen; Butt, Jeremy C; Young, Warren B

2004-05-01

The objective of this study was to investigate whether a warm-up consisting of a series of maximal contractions would augment the force and activation of subsequent leg extensor contractions. Both voluntary and evoked isometric contractions were tested to determine the mechanisms underlying the response. Nine subjects were tested for twitch, tetanic, submaximal (30%), and maximal voluntary contractile (MVC) properties before and after (1, 5, 10, and 15 minutes) one to three 10-second MVCs. MVC force either did not change following 1-2 MVCs or was depressed at 10 and 15 minutes after 3 MVCs. MVC activation was decreased (4.4-6.9%) throughout recovery, whereas submaximal contractions were minimally affected. Although overall, twitches were potentiated (15.5-19.8%) posttest, 3 MVCs had significantly greater twitch potentiation than 1 or 2 MVCs at 5 and 10 minutes. Results suggest that voluntary and evoked contractions respond differently to prior 10-second MVCs. In the present study, a warm-up routine of 1-3 MVCs of a 10-second duration did not enhance subsequent voluntary performance.

The influence of aging on the isometric torque sharing patterns among the plantar flexor muscles.

PubMed

Oliveira, Liliam F; Verneque, Debora; Menegaldo, Luciano L

2017-01-01

Physiological cross-sectional area (PCSA) reduction of the triceps surae (TS) muscles during aging suggests a proportional loss of torque among its components: soleus, medial and lateral gastrocnemii. However, direct measurements of muscle forces in vivo are not feasible. The purpose of this paper was to compare, between older and young women, isometric ankle joint torque sharing patterns among TS muscles and tibialis anterior (TA). An EMG-driven model was used for estimating individual muscle torque contributions to the total plantar flexor torque, during sustained contractions of 10% and 40% of maximum voluntary contraction (MVC). Relative individual muscle contributions to the total plantar flexion torque were similar between older and young women groups, for both intensities, increasing from LG, MG to SOL. Muscle strength (muscle torque/body mass) was significantly greater for all TS components in 40% MVC contractions. Increased TA activation was observed in 10% of MVC for older people. Despite the reduced maximum isometric torque and muscle strength, the results suggest small variations of ankle muscle synergies during the aging process.

Fractal feature of sEMG from Flexor digitorum superficialis muscle correlated with levels of contraction during low-level finger flexions.

PubMed

Arjunan, Sridhar P; Kumar, Dinesh K; Naik, Ganesh R

2010-01-01

This research paper reports an experimental study on identification of the changes in fractal properties of surface Electromyogram (sEMG) with the changes in the force levels during low-level finger flexions. In the previous study, the authors have identified a novel fractal feature, Maximum fractal length (MFL) as a measure of strength of low-level contractions and has used this feature to identify various wrist and finger movements. This study has tested the relationship between the MFL and force of contraction. The results suggest that changes in MFL is correlated with the changes in contraction levels (20%, 50% and 80% maximum voluntary contraction (MVC)) during low-level muscle activation such as finger flexions. From the statistical analysis and by visualisation using box-plot, it is observed that MFL (p ≈ 0.001) is a more correlated to force of contraction compared to RMS (p≈0.05), even when the muscle contraction is less than 50% MVC during low-level finger flexions. This work has established that this fractal feature will be useful in providing information about changes in levels of force during low-level finger movements for prosthetic control or human computer interface.

Influence of Joint Angle on EMG-Torque Model During Constant-Posture, Torque-Varying Contractions.

PubMed

Liu, Pu; Liu, Lukai; Clancy, Edward A

2015-11-01

Relating the electromyogram (EMG) to joint torque is useful in various application areas, including prosthesis control, ergonomics and clinical biomechanics. Limited study has related EMG to torque across varied joint angles, particularly when subjects performed force-varying contractions or when optimized modeling methods were utilized. We related the biceps-triceps surface EMG of 22 subjects to elbow torque at six joint angles (spanning 60° to 135°) during constant-posture, torque-varying contractions. Three nonlinear EMG σ -torque models, advanced EMG amplitude (EMG σ ) estimation processors (i.e., whitened, multiple-channel) and the duration of data used to train models were investigated. When EMG-torque models were formed separately for each of the six distinct joint angles, a minimum "gold standard" error of 4.01±1.2% MVC(F90) resulted (i.e., error relative to maximum voluntary contraction at 90° flexion). This model structure, however, did not directly facilitate interpolation across angles. The best model which did so achieved a statistically equivalent error of 4.06±1.2% MVC(F90). Results demonstrated that advanced EMG σ processors lead to improved joint torque estimation as do longer model training durations.

Neck muscle activity in fighter pilots wearing night-vision equipment during simulated flight.

PubMed

Ang, Björn O; Kristoffersson, Mats

2013-02-01

Night-vision goggles (NVG) in jet fighter aircraft appear to increase the risk of neck strain due to increased neck loading. The present aim was, therefore, to evaluate the effect on neck-muscle activity and subjective ratings of head-worn night-vision (NV) equipment in controlled simulated flights. Five experienced fighter pilots twice flew a standardized 2.5-h program in a dynamic flight simulator; one session with NVG and one with standard helmet mockup (control session). Each session commenced with a 1-h simulation at 1 Gz followed by a 1.5-h dynamic flight with repeated Gz profiles varying between 3 and 7 Gz and including aerial combat maneuvers (ACM) at 3-5 Gz. Large head-and-neck movements under high G conditions were avoided. Surface electromyographic (EMG) data was simultaneously measured bilaterally from anterior neck, upper and lower posterior neck, and upper shoulder muscles. EMG activity was normalized as the percentage of pretest maximal voluntary contraction (%MVC). Head-worn equipment (helmet comfort, balance, neck mobility, and discomfort) was rated subjectively immediately after flight. A trend emerged toward greater overall neck muscle activity in NV flight during sustained ACM episodes (10% vs. 8% MVC for the control session), but with no such effects for temporary 3-7 Gz profiles. Postflight ratings for NV sessions emerged as "unsatisfactory" for helmet comfort/neck discomfort. However, this was not significant compared to the control session. Helmet mounted NV equipment caused greater neck muscle activity during sustained combat maneuvers, indicating increased muscle strain due to increased neck loading. In addition, postflight ratings indicated neck discomfort after NV sessions, although not clearly increased compared to flying with standard helmet mockup.

Force Control Is Related to Low-Frequency Oscillations in Force and Surface EMG

PubMed Central

Moon, Hwasil; Kim, Changki; Kwon, Minhyuk; Chen, Yen Ting; Onushko, Tanya; Lodha, Neha; Christou, Evangelos A.

2014-01-01

Force variability during constant force tasks is directly related to oscillations below 0.5 Hz in force. However, it is unknown whether such oscillations exist in muscle activity. The purpose of this paper, therefore, was to determine whether oscillations below 0.5 Hz in force are evident in the activation of muscle. Fourteen young adults (21.07±2.76 years, 7 women) performed constant isometric force tasks at 5% and 30% MVC by abducting the left index finger. We recorded the force output from the index finger and surface EMG from the first dorsal interosseous (FDI) muscle and quantified the following outcomes: 1) variability of force using the SD of force; 2) power spectrum of force below 2 Hz; 3) EMG bursts; 4) power spectrum of EMG bursts below 2 Hz; and 5) power spectrum of the interference EMG from 10–300 Hz. The SD of force increased significantly from 5 to 30% MVC and this increase was significantly related to the increase in force oscillations below 0.5 Hz (R 2 = 0.82). For both force levels, the power spectrum for force and EMG burst was similar and contained most of the power from 0–0.5 Hz. Force and EMG burst oscillations below 0.5 Hz were highly coherent (coherence = 0.68). The increase in force oscillations below 0.5 Hz from 5 to 30% MVC was related to an increase in EMG burst oscillations below 0.5 Hz (R 2 = 0.51). Finally, there was a strong association between the increase in EMG burst oscillations below 0.5 Hz and the interference EMG from 35–60 Hz (R 2 = 0.95). In conclusion, this finding demonstrates that bursting of the EMG signal contains low-frequency oscillations below 0.5 Hz, which are associated with oscillations in force below 0.5 Hz. PMID:25372038

The Effects of Multiple Cold Water Immersions on Indices of Muscle Damage

PubMed Central

Goodall, Stuart; Howatson, Glyn

2008-01-01

The aim of this investigation was to elucidate the efficacy of repeated cold water immersions (CWI) in the recovery of exercise induced muscle damage. A randomised group consisting of eighteen males, mean ± s age, height and body mass were 24 ± 5 years, 1.82 ± 0.06 m and 85.7 ± 16.6 kg respectively, completed a bout of 100 drop jumps. Following the bout of damaging exercise, participants were randomly but equally assigned to either a 12 min CWI (15 ± 1 °C; n = 9) group who experienced immersions immediately post-exercise and every 24 h thereafter for the following 3 days, or a control group (no treatment; n = 9). Maximal voluntary contraction (MVC) of the knee extensors, creatine kinase activity (CK), muscle soreness (DOMS), range of motion (ROM) and limb girth were measured pre-exercise and then for the following 96 h at 24 h increments. In addition MVC was also recorded immediately post-exercise. Significant time effects were seen for MVC, CK, DOMS and limb girth (p < 0.05) indicating muscle damage was evident, however there was no group effect or interaction observed showing that CWI did not attenuate any of the dependent variables (p > 0.05). These results suggest that repeated CWI do not enhance recovery from a bout of damaging eccentric contractions. Key pointsCryotherapy, particularly cold water immersions are one of the most common interventions used in order to enhance recovery post-exercise.There is little empirical evidence demonstrating benefits from cold water immersions. Research evidence is equivocal, probably due to methodological inconsistencies.Our results show that the cryotherapy administered did not attenuate any markers of EIMD or enhance the recovery of function.We conclude that repeated cold water immersions are ineffective in the recovery from heavy plyometric exercise and suggest athletes and coaches should use caution before using this intervention as a recovery strategy PMID:24149455

Prior history of FDI muscle contraction: different effect on MEP amplitude and muscle activity.

PubMed

Talis, V L; Kazennikov, O V; Castellote, J M; Grishin, A A; Ioffe, M E

2014-03-01

Motor evoked potentials (MEPs) in the right first dorsal interosseous (FDI) muscle elicited by transcranial magnetic stimulation of left motor cortex were assessed in ten healthy subjects during maintenance of a fixed FDI contraction level. Subjects maintained an integrated EMG (IEMG) level with visual feedback and reproduced this level by memory afterwards in the following tasks: stationary FDI muscle contraction at the level of 40 ± 5 % of its maximum voluntary contraction (MVC; 40 % task), at the level of 20 ± 5 % MVC (20 % task), and also when 20 % MVC was preceded by either no contraction (0-20 task), by stronger muscle contraction (40-20 task) or by no contraction with a previous strong contraction (40-0-20 task). The results show that the IEMG level was within the prescribed limits when 20 and 40 % stationary tasks were executed with and without visual feedback. In 0-20, 40-20, and 40-0-20 tasks, 20 % IEMG level was precisely controlled in the presence of visual feedback, but without visual feedback the IEMG and force during 20 % IEMG maintenance were significantly higher in the 40-0-20 task than those in 0-20 and 40-20 tasks. That is, without visual feedback, there were significant variations in muscle activity due to different prehistory of contraction. In stationary tasks, MEP amplitudes in 40 % task were higher than in 20 % task. MEPs did not differ significantly during maintenance of the 20 % level in tasks with different prehistory of muscle contraction with and without visual feedback. Thus, in spite of variations in muscle background activity due to different prehistory of contraction MEPs did not vary significantly. This dissociation suggests that the voluntary maintenance of IEMG level is determined not only by cortical mechanisms, as reflected by corticospinal excitability, but also by lower levels of CNS, where afferent signals and influences from other brain structures and spinal cord are convergent.

Postmaximal contraction blood volume responses are blunted in obese and type 2 diabetic subjects in a muscle-specific manner

PubMed Central

Sanchez, Otto A.; Copenhaver, Elizabeth A.; Chance, Marti A.; Fowler, Michael J.; Towse, Theodore F.; Kent-Braun, Jane A.

2011-01-01

The purpose of this study was to determine whether there are differences in postisometric contraction blood volume and oxygenation responses among groups of type 2 diabetes mellitus (T2DM), obese, and lean individuals detectable using MRI. Eight T2DM patients were individually matched by age, sex, and race to non-T2DM individuals with similar body mass index (obese) and lean subjects. Functional MRI was performed using a dual-gradient-recalled echo, echo-planar imaging sequence with a repetition time of 1 s and at two echo times (TE = 6 and 46 ms). Data were acquired before, during, and after 10-s isometric dorsiflexion contractions performed at 50 and 100% of maximal voluntary contraction (MVC) force. MRI signal intensity (SI) changes from the tibialis anterior and extensor digitorum longus muscles were plotted as functions of time for each TE. From each time course, the difference between the minimum and the maximum postcontraction SI (ΔSI) were determined for TE = 6 ms (ΔSI6) and TE = 46 ms (ΔSI46), reflecting variations in blood volume and oxyhemoglobin saturation, respectively. Following 50% MVC contractions, the mean postcontraction ΔSI6 values were similar in the three groups. Following MVC only, and in the EDL muscle only, T2DM and obese participants had ∼56% lower ΔSI6 than the lean individuals. Also following MVC only, the ΔSI46 response in the EDL was lower in T2DM subjects than in lean individuals. These data suggest that skeletal muscle small vessel impairment occurs in T2DM and body mass index-matched subjects, in muscle-specific and contraction intensity-dependent manners. PMID:21572006

Alcohol Policies and Alcohol-Related Motor Vehicle Crash Fatalities Among Young People in the US.

PubMed

Hadland, Scott E; Xuan, Ziming; Sarda, Vishnudas; Blanchette, Jason; Swahn, Monica H; Heeren, Timothy C; Voas, Robert B; Naimi, Timothy S

2017-03-01

Motor vehicle crashes (MVCs) are a leading cause of death among young people in the United States. We examined the relationship between states' alcohol policy environments and alcohol-related MVC fatalities among children, adolescents, and young adults under the minimum legal drinking age of 21 years. We used the Alcohol Policy Scale (APS), an assessment of 29 alcohol policies across 50 states and Washington, DC, developed with the assistance of an interdisciplinary Delphi panel. Using the Fatality Analysis Reporting System, we examined APS scores in relation to fatalities of people ≤20 years old from 2000 to 2013 occurring in crashes in which ≥1 involved driver had a blood alcohol content ≥0.08%. Logistic regression was used with a 1-year lag between policies and MVC fatalities and adjusted for potential confounders. Of 84 756 MVC fatalities of those ≤20 years old during the study period, 23 757 (28.0%) were alcohol related, including deaths of 11 006 (46.3%) drivers, 10 212 (43.0%) passengers, and 2539 (10.7%) pedestrians, cyclists, and others. People killed in alcohol-related MVCs were predominantly male (72.7%) and older (65.5% were 18-20 years old), and 51.2% were non-Hispanic white. Restrictive policy environments were associated with fewer fatalities (adjusted odds ratio, 0.91 per 10-percentage-point increase in APS score; 95% confidence interval, 0.89-0.94). The association was observed for drivers and passengers, male and female decendents, and children, adolescents, and young adults. More restrictive alcohol policies are associated with reduced alcohol-related MVC mortality among young people. Studies should scrutinize the relationship between policies and fatalities to highlight mechanisms. Copyright © 2017 by the American Academy of Pediatrics.

Polymorphisms in PTK2 are associated with skeletal muscle specific force: an independent replication study.

PubMed

Stebbings, Georgina K; Williams, A G; Morse, C I; Day, S H

2017-04-01

The aim of the study was to investigate two single nucleotide polymorphisms (SNP) in PTK2 for associations with human muscle strength phenotypes in healthy men. Measurement of maximal isometric voluntary knee extension (MVC KE ) torque, net MVC KE torque and vastus lateralis (VL) specific force, using established techniques, was completed on 120 Caucasian men (age = 20.6 ± 2.3 year; height = 1.79 ± 0.06 m; mass = 75.0 ± 10.0 kg; mean ± SD). All participants provided either a blood (n = 96) or buccal cell sample, from which DNA was isolated and genotyped for the PTK2 rs7843014 A/C and rs7460 A/T SNPs using real-time polymerase chain reaction. Genotype frequencies for both SNPs were in Hardy-Weinberg equilibrium (X 2  ≤ 1.661, P ≥ 0.436). VL specific force was 8.3% higher in rs7843014 AA homozygotes than C-allele carriers (P = 0.017) and 5.4% higher in rs7460 AA homozygotes than T-allele carriers (P = 0.029). No associations between either SNP and net MVC KE torque (P ≥ 0.094) or peak MVC KE torque (P ≥ 0.107) were observed. These findings identify a genetic contribution to the inter-individual variability within muscle specific force and provides the first independent replication, in a larger Caucasian cohort, of an association between these PTK2 SNPs and muscle specific force, thus extending our understanding of the influence of genetic variation on the intrinsic strength of muscle.

Obesity and Non-fatal Motor Vehicle Crash Injuries: Sex Difference Effects

PubMed Central

Ma, Xiaoguang; Laud, Purushottam W.; Pintar, Frank; Kim, Jong-Eun; Shih, Alan; Shen, Wei; Heymsfield, Steven B.; Allison, David B.; Zhu, Shankuan

2010-01-01

Background Obesity and motor vehicle crash (MVC) injuries are two parallel epidemics in the United States. An important unanswered question is if there are sex differences in the associations between the presence of obesity and non-fatal MVC injuries. Objectives To further understand the association between obesity and non-fatal motor vehicle crash injuries, particularly the sex differences in these relations. Methods We examined this question by analyzing data from the 2003 to 2007 National Automotive Sampling System Crashworthiness Data System (NASS CDS). A total of 10, 962 drivers who were aged 18 years or older and who survived frontal collision crashes were eligible for study. Results Male drivers experienced a lower rate of overall non-fatal MVC injuries than did female drivers (38.1% vs. 52.2%) but a higher rate of severe injuries (0.7% vs. 0.2%). After adjusting for change in velocity (ΔV) during the crashes, obese male drivers showed a much higher risk [logistic coefficients of BMI for moderate, serious, and severe injury are 0.0766, 0.1470, and 0.1792, respectively; all p<0.05] of non-fatal injuries than did non-obese male drivers and these risks increased with injury severity. Non-fatal injury risks were not found to be increased in obese female drivers. The association between obesity and risk of non-fatal injury was much stronger for male drivers than for female drivers. Conclusion The higher risk of non-fatal MVC injuries in obese male drivers might result from their different body shape and fat distribution compared with obese female drivers. Our findings should be considered for obesity reduction, traffic safety evaluation and vehicle design for obese male drivers and provide testable hypotheses for future studies. PMID:21224830

Recovery of voluntary and evoked muscle performance following intermittent-sprint exercise in the heat.

PubMed

Duffield, Rob; King, Monique; Skein, Melissa

2009-06-01

This study investigated the effects of hot conditions on the acute recovery of voluntary and evoked muscle performance and physiological responses following intermittent exercise. Seven youth male and six female team-sport athletes performed two sessions separated by 7 d, involving a 30-min exercise protocol and 60-min passive recovery in either 22 degrees C or 33 degrees C and 40% relative humidity. The exercise protocol involved a 20-s maximal sprint every 5 min, separated by constant-intensity exercise at 100 W on a cycle ergometer. Maximal voluntary contraction (MVC) and a resting evoked twitch (Pf) of the right knee extensors were assessed before and immediately following exercise and again 15, 30, and 60 min postexercise, and capillary blood was obtained at the same time points to measure lactate, pH, and HCO3. During and following exercise, core temperature, heart rate and rating of perceived exertion (RPE) were also measured. No differences (P=0.73 to 0.95) in peak power during repeated sprints were present between conditions. Postexercise MVC was reduced (P<.05) in both conditions and a moderate effect size (d=0.60) indicated a slower percentage MVC recovered by 60 min in the heat (83+/-10 vs 74+/-11% recovered). Both heart rate and core temperature were significantly higher (P<.05) during recovery in the heat. Capillary blood values did not differ between conditions at any time point, whereas sessional RPE was higher 60 min postexercise in the heat. The current data suggests that passive recovery in warm temperatures not only delays cardiovascular and thermal recovery, but may also slow the recovery of MVC and RPE.

Beetroot-based gel supplementation improves handgrip strength, forearm muscle O2 saturation but not exercise tolerance and blood volume in jiu-jitsu athletes.

PubMed

de Oliveira, Gustavo Vieira; Nascimento, Luiz; Volino-Souza, Mônica; Mesquita, Jacilene; Alvares, Thiago

2018-03-22

The ergogenic effect of beetroot on the exercise performance of trained cyclists, runners, kayakers, and swimmers has been demonstrated. However, whether or not beetroot supplementation presents a beneficial effect on the exercise performance of jiu-jitsu athletes (JJA) remains inconclusive. Therefore, present study assessed the effect of beetroot-based gel (BG) supplementation on maximal voluntary contraction (MVC), exercise time until fatigue (ETF), muscle O2 saturation (SmO2), blood volume (tHb), and plasma nitrate and lactate in response to handgrip isotonic exercise (HIE) in JJA. In a randomized, crossover, double-blind design, 12 JJA performed three sets of HIE at 40% of the MVC until fatigue after 8 days (8th dose was offered 120 min previous exercise) of BG supplementation or a nitrate-depleted gel (PLA), and forearm SmO2 and tHb were continuously monitored by using near-infrared spectroscopy. Blood samples were taken before, immediately after exercise, and 20 min after exercise recovery in PLA and BG condition. MVC was evaluated at baseline and 20 min after HIE. There was a significant reduction in ∆MVC decline after HIE in BG condition. Forearm SmO2 during exercise recovery was significantly greater only after BG supplementation. No significant difference in ETF and tHb were observed between both BG and PLA in response to HIE. Plasma nitrate increased only after BG, whereas the exercise-induced increase in plasma lactate was significantly lower in BG when compared to PLA. In conclusion, BG supplementation may be a good nutritional strategy to improve forearm SmO2 and prevent force decline in response to exercise in JJA.

Postmortem computed tomography as an adjunct to autopsy for analyzing fatal motor vehicle crash injuries: results of a pilot study.

PubMed

Sochor, Mark R; Trowbridge, Matthew J; Boscak, Alexis; Maino, John C; Maio, Ronald F

2008-09-01

Detailed fatal injury data after fatal motor vehicle crashes (MVC) are necessary to improve occupant safety and promote injury prevention. Autopsy remains the principle source of detailed fatal injury data. However, procedure rates are declining because of a range of technical, ethical, and religious concerns. Postmortem computed tomography (PMCT) is a potential alternative or adjunct to autopsy which is increasingly used by forensic researchers. However, there are only limited data regarding the utility of PMCT for analysis of fatal MVC injuries. We performed whole body PMCT and autopsy on six subjects fatally injured in MVC in a single county in Michigan. All injuries detected by either method were coded using the Abbreviated Injury Scale (AIS). Severe injuries, defined as AIS 3 or higher (AIS 3+), were tallied for each forensic procedure to allow a comparison of relative diagnostic performance. A total of 46 AIS 3+ injuries were identified by autopsy and PMCT for these cases. The addition of PMCT to autopsy increased overall detection of AIS 3+ injuries (all types) by 28%. PMCT detected 27% more AIS 3+ skeletal injuries than autopsy but 25% less soft tissue injuries. Use of PMCT improves the detection of AIS 3+ injuries after fatal MVC compared with isolated use of autopsy and also produces a highly detailed permanent objective record. PMCT appears to improve detection of skeletal injury compared with autopsy but is less sensitive than autopsy for the detection of AIS 3+ soft tissue injuries. Neither autopsy nor PMCT identified all AIS 3+ injuries revealed by the combination of the two methodologies. This suggests that PMCT should be used as an adjunct to autopsy rather than a replacement whenever feasible.

Cold application for neuromuscular recovery following intense lower-body exercise.

PubMed

Pointon, Monique; Duffield, Rob; Cannon, Jack; Marino, Frank E

2011-12-01

This study examined the effects of cold therapy (COLD) on recovery of voluntary and evoked contractile properties following high-intensity, muscle-damaging and fatiguing exercise. Ten resistance-trained males performed 6 × 25 maximal concentric/eccentric muscle contractions of the dominant knee extensors (KE) followed by a 20-min recovery (COLD v control) in a randomized cross-over design. Voluntary and evoked neuromuscular properties of the right KE, ratings of perceived muscle soreness (MS) and pain, and blood markers for muscle damage were measured pre- and post-exercise, and immediately post-recovery, 2, 24 and 48-h post-recovery. Exercise resulted in decrements in voluntary and evoked torque, increased MS and elevated muscle damage markers (p < 0.05). Measures of maximal voluntary contraction (MVC) or voluntary activation (VA) were not significantly enhanced by COLD (p > 0.05). Activation of right KE decreased post-exercise with increased activation of biceps femoris (BF) (p < 0.05). However, no significant differences were evident between conditions of activation of KE and hamstrings at any time point (p > 0.05). No significant differences were observed between conditions for creatine kinase or asparate aminotransferase (p > 0.05). However, perceptual ratings of pain were significantly (p < 0.05) lower following COLD compared to control. In conclusion, following damage to the contractile apparatus, COLD did not significantly hasten the recovery of peripheral contractile trauma. Despite no beneficial effect of COLD on recovery of MVC, perceptions of pain were reduced following COLD.

Influence of mental workload on muscle endurance, fatigue, and recovery during intermittent static work.

PubMed

Mehta, Ranjana K; Agnew, Michael J

2012-08-01

Most occupational tasks involve some level of mental/cognitive processing in addition to physical work; however, the etiology of work-related musculoskeletal disorders (WMSDs) due to these demands remains unclear. The aim of this study was to quantify the interactive effects of physical and mental workload on muscle endurance, fatigue, and recovery during intermittent work. Twelve participants, balanced by gender, performed intermittent static shoulder abductions to exhaustion at 15, 35, and 55% of individual maximal voluntary contraction (MVC), in the absence (control) and presence (concurrent) of a mental arithmetic task. Changes in muscular capacity were determined using endurance time, strength decline, electromyographic (EMG) fatigue indicators, muscle oxygenation, and heart rate measures. Muscular recovery was quantified through changes in strength and physiological responses. Mental workload was associated with shorter endurance times, specifically at 35% MVC, and greater strength decline. EMG and oxygenation measures showed similar changes during fatigue manifestation during concurrent conditions compared to the control, despite shorter endurance times. Moreover, decreased heart rate variability during concurrent demand conditions indicated increased mental stress. Although strength recovery was not influenced by mental workload, a slower heart rate recovery was observed after concurrent demand conditions. The findings from this study provide fundamental evidence that physical capacity (fatigability and recovery) is adversely affected by mental workload. Thus, it is critical to determine or evaluate occupational demands based on modified muscular capacity (due to mental workload) to reduce risk of WMSD development.

Aircraft control forces and EMG activity in a C-130 Hercules during strength-critical maneuvers.

PubMed

Hewson, D J; McNair, P J; Marshall, R N

2001-03-01

The force levels required to operate aircraft controls should be readily generated by pilots, without undue fatigue or exertion. However, maximum pilot applied forces, as specified in aircraft design standards, were empirically derived from the subjective comments of test pilots, and may not be applicable for the majority of pilots. Further, experienced RNZAF Hercules flying instructors have indicated that endurance and fatigue are problems for Hercules pilots. The aim of this study was to quantify aircraft control forces during emergency maneuvers in a Hercules aircraft and compare these forces with design standards. In addition, EMG data were recorded as an indicator of muscle fatigue during flight. Six subjects were tested in a C-130 Hercules aircraft. The maneuvers performed were low-level dynamic flight, one engine-off straight-and-level flight, and a two-engines-off simulated approach. The variables recorded were pilot-applied forces and EMG activity. Left rudder pedal force and vastus lateralis activity were both significantly greater during engine-off maneuvers than during low-level dynamic flight (p < 0.05). Maximum aircraft control forces for all controls were within 10% of the design standards. The mean EMG activity across all muscles and maneuvers was 26% MVC, with a peak of 61% MVC in vastus lateralis during the two-engine-off approach. The median frequency of the vastus lateralis EMG signal decreased 13.0% and 16.0% for the one engine-off and two-engine-off maneuvers, respectively. The forces required to fly a Hercules aircraft during emergency maneuvers are similar to the aircraft design standards. However, the levels of vastus lateralis muscle activation observed during the engine-off maneuvers can be sustained for approximately 1 min only. Thus, if two engines fail more than 1 min before landing, pilots may have to alternate control of the aircraft to share the workload and enable the aircraft to land safely.

Intermittent whole-body cold immersion induces similar thermal stress but different motor and cognitive responses between males and females.

PubMed

Solianik, Rima; Skurvydas, Albertas; Mickevičienė, Dalia; Brazaitis, Marius

2014-10-01

The main aim of this study was to compare the thermal responses and the responses of cognitive and motor functions to intermittent cold stress between males and females. The intermittent cold stress continued until rectal temperature (TRE) reached 35.5°C or for a maximum of 170 min. Thermal response and motor and cognitive performance were monitored. During intermittent cold stress, body temperature variables decreased in all subjects (P < 0.001) and did not differ between sexes. The presence of fast and slow cooling types for participants with similar effect on physiological variables were observed; thus the different rate coolers were grouped together and were attributed only sex specific responses. Overall, TRE cooling rate and cold strain index did not differ between sexes. Maximal voluntary contraction (MVC) decreased after intermittent cold exposure only in males (P < 0.001), whereas changes in muscle electromyography (EMG) activity did not differ between sexes. The effects of intermittent cold stress on electrically evoked muscle properties, spinal (H-reflex), and supraspinal (V-waves) reflexes did not differ between sexes. Intermittent cold-induced cognitive perturbation of attention and memory task performance was greater in males (P < 0.05). Contrary to our expectations, the results of the present study indicated that males and females experience similar thermal stress induced by intermittent whole-body cold immersion. Although no sex-specific differences were observed in muscle EMG activity, involuntary muscle properties, spinal and supraspinal reflexes, some of the sex differences observed (e.g., lower isometric MVC and greater cognitive perturbation in males) support the view of sex-specific physiological responses to core temperature decrease. Copyright © 2014 Elsevier Inc. All rights reserved.

Understanding of the management information system based on MVC pattern

NASA Astrophysics Data System (ADS)

Chen, Sida

2018-04-01

With the development of the society, people have come to realize the significance of information, not only linguistically but also in the written form. To build an effective and efficient working flow, a new subject called Management Information System (MIS) came up. MIS is an integrated discipline, which utilizes comprehensive and systematical methods to manage information, and it enhances the work efficiency through building structured information platform. This paper demonstrates the Management Information System from shallow too deep with the understanding of MVC pattern, including its basic structure and application with ASP.NET. Also some discussions about its features are made in the last section.

The association between price of regular-grade gasoline and injury and mortality rates among occupants involved in motorcycle- and automobile-related motor vehicle collisions.

PubMed

Hyatt, Eddie; Griffin, Russell; Rue, Loring W; McGwin, Gerald

2009-09-01

Motorcyclists have been reported to be more likely to die in a motor vehicle collision (MVC) than automobile occupants. With the recent increase in the pump price of gasoline, it has been reported that people are switching to motorcycles as main modes of transportation. This study evaluated the association between motor vehicle collision-related injury and mortality rates and increases in gasoline prices for occupants of automobiles and riders of motorcycles. There were an estimated 1,270,512 motorcycle MVC and 238,390,853 automobile MVC involved occupants in the U.S. from 1992 to 2007. Higher gasoline prices were associated with increased motorcycle-related injuries and deaths; however, this association no longer remained after accounting for changes in the number of registered vehicles. The current study observed that, while the number of injuries and fatalities in motorcycle-related MVCs increase with increasing gasoline price, rates remained largely unchanged. This suggests that the observed increase in motorcycle-related injuries and fatalities with increasing gasoline price is more a factor of the number of motorcycles on the road rather than operator characteristics.

Mixing in the shear superposition micromixer: three-dimensional analysis.

PubMed

Bottausci, Frederic; Mezić, Igor; Meinhart, Carl D; Cardonne, Caroline

2004-05-15

In this paper, we analyse mixing in an active chaotic advection micromixer. The micromixer consists of a main rectangular channel and three cross-stream secondary channels that provide ability for time-dependent actuation of the flow stream in the direction orthogonal to the main stream. Three-dimensional motion in the mixer is studied. Numerical simulations and modelling of the flow are pursued in order to understand the experiments. It is shown that for some values of parameters a simple model can be derived that clearly represents the flow nature. Particle image velocimetry measurements of the flow are compared with numerical simulations and the analytical model. A measure for mixing, the mixing variance coefficient (MVC), is analysed. It is shown that mixing is substantially improved with multiple side channels with oscillatory flows, whose frequencies are increasing downstream. The optimization of MVC results for single side-channel mixing is presented. It is shown that dependence of MVC on frequency is not monotone, and a local minimum is found. Residence time distributions derived from the analytical model are analysed. It is shown that, while the average Lagrangian velocity profile is flattened over the steady flow, Taylor-dispersion effects are still present for the current micromixer configuration.

Video traffic characteristics of modern encoding standards: H.264/AVC with SVC and MVC extensions and H.265/HEVC.

PubMed

Seeling, Patrick; Reisslein, Martin

2014-01-01

Video encoding for multimedia services over communication networks has significantly advanced in recent years with the development of the highly efficient and flexible H.264/AVC video coding standard and its SVC extension. The emerging H.265/HEVC video coding standard as well as 3D video coding further advance video coding for multimedia communications. This paper first gives an overview of these new video coding standards and then examines their implications for multimedia communications by studying the traffic characteristics of long videos encoded with the new coding standards. We review video coding advances from MPEG-2 and MPEG-4 Part 2 to H.264/AVC and its SVC and MVC extensions as well as H.265/HEVC. For single-layer (nonscalable) video, we compare H.265/HEVC and H.264/AVC in terms of video traffic and statistical multiplexing characteristics. Our study is the first to examine the H.265/HEVC traffic variability for long videos. We also illustrate the video traffic characteristics and statistical multiplexing of scalable video encoded with the SVC extension of H.264/AVC as well as 3D video encoded with the MVC extension of H.264/AVC.

Video Traffic Characteristics of Modern Encoding Standards: H.264/AVC with SVC and MVC Extensions and H.265/HEVC

PubMed Central

2014-01-01

Video encoding for multimedia services over communication networks has significantly advanced in recent years with the development of the highly efficient and flexible H.264/AVC video coding standard and its SVC extension. The emerging H.265/HEVC video coding standard as well as 3D video coding further advance video coding for multimedia communications. This paper first gives an overview of these new video coding standards and then examines their implications for multimedia communications by studying the traffic characteristics of long videos encoded with the new coding standards. We review video coding advances from MPEG-2 and MPEG-4 Part 2 to H.264/AVC and its SVC and MVC extensions as well as H.265/HEVC. For single-layer (nonscalable) video, we compare H.265/HEVC and H.264/AVC in terms of video traffic and statistical multiplexing characteristics. Our study is the first to examine the H.265/HEVC traffic variability for long videos. We also illustrate the video traffic characteristics and statistical multiplexing of scalable video encoded with the SVC extension of H.264/AVC as well as 3D video encoded with the MVC extension of H.264/AVC. PMID:24701145

Determination of chewing efficiency using muscle work.

PubMed

Paphangkorakit, Jarin; Chaiyapanya, Nayiga; Sriladlao, Penprapa; Pimsupa, Sutasinee

2008-06-01

A new method was proposed to evaluate 'true' chewing efficiency in which the 'cost' of chewing was accounted for. Twenty-three subjects were asked to chew an almond for 5 cycles, after which the chewed particles were air-dried and passed through a 1.4-mm aperture sieve. The activity of both superficial masseter muscles was simultaneously recorded with surface EMG. Integrated EMG (IEMG) was used to calculate burst amplitude, burst duration and maximum voluntary contraction (MVC). The percentage weight of particles passing the sieve was used to represent the conventional chewing efficiency (or masticatory performance). Muscle work (integral of IEMG bursts), muscle effort (muscle work normalized to maximum work) and masticatory effectiveness (the ratio between masticatory performance and muscle work) were also calculated. The results showed that (1) masticatory performance was significantly correlated with muscle work (R=0.45; p<0.005), MVC (R=0.31; p=0.04), but not correlated with muscle effort; (2) masticatory effectiveness was significantly correlated with MVC (R=0.58, p<0.001), but not correlated with masticatory performance. Persons with good masticatory performance were not necessarily effective (or efficient) chewers. They seemed to have larger MVCs and use more muscle work during the chewing task.

Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosa Borges, Andrew; Wieczorek, Lindsay; Johnson, Benitra

2010-12-05

Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3'-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC{sub 50}s ranging from 0.1 to 7.4 {mu}g/ml. Inhibition of Env-mediated membrane fusion by MVC wasmore » also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. -- Research Highlights: {yields}Multivalent carbohydrates (MVCs) inhibited infection of PBMCs by HIV-1. {yields}MVCs inhibited infection by T cell line-adapted viruses. {yields}MVCs inhibited infection by primary isolates of HIV-1. {yields}MVCs inhibited Env-mediated membrane fusion.« less

Distribution of myofibroblast cells and microvessels around invasive ductal carcinoma of the breast and comparing with the adjacent range of their normal-to-DCIS zones.

PubMed

Dabiri, Shahriar; Talebi, Amin; Shahryari, Jahanbanoo; Meymandi, Manzoumeh Shamsi; Safizadeh, Hossein

2013-02-01

This study seeks to determine the relationships between manifestation of myofibroblasts in the stroma tissue of hyperplastic pre-invasive breast lesions to invasive cancer by investigating clinicopathological data of patients, their effect on steroid receptor expression and HER2, and angiogenesis according to CD34 antigen expression. 100 cases of invasive ductal carcinoma were immunohistochemically investigated for the presence of smooth muscle actin (SMA), ER/PR, HER2, anti-CD34 antibody and microvessel count (MVC). Patients were scored in four different zones of invasive areas: invasive cancer, DCIS, fibrocystic disease ± ductal intraepithelial neoplasia (FCD ± DIN), and normal tissue.  There was a significant difference in stromal myofibroblasts between all areas except for the stroma of DCIS and FCD ± DIN (P < 0.001). We observed positive significant correlations between stromal myofibroblasts, HER2 expression, and the numbers of involved lymph nodes in invasive cancer, DCIS, and FCD ± DIN (P < 0.001). More myofibroblasts were present in grade III cases, with the least frequent observed among grade I cases in the stroma of those with invasive disease, DCIS, and FCD ± DIN (P < 0.001).  MVC was inversely related to stromal myofibroblasts in invasive cancer (P < 0.001) and DCIS (P < 0.001), whereas there was a positive correlation in the stroma of FCD ± DIN (P = 0.002) and normal areas (P = 0.054). There was a significant difference in MVC observed in all areas except for DCIS and FCD ± DIN (P < 0.001). We noted significant inverse correlations between MVC, HER2 expression, and the numbers of involved lymph nodes in invasive cancer and DCIS (P < 0.001). Most MVC were present in grade I, with the least frequent observed in grade III cases in the stroma of invasive cancer, DCIS and FCD ± DIN (P < 0.001).  Angiogenesis can be observed before any significant myofibroblastic changes in the pre-invasive breast lesions. The elevated content of myofibroblasts in stroma of tumor; probably may be a worse prognostic factor  and the steps from atypical epithelial hyperplasia to DCIS and then to the invasive carcinoma do not appear to be always part of a linear progression.

Influence of Maturation Status on Eccentric Exercise-Induced Muscle Damage and the Repeated Bout Effect in Females

PubMed Central

Lin, Ming-Ju; Nosaka, Kazunori; Ho, Chih-Chiao; Chen, Hsin-Lian; Tseng, Kuo-Wei; Ratel, Sébastien; Chen, Trevor Chung-Ching

2018-01-01

This study compared changes in indirect muscle damage markers, proprioception and arterial stiffness after elbow flexor eccentric exercise between pre-pubescent (9–10 y), pubescent (14–15 y), and post-pubescent (20–24 y) healthy, untrained females (n = 13/group). The maturation of the participants was confirmed by the hand bone age. All participants performed two bouts of 30 sub-maximal eccentric contractions (EC1, EC2) using a dumbbell set at 60% of pre-exercise maximal voluntary isometric elbow flexion strength at 90°. Changes in maximal voluntary concentric contraction (MVC) torque, muscle soreness (SOR), plasma creatine kinase activity, proprioception (position sense, joint reaction angle) and arterial stiffness (carotid-femoral pulse-wave velocity: cfPWV) before to 5 days after EC1 and EC2 were compared among groups by a mixed-design two-way ANOVA. Pre-exercise MVC torque and cfPWV were smaller (P < 0.05) for the pre-pubescent (MVC: 10.0 ± 0.9 Nm, cfPWV: 903 ± 60 cm/s) and the pubescent (14.3 ± 1.1 Nm, 967 ± 61 cm/s) than the post-pubescent (19.1 ± 1.4 Nm, 1,103 ± 73 cm/s). Changes in all variables after EC1 were smaller (P < 0.05) for the pre-pubescent (e.g., MVC at 1 d post-exercise: −10 ± 6%, peak SOR: 5 ± 2 mm) than the pubescent (−15 ± 9%, 12 ± 6 mm) and the post-pubescent (−25 ± 7%, 19 ± 13 mm). After EC2, changes in all variables were smaller (P < 0.05) than those after EC1 for all groups (e.g., MVC at 1 d post-exercise, pre-pubescent: −4 ± 6%, pubescent: −9 ± 4%, post-pubescent: −14 ± 5%; peak SOR: 3 ± 2, 7 ± 3, 11 ± 6 mm), but the magnitude of the repeated bout effect was not different (P > 0.05) among the groups. These results show that the extents of muscle damage, and proprioception and arterial stiffness changes after eccentric exercise are greater at later stages of maturation, but the repeated bout effect is not affected by maturation. PMID:29354073

Maximal Voluntary Activation of the Elbow Flexors Is under Predicted by Transcranial Magnetic Stimulation Compared to Motor Point Stimulation Prior to and Following Muscle Fatigue

PubMed Central

Cadigan, Edward W. J.; Collins, Brandon W.; Philpott, Devin T. G.; Kippenhuck, Garreth; Brenton, Mitchell; Button, Duane C.

2017-01-01

Transcranial magnetic (TMS) and motor point stimulation have been used to determine voluntary activation (VA). However, very few studies have directly compared the two stimulation techniques for assessing VA of the elbow flexors. The purpose of this study was to compare TMS and motor point stimulation for assessing VA in non-fatigued and fatigued elbow flexors. Participants performed a fatigue protocol that included twelve, 15 s isometric elbow flexor contractions. Participants completed a set of isometric elbow flexion contractions at 100, 75, 50, and 25% of maximum voluntary contraction (MVC) prior to and following fatigue contractions 3, 6, 9, and 12 and 5 and 10 min post-fatigue. Force and EMG of the bicep and triceps brachii were measured for each contraction. Force responses to TMS and motor point stimulation and EMG responses to TMS (motor evoked potentials, MEPs) and Erb's point stimulation (maximal M-waves, Mmax) were also recorded. VA was estimated using the equation: VA% = (1−SITforce/PTforce) × 100. The resting twitch was measured directly for motor point stimulation and estimated for both motor point stimulation and TMS by extrapolation of the linear regression between the superimposed twitch force and voluntary force. MVC force, potentiated twitch force and VA significantly (p < 0.05) decreased throughout the elbow flexor fatigue protocol and partially recovered 10 min post fatigue. VA was significantly (p < 0.05) underestimated when using TMS compared to motor point stimulation in non-fatigued and fatigued elbow flexors. Motor point stimulation compared to TMS superimposed twitch forces were significantly (p < 0.05) higher at 50% MVC but similar at 75 and 100% MVC. The linear relationship between TMS superimposed twitch force and voluntary force significantly (p < 0.05) decreased with fatigue. There was no change in triceps/biceps electromyography, biceps/triceps MEP amplitudes, or bicep MEP amplitudes throughout the fatigue protocol at 100% MVC. In conclusion, motor point stimulation as opposed to TMS led to a higher estimation of VA in non-fatigued and fatigued elbow flexors. The decreased linear relationship between TMS superimposed twitch force and voluntary force led to an underestimation of the estimated resting twitch force and thus, a reduced VA. PMID:28979211

Maximal Voluntary Activation of the Elbow Flexors Is under Predicted by Transcranial Magnetic Stimulation Compared to Motor Point Stimulation Prior to and Following Muscle Fatigue.

PubMed

Cadigan, Edward W J; Collins, Brandon W; Philpott, Devin T G; Kippenhuck, Garreth; Brenton, Mitchell; Button, Duane C

2017-01-01

Transcranial magnetic (TMS) and motor point stimulation have been used to determine voluntary activation (VA). However, very few studies have directly compared the two stimulation techniques for assessing VA of the elbow flexors. The purpose of this study was to compare TMS and motor point stimulation for assessing VA in non-fatigued and fatigued elbow flexors. Participants performed a fatigue protocol that included twelve, 15 s isometric elbow flexor contractions. Participants completed a set of isometric elbow flexion contractions at 100, 75, 50, and 25% of maximum voluntary contraction (MVC) prior to and following fatigue contractions 3, 6, 9, and 12 and 5 and 10 min post-fatigue. Force and EMG of the bicep and triceps brachii were measured for each contraction. Force responses to TMS and motor point stimulation and EMG responses to TMS (motor evoked potentials, MEPs) and Erb's point stimulation (maximal M-waves, M max ) were also recorded. VA was estimated using the equation: VA% = (1- SITforce / PTforce ) × 100. The resting twitch was measured directly for motor point stimulation and estimated for both motor point stimulation and TMS by extrapolation of the linear regression between the superimposed twitch force and voluntary force. MVC force, potentiated twitch force and VA significantly ( p < 0.05) decreased throughout the elbow flexor fatigue protocol and partially recovered 10 min post fatigue. VA was significantly ( p < 0.05) underestimated when using TMS compared to motor point stimulation in non-fatigued and fatigued elbow flexors. Motor point stimulation compared to TMS superimposed twitch forces were significantly ( p < 0.05) higher at 50% MVC but similar at 75 and 100% MVC. The linear relationship between TMS superimposed twitch force and voluntary force significantly ( p < 0.05) decreased with fatigue. There was no change in triceps/biceps electromyography, biceps/triceps MEP amplitudes, or bicep MEP amplitudes throughout the fatigue protocol at 100% MVC. In conclusion, motor point stimulation as opposed to TMS led to a higher estimation of VA in non-fatigued and fatigued elbow flexors. The decreased linear relationship between TMS superimposed twitch force and voluntary force led to an underestimation of the estimated resting twitch force and thus, a reduced VA.

Experimental muscle pain increases variability of neural drive to muscle and decreases motor unit coherence in tremor frequency band.

PubMed

Yavuz, Utku Ş; Negro, Francesco; Falla, Deborah; Farina, Dario

2015-08-01

It has been observed that muscle pain influences force variability and low-frequency (<3 Hz) oscillations in the neural drive to muscle. In this study, we aimed to investigate the effect of experimental muscle pain on the neural control of muscle force at higher frequency bands, associated with afferent feedback (alpha band, 5-13 Hz) and with descending cortical input (beta band, 15-30 Hz). Single-motor unit activity was recorded, in two separate experimental sessions, from the abductor digiti minimi (ADM) and tibialis anterior (TA) muscles with intramuscular wire electrodes, during isometric abductions of the fifth finger at 10% of maximal force [maximum voluntary contraction (MVC)] and ankle dorsiflexions at 25% MVC. The contractions were repeated under three conditions: no pain (baseline) and after intramuscular injection of isotonic (0.9%, control) and hypertonic (5.8%, painful) saline. The results showed an increase of the relative power of both the force signal and the neural drive at the tremor frequency band (alpha, 5-13 Hz) between the baseline and hypertonic (painful) conditions for both muscles (P < 0.05) but no effect on the beta band. Additionally, the strength of motor unit coherence was lower (P < 0.05) in the hypertonic condition in the alpha band for both muscles and in the beta band for the ADM. These results indicate that experimental muscle pain increases the amplitude of the tremor oscillations because of an increased variability of the neural control (common synaptic input) in the tremor band. Moreover, the concomitant decrease in coherence suggests an increase in independent input in the tremor band due to pain. Copyright © 2015 the American Physiological Society.

Effects of prolonged vibration to vastus intermedius muscle on force steadiness of knee extensor muscles during isometric force-matching task.

PubMed

Saito, Akira; Ando, Ryosuke; Akima, Hiroshi

2016-12-01

Afferent inputs from Ia fibers in muscle spindles are essential for the control of force and prolonged vibration has been applied to muscle-tendon units to manipulate the synaptic input from Ia afferents onto α-motor neurons. The vastus intermedius (VI) reportedly provides the highest contribution to the low-level knee extension torque among the individual synergists of quadriceps femoris (QF). The purpose of the present study was to examine the effect of prolonged vibration to the VI on force steadiness of the QF. Nine healthy men (25.1±4.3years) performed submaximal force-matching task of isometric knee extension for 15s before and after mechanical vibration to the superficial region of VI for 30min. Target forces were 2.5%, 10%, and 30% of maximal voluntary contraction (MVC), and force steadiness was determined by the coefficient of variation (CV) of force. After the prolonged VI vibration, the CV of force at 2.5%MVC was significantly increased, but CVs at 10% and 30%MVCs were not significantly changed. The present study concluded that application of prolonged vibration to the VI increased force fluctuations of the QF during a very low-level force-matching task. Copyright © 2016 Elsevier Ltd. All rights reserved.

Thinking about muscles: the neuromuscular effects of attentional focus on accuracy and fatigue.

PubMed

Lohse, Keith R; Sherwood, David E

2012-07-01

Although the effects of attention on movement execution are well documented behaviorally, much less research has been done on the neurophysiological changes that underlie attentional focus effects. This study presents two experiments exploring effects of attention during an isometric plantar-flexion task using surface electromyography (sEMG). Participants' attention was directed either externally (towards the force plate they were pushing against) or internally (towards their own leg, specifically the agonist muscle). Experiment 1 tested the effects of attention on accuracy and efficiency of force produced at three target forces (30, 60, and 100% of the maximum voluntary contraction; MVC). An internal focus of attention reduced the accuracy of force being produced and increased cocontraction of the antagonist muscle. Error on a given trial was positively correlated with the magnitude of cocontraction on that trial. Experiment 2 tested the effects of attention on muscular fatigue at 30, 60 and 100%MVC. An internal focus of attention led to less efficient intermuscular coordination, especially early in the contraction. These results suggest that an internal focus of attention disrupts efficient motor control in force production resulting in increased cocontraction, which potentially explains other neuromechanical findings (e.g. reduced functional variability with an internal focus). Copyright © 2012 Elsevier B.V. All rights reserved.

Cold-Water Immersion and Contrast Water Therapy: No Improvement of Short-Term Recovery After Resistance Training.

PubMed

Argus, Christos K; Broatch, James R; Petersen, Aaron C; Polman, Remco; Bishop, David J; Halson, Shona

2017-08-01

An athlete's ability to recover quickly is important when there is limited time between training and competition. As such, recovery strategies are commonly used to expedite the recovery process. To determine the effectiveness of both cold-water immersion (CWI) and contrast water therapy (CWT) compared with control on short-term recovery (<4 h) after a single full-body resistance-training session. Thirteen men (age 26 ± 5 y, weight 79 ± 7 kg, height 177 ± 5 cm) were assessed for perceptual (fatigue and soreness) and performance measures (maximal voluntary isometric contraction [MVC] of the knee extensors, weighted and unweighted countermovement jumps) before and immediately after the training session. Subjects then completed 1 of three 14-min recovery strategies (CWI, CWT, or passive sitting [CON]), with the perceptual and performance measures reassessed immediately, 2 h, and 4 h postrecovery. Peak torque during MVC and jump performance were significantly decreased (P < .05) after the resistance-training session and remained depressed for at least 4 h postrecovery in all conditions. Neither CWI nor CWT had any effect on perceptual or performance measures over the 4-h recovery period. CWI and CWT did not improve short-term (<4-h) recovery after a conventional resistance-training session.

Dynamic knee stability and ballistic knee movement after ACL reconstruction: an application on instep soccer kick.

PubMed

Cordeiro, Nuno; Cortes, Nelson; Fernandes, Orlando; Diniz, Ana; Pezarat-Correia, Pedro

2015-04-01

The instep soccer kick is a pre-programmed ballistic movement with a typical agonist-antagonist coordination pattern. The coordination pattern of the kick can provide insight into deficient neuromuscular control. The purpose of this study was to investigate knee kinematics and hamstrings/quadriceps coordination pattern during the knee ballistic extension phase of the instep kick in soccer players after anterior cruciate ligament reconstruction (ACL reconstruction). Seventeen players from the Portuguese Soccer League participated in this study. Eight ACL-reconstructed athletes (experimental group) and 9 healthy individuals (control group) performed three instep kicks. Knee kinematics (flexion and extension angles at football contact and maximum velocity instants) were calculated during the kicks. Rectus femoris (RF), vastus lateralis, vastus medialis, biceps femoralis, and semitendinosus muscle activations were quantified during the knee extension phase. The ACL-reconstructed group had significantly lower knee extension angle (-1.2 ± 1.6, p < 0.021) and increased variability (1.1 ± 1.2, p < 0.012) when compared with the control group. Within the EMG variables, the RF had a significantly greater activity in the ACL-reconstructed group than in the control group (79.9 ± 27.7 % MVC vs. 49.2 ± 20.8 % MVC, respectively, p < 0.034). No other statistically significant differences were found. The findings of this study demonstrate that changes in ACL-reconstructed individuals were observed on knee extension angle and RF muscle activation while performing an instep kick. These findings are in accordance with the knee stability recovery process after ACL reconstruction. No differences were observed in the ballistic control movement pattern between normal and ACL-reconstructed subjects. Performing open kinetic chain exercises using ballistic movements can be beneficial when recovering from ACL reconstruction. The exercises should focus on achieving multi-joint coordination and full knee extension (range of motion). III.

The developing one door licensing service system based on RESTful oriented services and MVC framework

NASA Astrophysics Data System (ADS)

Widiyanto, Sigit; Setyawan, Aris Budi; Tarigan, Avinanta; Sussanto, Herry

2016-02-01

The increase of the number of business impact on the increasing service requirements for companies and Small Medium Enterprises (SMEs) in submitting their license request. The service system that is needed must be able to accommodate a large number of documents, various institutions, and time limitations of applicant. In addition, it is also required distributed applications which is able to be integrated each other. Service oriented application fits perfectly developed along client-server application which has been developed by the Government to digitalize submitted data. RESTful architecture and MVC framework are embedded in developing application. As a result, the application proves its capability in solving security, transaction speed, and data accuracy issues.

Innervation zone shift at different levels of isometric contraction in the biceps brachii muscle.

PubMed

Piitulainen, Harri; Rantalainen, Timo; Linnamo, Vesa; Komi, Paavo; Avela, Janne

2009-08-01

Experiments were carried out to examine whether innervation zone (IZ) location remains stable at different levels of isometric contraction in the biceps brachii muscle (BB), and to determine how the proximity of the IZ affects common surface electromyography (sEMG) parameters. Twelve subjects performed maximal (MVC) and submaximal voluntary isometric contractions at 10%, 20%, 30%, 40%, 50% and 75% of MVC. sEMG signals were recorded with a 13 rows x 5 columns grid of electrodes from the short head of BB. The IZ shifted in the proximal direction by up to 2.4 cm, depending upon the subject and electrode column. The mean shift of all the columns was 0.6+/-0.4 cm (10% vs. 100% MVC, P<0.001). This shift biased the average values of mean frequency (+21.8+/-9.9 Hz, P<0.001), root mean square (-0.16+/-0.15 mV, P<0.05) and conduction velocity (-1.15+/-0.93 m/s, P<0.01) in the channels immediately proximal to the IZ. The shift in IZ could be explained by shortening of the muscle fibers, and thus lengthening of the (distal) tendon due to increasing force. These results underline the importance of individual investigation of IZ locations before the placement of sEMG electrodes, even in isometric contractions.

History dependence of the EMG-torque relationship.

PubMed

Paquin, James; Power, Geoffrey A

2018-05-28

The influence of active lengthening (residual force enhancement: RFE) and shortening (force depression: FD) on the electromyography (EMG)-torque relationship was investigated by matching torque and activation at 20%, 40%, 60%, 80% and 100% maximal voluntary contraction (MVC). Sixteen males performed lengthening and shortening contractions of the dorsiflexors over 25° into an isometric steady-state. There was 5% greater torque, with no change in agonist EMG during the RFE condition as compared to the isometric condition. Sub-maximally, in the force enhanced state, there was less agonist EMG during the torque clamp at all intensities relative to isometric, and greater torque during the activation clamps relative to isometric was observed across all intensities except 20% MVC. During the FD state compared to isometric, there was less torque produced during MVC (∼15%) with no change in agonist EMG. Sub-maximally, in the FD state, there was greater agonist EMG during the torque clamp and less torque during the activation clamp relative to the isometric condition across all intensities. The EMG-torque relationship was bilinear for all contraction types but was shifted to the left and right for FD and RFE, respectively as compared with isometric, indicating altered neuromuscular activation strategies in the history-dependent states of RFE and FD. Copyright © 2018. Published by Elsevier Ltd.

Noncompliance with seat-belt use in patients involved in motor vehicle collisions

PubMed Central

Ball, Chad G.; Kirkpatrick, Andrew W.; Brenneman, Frederick D.

2005-01-01

Background Seat-belt compliance in trauma patients involved in motor vehicle collisions (MVCs) appears low when compared with compliance of the general public. In this study we wished to define the relative frequency of seat-belt use in injured Canadian drivers and passengers and to determine if there are risk factors particular to seat-belt noncompliance in this cohort. Methods We identified trauma patients who were involved in MVCs over a 24-month period and contacted them 2–4 years after the injury by telephone to administer a standardized survey. Potential determinants of seat-belt noncompliance were compared with the occurrence of an MVC by multiple logistic regression. Results Seat-belt noncompliance in 386 MVC patients was associated with drinking and driving, youth, speeding, male sex, being a passenger, smoking, secondary roads, rural residence, low level of education, overnight driving, having no dependents, licence demerit points, previous collisions, unemployment and short journeys. There was an increase in seat-belt awareness and a decrease in self-rated driving ability after the MVC. Conclusions Factors that indicate poor driving habits (alcohol, speeding, previous MVCs and driving offences) also predict seat-belt noncompliance. Injury prevention programs should selectively target these high-risk drivers to improve seat-belt compliance and limit associated injury and consumption of health care resources. PMID:16248134

Mechanisms and Mitigation of Head and Spinal Injuries Due to Motor Vehicle Crashes.

PubMed

Ivancic, Paul C

2016-10-01

Synopsis Head and spinal injuries commonly occur during motor vehicle crashes (MVCs). The goal of this clinical commentary is to discuss real-life versus simulated MVCs and to present clinical, biomechanical, and epidemiological evidence of MVC-related injury mechanisms. It will also address how this knowledge may guide and inform the design of injury mitigation devices and assist in clinical decision making. Evidence indicates that there exists no universal injury tolerance applicable to the entire population of the occupants of MVCs. Injuries sustained by occupants depend on a number of factors, including occupant characteristics (age, height, weight, sex, bone mineral density, and pre-existing medical and musculoskeletal conditions), pre-MVC factors (awareness of the impending crash, occupant position, usage of and position of the seatbelt and head restraint, and vehicle specifications), and MVC-related factors (crash orientation, vehicle dynamics, type of active or passive safety systems, and occupant kinematic response). Injuries resulting from an MVC occur due to blunt impact and/or inertial loading. An S-shaped curvature of the cervical spine and associated injurious strains have been documented during rear-, frontal-, and side-impact MVCs. Data on the injury mechanism and the quantification of spinal instability guide and inform the emergent and subsequent conservative or surgical care. Such care may require determining optimal patient positioning during transport, which injuries may be treated conservatively, whether reduction should be performed, optimal patient positioning intraoperatively, and whether bracing should be worn prior to and/or following surgery. The continued improvement of traditional injury mitigation systems, such as seats, seatbelts, airbags, and head restraints, together with research of newer collision-avoidance technologies, will lead to safer motor vehicles and ultimately more effective injury management strategies. J Orthop Sports Phys Ther 2016;46(10):826-833. Epub 3 Sep 2016. doi:10.2519/jospt.2016.6716.

Post-traumatic stress disorder associated with life-threatening motor vehicle collisions in the WHO World Mental Health Surveys.

PubMed

Stein, Dan J; Karam, Elie G; Shahly, Victoria; Hill, Eric D; King, Andrew; Petukhova, Maria; Atwoli, Lukoye; Bromet, Evelyn J; Florescu, Silvia; Haro, Josep Maria; Hinkov, Hristo; Karam, Aimee; Medina-Mora, María Elena; Navarro-Mateu, Fernando; Piazza, Marina; Shalev, Arieh; Torres, Yolanda; Zaslavsky, Alan M; Kessler, Ronald C

2016-07-22

Motor vehicle collisions (MVCs) are a substantial contributor to the global burden of disease and lead to subsequent post-traumatic stress disorder (PTSD). However, the relevant literature originates in only a few countries, and much remains unknown about MVC-related PTSD prevalence and predictors. Data come from the World Mental Health Survey Initiative, a coordinated series of community epidemiological surveys of mental disorders throughout the world. The subset of 13 surveys (5 in high income countries, 8 in middle or low income countries) with respondents reporting PTSD after life-threatening MVCs are considered here. Six classes of predictors were assessed: socio-demographics, characteristics of the MVC, childhood family adversities, MVCs, other traumatic experiences, and respondent history of prior mental disorders. Logistic regression was used to examine predictors of PTSD. Mental disorders were assessed with the fully-structured Composite International Diagnostic Interview using DSM-IV criteria. Prevalence of PTSD associated with MVCs perceived to be life-threatening was 2.5 % overall and did not vary significantly across countries. PTSD was significantly associated with low respondent education, someone dying in the MVC, the respondent or someone else being seriously injured, childhood family adversities, prior MVCs (but not other traumatic experiences), and number of prior anxiety disorders. The final model was significantly predictive of PTSD, with 32 % of all PTSD occurring among the 5 % of respondents classified by the model as having highest PTSD risk. Although PTSD is a relatively rare outcome of life-threatening MVCs, a substantial minority of PTSD cases occur among the relatively small proportion of people with highest predicted risk. This raises the question whether MVC-related PTSD could be reduced with preventive interventions targeted to high-risk survivors using models based on predictors assessed in the immediate aftermath of the MVCs.

Complexity and dynamics of HIV-1 chemokine receptor usage in a multidrug-resistant adolescent.

PubMed

Cavarelli, Mariangela; Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-12-01

Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options.

Complexity and Dynamics of HIV-1 Chemokine Receptor Usage in a Multidrug-Resistant Adolescent

PubMed Central

Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-01-01

Abstract Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options. PMID:25275490

Intra and inter-session reliability of rapid Transcranial Magnetic Stimulation stimulus-response curves of tibialis anterior muscle in healthy older adults.

PubMed

Peri, Elisabetta; Ambrosini, Emilia; Colombo, Vera Maria; van de Ruit, Mark; Grey, Michael J; Monticone, Marco; Ferriero, Giorgio; Pedrocchi, Alessandra; Ferrigno, Giancarlo; Ferrante, Simona

2017-01-01

The clinical use of Transcranial Magnetic Stimulation (TMS) as a technique to assess corticospinal excitability is limited by the time for data acquisition and the measurement variability. This study aimed at evaluating the reliability of Stimulus-Response (SR) curves acquired with a recently proposed rapid protocol on tibialis anterior muscle of healthy older adults. Twenty-four neurologically-intact adults (age:55-75 years) were recruited for this test-retest study. During each session, six SR curves, 3 at rest and 3 during isometric muscle contractions at 5% of maximum voluntary contraction (MVC), were acquired. Motor Evoked Potentials (MEPs) were normalized to the maximum peripherally evoked response; the coil position and orientation were monitored with an optical tracking system. Intra- and inter-session reliability of motor threshold (MT), area under the curve (AURC), MEPmax, stimulation intensity at which the MEP is mid-way between MEPmax and MEPmin (I50), slope in I50, MEP latency, and silent period (SP) were assessed in terms of Standard Error of Measurement (SEM), relative SEM, Minimum Detectable Change (MDC), and Intraclass Correlation Coefficient (ICC). The relative SEM was ≤10% for MT, I50, latency and SP both at rest and 5%MVC, while it ranged between 11% and 37% for AURC, MEPmax, and slope. MDC values were overall quite large; e.g., MT required a change of 12%MSO at rest and 10%MSO at 5%MVC to be considered a real change. Inter-sessions ICC were >0.6 for all measures but slope at rest and MEPmax and latency at 5%MVC. Measures derived from SR curves acquired in <4 minutes are affected by similar measurement errors to those found with long-lasting protocols, suggesting that the rapid method is at least as reliable as the traditional methods. As specifically designed to include older adults, this study provides normative data for future studies involving older neurological patients (e.g. stroke survivors).

Benefits of Compression Garments Worn During Handball-Specific Circuit on Short-Term Fatigue in Professional Players.

PubMed

Ravier, Gilles; Bouzigon, Romain; Beliard, Samuel; Tordi, Nicolas; Grappe, Frederic

2018-04-04

Ravier, G, Bouzigon, R, Beliard, S, Tordi, N, and Grappe, F. Benefits of compression garments worn during handball-specific circuit on short-term fatigue in professional players. J Strength Cond Res XX(X): 000-000, 2016-The purpose of this study was to investigate the benefits of full-leg length compression garments (CGs) worn during a handball-specific circuit exercises on athletic performance and acute fatigue-induced changes in strength and muscle soreness in professional handball players. Eighteen men (mean ± SD: age 23.22 ± 4.97 years; body mass: 82.06 ± 9.69 kg; height: 184.61 ± 4.78 cm) completed 2 identical sessions either wearing regular gym short or CGs in a randomized crossover design. Exercise circuits of explosive activities included 3 periods of 12 minutes of sprints, jumps, and agility drills every 25 seconds. Before, immediately after and 24 hours postexercise, maximal voluntary knee extension (maximal voluntary contraction, MVC), rate of force development (RFD), and muscle soreness were assessed. During the handball-specific circuit sprint and jump performances were unchanged in both conditions. Immediately after performing the circuit exercises MVC, RFD, and PPT decreased significantly compared with preexercise with CGs and noncompression clothes. Decrement was similar in both conditions for RFD (effect size, ES = 0.40) and PPT for the soleus (ES = 0.86). However, wearing CGs attenuated decrement in MVC (p < 0.001) with a smaller decrease (ES = 1.53) in CGs compared with regular gym shorts condition (-5.4 vs. -18.7%, respectively). Full recovery was observed 24 hours postexercise in both conditions for muscle soreness, MVC, and RFD. These findings suggest that wearing CGs during a handball-specific circuit provides benefits on the impairment of the maximal muscle force characteristics and is likely to be worthwhile for handball players involved in activities such as tackles.

Central activation, metabolites, and calcium handling during fatigue with repeated maximal isometric contractions in human muscle.

PubMed

Cairns, Simeon P; Inman, Luke A G; MacManus, Caroline P; van de Port, Ingrid G L; Ruell, Patricia A; Thom, Jeanette M; Thompson, Martin W

2017-08-01

To determine the roles of calcium (Ca 2+ ) handling by sarcoplasmic reticulum (SR) and central activation impairment (i.e., central fatigue) during fatigue with repeated maximal voluntary isometric contractions (MVC) in human muscles. Contractile performance was assessed during 3 min of repeated MVCs (7-s contraction, 3-s rest, n = 17). In ten participants, in vitro SR Ca 2+ -handling, metabolites, and fibre-type composition were quantified in biopsy samples from quadriceps muscle, along with plasma venous [K + ]. In 11 participants, central fatigue was compared using tetanic stimulation superimposed on MVC in quadriceps and adductor pollicis muscles. The decline of peak MVC force with fatigue was similar for both muscles. Fatigue resistance correlated directly with % type I fibre area in quadriceps (r = 0.77, P = 0.009). The maximal rate of ryanodine-induced Ca 2+ -release and Ca 2+ -uptake fell by 31 ± 26 and 28 ± 13%, respectively. The tetanic force depression was correlated with the combined reduction of ATP and PCr, and increase of lactate (r = 0.77, P = 0.009). Plasma venous [K + ] increased from 4.0 ± 0.3 to 5.4 ± 0.8 mM over 1-3-min exercise. Central fatigue occurred during the early contractions in the quadriceps in 7 out of 17 participants (central activation ratio fell from 0.98 ± 0.05 to 0.86 ± 0.11 at 1 min), but dwindled at exercise cessation. Central fatigue was seldom apparent in adductor pollicis. Fatigue with repeated MVC in human limb muscles mainly involves peripheral aspects which include impaired SR Ca 2+ -handling and we speculate that anaerobic metabolite changes are involved. A faster early force loss in quadriceps muscle with some participants is attributed to central fatigue.

The impact of serum lipids on risk for microangiopathy in patients with type 2 diabetes mellitus.

PubMed

Toth, Peter P; Simko, Robert J; Palli, Swetha Rao; Koselleck, Dawn; Quimbo, Ralph A; Cziraky, Mark J

2012-09-14

Few large-scale, real-world studies have assessed the relative associations of lipid fractions with diabetic microvascular events. The main objective of this study was to evaluate the association of the lipid profile components, high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), triglycerides (TG), and non-high density lipoprotein cholesterol (non-HDL-C) with microvascular complications (MVCs) in type 2 diabetes mellitus (T2DM) patients. This observational cohort study queried the HealthCore Integrated Research Database (HIRDSM) for newly-diagnosed (Index Date) 18-64-year-old patients with diabetes mellitus between 01/01/2005-06/30/2010. Inclusion required ≥ 12 months pre-index continuous health plan eligibility and ≥ 1 pre-index lipid profile result. Patients with polycystic ovary syndrome and prior MVCs were excluded. Incident complications were defined as the earliest occurrence of diabetic retinopathy, peripheral neuropathy, and/or nephropathy post-index. Cox proportional models and Kaplan-Meier (KM) curves were used to evaluate associations among variables. Of the patients (N=72,267), 50.05% achieved HDL-C, 64.28% LDL-C, 59.82% TG, and 56.79% non-HDL-C American Diabetes Association goals at baseline. During follow-up (mean, 21.74 months), there were 5.21 microvascular events per 1,000 patient-months. A 1-mg/dL increase in HDL-C was associated with 1% decrease in any MVC risk (P< .0001), but for LDL-C, TG, and non-HDL-C, 1-mg/dL increase resulted in increases of 0.2% (P< .0001), 0.1% (P<0.001) and 0.3% (P<0.001) in MVC risk. Patients achieving HDL-C goals had a 11% lower risk of MVC versus non-achievers (RR 0.895, [95% CI, 0.852-0.941], P< .0001). Similarly, TG goal attainment was associated with a lowered risk for any MVC (RR 0.849, [95% CI, 0.808-0.892], P< .0001). Evaluation of KM survival curves demonstrated no significant difference in the risk of MVCs between patients achieving vs. not achieving LDL-C goals, but did demonstrate a difference in MVC risk between patients achieving vs. not achieving non-HDL-C goals. This study demonstrates significant independent associations among lipid fractions and risk for microangiopathy. These findings suggest that attaining established ADA goals for HDL-C, TG, and non-HDL-C may reduce risk for microvascular events among patients with diabetes.

Coactivation of the elbow antagonist muscles is not affected by the speed of movement in isokinetic exercise.

PubMed

Bazzucchi, Ilenia; Sbriccoli, Paola; Marzattinocci, Giulia; Felici, Francesco

2006-02-01

Since muscle coactivation increases the stiffness and stability of a joint, greater coactivation is likely during faster than slower movements. Very few studies, though, have been conducted to verify this hypothesis. Moreover, a large number of studies have examined coactivation of muscles surrounding the knee joint whereas there are few reports on the elbow joint. The aim of this study was therefore to compare the antagonist activation of the elbow flexors and extensors during isokinetic concentric exercises and to investigate the influence of angular velocity on their activation. Twelve men participated in the study. The surface electromyographic signals (sEMG) were recorded from the biceps brachii (BB) and triceps brachii (TB) muscles during three maximal voluntary isometric contractions (MVC) of elbow flexors and extensors and a set of three maximal elbow flexions and extensions each at 15 degrees, 30 degrees , 60 degrees, 120 degrees, 180 degrees, and 240 degrees.s(-1). Normalized root mean square (RMS) of sEMG was calculated during the isokinetic phase of movement as an index of sEMG amplitude. During elbow flexion, the antagonist activation of BB averaged 16.2% lower than TB, and this difference was statistically significant at all angular velocities. The normalized RMS values ranged from 26.0% +/- 19.0 at MVC to 37.8% +/- 13.9 at 240 degrees.s(-1) for antagonist TB activation, and from 5.7% +/- 5.2 at MVC to 18.9% +/- 8.6 at 240 degrees.s(-1) for antagonist BB activation. No influence of angular velocity on agonist and antagonist activity was found. Moreover, flexion and extension torques were both strongly affected by the amount of antagonist activation. The functional specialization of the two muscle groups could be responsible for the different levels of antagonist activation. The frequent use of BB, which is not assisted by gravity during daily activities, could lead to reduced coactivation due to a better functioning of the control system based upon reciprocal innervation. These findings may have significant implications in the design of rehabilitation programs directed to the elbow joint.

Phototherapy in skeletal muscle performance and recovery after exercise: effect of combination of super-pulsed laser and light-emitting diodes.

PubMed

Antonialli, Fernanda Colella; De Marchi, Thiago; Tomazoni, Shaiane Silva; Vanin, Adriane Aver; dos Santos Grandinetti, Vanessa; de Paiva, Paulo Roberto Vicente; Pinto, Henrique Dantas; Miranda, Eduardo Foschini; de Tarso Camillo de Carvalho, Paulo; Leal-Junior, Ernesto Cesar Pinto

2014-11-01

Recent studies with phototherapy have shown positive results in enhancement of performance and improvement of recovery when applied before exercise. However, several factors still remain unknown such as therapeutic windows, optimal treatment parameters, and effects of combination of different light sources (laser and LEDs). The aim of this study was to evaluate the effects of phototherapy with the combination of different light sources on skeletal muscle performance and post-exercise recovery, and to establish the optimal energy dose. A randomized, double-blinded, placebo-controlled trial with participation of 40 male healthy untrained volunteers was performed. A single phototherapy intervention was performed immediately after pre-exercise (baseline) maximum voluntary contraction (MVC) with a cluster of 12 diodes (4 of 905 nm lasers-0.3125 mW each, 4 of 875 nm LEDs-17.5 mW each, and 4 of 670 nm LEDs-15 mW each- manufactured by Multi Radiance Medical™) and dose of 10, 30, and 50 J or placebo in six sites of quadriceps. MVC, delayed onset muscle soreness (DOMS), and creatine kinase (CK) activity were analyzed. Assessments were performed before, 1 min, 1, 24, 48, 72, and 96 h after eccentric exercise protocol employed to induce fatigue. Phototherapy increased (p < 0.05) MVC was compared to placebo from immediately after to 96 h after exercise with 10 or 30 J doses (better results with 30 J dose). DOMS was significantly decreased compared to placebo (p < 0.05) with 30 J dose from 24 to 96 h after exercise, and with 50 J dose from immediately after to 96 h after exercise. CK activity was significantly decreased (p < 0.05) compared to placebo with all phototherapy doses from 1 to 96 h after exercise (except for 50 J dose at 96 h). Pre-exercise phototherapy with combination of low-level laser and LEDs, mainly with 30 J dose, significantly increases performance, decreases DOMS, and improves biochemical marker related to skeletal muscle damage.

Motor Variability during Sustained Contractions Increases with Cognitive Demand in Older Adults

PubMed Central

Vanden Noven, Marnie L.; Pereira, Hugo M.; Yoon, Tejin; Stevens, Alyssa A.; Nielson, Kristy A.; Hunter, Sandra K.

2014-01-01

To expose cortical involvement in age-related changes in motor performance, we compared steadiness (force fluctuations) and fatigability of submaximal isometric contractions with the ankle dorsiflexor muscles in older and young adults and with varying levels of cognitive demand imposed. Sixteen young (20.4 ± 2.1 year: 8 men, 9 women) and 17 older adults (68.8 ± 4.4 years: 9 men, 8 women) attended three sessions and performed a 40 s isometric contraction at 5% maximal voluntary contraction (MVC) force followed by an isometric contraction at 30% MVC until task failure. The cognitive demand required during the submaximal contractions in each session differed as follows: (1) high-cognitive demand session where difficult mental math was imposed (counting backward by 13 from a 4-digit number); (2) low-cognitive demand session which involved simple mental math (counting backward by 1); and (3) control session with no mental math. Anxiety was elevated during the high-cognitive demand session compared with other sessions for both age groups but more so for the older adults than young adults (p  < 0.05). Older adults had larger force fluctuations than young adults during: (1) the 5% MVC task as cognitive demand increased (p  = 0.007), and (2) the fatiguing contraction for all sessions (p  = 0.002). Time to task failure did not differ between sessions or age groups (p  > 0.05), but the variability between sessions (standard deviation of three sessions) was greater for older adults than young (2.02 ± 1.05 vs. 1.25 ± 0.51 min, p  < 0.05). Thus, variability in lower limb motor performance for low- and moderate-force isometric tasks increased with age and was exacerbated when cognitive demand was imposed, and may be related to modulation of synergist and antagonist muscles and an altered neural strategy with age originating from central sources. These data have significant implications for cognitively demanding low-force motor tasks that are relevant to functional and ergonomic in an aging workforce. PMID:24904410

A Web application for the management of clinical workflow in image‐guided and adaptive proton therapy for prostate cancer treatments

PubMed Central

Boes, Peter; Ho, Meng Wei; Li, Zuofeng

2015-01-01

Image‐guided radiotherapy (IGRT), based on radiopaque markers placed in the prostate gland, was used for proton therapy of prostate patients. Orthogonal X‐rays and the IBA Digital Image Positioning System (DIPS) were used for setup correction prior to treatment and were repeated after treatment delivery. Following a rationale for margin estimates similar to that of van Herk,(1) the daily post‐treatment DIPS data were analyzed to determine if an adaptive radiotherapy plan was necessary. A Web application using ASP.NET MVC5, Entity Framework, and an SQL database was designed to automate this process. The designed features included state‐of‐the‐art Web technologies, a domain model closely matching the workflow, a database‐supporting concurrency and data mining, access to the DIPS database, secured user access and roles management, and graphing and analysis tools. The Model‐View‐Controller (MVC) paradigm allowed clean domain logic, unit testing, and extensibility. Client‐side technologies, such as jQuery, jQuery Plug‐ins, and Ajax, were adopted to achieve a rich user environment and fast response. Data models included patients, staff, treatment fields and records, correction vectors, DIPS images, and association logics. Data entry, analysis, workflow logics, and notifications were implemented. The system effectively modeled the clinical workflow and IGRT process. PACS number: 87 PMID:26103504

Rapid Quantification of Melamine in Different Brands/Types of Milk Powders Using Standard Addition Net Analyte Signal and Near-Infrared Spectroscopy

PubMed Central

2016-01-01

Multivariate calibration (MVC) and near-infrared (NIR) spectroscopy have demonstrated potential for rapid analysis of melamine in various dairy products. However, the practical application of ordinary MVC can be largely restricted because the prediction of a new sample from an uncalibrated batch would be subject to a significant bias due to matrix effect. In this study, the feasibility of using NIR spectroscopy and the standard addition (SA) net analyte signal (NAS) method (SANAS) for rapid quantification of melamine in different brands/types of milk powders was investigated. In SANAS, the NAS vector of melamine in an unknown sample as well as in a series of samples added with melamine standards was calculated and then the Euclidean norms of series standards were used to build a straightforward univariate regression model. The analysis results of 10 different brands/types of milk powders with melamine levels 0~0.12% (w/w) indicate that SANAS obtained accurate results with the root mean squared error of prediction (RMSEP) values ranging from 0.0012 to 0.0029. An additional advantage of NAS is to visualize and control the possible unwanted variations during standard addition. The proposed method will provide a practically useful tool for rapid and nondestructive quantification of melamine in different brands/types of milk powders. PMID:27525154

Ankle plantarflexion strength in rearfoot and forefoot runners: a novel clusteranalytic approach.

PubMed

Liebl, Dominik; Willwacher, Steffen; Hamill, Joseph; Brüggemann, Gert-Peter

2014-06-01

The purpose of the present study was to test for differences in ankle plantarflexion strengths of habitually rearfoot and forefoot runners. In order to approach this issue, we revisit the problem of classifying different footfall patterns in human runners. A dataset of 119 subjects running shod and barefoot (speed 3.5m/s) was analyzed. The footfall patterns were clustered by a novel statistical approach, which is motivated by advances in the statistical literature on functional data analysis. We explain the novel statistical approach in detail and compare it to the classically used strike index of Cavanagh and Lafortune (1980). The two groups found by the new cluster approach are well interpretable as a forefoot and a rearfoot footfall groups. The subsequent comparison study of the clustered subjects reveals that runners with a forefoot footfall pattern are capable of producing significantly higher joint moments in a maximum voluntary contraction (MVC) of their ankle plantarflexor muscles tendon units; difference in means: 0.28Nm/kg. This effect remains significant after controlling for an additional gender effect and for differences in training levels. Our analysis confirms the hypothesis that forefoot runners have a higher mean MVC plantarflexion strength than rearfoot runners. Furthermore, we demonstrate that our proposed stochastic cluster analysis provides a robust and useful framework for clustering foot strikes. Copyright © 2014 Elsevier B.V. All rights reserved.

Fatigue and Muscle Strength Involving Walking Speed in Parkinson's Disease: Insights for Developing Rehabilitation Strategy for PD.

PubMed

Huang, Ying-Zu; Chang, Fang-Yu; Liu, Wei-Chia; Chuang, Yu-Fen; Chuang, Li-Ling; Chang, Ya-Ju

2017-01-01

Background . Problems with gait in Parkinson's disease (PD) are a challenge in neurorehabilitation, partly because the mechanisms causing the walking disability are unclear. Weakness and fatigue, which may significantly influence gait, are commonly reported by patients with PD. Hence, the aim of this study was to investigate the association between weakness and fatigue and walking ability in patients with PD. Methods . We recruited 25 patients with idiopathic PD and 25 age-matched healthy adults. The maximum voluntary contraction (MVC), twitch force, and voluntary activation levels were measured before and after a knee fatigue exercise. General fatigue, central fatigue, and peripheral fatigue were quantified by exercise-induced changes in MVC, twitch force, and activation level. In addition, subjective fatigue was measured using the Multidimensional Fatigue Inventory (MFI) and Fatigue Severity Scale (FSS). Results . The patients with PD had lower activation levels, more central fatigue, and more subjective fatigue than the healthy controls. There were no significant differences in twitch force or peripheral fatigue index between the two groups. The reduction in walking speed was related to the loss of peripheral strength and PD itself. Conclusion . Fatigue and weakness of central origin were related to PD, while peripheral strength was important for walking ability. The results suggest that rehabilitation programs for PD should focus on improving both central and peripheral components of force.

Surface electromyographic patterns of masticatory, neck, and trunk muscles in temporomandibular joint dysfunction patients undergoing anterior repositioning splint therapy.

PubMed

Tecco, Simona; Tetè, Stefano; D'Attilio, Michele; Perillo, Letizia; Festa, Felice

2008-12-01

The aim of this study was to investigate the surface electromyographic (sEMG) activity of neck, trunk, and masticatory muscles in subjects with temporomandibular joint (TMJ) internal derangement treated with anterior mandibular repositioning splints. sEMG activities of the muscles in 34 adult subjects (22 females and 12 males; mean age 30.4 years) with TMJ internal derangement were compared with a control group of 34 untreated adults (20 females and 14 males; mean age 31.8 years). sEMG activities of seven muscles (anterior and posterior temporalis, masseter, posterior cervicals, sternocleidomastoid, and upper and lower trapezius) were studied bilaterally, with the mandible in the rest position and during maximal voluntary clenching (MVC), at the beginning of therapy (T0) and after 10 weeks of treatment (T1). Paired and Student's t-tests were undertaken to determine differences between the T0 and T1 data and in sEMG activity between the study and control groups. At T0, paired masseter, sternocleidomastoid, and cervical muscles, in addition to the left anterior temporal and right lower trapezius, showed significantly greater sEMG activity (P = 0.0001; P = 0.0001; for left cervical, P = 0.03; for right cervical, P = 0.0001; P = 0.006 and P = 0.007 muscles, respectively) compared with the control group. This decreased over the remaining study period, such that after treatment, sEMG activity revealed no statistically significant difference when compared with the control group. During MVC at T0, paired masseter and anterior and posterior temporalis muscles showed significantly lower sEMG activity (P = 0.03; P = 0.005 and P = 0.04, respectively) compared with the control group. In contrast, at T1 sEMG activity significantly increased (P = 0.02; P = 0.004 and P = 0.04, respectively), but no difference was observed in relation to the control group. Splint therapy in subjects with internal disk derangement seems to affect sEMG activity of the masticatory, neck, and trunk muscles.

Training through gametherapy promotes coactivation of the pelvic floor and abdominal muscles in young women, nulliparous and continents

PubMed Central

Silva, Valeria Regina; Riccetto, Cássio; Martinho, Natalia Miguel; Marques, Joseane; Carvalho, Leonardo Cesar; Botelho, Simone

2016-01-01

ABSTRACT Introduction and objectives: Several studies have been investigated co-activation can enhance the effectveness of PFM training protocols allowing preventive and therapeutic goals in pelvic floor dysfunctions. The objective of the present study was to investigate if an abdominal-pelvic protocol of training (APT) using gametherapy would allow co-activation of PFM and transversus abdominis/oblique internal (TrA/OI) muscles. Patients and methods: Twenty-five nulliparous, continent, young females, with median age 24.76 (±3.76) years were evaluated using digital palpation (DP) of PFM and surface electromyography of PFM and TrA/OI simultaneously, during maximal voluntary contraction (MVC), alternating PFM and TrA/OI contraction requests. All women participated on a supervised program of APT using gametherapy, that included exercises of pelvic mobilization associated to contraction of TrA/OI muscles oriented by virtual games, for 30 minutes, three times a week, in a total of 10 sessions. Electromyographic data were processed and analyzed by ANOVA - analysis of variance. Results: When MVC of TrA/OI was solicited, it was observed simultaneous increase of electromyographic activity of PFM (p=0.001) following ATP. However, EMG activity did not change significantly during MVC of PFM. Conclusion: Training using gametherapy allowed better co-activation of pelvic floor muscles in response to contraction of TrA, in young nulliparous and continent women. PMID:27564290

Acute fatigue impairs neuromuscular activity of anterior cruciate ligament-agonist muscles in female team handball players.

PubMed

Zebis, M K; Bencke, J; Andersen, L L; Alkjaer, T; Suetta, C; Mortensen, P; Kjaer, M; Aagaard, P

2011-12-01

In sports, like team handball, fatigue has been associated with an increased risk of anterior cruciate ligament (ACL) injury. While effects of fatigue on muscle function are commonly assessed during maximal isometric voluntary contraction (MVC), such measurements may not relate to the muscle function during match play. The purpose of this study was to investigate the effect of muscle fatigue induced by a simulated handball match on neuromuscular strategy during a functional sidecutting movement, associated with the incidence of ACL injury. Fourteen female team handball players were tested for neuromuscular activity [electromyography (EMG)] during a sidecutting maneuver on a force plate, pre and post a simulated handball match. MVC was obtained during maximal isometric quadriceps and hamstring contraction. The simulated handball match consisted of exercises mimicking handball match activity. Whereas the simulated handball match induced a decrease in MVC strength for both the quadriceps and hamstring muscles (P<0.05), a selective decrease in hamstring neuromuscular activity was seen during sidecutting (P<0.05). This study shows impaired ACL-agonist muscle (i.e. hamstring) activity during sidecutting in response to acute fatigue induced by handball match play. Thus, screening procedures should involve functional movements to reveal specific fatigue-induced deficits in ACL-agonist muscle activation during high-risk phases of match play. © 2010 John Wiley & Sons A/S.

Glucocorticoid Receptor (NR3C1) Variants Associate with the Muscle Strength and Size Response to Resistance Training.

PubMed

Ash, Garrett I; Kostek, Matthew A; Lee, Harold; Angelopoulos, Theodore J; Clarkson, Priscilla M; Gordon, Paul M; Moyna, Niall M; Visich, Paul S; Zoeller, Robert F; Price, Thomas B; Devaney, Joseph M; Gordish-Dressman, Heather; Thompson, Paul D; Hoffman, Eric P; Pescatello, Linda S

2016-01-01

Glucocorticoid receptor (NR3C1) polymorphisms associate with obesity, muscle strength, and cortisol sensitivity. We examined associations among four NR3C1 polymorphisms and the muscle response to resistance training (RT). European-American adults (n = 602, 23.8±0.4yr) completed a 12 week unilateral arm RT program. Maximum voluntary contraction (MVC) assessed isometric strength (kg) and MRI assessed biceps size (cm2) pre- and post-resistance training. Subjects were genotyped for NR3C1 -2722G>A, -1887G>A, -1017T>C, and +363A>G. Men carrying the -2722G allele gained less relative MVC (17.3±1.2vs33.5±6.1%) (p = 0.010) than AA homozygotes; men with -1887GG gained greater relative MVC than A allele carriers (19.6±1.4vs13.2±2.3%) (p = 0.016). Women carrying the -1017T allele gained greater relative size (18.7±0.5vs16.1±0.9%) (p = 0.016) than CC homozygotes. We found sex-specific NR3C1 associations with the muscle strength and size response to RT. Future studies should investigate whether these associations are partially explained by cortisol's actions in muscle tissue as they interact with sex differences in cortisol production.

Hormonal Responses to Active and Passive Recovery After Load Carriage.

PubMed

Taipale, Ritva S; Heinaru, Siiri; Nindl, Bradley C; Vaara, Jani P; Santtila, Matti; Häkkinen, Keijo; Kyröläinen, Heikki

2015-11-01

Military operations often induce fatigue resulting from load carriage. Recovery promotes military readiness. This study investigated the acute effects of AR vs. PR after load carriage on maximal isometric leg extension force (MVC) and serum hormonal concentrations. Male reservists (27 ± 3 years, 180 ± 7 cm, 74 ± 11 kg, V[Combining Dot Above]O2max 64 ± 9 ml·kg⁻¹·min⁻¹) completed PR (n = 8) or AR (n = 8) after 50 minutes of loaded (16 kg) uphill (gradient 4.0%) treadmill marching at individual anaerobic threshold. No differences were observed between groups in relative changes in MVC during the marching loading, after AR or PR or the next morning. Significant differences in relative responses to AR and PR postmarching loading were observed in serum testosterone (T), cortisol, and sex-hormone binding globulin immediately post AR and PR; however the next morning, all serum hormone concentrations had returned to normal. This study did not reveal any significant differences between the effects of AR and PR after an hour-long marching protocol at approximately anaerobic threshold on MVC or serum hormones the morning after the experimental marching protocol. Thus, based on the variable measured in this study, marching performed by physically fit army reservists at an intensity at or below anaerobic threshold may not necessitate specialized recovery protocols.

Selective fatigue of fast motor units after electrically elicited muscle contractions.

PubMed

Hamada, Taku; Kimura, Tetsuya; Moritani, Toshio

2004-10-01

The aim of the present study was to elucidate the electrophysiological manifestations of selective fast motor unit (MU) activation by electrical stimulation (ES) of knee extensor muscles. In six male subjects, test contraction measurement at 40% maximal voluntary contraction (MVC) was performed before and at every 5 min (5, 10, 15 and 20 min) during 20-min low intensity intermittent exercise of either ES or voluntary contractions (VC) at 10% MVC (5-s isometric contraction and 5-s rest cycles). Both isolated intramuscular MU spikes obtained from three sets of bipolar fine-wire electrodes and surface electromyogram (EMG) were simultaneously recorded and were analyzed by means of a computer-aided intramuscular spike amplitude-frequency analysis and frequency power spectral analysis, respectively. Results indicated that mean MU spike amplitude, particularly those MUs with relatively large amplitude, was significantly reduced while those MUs with small spike amplitude increased their firing rate during the 40% MVC test contraction after the ES. This was accompanied by the increased amplitude of surface EMG (rmsEMG). However, no such significant changes in the intramuscular and surface EMGs were observed after VC. These findings indicated differential MU activation patterns in terms of MU recruitment and rate coding characteristics during ES and VC, respectively. Our data strongly suggest the possibility of "an inverse size principle" of MU recruitment during ES.

Training through gametherapy promotes coactivation of the pelvic floor and abdominal muscles in young women, nulliparous and continents.

PubMed

Silva, Valeria Regina; Riccetto, Cássio Luis Zanettini; Martinho, Natalia Miguel; Marques, Joseane; Carvalho, Leonardo Cesar; Botelho, Simone

2016-01-01

several studies have been investigated co-activation can enhance the effectveness of PFM training protocols allowing preventive and therapeutic goals in pelvic floor dysfunctions. The objective of the present study was to investigate if an abdominal-pelvic protocol of training (APT) using gametherapy would allow co-activation of PFM and transversus abdominis/oblique internal (TrA/OI) muscles. Twenty-five nulliparous, continent, young females, with median age 24.76 (±3.76) years were evaluated using digital palpation (DP) of PFM and surfasse electromyography of PFM and TrA/OI simultaneously, during maximal voluntary contraction (MVC), alternating PFM and TrA/OI contraction requests. All women participated on a supervised program of APT using gametherapy, that included exercises of pelvic mobilization associated to contraction of TrA/OI muscles oriented by virtual games, for 30 minutes, three times a week, in a total of 10 sessions. Electromyographic data were processed and analyzed by ANOVA - analysis of variance. When MVC of TrA/OI was solicited, it was observed simultaneous increase of electromyographic activity of PFM (p=0.001) following ATP. However, EMG activity did not change significantly during MVC of PFM. Training using gametherapy allowed better co-activation of pelvic floor muscles in response to contraction of TrA, in young nulliparous and continent women. Copyright© by the International Brazilian Journal of Urology.

Quantifying the history dependency of muscle recovery from a fatiguing intermittent task.

PubMed

Rashedi, Ehsan; Nussbaum, Maury A

2017-01-25

Muscle fatigue and recovery are complex processes influencing muscle force generation capacity. While fatigue reduces this capacity, recovery acts to restore the unfatigued muscle state. Many factors can potentially affect muscle recovery, and among these may be a task dependency of recovery following an exercise. However, little has been reported regarding the history dependency of recovery after fatiguing contractions. We examined the dependency of muscle recovery subsequent to four different histories of fatiguing muscle contractions, imposed using two cycle times (30 and 60s) during low to moderate levels (15% and 25% of maximum voluntary contraction (MVC)) of intermittent static exertions involving index finger abduction. MVC and low-frequency electrical stimulation (LFES) measures (i.e., magnitude, rise and relaxation rates) of muscle capacity were used, all of which indicated a dependency of muscle recovery on the muscle capacity state existing immediately after fatiguing exercise. This dependency did not appear to be modified by either the cycle time or exertion level leading to that state. These results imply that the post-exercise rate of recovery is primarily influenced by the immediate post-exercise muscle contractile status (estimated by MVC and LFES measures). Such results may help improve existing models of muscle recovery, facilitating more accurate predictions of localized muscle fatigue development and thereby helping to enhance muscle performance and reduce the risk of injury. Copyright © 2016 Elsevier Ltd. All rights reserved.

The importance of cutaneous feedback on neural activation during maximal voluntary contraction.

PubMed

Cruz-Montecinos, Carlos; Maas, Huub; Pellegrin-Friedmann, Carla; Tapia, Claudio

2017-12-01

The purpose of this study was to investigate the importance of cutaneous feedback on neural activation during maximal voluntary contraction (MVC) of the ankle plantar flexors. The effects of cutaneous plantar anaesthesia were assessed in 15 subjects and compared to 15 controls, using a one-day pre/post-repeated measures design. Cutaneous plantar anaesthesia was induced by lidocaine injection at the centre of forefoot, lateral midfoot, and heel. Each subject performed isometric MVCs of the ankle plantar flexors. During each isometric ramp contraction, the following variables were assessed: maximal isometric torque; surface electromyography (EMG) activity of the medial gastrocnemius (MG) and tibialis anterior (TA) muscles; and co-contraction index (CCI) between the MG and TA. For ankle torque, two-way ANOVA showed no significant interaction between the pre/post-measurements × group (p = 0.166). However, MG activity presented significant interactions between the pre/post-measurements × group (p = 0.014). Post hoc comparisons indicated a decrease of MG activity in the experimental group, from 85.9 ± 11.9 to 62.7 ± 30.8% (p = 0.016). Additionally, the post-anaesthesia MG activity of the experimental group differed statistically with pre- and post-MG activity of the control group (p = 0.027 and p = 0.008, respectively). For TA activity and CCI, two-way ANOVA detected no significant interactions between the pre/post-measurements × group (p = 0.605 and p = 0.332, respectively). Our results indicate that during MVC, cutaneous feedback modulates neural activity to MG muscle, without changing the extent of MG-TA co-contraction.

Investigating the Effects of Typical Rowing Strength Training Practices on Strength and Power Development and 2,000 m Rowing Performance

PubMed Central

Caplan, Nicholas; Christian Gibbon, Karl; Howatson, Glyn; Grant Thompson, Kevin

2016-01-01

Abstract This study aimed to determine the effects of a short-term, strength training intervention, typically undertaken by club-standard rowers, on 2,000 m rowing performance and strength and power development. Twenty-eight male rowers were randomly assigned to intervention or control groups. All participants performed baseline testing involving assessments of muscle soreness, creatine kinase activity (CK), maximal voluntary contraction (leg-extensors) (MVC), static-squat jumps (SSJ), counter-movement jumps (CMJ), maximal rowing power strokes (PS) and a 2,000 m rowing ergometer time-trial (2,000 m) with accompanying respiratory-exchange and electromyography (EMG) analysis. Intervention group participants subsequently performed three identical strength training (ST) sessions, in the space of five days, repeating all assessments 24 h following the final ST. The control group completed the same testing procedure but with no ST. Following ST, the intervention group experienced significant elevations in soreness and CK activity, and decrements in MVC, SSJ, CMJ and PS (p < 0.01). However, 2,000 m rowing performance, pacing strategy and gas exchange were unchanged across trials in either condition. Following ST, significant increases occurred for EMG (p < 0.05), and there were non-significant trends for decreased blood lactate and anaerobic energy liberation (p = 0.063 – 0.086). In summary, club-standard rowers, following an intensive period of strength training, maintained their 2,000 m rowing performance despite suffering symptoms of muscle damage and disruption to muscle function. This disruption likely reflected the presence of acute residual fatigue, potentially in type II muscle fibres as strength and power development were affected. PMID:28149354

Effects of low-level laser therapy applied before or after plyometric exercise on muscle damage markers: randomized, double-blind, placebo-controlled trial.

PubMed

Fritsch, Carolina Gassen; Dornelles, Maurício Pinto; Severo-Silveira, Lucas; Marques, Vanessa Bernardes; Rosso, Isabele de Albuquerque; Baroni, Bruno Manfredini

2016-12-01

Promising effects of phototherapy on markers of exercise-induced muscle damage has been already demonstrated in constant load or isokinetic protocols. However, its effects on more functional situations, such as plyometric exercises, and when is the best moment to apply this treatment (pre- or post-exercise) remain unclear. Therefore, the purpose of this study was to investigate the effect of low-level laser therapy (LLLT) before or after plyometric exercise on quadriceps muscle damage markers. A randomized, double-blinded, placebo-controlled trial was conducted with 24 healthy men, 12 at pre-exercise treatment group and 12 at post-exercise treatment group. Placebo and LLLT (810 nm, 200 mW per diode, 6 J per diode, 240 J per leg) were randomly applied on right/left knee extensor muscles of each volunteer before/after a plyometric exercise protocol. Muscular echo intensity (ultrasonography images), soreness (visual analogue scale - VAS), and strength impairment (maximal voluntary contraction - MVC) were assessed at baseline, 24, 48, and 72 h post-exercise. Legs treated with LLLT before or after exercise presented significantly smaller increments of echo intensity (values up to 1 %) compared to placebo treatments (increased up to ∼7 %). No significant treatment effect was found for VAS and MVC, although a trend toward better results on LLLT legs have been found for VAS (mean values up to 30 % lesser than placebo leg). In conclusion, LLLT applied before or after plyometric exercise reduces the muscle echo intensity response and possibly attenuates the muscle soreness. However, these positive results were not observed on strength impairment.

Hormonal and neuromuscular responses to mechanical vibration applied to upper extremity muscles.

PubMed

Di Giminiani, Riccardo; Fabiani, Leila; Baldini, Giuliano; Cardelli, Giovanni; Giovannelli, Aldo; Tihanyi, Jozsef

2014-01-01

To investigate the acute residual hormonal and neuromuscular responses exhibited following a single session of mechanical vibration applied to the upper extremities among different acceleration loads. Thirty male students were randomly assigned to a high vibration group (HVG), a low vibration group (LVG), or a control group (CG). A randomized double-blind, controlled-parallel study design was employed. The measurements and interventions were performed at the Laboratory of Biomechanics of the University of L'Aquila. The HVG and LVG participants were exposed to a series of 20 trials ×10 s of synchronous whole-body vibration (WBV) with a 10-s pause between each trial and a 4-min pause after the first 10 trials. The CG participants assumed an isometric push-up position without WBV. The outcome measures were growth hormone (GH), testosterone, maximal voluntary isometric contraction during bench-press, maximal voluntary isometric contraction during handgrip, and electromyography root-mean-square (EMGrms) muscle activity (pectoralis major [PM], triceps brachii [TB], anterior deltoid [DE], and flexor carpi radialis [FCR]). The GH increased significantly over time only in the HVG (P = 0.003). Additionally, the testosterone levels changed significantly over time in the LVG (P = 0.011) and the HVG (P = 0.001). MVC during bench press decreased significantly in the LVG (P = 0.001) and the HVG (P = 0.002). In the HVG, the EMGrms decreased significantly in the TB (P = 0.006) muscle. In the LVG, the EMGrms decreased significantly in the DE (P = 0.009) and FCR (P = 0.006) muscles. Synchronous WBV acutely increased GH and testosterone serum concentrations and decreased the MVC and their respective maximal EMGrms activities, which indicated a possible central fatigue effect. Interestingly, only the GH response was dependent on the acceleration with respect to the subjects' responsiveness.

Relationships Between 3-Dimensional Transperineal Ultrasound Imaging and Digital Intravaginal Palpation Assessments of the Pelvic Floor Muscles in Women With and Without Provoked Vestibulodynia.

PubMed

Thibault-Gagnon, Stéphanie; Goldfinger, Corrie; Pukall, Caroline; Chamberlain, Susan; McLean, Linda

2018-03-01

Digital intravaginal palpation remains the favored method for clinical assessment of pelvic floor muscle (PFM) function in women; however, there is growing interest in using transperineal ultrasound imaging (TPUSI). TPUSI does not involve vaginal penetration, making it particularly relevant for PFM assessment in women with genito-pelvic pain and penetration disorders. To study the relations between measures of PFM morphology and function assessed using 3-dimensional (3D) TPUSI and PFM assessment through intravaginal palpation. 77 nulliparous premenopausal women with (n = 38) and without (n = 39) PVD participated. 3D TPUSI was used to measure levator hiatal dimensions at rest, at maximal voluntary contraction (MVC) of the PFMs, and at maximal Valsalva maneuver (MVM). Intravaginal palpation was used to assess PFM strength, PFM tone, PFM relaxation after contraction, and vaginal flexibility; each was scored using an ordinal grading scale. Ultrasound and palpation outcomes were compared using Spearman correlation coefficients and Kruskal-Wallis 1-way analyses of variance by rank. Outcomes included ultrasound measures of the levator hiatal area, anteroposterior diameter, and left-right transverse diameter at rest, at MVC, and at MVM; raw and relative changes in hiatal dimensions between rest and MVC and between rest and MVM; and palpation measures of PFM strength, tone, and relaxation after contraction, and vaginal flexibility. Weak to fair correlations were found between ultrasound and palpation measures. A smaller levator hiatus at rest was associated with greater PFM tone, less PFM relaxation, and less vaginal flexibility. Greater levator hiatal constriction and shortening of the hiatal anteroposterior diameter at MVC were associated with greater palpated PFM strength. Greater hiatal distention at MVM was associated with lower PFM tone and greater relaxation. 3D TPUSI and intravaginal palpation provide related but distinct information about PFM function in young women with and without PVD with high functioning PFMs. This was the first study to compare PFM assessment using 3D TPUSI and intravaginal palpation in nulliparous premenopausal women. A main strength of the study was the inclusion of women with PVD and asymptomatic controls, which provided a wide range in outcomes because differences in PFM morphology and function exist between women with and without PVD. The lack of inclusion of older women and women with weaker and/or hypotonic PFMs limits the generalizability of the findings. Although TPUSI has several advantages, including painless application, it is not recommended as a replacement for digital palpation in the clinical assessment of PFM function. Thibault-Gagnon S, Goldfinger C, Pukall C, et al. Relationships Between 3-Dimensional Transperineal Ultrasound Imaging and Digital Intravaginal Palpation Assessments of the Pelvic Floor Muscles in Women With and Without Provoked Vestibulodynia. J Sex Med 2018;15:346-360. Crown Copyright © 2018. Published by Elsevier Inc. All rights reserved.

Deceleration energy and change in velocity on impact: key factors in fatal versus potentially survivable motor vehicle crash (mvc) aortic injuries (AI): the role of associated injuries as determinants of outcome.

PubMed

Siegel, John H; Smith, Joyce A; Tenenbaum, Nadegda; McCammon, Laurie; Siddiqi, Shabana Q; Presswalla, Faruk; Pierre-Louis, Phito; Williams, Wayne; Zaretski, Leonard; Hutchins, Kenneth; Perez, Lyla; Shaikh, J; Natarajan, Geetha

2002-01-01

To examine the difference in force mechanisms between fatal and potentially survivable MVC aortic injuries (AI) compared to non-AI severe thoracic injuries (ST). Of 324 autopsied MVC driver or front seat passenger fatalities (1997-2000), there were 43 fatal AI (36 scene deaths, 7 hospital deaths) and 5 additional AI survivors. Of the 48 AI, there was only a 42% survival for those reaching hospital alive. 80% of AI survivors had isthmus lesions and all had no or minimal brain injury (GCS >= 13), no cardiac injury and only 20% ribs 1-4 fx or shock; of AI non-survivors reaching hospital alive, 67% had GCS <= 12, 50% cardiac injury, 83% ribs 1-4 fx and 83% shock; AI scene deaths had 78% severe brain injury, 56% cardiac injury, 69% lung injury and 78% ribs 1-4 fx. Quantifying forces in AI scene mortality: the Instantaneous Velocity on Impact of the subject vehicle (delta V1) and the Impact Energy Dissipated (IE) on the subject vehicle (V1) in joules demonstrated a linear regression in fatal car MVC AIs: Energy dissipated (joules) = -56.65 x (delta V1)(2) + 15972 x delta V1 - 454661, r(2) = 0.83. However, for 27 patients with non-AI but severe thoracic (ST) injury (AIS>=3), the relationship of IE to delta V1 had a linear regression of Energy dissipated (joules) = -5.0787 x (delta V1)(2) + 4282.1 x delta V1 - 57182 1, r(2) = 0.84, with the slope difference between the regression for AI scene deaths and that of ST and AI survivors being significant (p<0.05). Based on these relationships, a Critical Zone limited by MVC Impact Energy level of 336000 joules and a delta V1 of 64 kph appears to be the limit of potential survivability in MVCs producing aortic injuries. All AI above these thresholds died. In contrast, ST had greater use of seatbelts (AI 10% vs all ST 60%) and airbags (AI 50% vs all ST 72%), and an 83% survival. The data suggest different mechanisms of force delivery and injury patterns in fatal vs potentially survivable AI, and vs ST MVCs. They suggest that an approach to improving vehicle safety measures for AI may involve better safety devices and mechanisms for reducing that fraction of Impact Energy dissipated on V1 for a given delta V1 which is focused on the upper portion of the subject's thoracic cage between the levels of ribs1-8.

The impact of serum lipids on risk for microangiopathy in patients with type 2 diabetes mellitus

PubMed Central

2012-01-01

Background Few large-scale, real-world studies have assessed the relative associations of lipid fractions with diabetic microvascular events. The main objective of this study was to evaluate the association of the lipid profile components, high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), triglycerides (TG), and non-high density lipoprotein cholesterol (non-HDL-C) with microvascular complications (MVCs) in type 2 diabetes mellitus (T2DM) patients. Methods This observational cohort study queried the HealthCore Integrated Research Database (HIRDSM) for newly-diagnosed (Index Date) 18-64-year-old patients with diabetes mellitus between 01/01/2005-06/30/2010. Inclusion required ≥12 months pre-index continuous health plan eligibility and ≥1 pre-index lipid profile result. Patients with polycystic ovary syndrome and prior MVCs were excluded. Incident complications were defined as the earliest occurrence of diabetic retinopathy, peripheral neuropathy, and/or nephropathy post-index. Cox proportional models and Kaplan-Meier (KM) curves were used to evaluate associations among variables. Results Of the patients (N = 72,267), 50.05 % achieved HDL-C, 64.28 % LDL-C, 59.82 % TG, and 56.79 % non-HDL-C American Diabetes Association goals at baseline. During follow-up (mean, 21.74 months), there were 5.21 microvascular events per 1,000 patient-months. A 1-mg/dL increase in HDL-C was associated with 1 % decrease in any MVC risk (P < .0001), but for LDL-C, TG, and non-HDL-C, 1-mg/dL increase resulted in increases of 0.2 % (P < .0001), 0.1 % (P < 0.001) and 0.3 % (P < 0.001) in MVC risk. Patients achieving HDL-C goals had a 11 % lower risk of MVC versus non-achievers (RR 0.895, [95 % CI, 0.852-0.941], P < .0001). Similarly, TG goal attainment was associated with a lowered risk for any MVC (RR 0.849, [95 % CI, 0.808-0.892], P < .0001). Evaluation of KM survival curves demonstrated no significant difference in the risk of MVCs between patients achieving vs. not achieving LDL-C goals, but did demonstrate a difference in MVC risk between patients achieving vs. not achieving non-HDL-C goals. Conclusion This study demonstrates significant independent associations among lipid fractions and risk for microangiopathy. These findings suggest that attaining established ADA goals for HDL-C, TG, and non-HDL-C may reduce risk for microvascular events among patients with diabetes. PMID:22978715

Change in velocity and energy dissipation on impact in motor vehicle crashes as a function of the direction of crash: key factors in the production of thoracic aortic injuries, their pattern of associated injuries and patient survival. A Crash Injury Research Engineering Network (CIREN) study.

PubMed

Siegel, John H; Smith, Joyce A; Siddiqi, Shabana Q

2004-10-01

To examine the effect of change in velocity (MV) and energy dissipation (IE) on impact, above and below the test levels for federal motor vehicle crash (MVC) safety standards, on the incidence of aortic injury (AI) and its mortality and associated injury patterns in frontal (F) and lateral (L) MVCs. Comparison of 80 AI and 796 non-AI patients of AIS=3. Eight hundred seventy-six MVC adult drivers or front-seat passengers (552 F and 324 L) evaluated by 10 Level I CIREN study Trauma Centers together with vehicle and crash scene engineering reconstruction. Patient seatbelt and/or airbag use correlated with clinical or autopsy findings. In AI, 63% of cases were dead at the scene and only 16% survived to leave hospital. The relation between IE dissipated in the MVC and the DeltaV on impact was exponential as DeltaV increased, but the rise in IE for a given DeltaV was greater in LMVC than in FMVC (p <0.05). A more rapid rise in IE/DeltaV occurred above the mean DeltaV of 48 +/- 19.7 kph (30 mph) in FMVC and above the mean DeltaV of 36 +/- 16.2 kph (23 mph) in LMVC. As DeltaV increased above these means, 65% of 46 FMVC aortic injuries (AIs) and 64% of 34 LMVC AIs occurred. In AI patients there was evidence of focusing of the point of IE impact on the upper chest with a higher incidence of rib1-4 fractures than in non-AI (p <0.01) and more brain, heart, lung and spleen injuries (p <0.01) consequent to lower seatbelt use (p <0.01), but LMVC also had more pelvic fx (p <0.05). Airbags + seatbelts in FMVC and seatbelts in LMVC reduced mortality (p <0.05) Comparison of AI incidence in three successive 4-year vehicle model year periods showed a progressive decrease as new safety devices were introduced (p < 0.05). The implications for AI of the focused IE at the upper chest suggest a probable mechanism for MVC AI with the pressurized aortic arch acting as the long arm of a lever system with the fulcrum at the subclavian artery, producing maximum torsional strain at the short arm of the isthmus where 75% of the AIs occurred. AI mortality is also influenced by the associated injuries. To develop more effective safety systems to prevent AI, MVC safety testing with airbags and seatbelts should be carried out at DeltaVs of 1 SD above means for FMVC and LMVC.

Acute muscle and joint mechanical responses following a high-intensity stretching protocol.

PubMed

Freitas, Sandro R; Andrade, Ricardo J; Nordez, Antoine; Mendes, Bruno; Mil-Homens, Pedro

2016-08-01

A previous study observed a joint passive torque increase above baseline ~30 min after a high-intensity stretching. This study examined the effect of a high-intensity stretching on ankle dorsiflexion passive torque, medial gastrocnemius (MG) shear modulus, and plantar flexors maximal voluntary isometric force (MVIC). Participants (n = 11, age 27.2 ± 6.5 years, height 172.0 ± 10.0 cm, weight 69.5 ± 10.4 kg) underwent two stretching sessions with plantar flexors isometric contractions performed: (1) 5 min before, 1 min after, and every 10 min after stretching (MVC session); (2) 5 min before, and 60 min after the stretching (no-MVC session). In both sessions, no changes were observed for MG shear modulus (p > 0.109). In the no-MVC session, passive torque decreased 1 min after stretching (-7.5 ± 8.4 %, p = 0.015), but increased above baseline 30 min after stretching (+6.3 ± 9.3 %, p = 0.049). In the MVC session, passive torque decreased at 1 min (-10.1 ± 6.3 %, p < 0.001), 10 min (-6.3 ± 8.2 %, p = 0.03), 20 min (-8.0 ± 9.2 %, p = 0.017), and 60 min (-9.2 ± 12.4 %, p = 0.034) after the stretching, whereas the MVIC decreased at 1 min (-5.0 ± 9.3 %, p = 0.04) and 10 min (-6.7 ± 8.7 %, p = 0.02) after stretching. The ankle passive torque increase 30 min following the stretch was not due to the MG shear modulus response; consequently, response may be due to changes in surrounding connective tissue mechanical properties.

Intra and inter-session reliability of rapid Transcranial Magnetic Stimulation stimulus-response curves of tibialis anterior muscle in healthy older adults

PubMed Central

Colombo, Vera Maria; van de Ruit, Mark; Grey, Michael J.; Monticone, Marco; Ferriero, Giorgio; Pedrocchi, Alessandra; Ferrigno, Giancarlo; Ferrante, Simona

2017-01-01

Objective The clinical use of Transcranial Magnetic Stimulation (TMS) as a technique to assess corticospinal excitability is limited by the time for data acquisition and the measurement variability. This study aimed at evaluating the reliability of Stimulus-Response (SR) curves acquired with a recently proposed rapid protocol on tibialis anterior muscle of healthy older adults. Methods Twenty-four neurologically-intact adults (age:55–75 years) were recruited for this test-retest study. During each session, six SR curves, 3 at rest and 3 during isometric muscle contractions at 5% of maximum voluntary contraction (MVC), were acquired. Motor Evoked Potentials (MEPs) were normalized to the maximum peripherally evoked response; the coil position and orientation were monitored with an optical tracking system. Intra- and inter-session reliability of motor threshold (MT), area under the curve (AURC), MEPmax, stimulation intensity at which the MEP is mid-way between MEPmax and MEPmin (I50), slope in I50, MEP latency, and silent period (SP) were assessed in terms of Standard Error of Measurement (SEM), relative SEM, Minimum Detectable Change (MDC), and Intraclass Correlation Coefficient (ICC). Results The relative SEM was ≤10% for MT, I50, latency and SP both at rest and 5%MVC, while it ranged between 11% and 37% for AURC, MEPmax, and slope. MDC values were overall quite large; e.g., MT required a change of 12%MSO at rest and 10%MSO at 5%MVC to be considered a real change. Inter-sessions ICC were >0.6 for all measures but slope at rest and MEPmax and latency at 5%MVC. Conclusions Measures derived from SR curves acquired in <4 minutes are affected by similar measurement errors to those found with long-lasting protocols, suggesting that the rapid method is at least as reliable as the traditional methods. As specifically designed to include older adults, this study provides normative data for future studies involving older neurological patients (e.g. stroke survivors). PMID:28910370

Obesity and vehicle type as risk factors for injury caused by motor vehicle collision.

PubMed

Donnelly, John P; Griffin, Russell Lee; Sathiakumar, Nalini; McGwin, Gerald

2014-04-01

This study sought to describe variations in the risk of motor vehicle collision (MVC) injury and death by occupant body mass index (BMI) class and vehicle type. We hypothesized that the relationship between BMI and the risk of MVC injury or mortality would be modified by vehicle type. This is a retrospective cohort study of occupants involved in MVCs using data from the Crash Injury Research and Engineering Network and the National Automotive Sampling System Crashworthiness Data System. Occupants were grouped based on vehicle body style (passenger car, sport utility vehicle, or light truck) and vehicle size (compact or normal, corresponding to below- or above-average curb weight). The relationship between occupant BMI class (underweight, normal weight, overweight, or obese) and risk of injury or mortality was examined for each vehicle type. Odds ratios (ORs) adjusted for various occupant and collision characteristics were estimated. Of an estimated 44 million occupants of MVCs sampled from 2000 to 2009, 37.1% sustained an injury. We limited our analysis to injuries achieving an Abbreviated Injury Scale (AIS) score of 2 or more severe, totaling 17 million injuries. Occupants differed substantially in terms of demographic and collision characteristics. After adjustment for confounding factors, we found that obesity was a risk factor for mortality caused by MVC (OR, 1.6; 95% confidence interval [CI], 1.2-2.0). When stratified by vehicle type, we found that obesity was a risk factor for mortality in larger vehicles, including any-sized light trucks (OR, 2.1; 95% CI, 1.3-3.5), normal-sized passenger cars (OR, 1.6; 95% CI, 1.1-2.3), and normal-sized sports utility vehicles or vans (OR, 2.0; 95% CI, 1.0-3.8). Being overweight was a risk factor in any-sized light trucks (OR, 1.5; 95% CI, 1.1-2.1). We identified a significant interaction between occupant BMI class and vehicle type in terms of MVC-related mortality risk. Both factors should be taken into account when considering occupant safety, and additional study is needed to determine underlying causes of the observed relationships. Epidemiologic study, level III.

Effects of the ACTN3 R577X Genotype on the Muscular Strength and Range of Motion Before and After Eccentric Contractions of the Elbow Flexors.

PubMed

Kikuchi, Naoki; Tsuchiya, Yosuke; Nakazato, Koichi; Ishii, Naokata; Ochi, Eisuke

2018-02-01

The purpose of present study was to examine the association between ACTN3 R577X genotype and functional characteristics of elbow flexors before and after isokinetic eccentric contractions (ECCs). Fifty-two men (age: 20.8±3.8 years, height: 172.5±5.9 cm, body mass: 64.7±6.5 kg, BMI: 21.7±1.7) who had not participated in any regular resistance training for at least 1 year prior to this study were recruited. ECCs consisted of five sets of six maximal voluntary isokinetic (30°/s) ECCs of the elbow flexors with a range of motion (ROM) from 90° flexion to 0° (full extension). Measurements of maximal voluntary isometric contraction (MVC) torque, ROM, and muscle soreness were taken before, immediately after, and 1, 2, 3, and 5 days after ECCs. Genotyping results were analyzed for identifying ACTN3 R577X polymorphism (rs1815739) using TaqMan approach. The genotype frequencies of the ACTN3 R577X polymorphism were RR 26.9% (n=14), RX 50.0% (n=26), and XX 23.1% (n=12). There were no significant differences in MVC torque, ROM, and soreness between three genotype groups of ACTN3 R577X. However, MVC at baseline was greater in RR homozygotes than in X-allele carriers (combined XX and RX; p<0.05). ROM in RR homozygotes at baseline was lower than that of X-allele carriers. Although a significant decrease in ROM was observed in X-allele carriers until 3 days after ECCs, a significant ROM reduction in RR homozygotes was observed only immediately after ECCs. Our data indicated that ACTN3 RR genotype has higher MVC and lower flexibility than X-allele carriers at baseline, but the effect of ACTN3 R577X genotype on these two parameters is limited after ECCs. © Georg Thieme Verlag KG Stuttgart · New York.

The Location of Peak Upper Trapezius Muscle Activity During Submaximal Contractions is not Associated With the Location of Myofascial Trigger Points: New Insights Revealed by High-density Surface EMG.

PubMed

Barbero, Marco; Falla, Deborah; Mafodda, Luca; Cescon, Corrado; Gatti, Roberto

2016-12-01

To apply topographical mapping of the electromyography (EMG) amplitude recorded from the upper trapezius muscle to evaluate the distribution of activity and the location of peak activity during a shoulder elevation task in participants with and without myofascial pain and myofascial trigger points (MTrP) and compare this location with the site of the MTrP. Thirteen participants with myofascial pain and MTrP in the upper trapezius muscle and 12 asymptomatic individuals participated. High-density surface EMG was recorded from the upper trapezius muscle using a matrix of 64 surface electrodes aligned with an anatomic landmark system (ALS). Each participant performed a shoulder elevation task consisting of a series of 30 s ramped contractions to 15% or 60% of their maximal voluntary contraction (MVC) force. Topographical maps of the EMG average rectified value were computed and the peak EMG amplitude during the ramped contractions was identified and its location determined with respect to the ALS. The location of the MTrP was also determined relative to the ALS and Spearman correlation coefficients were used to examine the relationship between MTrP and peak EMG amplitude location. The location of the peak EMG amplitude was significantly (P<0.05) different between groups (participants with pain/MTrP: -0.32±1.2 cm at 15% MVC and -0.35±0.9 cm at 60% MVC relative to the ALS; asymptomatic participants: 1.0±1.3 cm at 15% MVC and 1.3±1.1 cm relative to the ALS). However, no correlation was observed between the position of the MTrP and peak EMG amplitude during the ramped contractions at either force level (15%: rs=0.039, P=0.9; 60%: rs=-0.087, P=0.778). People with myofascial pain and MTrP displayed a caudal shift of the distribution of upper trapezius muscle activity compared with asymptomatic individuals during a submaximal shoulder elevation task. For the first time, we show that the location of peak muscle activity is not associated with the location of the MTrP.

Women show similar central and peripheral fatigue to men after half-marathon.

PubMed

Boccia, Gennaro; Dardanello, Davide; Tarperi, Cantor; Festa, Luca; La Torre, Antonio; Pellegrini, Barbara; Schena, Federico; Rainoldi, Alberto

2018-06-01

Women are known to be less fatigable than men in single-joint exercises, but fatigue induced by running has not been well understood. Here we investigated sex differences in central and peripheral fatigue and in rate of force development (RFD) in the knee extensors after a half-marathon run. Ten male and eight female amateur runners (aged 25-50 years) were evaluated before and immediately after a half-marathon race. Knee extensors forces were obtained under voluntary and electrically evoked isometric contractions. Maximal voluntary isometric contraction (MVC) force and peak RFD were recorded. Electrically doublet stimuli were delivered during the MVC and at rest to calculate the level of voluntary activation and the resting doublet twitch. After the race, decreases in MVC force (males: -11%, effect size [ES] 0.52; females: -11% ES 0.33), voluntary activation (males: -6%, ES 0.87; females: -4%, ES 0.72), and resting doublet twitch (males: -6%, ES 0.34; females: -8%, ES 0.30) were found to be similar between males and females. The decrease in peak RFD was found to be similar between males and females (males: -14%, ES 0.43; females: -15%, ES 0.14). Half-marathon run induced both central and peripheral fatigue, without any difference between men and women. The maximal and explosive strength loss was found similar between sexes. Together, these findings do not support the need of sex-specific training interventions to increase the tolerance to neuromuscular fatigue in half-marathoners.

Characterizing rapid-onset vasodilation to single muscle contractions in the human leg

PubMed Central

Credeur, Daniel P.; Holwerda, Seth W.; Restaino, Robert M.; King, Phillip M.; Crutcher, Kiera L.; Laughlin, M. Harold; Padilla, Jaume

2014-01-01

Rapid-onset vasodilation (ROV) following single muscle contractions has been examined in the forearm of humans, but has not yet been characterized in the leg. Given known vascular differences between the arm and leg, we sought to characterize ROV following single muscle contractions in the leg. Sixteen healthy men performed random ordered single contractions at 5, 10, 20, 40, and 60% of their maximum voluntary contraction (MVC) using isometric knee extension made with the leg above and below heart level, and these were compared with single isometric contractions of the forearm (handgrip). Single thigh cuff compressions (300 mmHg) were utilized to estimate the mechanical contribution to leg ROV. Continuous blood flow was determined by duplex-Doppler ultrasound and blood pressure via finger photoplethysmography (Finometer). Single isometric knee extensor contractions produced intensity-dependent increases in peak leg vascular conductance that were significantly greater than the forearm in both the above- and below-heart level positions (e.g., above heart level: leg 20% MVC, +138 ± 28% vs. arm 20% MVC, +89 ± 17%; P < 0.05). Thigh cuff compressions also produced a significant hyperemic response, but these were brief and smaller in magnitude compared with single isometric contractions in the leg. Collectively, these data demonstrate the presence of a rapid and robust vasodilation to single muscle contractions in the leg that is largely independent of mechanical factors, thus establishing the leg as a viable model to study ROV in humans. PMID:25539935

Central and peripheral fatigue in knee and elbow extensor muscles after a long-distance cross-country ski race.

PubMed

Boccia, G; Dardanello, D; Zoppirolli, C; Bortolan, L; Cescon, C; Schneebeli, A; Vernillo, G; Schena, F; Rainoldi, A; Pellegrini, B

2017-09-01

Although elbow extensors (EE) have a great role in cross-country skiing (XC) propulsion, previous studies on neuromuscular fatigue in long-distance XC have investigated only knee extensor (KE) muscles. In order to investigate the origin and effects of fatigue induced by long-distance XC race, 16 well-trained XC skiers were tested before and after a 56-km classical technique race. Maximal voluntary isometric contraction (MVC) and rate of force development (RFD) were measured for both KE and EE. Furthermore, electrically evoked double twitch during MVC and at rest were measured. MVC decreased more in KE (-13%) than in EE (-6%, P = 0.016), whereas the peak RFD decreased only in EE (-26%, P = 0.02) but not in KE. The two muscles showed similar decrease in voluntary activation (KE -5.0%, EE -4.8%, P = 0.61) and of double twitch amplitude (KE -5%, EE -6%, P = 0.44). A long-distance XC race differently affected the neuromuscular function of lower and upper limbs muscles. Specifically, although the strength loss was greater for lower limbs, the capacity to produce force in short time was more affected in the upper limbs. Nevertheless, both KE and EE showed central and peripheral fatigue, suggesting that the origins of the strength impairments were multifactorial for the two muscles. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Incidence and Predictors of Acute Psychological Distress and Dissociation after Motor Vehicle Collision: a Cross-Sectional Study

PubMed Central

Lewis, Gemma C.; Platts-Mills, Timothy F.; Liberzon, Israel; Bair, Eric; Swor, Robert; Peak, David; Jones, Jeffrey; Rathlev, Niels; Lee, David; Domeier, Robert; Hendry, Phyllis; McLean, Samuel A.

2014-01-01

Objective The authors examined the incidence and predictors of peritraumatic distress and dissociation after one of the most common forms of civilian trauma exposure: motor vehicle collision (MVC). Methods In this study, patients presenting to the emergency department after MVC who were without serious injury and discharged to home after evaluation (n = 935) completed an emergency department interview evaluating sociodemographic, collision-related, and psychological characteristics. Results The incidence and predictors of distress (Peritraumatic Distress Inventory score ≥ 23) and dissociation (Michigan Critical Events Perception Scale score >3) were assessed. Distress was present in 355 of 935 patients (38%) and dissociation was present in 260 of 942 patients (28%). These outcomes showed only moderate correlation (r = 0.45), and had both shared and distinct predictors. Female gender, anxiety symptoms prior to MVC, and vehicle damage severity predicted both distress and dissociation. Higher socioeconomic status (higher education, higher income, full time employment) had a protective effect against distress but not dissociative symptoms. Better physical health and worse overall mental health were associated with increased risk of dissociation, but not distress. Distress but not dissociation was associated with lower patient confidence in recovery and a longer expected duration of recovery. Conclusion There are unique predictors of peritraumatic distress and dissociation. Further work is needed to better understand the neurobiology of peritraumatic distress and dissociation, and the influence of these peritraumatic outcomes on persistent psychological sequelae. PMID:24983475

Risk of injury for occupants of motor vehicle collisions from unbelted occupants.

PubMed

MacLennan, P A; McGwin, G; Metzger, J; Moran, S G; Rue, L W

2004-12-01

Unbelted occupants may increase the risk of injury for other occupants in a motor vehicle collision (MVC). This study evaluated the association between occupant restraint use and the risk of injury (including death) to other vehicle occupants. A population based cohort study. United States. MVC occupants (n = 152 191 unweighted, n = 18 426 684 weighted) seated between a belted or unbelted occupant and the line of the principal direction of force in frontal, lateral, and rear MVCs were sampled from the 1991-2002 National Automotive Sampling System General Estimates System. Offset MVCs were not included in the study. Risk ratios and 95% confidence intervals for injury (including death) for occupants seated contiguous to unbelted occupants compared to occupants seated contiguous to belted occupants. Risk ratios were adjusted for at risk occupant's sex, age, seating position, vehicle type, collision type, travel speed, crash severity, and at risk occupants' own seat belt use. Exposure to unbelted occupants was associated with a 40% increased risk of any injury. Belted at risk occupants were at a 90% increased risk of injury but unbelted occupants were not at increased risk. Risks were similar for non-incapacitating and capacitating injuries. There was a 4.8-fold increased risk of death for exposed belted occupants but no increased risk of death for unbelted occupants. Belted occupants are at an increased risk of injury and death in the event of a MVC from unbelted occupants.

Triphasic behavioral response of motor units to submaximal fatiguing exercise.

PubMed

Dorfman, L J; Howard, J E; McGill, K C

1990-07-01

We have measured the firing rate and amplitude of 4551 motor unit action potentials (MUAPs) recorded with concentric needle electrodes from the brachial biceps muscles of 10 healthy young adults before, during, and after 45 minutes of intermittent isometric exercise at 20% of maximum voluntary contraction (MVC), using an automatic method for decomposition of electromyographic activity (ADEMG). During and after exercise, MUAPs derived from contractions of 30% MVC showed progressive increase in mean firing rate (P less than or equal to .01) and amplitude (P less than or equal to .05). The firing rate increase preceded the rise in mean amplitude, and was evident prior to the development of fatigue, defined as reduction of MVC. Analysis of individual potentials revealed that the increase in firing rate and in amplitude reflected different MUAP subpopulations. A short-term (less than 1 minute) reduction in MUAP firing rates (P less than or equal to .05) was also observed at the onset of each test contraction. These findings suggest that motor units exhibit a triphasic behavioral response to prolonged submaximal exercise: (1) short-term decline and stabilization of onset firing rates, followed by (2) gradual and progressive increase in firing rates and firing variability, and then by (3) recruitment of additional (larger) motor units. The (2) and (3) components presumably compensate for loss of force-generating capacity in the exercising muscle, and give rise jointly to the well-known increase in total surface EMG which accompanies muscle fatigue.

Risk of injury for occupants of motor vehicle collisions from unbelted occupants

PubMed Central

MacLennan, P; McGwin, G; Metzger, J; Moran, S; Rue, L

2004-01-01

Objective: Unbelted occupants may increase the risk of injury for other occupants in a motor vehicle collision (MVC). This study evaluated the association between occupant restraint use and the risk of injury (including death) to other vehicle occupants. Design: A population based cohort study. Setting: United States. Subjects: MVC occupants (n = 152 191 unweighted, n = 18 426 684 weighted) seated between a belted or unbelted occupant and the line of the principal direction of force in frontal, lateral, and rear MVCs were sampled from the 1991–2002 National Automotive Sampling System General Estimates System. Offset MVCs were not included in the study. Main outcome measure: Risk ratios and 95% confidence intervals for injury (including death) for occupants seated contiguous to unbelted occupants compared to occupants seated contiguous to belted occupants. Risk ratios were adjusted for at risk occupant's sex, age, seating position, vehicle type, collision type, travel speed, crash severity, and at risk occupants' own seat belt use. Results: Exposure to unbelted occupants was associated with a 40% increased risk of any injury. Belted at risk occupants were at a 90% increased risk of injury but unbelted occupants were not at increased risk. Risks were similar for non-incapacitating and capacitating injuries. There was a 4.8-fold increased risk of death for exposed belted occupants but no increased risk of death for unbelted occupants. Conclusions: Belted occupants are at an increased risk of injury and death in the event of a MVC from unbelted occupants. PMID:15583258

Effect of hypnotic suggestion on knee extensor neuromuscular properties in resting and fatigued states

PubMed Central

Antonini Philippe, Roberta; Guglielmo, Luiz Guilherme A.

2018-01-01

Purpose The aim of this study was to investigate whether hypnotic suggestions can alter knee extensor neuromuscular function at rest and during exercise. Methods Thirteen healthy volunteers (8 men and 5 women, 27 ± 3 years old) took part in this counterbalanced, crossover study including two experimental (hypnosis and control) sessions. Knee extensor neuromuscular function was tested before and after hypnosis suggestion by using a combination of voluntary contraction, transcutaneous femoral nerve electrical stimulation and transcranial magnetic stimulation (TMS). A fatiguing exercise (sustained submaximal contraction at 20% maximal voluntary contraction (MVC) force) was also performed to evaluate the potential influence of hypnosis on the extent and origin of neuromuscular adjustments. Results Hypnosis did not (p>0.05) alter MVC force or knee extensor neural properties. Corticospinal excitability, assessed with the amplitude of knee extensor motor evoked potentials, was also unchanged (p>0.05), as was the level of intracortical inhibition assessed with paired pulse TMS (short-interval intracortical inhibition, SICI). Time to task failure (~300 s) was not different (p>0.05) between the two sessions; accordingly, hypnosis did not influence neuromuscular adjustments measured during exercise and at task failure (p>0.05). Conclusion Hypnotic suggestions did not alter neuromuscular properties of the knee extensor muscles under resting condition or during/after exercise, suggesting that hypnosis-induced improvement in exercise performance and enhanced corticospinal excitability might be limited to highly susceptible participants. PMID:29684047

The vestibulomyogenic balance response is elevated following high-intensity lengthening contractions of the lower limb.

PubMed

McIntosh, Emily I; Power, Geoffrey A; Dalton, Brian H

2018-05-14

The purpose was to investigate whether exercise-induced muscle weakness of the plantar and dorsiflexors through high-intensity lengthening contractions increases the vestibulomyogenic balance response. Nine males (∼25 years) participated in three experimental testing days to evaluate the vestibular control of standing balance and neuromuscular function of the plantar and dorsiflexors pre- and post (30 min, and 1 and 7 days) high-intensity lengthening plantar and dorsiflexions. To evaluate the vestibular-evoked balance response, participants stood quietly on a force plate while exposed to continuous, random electrical vestibular stimulation (EVS) for two 90-s trials. Relationships between EVS-antero-posterior (AP) forces and EVS-medial gastrocnemius electromyography (EMG) were estimated in the frequency domain (i.e., coherence). Weakness of the right plantar and dorsiflexors were assessed using maximal voluntary contraction (MVC) torque. The lengthening contractions induced a 13 and 24% reduction in plantar and dorsiflexor MVC torque, respectively (p < 0.05) of the exercised leg, which did not recover by 1 day post. The EVS-EMG coherence increased over a range of frequencies up to 7 days post compared to pre-lengthening contractions. Conversely, EVS-AP forces coherence exhibited limited changes. The greater EVS-EMG coherence post exercise-induced muscle weakness may be a compensatory mechanism to maintain the whole-body vestibular-evoked balance response when muscle strength is reduced. Copyright © 2018 Elsevier B.V. All rights reserved.

Pelvic Floor Morphometric Differences in Elderly Women with or without Urinary Incontinence.

PubMed

Fradet, Sarah; Morin, Mélanie; Kruger, Jennifer; Dumoulin, Chantale

2018-01-01

Purpose: Urinary incontinence (UI) affects as many as 50% of women aged 60 years and older, but UI pathophysiology, specifically in elderly women, remains unclear. A better understanding of morphometric differences between continent and urinary incontinent elderly women is needed to improve the effectiveness of conservative treatment approaches. We hypothesized that morphometric differences in the pelvic floor muscles (PFM) among elderly women with and without UI could be observed using three- and four-dimensional (3D/4D) transperineal ultrasound (TPU) imaging. Method: A total of 40 elderly women (20 women with and 20 women without UI), with a mean age of 67.10 (SD 4.94) years, participated in the study. This was a case-control study in which TPU images were taken under three conditions: rest, maximal voluntary contraction (MVC), and Valsalva. Independent t -tests were conducted to compare measurements between the groups. Results: The study revealed statistically significant differences between the groups. At rest, the levator hiatal area and transverse diameter were bigger, and the PFM position was lower in the incontinent group. During MVC, all axial plane parameters were bigger in the incontinent group. In the sagittal plane, PFM position was again lower in the incontinent group. During Valsalva, the anorectal angle was wider in the women with incontinence. Conclusion: PFM morphometric differences were present and were observed using 3D/4D TPU imaging in elderly women with and without UI.

'Tagger' - a Mac OS X Interactive Graphical Application for Data Inference and Analysis of N-Dimensional Datasets in the Natural Physical Sciences.

NASA Astrophysics Data System (ADS)

Morse, P. E.; Reading, A. M.; Lueg, C.

2014-12-01

Pattern-recognition in scientific data is not only a computational problem but a human-observer problem as well. Human observation of - and interaction with - data visualization software can augment, select, interrupt and modify computational routines and facilitate processes of pattern and significant feature recognition for subsequent human analysis, machine learning, expert and artificial intelligence systems.'Tagger' is a Mac OS X interactive data visualisation tool that facilitates Human-Computer interaction for the recognition of patterns and significant structures. It is a graphical application developed using the Quartz Composer framework. 'Tagger' follows a Model-View-Controller (MVC) software architecture: the application problem domain (the model) is to facilitate novel ways of abstractly representing data to a human interlocutor, presenting these via different viewer modalities (e.g. chart representations, particle systems, parametric geometry) to the user (View) and enabling interaction with the data (Controller) via a variety of Human Interface Devices (HID). The software enables the user to create an arbitrary array of tags that may be appended to the visualised data, which are then saved into output files as forms of semantic metadata. Three fundamental problems that are not strongly supported by conventional scientific visualisation software are addressed:1] How to visually animate data over time, 2] How to rapidly deploy unconventional parametrically driven data visualisations, 3] How to construct and explore novel interaction models that capture the activity of the end-user as semantic metadata that can be used to computationally enhance subsequent interrogation. Saved tagged data files may be loaded into Tagger, so that tags may be tagged, if desired. Recursion opens up the possibility of refining or overlapping different types of tags, tagging a variety of different POIs or types of events, and of capturing different types of specialist observations of important or noticeable events. Other visualisations and modes of interaction will also be demonstrated, with the aim of discovering knowledge in large datasets in the natural, physical sciences. Fig.1 Wave height data from an oceanographic Wave Rider Buoy. Colors/radii are driven by wave height data.

Eight weeks of local vibration training increases dorsiflexor muscle cortical voluntary activation.

PubMed

Souron, Robin; Farabet, Adrien; Féasson, Léonard; Belli, Alain; Millet, Guillaume Y; Lapole, Thomas

2017-06-01

The aim of this study was to evaluate the effects of an 8-wk local vibration training (LVT) program on functional and corticospinal properties of dorsiflexor muscles. Forty-four young subjects were allocated to a training (VIB, n = 22) or control (CON, n = 22 ) group. The VIB group performed twenty-four 1-h sessions (3 sessions/wk) of 100-Hz vibration applied to the right tibialis anterior. Both legs were tested in each group before training (PRE), after 4 (MID) and 8 (POST) wk of training, and 2 wk after training (POST 2W ). Maximal voluntary contraction (MVC) torque was assessed, and transcranial magnetic stimulation (TMS) was used to evaluate cortical voluntary activation (VA TMS ), motor evoked potential (MEP), cortical silent period (CSP), and input-output curve parameters. MVC was significantly increased for VIB at MID for right and left legs [+7.4% ( P = 0.001) and +6.2% ( P < 0.01), respectively] and remained significantly greater than PRE at POST [+12.0% ( P < 0.001) and +10.1% ( P < 0.001), respectively]. VA TMS was significantly increased for right and left legs at MID [+4.4% ( P < 0.01) and +4.7% ( P < 0.01), respectively] and at POST [+4.9% ( P = 0.001) and +6.2% ( P = 0.001), respectively]. These parameters remained enhanced in both legs at POST 2W MEP and CSP recorded during MVC and input-output curve parameters did not change at any time point for either leg. Despite no changes in excitability or inhibition being observed, LVT seems to be a promising method to improve strength through an increase of maximal voluntary activation, i.e., neural adaptations. Local vibration may thus be further considered for clinical or aging populations. NEW & NOTEWORTHY The effects of a local vibration training program on cortical voluntary activation measured with transcranial magnetic stimulation were assessed for the first time in dorsiflexors, a functionally important muscle group. We observed that training increased maximal voluntary strength likely because of the strong and repeated activation of Ia spindle afferents during vibration training that led to changes in the cortico-motoneuronal pathway, as demonstrated by the increase in cortical voluntary activation. Copyright © 2017 the American Physiological Society.

Whey Protein Supplementation Enhances Whole Body Protein Metabolism and Performance Recovery after Resistance Exercise: A Double-Blind Crossover Study

PubMed Central

West, Daniel W. D.; Abou Sawan, Sidney; Mazzulla, Michael; Williamson, Eric; Moore, Daniel R.

2017-01-01

No study has concurrently measured changes in free-living whole body protein metabolism and exercise performance during recovery from an acute bout of resistance exercise. We aimed to determine if whey protein ingestion enhances whole body net protein balance and recovery of exercise performance during overnight (10 h) and 24 h recovery after whole body resistance exercise in trained men. In a double-blind crossover design, 12 trained men (76 ± 8 kg, 24 ± 4 years old, 14% ± 5% body fat; means ± standard deviation (SD)) performed resistance exercise in the evening prior to consuming either 25 g of whey protein (PRO; MuscleTech 100% Whey) or an energy-matched placebo (CHO) immediately post-exercise (0 h), and again the following morning (~10 h of recovery). A third randomized trial, completed by the same participants, involving no exercise and no supplement served as a rested control trial (Rest). Participants ingested [15N]glycine to determine whole body protein kinetics and net protein balance over 10 and 24 h of recovery. Performance was assessed pre-exercise and at 0, 10, and 24 h of recovery using a battery of tests. Net protein balance tended to improve in PRO (P = 0.064; effect size (ES) = 0.61, PRO vs. CHO) during overnight recovery. Over 24 h, net balance was enhanced in PRO (P = 0.036) but not in CHO (P = 0.84; ES = 0.69, PRO vs. CHO), which was mediated primarily by a reduction in protein breakdown (PRO < CHO; P < 0.01. Exercise decreased repetitions to failure (REP), maximal strength (MVC), peak and mean power, and countermovement jump performance (CMJ) at 0 h (all P < 0.05 vs. Pre). At 10 h, there were small-to-moderate effects for enhanced recovery of the MVC (ES = 0.56), mean power (ES = 0.49), and CMJ variables (ES: 0.27–0.49) in PRO. At 24 h, protein supplementation improved MVC (ES = 0.76), REP (ES = 0.44), and peak power (ES = 0.55). In conclusion, whey protein supplementation enhances whole body anabolism, and may improve acute recovery of exercise performance after a strenuous bout of resistance exercise. PMID:28696380

Bioelectrical activity of the pelvic floor muscles during synchronous whole-body vibration--a randomized controlled study.

PubMed

Stania, Magdalena; Chmielewska, Daria; Kwaśna, Krystyna; Smykla, Agnieszka; Taradaj, Jakub; Juras, Grzegorz

2015-10-24

More and more frequently stress urinary incontinence affects young healthy women. Hence, early implementation of effective preventive strategies in nulliparous continent women is essential, including pelvic floor muscle training. An initial evaluation based on the bioelectrical activity of the pelvic floor muscles (PFM) during whole-body vibration (WBV) would help to devise the best individualized training for prevention of stress urinary incontinence in woman. We hypothesized that synchronous WBV enhances bioelectrical activity of the PFM which depends on vibration frequency and peak-to-peak vibration displacement. The sample consisted of 36 nulliparous continent women randomly allocated to three comparative groups. Group I and II subjects participated in synchronous whole-body vibrations on a vibration platform; the frequency and peak-to-peak displacement of vibration were set individually for each group. Control participants performed exercises similar to those used in the study groups but without the concurrent application of vibrations. Pelvic floor surface electromyography (sEMG) activity was recorded using a vaginal probe during three experimental trials limited to 30s, 60s and 90 s. The mean amplitude and variability of the signal were normalized to the Maximal Voluntary Contraction - MVC. Friedman's two-way ANOVA revealed a statistically significant difference in the mean normalized amplitudes (%MVC) of the sEMG signal from the PFM during 60s- and 90 s-trials between the group exposed to high-intensity WBV and control participants (p < 0.05). Longer trial duration was associated with a statistically significant decrease in the variability of sEMG signal amplitude in the study and control groups (p < 0.05). Synchronous high-intensity WBV (40 Hz, 4 mm) of long duration (60s, 90 s) significantly enhances the activation of the PFM in young continent women. Prolonged maintenance of a static position significantly decreases the variability of sEMG signal amplitude independent of whole-body vibrations. Single whole-body vibrations in nulliparous continent women does not cause pelvic floor muscle fatigue. The trial was registered in the Australian and New Zealand Clinical Trials Registry (no. ACTRN12615000966594); registration date: 15/09/2015.

Protection of muscle membrane excitability during prolonged cycle exercise with glucose supplementation.

PubMed

Stewart, R D; Duhamel, T A; Foley, K P; Ouyang, J; Smith, I C; Green, H J

2007-07-01

To determine if exercise-induced depressions in neuromuscular function are altered with oral glucose supplementation, 15 untrained participants (Vo2 peak = 45 +/- 2 ml x kg(-1) x min(-1), mean +/- SE) performed prolonged cycle exercise at approximately 60% Vo2 peak on two occasions: without glucose supplementation (NG) and with oral glucose supplementation (G). The oral G began at 30 min of exercise and was administered every 15 min (total ingested = 1.23 +/- 0.11 g carbohydrate/kg body mass). Quadriceps isometric properties and membrane excitability were assessed prior to exercise, after 90 min of exercise, and at fatigue. Cycle time to fatigue was greater (P < 0.05) in G compared with NG (137 +/- 7 vs. 115 +/- 6 min). Progressive reductions (P < 0.05) in maximal voluntary contraction (MVC, N) were observed for NG at 90 min (441 +/- 29) and at fatigue (344 +/- 33) compared with pre-exercise (666 +/- 30). At fatigue in G, the reduction in MVC was not as pronounced (P < 0.05) as in NG. Motor unit activation assessed with the interpolated twitch technique during an MVC following exercise was not different between conditions. During cycling, the G condition also resulted in a higher (P < 0.05) muscle compound potential (M-wave) amplitude (mV) at both 90 min (+50%) and at fatigue (+87%) compared with NG. Similar effects were also found M-wave area (mV/ms). These results suggest that the ergogenic effect of glucose supplementation occurs not as a result of decreased neural activation but to improved muscle function, possibly as a consequence of protection of muscle membrane excitability.

Developmental biomechanics of neck musculature

PubMed Central

Lavallee, Amy V.; Ching, Randal P.; Nuckley, David J.

2012-01-01

Neck mechanics is central to head injury prevention since it is the musculoskeletal neck, which dictates the position and movement of the head. In the US, traumatic injury is the leading cause of death for children; however prevention is hampered by the lack of data concerning the mechanics of the immature head-and-neck. Thus, the objective of this study was to quantify neck muscle strength and endurance across the maturation spectrum and correlate these with head-and-neck anthropometry. A factorial study was performed on 91 human subjects measuring head-and-neck anthropometry and neck strength and endurance in three bending directions (flexion, extension, and lateral) as a function of age (6–23 years). Using a custom device, neck maximum voluntary contraction (MVC) force was measured in triplicate. Next, neck muscle endurance (sustained effort) was measured as the subjects’ ability to maintain 70% of peak force over 30 s. Linear regression of peak force and endurance as a function of age revealed each direction to significantly (p<0.0001) increase with age. The MVC force, averaged across all directions and normalized to the adult values, exhibits the following maturation curve: %MVC Force= −0.0879(age)2+6.018(age)+8.120. Neck muscle strength, similar between young males and females, becomes disparate in adolescence and adulthood with males exhibiting greater strength. Bending direction differences were also found with extension strength being the greatest regardless of age and sex. Furthermore, neck circumference appears predictive of neck strength and endurance in children. Together, these relationships may facilitate improved design of injury prevention interventions. PMID:23127787

The effects of tapering on strength performance in trained athletes.

PubMed

Gibala, M J; MacDougall, J D; Sale, D G

1994-11-01

The optimum pre-competition taper procedure for "strength athletes" is not known. We examined voluntary strength and evoked contractile properties of the elbow flexors over a 10 day rest only (ROT) and a 10 day reduced volume taper (RVT) in 8 resistance trained males (23 +/- 2.1 years). Following 3 wks of standardized training of the elbow flexors, subjects were randomly assigned to one of the tapers. Upon completion, they resumed training for 3 wks and completed the other taper. No arm training was performed during the ROT, while high intensity, low volume training was done every second day during the RVT. Maximum isometric (MVC), low (0.52 rad.s-1; LV) and high velocity (3.14 rad.s-1; HV) concentric peak torque, and evoked isometric twitch contractile properties were measured before and after each training phase and every 48 h during each taper. ANOVA comparison of the tapers revealed that MVC increased (p < or = 0.05) over pre-taper values throughout the RVT (measurement days 2, 4, 6, 8 and 10), as did LV at 2, 4, 6, and 8 d. MVC did not change over the ROT but LV was significantly higher on day 2 and lower on days 8 and 10. LV was also greater on days 4, 6, 8 and 10 during the RVT compared to the ROT. The evoked contractile properties remained largely unchanged. The data indicate that resistance-trained athletes can improve low velocity concentric strength for at least 8 days by greatly reducing training volume, but maintaining training intensity.

Attenuation of indirect markers of eccentric exercise-induced muscle damage by curcumin.

PubMed

Tanabe, Yoko; Maeda, Seiji; Akazawa, Nobuhiko; Zempo-Miyaki, Asako; Choi, Youngju; Ra, Song-Gyu; Imaizumi, Atsushi; Otsuka, Yoshihiko; Nosaka, Kazunori

2015-09-01

Polyphenolic curcumin is known to have potent anti-inflammatory effects; thus the present study investigated the hypothesis that curcumin ingestion would attenuate muscle damage after eccentric exercise. Fourteen untrained young men (24 ± 1 years) performed 50 maximal isokinetic (120°/s) eccentric contractions of the elbow flexors of one arm on an isokinetic dynamometer and the same exercise with the other arm 4 weeks later. They took 150 mg of curcumin (theracurmin) or placebo (starch) orally before and 12 h after each eccentric exercise bout in a randomised, crossover design. Maximal voluntary contraction (MVC) torque of the elbow flexors, range of motion of the elbow joint, upper-arm circumference, muscle soreness, serum creatine kinase (CK) activity, and plasma interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) concentration were measured before, immediately after, and 24, 48, 72 and 96 h after each eccentric exercise. Changes in these variables over time were compared between curcumin and placebo conditions by two-way repeated measures ANOVA. MVC torque decreased smaller and recovered faster (e.g., 4 days post-exercise: -31 ± 13 % vs. -15 ± 15 %), and peak serum CK activity was smaller (peak: 7684 ± 8959 IU/L vs. 3398 ± 3562 IU/L) for curcumin than placebo condition (P < 0.05). However, no significant differences between conditions were evident for other variables, and no significant changes in IL-6 and TNF-α were evident after exercise. It is concluded that theracurmin ingestion attenuates some aspects of muscle damage such as MVC loss and CK activity increase.

Neuromuscular fatigue following isometric contractions with similar torque time integral.

PubMed

Rozand, V; Cattagni, T; Theurel, J; Martin, A; Lepers, R

2015-01-01

Torque time integral (TTI) is the combination of intensity and duration of a contraction. The aim of this study was to compare neuromuscular alterations following different isometric sub-maximal contractions of the knee extensor muscles but with similar TTI. Sixteen participants performed 3 sustained contractions at different intensities (25%, 50%, and 75% of Maximal Voluntary Contraction (MVC) torque) with different durations (68.5±33.4 s, 35.1±16.8 s and 24.8±12.9 s, respectively) but similar TTI value. MVC torque, maximal voluntary activation level (VAL), M-wave characteristics and potentiated doublet amplitude were assessed before and immediately after the sustained contractions. EMG activity of the vastus lateralis (VL) and -rectus femoris (RF) muscles was recorded during the sustained contractions. MVC torque reduction was similar in the 3 conditions after the exercise (-23.4±2.7%). VAL decreased significantly in a similar extent (-3.1±1.3%) after the 3 sustained contractions. Potentiated doublet amplitude was similarly reduced in the 3 conditions (-19.7±1.5%), but VL and RF M-wave amplitudes remained unchanged. EMG activity of VL and RF muscles increased in the same extent during the 3 contractions (VL: 54.5±40.4%; RF: 53.1±48.7%). These results suggest that central and peripheral alterations accounting for muscle fatigue are similar following isometric contractions with similar TTI. TTI should be considered in the exploration of muscle fatigue during sustained isometric contractions. © Georg Thieme Verlag KG Stuttgart · New York.

Carotid artery dissection and motor vehicle trauma: patient demographics, associated injuries and impact of treatment on cost and length of stay.

PubMed

Kray, Jared E; Dombrovskiy, Viktor Y; Vogel, Todd R

2016-07-08

Blunt carotid arterial injury (BCI) is a rare injury associated with motor vehicle collision (MVC). There are few population based analyses evaluating carotid injury associated with blunt trauma and their associated injuries as well as outcomes. The Nationwide Inpatient Sample (NIS) 2003-2010 data was queried to identify patients after MVC who had documented BCI during their hospitalizations utilizing ICD-9-CM codes. Demographics, associated injuries, interventions performed, length of stay, and cost were evaluated. 1,686,867 patients were estimated having sustained MVC; 1,168 BCI were estimated. No patients with BCI had open repair, 4.24 % had a carotid artery stent (CAS), and 95.76 % of patients had no operative intervention. Age groups associated with BCI were: 18-24 (27.8 %), 47-60 (22.3 %), 35-46 (20.6 %), 25-34 (19.1 %), >61 (10.2 %). Associated injuries included long bone fractures (28.5 %), stroke and intracranial hemorrhage (28.5 %), cranial injuries (25.6 %), thoracic injuries (23.6 %), cervical fractures (21.8 %), facial fractures (19.9 %), skull fractures (18.8 %), pelvic fractures (18.5 %), hepatic (13.3 %) and splenic (9.2 %) injuries. Complications included respiratory (44.2 %), bleeding (16.1 %), urinary tract infections (8.9 %), and sepsis (4.9 %). Overall mortality was 14.1 % without differences with regard to intervention (18.5 % vs. 13.9 %; P = 0.36). Stroke and intracranial hemorrhage was associated with a 2.7 times greater risk of mortality. Mean length of stay for patients with BCI undergoing stenting compared to no intervention were similar (13.1 days vs. 15.9 days) but had a greater mean cost ($83,030 vs. $63,200, p = 0.3). BCI is a rare injury associated with MVC, most frequently reported in younger patients. Frequently associated injuries were long bone fractures, stroke and intracranial hemorrhage, thoracic injuries, and pelvic fractures which are likely associated with the force/mechanism of injury. The majority of patients were treated without intervention, but when CAS was utilized, it did not impact mortality and trended toward increased costs.

Neuromuscular function during knee extension exercise after cold water immersion.

PubMed

Wakabayashi, Hitoshi; Wijayanto, Titis; Tochihara, Yutaka

2017-06-23

Human adaptability to cold environment has been focused on in the physiological anthropology and related research area. Concerning the human acclimatization process in the natural climate, it is necessary to conduct a research assessing comprehensive effect of cold environment and physical activities in cold. This study investigated the effect of cold water immersion on the exercise performance and neuromuscular function during maximal and submaximal isometric knee extension. Nine healthy males participated in this study. They performed maximal and submaximal (20, 40, and 60% maximal load) isometric knee extension pre- and post-immersion in 23, 26, and 34 °C water. The muscle activity of the rectus femoris (RF) and vastus lateralis (VL) was measured using surface electromyography (EMG). The percentages of the maximum voluntary contraction (%MVC) and mean power frequency (MPF) of EMG data were analyzed. The post-immersion maximal force was significantly lower in 23 °C than in 26 and 34 °C conditions (P < 0.05). The post-immersion %MVC of RF was significantly higher than pre-immersion during 60% maximal exercise in 23 and 26 °C conditions (P < 0.05). In the VL, the post-immersion %MVC was significantly higher than pre-immersion in 23 and 26 °C conditions during 20% maximal exercise and in 26 °C at 40 and 60% maximal intensities (P < 0.05). The post-immersion %MVC of VL was significantly higher in 26 °C than in 34 °C at 20 and 60% maximal load (P < 0.05). The post-immersion MPF of RF during 20% maximal intensity was significantly lower in 23 °C than in 26 and 34 °C conditions (P < 0.05), and significantly different between three water temperature conditions at 40 and 60% maximal intensities (P < 0.05). The post-immersion MPF of VL during three submaximal trials were significantly lower in 23 and 26 °C than in 34 °C conditions (P < 0.05). The lower shift of EMG frequency would be connected with the decrease in the nerve and muscle fibers conduction velocity. To compensate for the impairment of each muscle fibers function, more muscle fibers might be recruited to maintain the working load. This might result in the greater amplitude of EMG after the cold immersion.

Elastic properties of muscle-tendon complex in long-distance runners.

PubMed

Kubo, K; Kanehisa, H; Kawakami, Y; Fukunaga, T

2000-02-01

The purpose of this study was to investigate the elastic properties of muscle-tendon complex (MTC) in knee extensor muscles and the capacity for elastic energy utilization in long-distance runners (LDR) by comparing with data obtained from untrained individuals (CON). The elongation (L) of the tendon and aponeurosis of vastus lateralis muscle during isometric knee extension was determined by real-time brightness mode ultrasonography, while the subjects developed a gradually increasing torque from 0 (relaxed) to maximal effort (MVC) within 7 s. In addition, performances in two kinds of maximal vertical jumps, i.e. squatting (SJ) and counter-movement jumps (CMJ), were measured. The relationship between L muscle and force (F) was curvilinear and consisted of an initial region (toe region), characterized by a large increase in L with increasing F, immediately followed by a linear region. The slope of the regression equation for the L-F relationship in the range 50%-100% of MVC was defined as an index of MTC compliance, where the rate of the changes in L to that in muscle F at every 10% of MVC became almost constant. The maximal L (Lmax) and MTC compliance were significantly lower in LDR than in CON: 29.9 (SD 3.9) mm in LDR compared to 33.3 (SD 5.5) mm in CON for Lmax and 1.55 (SD 0.25) x 10(-2) mm.N-1 in LDR compared to 1.88 (SD 0.82) x 10(-2) mm.N-1 in CON for MTC compliance. Also, LDR showed significantly less elastic energy absorption (Ee) than CON, defined as the area below the L-F relationship curve from 0 to 100% of MVC. Not only jump heights but also the differences between the heights in SJ and CMJ, expressed as the percentage of the height in SJ, were significantly lower in LDR than in CON. The augmentation with counter-movement was significantly correlated to either MTC compliance (r = 0.554, P < 0.05) or Ee (r = 0.563, P < 0.05). Thus, the present results would indicate that MTC of vastus lateralis muscle is less compliant and its potential for energy storage during MTS lengthening is lower in LDR than untrained individuals. These elastic profiles of vastus lateralis muscle in LDR may be associated with their lower performances during CMJ.

Does serum 25-hydroxyvitamin D influence muscle development during puberty in girls? A 7-year longitudinal study.

PubMed

Wang, Ru; Alen, Markku; Yu, Zhusheng; Wiklund, Petri; Cheng, Shu Mei; Törmäkangas, Timo; Chen, Peijie; Cheng, Sulin

2013-01-01

Vitamin D is well known for its regulatory role in calcium and phosphate homeostasis, but its role in muscle mass and strength during growth remains inconclusive. We explored the association of serum 25-hydroxyvitamin D (25(OH)D) with muscle development in girls from 11 to 18-years old. Whole body lean tissue mass (LMWB), appendicular lean mass (aLM), muscle cross-sectional area at the lower leg (mCSA), maximal voluntary contraction of elbow flexors (MVC elbow) and knee extensors (MVC knee) were assessed in 217 girls aged 10-13 years (at baseline), 215 in 2-year and 226 in 7.5-year follow-up. Serum concentration of 25(OH)D and intact parathyroid hormone (PTH) were analyzed retrospectively and girls were categorized according to their 25(OH)D levels (consistently insufficient 25(OH)D GLL <50 nmol/l and consistently sufficient GHH >50 nmol/l from baseline to 7-year follow-up). We found that 25(OH)D level declined until menarche (p<0.05) while LMWB, aLM, mCSA, MVC elbow and MVC knee continued to increase (p<0.001 for all) post menarche. At pre-menarche, the GLL (n = 34) had higher LMWB and aLM than the GHH (n = 21, p<0.05), while post-menarche the GHH (n = 15) had a greater catch-up gain in LMWB (p = 0.004), aLM (p = 0.001) and mCSA (p = 0.027) compared to the GLL (n = 65) over the first 2-year period. At the age of 18, no differences in muscle mass/strength between the low (n = 151) and high (n = 77) levels of 25(OH)D groups were found. This finding was independent of vitamin D receptor genotype and other confounders. In conclusion, our results showed that levels of 25(OH)D have no significant negative influence on the development of muscle mass and strength during pubertal growth both with longitudinal and cross-sectional comparison. On the contrary, our results suggest that the temporary negative association between 25(OH)D and muscle mass arises as a consequence of fast growth prior to menarche, and this negative association is diminished through catch-up growth after menarche.

Prediction of HIV-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach.

PubMed

Sierra, Saleta; Kaiser, Rolf; Lübke, Nadine; Thielen, Alexander; Schuelter, Eugen; Heger, Eva; Däumer, Martin; Reuter, Stefan; Esser, Stefan; Fätkenheuer, Gerd; Pfister, Herbert; Oette, Mark; Lengauer, Thomas

2011-12-01

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by the majority of HIV strains in order to infect the human immune cells (Fig. 1). Other HIV isolates use a different coreceptor, the CXCR4. Which receptor is used, is determined in the virus by the Env protein (Fig. 2). Depending on the coreceptor used, the viruses are classified as R5 or X4, respectively. MVC binds to the CCR5 receptor inhibiting the entry of R5 viruses into the target cell. During the course of disease, X4 viruses may emerge and outgrow the R5 viruses. Determination of coreceptor usage (also called tropism) is therefore mandatory prior to administration of MVC, as demanded by EMA and FDA. The studies for MVC efficiency MOTIVATE, MERIT and 1029 have been performed with the Trofile assay from Monogram, San Francisco, U.S.A. This is a high quality assay based on sophisticated recombinant tests. The acceptance for this test for daily routine is rather low outside of the U.S.A., since the European physicians rather tend to work with decentralized expert laboratories, which also provide concomitant resistance testing. These laboratories have undergone several quality assurance evaluations, the last one being presented in 2011. For several years now, we have performed tropism determinations based on sequence analysis from the HIV env-V3 gene region (V3). This region carries enough information to perform a reliable prediction. The genotypic determination of coreceptor usage presents advantages such as: shorter turnover time (equivalent to resistance testing), lower costs, possibility to adapt the results to the patients' needs and possibility of analysing clinical samples with very low or even undetectable viral load (VL), particularly since the number of samples analysed with VL < 1000 copies/μl roughly increased in the last years (Fig. 3). The main steps for tropism testing (Fig. 4) demonstrated in this video: Collection of a blood sample Isolation of the HIV RNA from the plasma and/or HIV proviral DNA from blood mononuclear cells Amplification of the env region Amplification of the V3 region Sequence reaction of the V3 amplicon Purification of the sequencing samples Sequencing the purified samples Sequence editing Sequencing data interpretation and tropism prediction.

Analysis of linear electrode array EMG for assessment of hemiparetic biceps brachii muscles.

PubMed

Yao, Bo; Zhang, Xu; Li, Sheng; Li, Xiaoyan; Chen, Xiang; Klein, Cliff S; Zhou, Ping

2015-01-01

This study presents a frequency analysis of surface electromyogram (EMG) signals acquired by a linear electrode array from the biceps brachii muscles bilaterally in 14 hemiparetic stroke subjects. For different levels of isometric contraction ranging from 10 to 80% of the maximum voluntary contraction (MVC), the power spectra of 19 bipolar surface EMG channels arranged proximally to distally along the muscle fibers were examined in both paretic and contralateral muscles. It was found that across all stroke subjects, the median frequency (MF) and the mean power frequency (MPF), averaged from different surface EMG channels, were significantly smaller in the paretic muscle compared to the contralateral muscle at each of the matched percent MVC contractions. The muscle fiber conduction velocity (MFCV) was significantly slower in the paretic muscle than in the contralateral muscle. No significant correlation between the averaged MF, MPF, or MFCV vs. torque was found in both paretic and contralateral muscles. However, there was a significant positive correlation between the global MFCV and MF. Examination of individual EMG channels showed that electrodes closest to the estimated muscle innervation zones produced surface EMG signals with significantly higher MF and MPF than more proximal or distal locations in both paretic and contralateral sides. These findings suggest complex central and peripheral neuromuscular alterations (such as selective loss of large motor units, disordered control of motor units, increased motor unit synchronization, and atrophy of muscle fibers, etc.) which can collectively influence the surface EMG signals. The frequency difference with regard to the innervation zone also confirms the relevance of electrode position in surface EMG analysis.

Are 1994 alcohol production and the sales deregulation policy in Japan associated with increased road traffic fatalities among adult and teenage males and females in Japan?

PubMed

Desapriya, Ediriweera; Fujiwara, Takeo; Scime, Giulia; Sasges, Deborah; Pike, Ian; Shimizu, Shinji

2009-10-01

International studies have shown a significant association between alcohol availability and traffic crashes that involve alcohol-impaired drivers. A key limitation to previous alcohol availability and motor vehicle crash (MVC) evaluation research is the assumption of population homogeneity in responding to the policies. The present analysis focuses on the evaluation of the impact of alcohol availability on different segments of the Japanese population by comparing MVC fatality rates from before and after implementation of the alcohol deregulation policy in 1994. Poisson regression with robust standard error was used to model the before-to-after change in incidence rate ratios (IRR) in adult males, adult females, teenage males and teenage females. To control potential confounders, unemployment rate, vehicle miles of travel (VMT), vehicle registration, and number of drivers licensed in Japan were added to the model. The exponents of the fitted coefficients are equivalent to incidence rate ratios. Implementation of the policy deregulating alcohol sales and production did not appear to increase traffic fatalities among adult or teenage males or females in Japan. We found that male adult fatalities demonstrated a statistically significant decline following enactment of the deregulation policy in 1994. Contrary to previous research, the findings of this study demonstrated lower rates of fatalities and higher compliance with alcohol-related driving legislation in Japanese society following implementation of the deregulation policy in 1994. Further well designed, nonaligned studies on alcohol availability and traffic fatalities in other countries are urgently needed.

Alterations in muscular performance and orthostatic tolerance during Ramadan.

PubMed

Bigard, A X; Boussif, M; Chalabi, H; Guezennec, C Y

1998-04-01

During Ramadan, physiological changes are expected to result from both long-term dietary restriction and partial sleep loss. We speculated that Ramadan fasting has deleterious effects on muscle performances and on orthostatic tolerance. There were 11 senior fighter pilots tested on three occasions during the first week of Ramadan (Beg-R), during the fourth week (End-R) and during a control period, 2 mo after Ramadan (C). Each test session consisted of an assessment of the strength and endurance performances of the knee extensors and elbow flexors and of an analysis of the HR and BP responses to the orthostatic stress imposed by a 80 degrees head-up tilt. Body weight decreased by 2.7% at End-R in comparison with C period (p < 0.01). Maximum isometric strength (MVC) of elbow flexor muscles decreased immediately (by 10-12%; p < 0.05). Muscular endurance at both 35 and 70% MVC were lower at End-R in comparison with C period (-28%, -22%, respectively; p < 0.05). The head-up tilt test at End-R was accompanied by a higher increase in heart response than during orthostasis during C and Beg-R periods, and by a decrease in pulse pressures (p < 0.001). These alterations in responses to the head-up tilt were associated with a fall by about 7% in plasma volume. These data demonstrate that Ramadan fasting leads to an impairment in muscular performances and to a decrease in orthostatic tolerance. Further studies are needed to verify the impact of these changes on +Gz tolerance.

The impact of type 1 diabetes and diabetic polyneuropathy on muscle strength and fatigability.

PubMed

Orlando, Giorgio; Balducci, Stefano; Bazzucchi, Ilenia; Pugliese, Giuseppe; Sacchetti, Massimo

2017-06-01

Although it is widely accepted that diabetic polyneuropathy (DPN) is linked to a marked decline in neuromuscular performance, information on the possible impact of type 1 diabetes (T1D) on muscle strength and fatigue remains unclear. The purpose of this study was to investigate the effects of T1D and DPN on strength and fatigability in knee extensor muscles. Thirty-one T1D patients (T1D), 22 T1D patients with DPN (DPN) and 23 matched healthy control participants (C) were enrolled. Maximal voluntary contraction (MVC) and endurance time at an intensity level of 50% of the MVC were assessed at the knee extensor muscles with an isometric dynamometer. Clinical characteristics of diabetic patients were assessed by considering a wide range of vascular and neurological parameters. DPN group had lower knee extensor muscles strength than T1D (-19%) and the C group (-37.5%). T1D group was 22% weaker when compared to the C group. Lower body muscle fatigability of DPN group was 22 and 45.5% higher than T1D and C group, respectively. T1D group possessed a higher fatigability (29.4%) compared to C group. A correlation was found between motor and sensory nerve conduction velocity and muscle strength and fatigability. Patients with T1D are characterised by both a higher fatigability and a lower muscle strength, which are aggravated by DPN. Our data suggest that factors other than nervous damage play a role in the pathogenesis of such defect.

Age and sex differences in steadiness of elbow flexor muscles with imposed cognitive demand

PubMed Central

Pereira, Hugo M.; Spears, Vincent C.; Schlinder-Delap, Bonnie; Yoon, Tejin; Nielson, Kristy A.; Hunter, Sandra K.

2015-01-01

Purpose These studies determined (1) age and sex-related differences in steadiness of isometric contractions when high cognitive demand was imposed across a range of forces with the elbow flexor muscles (study 1) and, (2) sex differences in steadiness among older adults when low cognitive demand was imposed (study 2). Methods 36 young adults (18–25 years; 18 women) and 30 older adults (60–82 years; 17 women) performed isometric contractions at 5%, 30% and 40% of maximum voluntary contraction (MVC). Study 1 involved a high-cognitive demand session (serial subtractions by 13 during the contraction) and a control session (no mental math). Study 2 (older adults only) involved a low-cognitive demand session (subtracting by 1s). Results Older individuals exhibited greater increases in force fluctuations (coefficient of variation of force, CV) with high cognitive demand than young adults, with the largest age difference at 5% MVC (P = 0.01). Older adults had greater agonist EMG activity with high-cognitive demand and women had greater coactivation than men (P<0.05). In study 2, CV of force increased with low cognitive demand for the older women but not for the older men (P = 0.03). Conclusion Older adults had reduced steadiness and increased muscle activation when high cognitive demand was imposed while low cognitive demand induced increased force fluctuations in older women but not older men. These findings have implications for daily and work-related tasks that involve cognitive demand performed simultaneously during submaximal isometric contractions in an aging workforce. PMID:25633070

Multi-Variant/Capability Next Generation Troop Seat (M-V/C NGTS)

DTIC Science & Technology

2009-01-01

John Plaga , Work Unit Manager MARK M. HOFFMAN Deputy Chief Biomechanics Branch Biosciences and Protection Division Human...John A. Plaga a. REPORT U b. ABSTRACT U c. THIS PAGE U SAR 20 19b. TELEPHONE NUMBER (include area

The interaction of respiration and visual feedback on the control of force and neural activation of the agonist muscle

PubMed Central

Baweja, Harsimran S.; Patel, Bhavini K.; Neto, Osmar P.; Christou, Evangelos A.

2011-01-01

The purpose of this study was to compare force variability and the neural activation of the agonist muscle during constant isometric contractions at different force levels when the amplitude of respiration and visual feedback were varied. Twenty young adults (20–32 years, 10 men and 10 women) were instructed to accurately match a target force at 15 and 50% of their maximal voluntary contraction (MVC) with abduction of the index finger while controlling their respiration at different amplitudes (85, 100 and 125% normal) in the presence and absence of visual feedback. Each trial lasted 22 s and visual feedback was removed from 8–12 to 16–20 s. Each subject performed 3 trials with each respiratory condition at each force level. Force variability was quantified as the standard deviation of the detrended force data. The neural activation of the first dorsal interosseus (FDI) was measured with bipolar surface electrodes placed distal to the innervation zone. Relative to normal respiration, force variability increased significantly only during high-amplitude respiration (~63%). The increase in force variability from normal- to high-amplitude respiration was strongly associated with amplified force oscillations from 0–3 Hz (R2 ranged from .68 – .84; p < .001). Furthermore, the increase in force variability was exacerbated in the presence of visual feedback at 50% MVC (vision vs. no-vision: .97 vs. .87 N) and was strongly associated with amplified force oscillations from 0–1 Hz (R2 = .82) and weakly associated with greater power from 12–30 Hz (R2 = .24) in the EMG of the agonist muscle. Our findings demonstrate that high-amplitude respiration and visual feedback of force interact and amplify force variability in young adults during moderate levels of effort. PMID:21546109

Short-term transcutaneous electrical nerve stimulation reduces pain and improves the masticatory muscle activity in temporomandibular disorder patients: a randomized controlled trial.

PubMed

Ferreira, Ana Paula de Lima; Costa, Dayse Regina Alves da; Oliveira, Ana Izabela Sobral de; Carvalho, Elyson Adam Nunes; Conti, Paulo César Rodrigues; Costa, Yuri Martins; Bonjardim, Leonardo Rigoldi

2017-01-01

To investigate the short-term effect of transcutaneous electrical nerve stimulation (TENS) by examining pain intensity, pressure pain threshold (PPT) and electromyography (EMG) activity in patients with temporomandibular disorder (TMD). Forty patients with myofascial TMD were enrolled in this randomized placebo-controlled trial and were divided into two groups: active (n=20) and placebo (n=20) TENS. Outcome variables assessed at baseline (T0), immediately after (T2) and 48 hours after treatment (T1) were: pain intensity with the aid of a visual analogue scale (VAS); PPT of masticatory and cervical structures; EMG activity during mandibular rest position (MR), maximal voluntary contraction (MVC) and habitual chewing (HC). Two-way ANOVA for repeated measures was applied to the data and the significance level was set at 5%. There was a decrease in the VAS values at T1 and T2 when compared with T0 values in the active TENS group (p<0.050). The PPT between-group differences were significant at T1 assessment of the anterior temporalis and sternocleidomastoid (SCM) and T2 for the masseter and the SCM (p<0.050). A significant EMG activity reduction of the masseter and anterior temporalis was presented in the active TENS during MR at T1 assessment when compared with T0 (p<0.050). The EMG activity of the anterior temporalis was significantly higher in the active TENS during MVC at T1 and T2 when compared with placebo (p<0.050). The EMG activity of the masseter and anterior temporalis muscle was significantly higher in the active TENS during HC at T1 when compared with placebo (p<0.050). The short-term therapeutic effects of TENS are superior to those of the placebo, because of reported facial pain, deep pain sensitivity and masticatory muscle EMG activity improvement.

Plyometric training improves voluntary activation and strength during isometric, concentric and eccentric contractions.

PubMed

Behrens, Martin; Mau-Moeller, Anett; Mueller, Karoline; Heise, Sandra; Gube, Martin; Beuster, Nico; Herlyn, Philipp K E; Fischer, Dagmar-C; Bruhn, Sven

2016-02-01

This study investigated effects of plyometric training (6 weeks, 3 sessions/week) on maximum voluntary contraction (MVC) strength and neural activation of the knee extensors during isometric, concentric and eccentric contractions. Twenty-seven participants were randomly assigned to the intervention or control group. Maximum voluntary torques (MVT) during the different types of contraction were measured at 110° knee flexion (180°=full extension). The interpolated twitch technique was applied at the same knee joint angle during isometric, concentric and eccentric contractions to measure voluntary activation. In addition, normalized root mean square of the EMG signal at MVT was calculated. The twitch torque signal induced by electrical nerve stimulation at rest was used to evaluate training-related changes at the muscle level. In addition, jump height in countermovement jump was measured. After training, MVT increased by 20Nm (95% CI: 5-36Nm, P=0.012), 24Nm (95% CI: 9-40Nm, P=0.004) and 27Nm (95% CI: 7-48Nm, P=0.013) for isometric, concentric and eccentric MVCs compared to controls, respectively. The strength enhancements were associated with increases in voluntary activation during isometric, concentric and eccentric MVCs by 7.8% (95% CI: 1.8-13.9%, P=0.013), 7.0% (95% CI: 0.4-13.5%, P=0.039) and 8.6% (95% CI: 3.0-14.2%, P=0.005), respectively. Changes in the twitch torque signal of the resting muscle, induced by supramaximal electrical stimulation of the femoral nerve, were not observed, indicating no alterations at the muscle level, whereas jump height was increased. Given the fact that the training exercises consisted of eccentric muscle actions followed by concentric contractions, it is in particular relevant that the plyometric training increased MVC strength and neural activation of the quadriceps muscle regardless of the contraction mode. Copyright © 2015 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Hormonal and Neuromuscular Responses to Mechanical Vibration Applied to Upper Extremity Muscles

PubMed Central

Di Giminiani, Riccardo; Fabiani, Leila; Baldini, Giuliano; Cardelli, Giovanni; Giovannelli, Aldo; Tihanyi, Jozsef

2014-01-01

Objective To investigate the acute residual hormonal and neuromuscular responses exhibited following a single session of mechanical vibration applied to the upper extremities among different acceleration loads. Methods Thirty male students were randomly assigned to a high vibration group (HVG), a low vibration group (LVG), or a control group (CG). A randomized double-blind, controlled-parallel study design was employed. The measurements and interventions were performed at the Laboratory of Biomechanics of the University of L'Aquila. The HVG and LVG participants were exposed to a series of 20 trials ×10 s of synchronous whole-body vibration (WBV) with a 10-s pause between each trial and a 4-min pause after the first 10 trials. The CG participants assumed an isometric push-up position without WBV. The outcome measures were growth hormone (GH), testosterone, maximal voluntary isometric contraction during bench-press, maximal voluntary isometric contraction during handgrip, and electromyography root-mean-square (EMGrms) muscle activity (pectoralis major [PM], triceps brachii [TB], anterior deltoid [DE], and flexor carpi radialis [FCR]). Results The GH increased significantly over time only in the HVG (P = 0.003). Additionally, the testosterone levels changed significantly over time in the LVG (P = 0.011) and the HVG (P = 0.001). MVC during bench press decreased significantly in the LVG (P = 0.001) and the HVG (P = 0.002). In the HVG, the EMGrms decreased significantly in the TB (P = 0.006) muscle. In the LVG, the EMGrms decreased significantly in the DE (P = 0.009) and FCR (P = 0.006) muscles. Conclusion Synchronous WBV acutely increased GH and testosterone serum concentrations and decreased the MVC and their respective maximal EMGrms activities, which indicated a possible central fatigue effect. Interestingly, only the GH response was dependent on the acceleration with respect to the subjects' responsiveness. PMID:25368995

Upper Limb Asymmetry in the Sense of Effort Is Dependent on Force Level

PubMed Central

Mitchell, Mark; Martin, Bernard J.; Adamo, Diane E.

2017-01-01

Previous studies have shown that asymmetries in upper limb sensorimotor function are dependent on the source of sensory and motor information, hand preference and differences in hand strength. Further, the utilization of sensory and motor information and the mode of control of force may differ between the right hand/left hemisphere and left hand/right hemisphere systems. To more clearly understand the unique contribution of hand strength and intrinsic differences to the control of grasp force, we investigated hand/hemisphere differences when the source of force information was encoded at two different force levels corresponding to a 20 and 70% maximum voluntary contraction or the right and left hand of each participant. Eleven, adult males who demonstrated a stronger right than left maximum grasp force were requested to match a right or left hand 20 or 70% maximal voluntary contraction reference force with the opposite hand. During the matching task, visual feedback corresponding to the production of the reference force was available and then removed when the contralateral hand performed the match. The matching relative force error was significantly different between hands for the 70% MVC reference force but not for the 20% MVC reference force. Directional asymmetries, quantified as the matching force constant error, showed right hand overshoots and left undershoots were force dependent and primarily due to greater undershoots when matching with the left hand the right hand reference force. Findings further suggest that the interaction between internal sources of information, such as efferent copy and proprioception, as well as hand strength differences appear to be hand/hemisphere system dependent. Investigations of force matching tasks under conditions whereby force level is varied and visual feedback of the reference force is available provides critical baseline information for building effective interventions for asymmetric (stroke-related, Parkinson’s Disease) and symmetric (Amyotrophic Lateral Sclerosis) upper limb recovery of neurological conditions where the various sources of sensory – motor information have been significantly altered by the disease process. PMID:28491047

Upper Limb Asymmetry in the Sense of Effort Is Dependent on Force Level.

PubMed

Mitchell, Mark; Martin, Bernard J; Adamo, Diane E

2017-01-01

Previous studies have shown that asymmetries in upper limb sensorimotor function are dependent on the source of sensory and motor information, hand preference and differences in hand strength. Further, the utilization of sensory and motor information and the mode of control of force may differ between the right hand/left hemisphere and left hand/right hemisphere systems. To more clearly understand the unique contribution of hand strength and intrinsic differences to the control of grasp force, we investigated hand/hemisphere differences when the source of force information was encoded at two different force levels corresponding to a 20 and 70% maximum voluntary contraction or the right and left hand of each participant. Eleven, adult males who demonstrated a stronger right than left maximum grasp force were requested to match a right or left hand 20 or 70% maximal voluntary contraction reference force with the opposite hand. During the matching task, visual feedback corresponding to the production of the reference force was available and then removed when the contralateral hand performed the match. The matching relative force error was significantly different between hands for the 70% MVC reference force but not for the 20% MVC reference force. Directional asymmetries, quantified as the matching force constant error, showed right hand overshoots and left undershoots were force dependent and primarily due to greater undershoots when matching with the left hand the right hand reference force. Findings further suggest that the interaction between internal sources of information, such as efferent copy and proprioception, as well as hand strength differences appear to be hand/hemisphere system dependent. Investigations of force matching tasks under conditions whereby force level is varied and visual feedback of the reference force is available provides critical baseline information for building effective interventions for asymmetric (stroke-related, Parkinson's Disease) and symmetric (Amyotrophic Lateral Sclerosis) upper limb recovery of neurological conditions where the various sources of sensory - motor information have been significantly altered by the disease process.

Arterial baroreflex control of muscle blood flow at the onset of voluntary locomotion in mice

PubMed Central

Masuki, Shizue; Nose, Hiroshi

2003-01-01

To assess the role of arterial baroreflex control in muscle blood flow (MBF) and voluntary locomotion, mean arterial pressure (MAP), MBF, and electromyograms (EMGs) were measured in freely moving mice before (CNT) and after blocking the afferent or efferent pathway of arterial baroreflexes, carotid sinus denervation (CSD), or intraperitoneal administration of phentolamine (BLK), respectively. MAP was measured through a catheter placed in the femoral artery. MBF was measured with a needle-type laser-Doppler flowmeter and recorded through a low-pass filter with an edge frequency of 0.1 Hz. The frequency and duration of locomotion were judged from EMG recordings in the hindlimb. These probes were implanted at least 2 days before the measurements. Muscle vascular conductance (MVC = MBF/MAP) in all groups started to rise within 1 s after the onset of locomotion, but the increasing rate in CSD and BLK was significantly higher than in CNT for the first 9 s (P < 0.001). MAP in CSD and BLK significantly decreased below the baseline within 1 s and this was highly correlated with the increase in MVC for the first 9 s (R2 = 0.842, P < 0.001), whereas MAP in CNT increased significantly 8 s after the onset of locomotion. Although the total period of movement in a free-moving state for 60 min was not significantly different between CNT and CSD (P > 0.1), the frequency of movement with a short duration of 0.1–0.4 min was higher in CSD than in CNT (P < 0.001), which was highly correlated with the reduction in MAP accompanying each period of movement (R2 = 0.883, P < 0.01). These results suggest that arterial baroreflexes suppress vasodilatation in contracting muscle to maintain MAP at the onset of voluntary locomotion, and are necessary to continue a given duration of locomotion in mice. PMID:12937292

Dynamic Assembly, Assessment, Assurance, and Adaptation via Heterogeneous Software Connectors

DTIC Science & Technology

2004-10-01

Versioning Connectors (MVC) Representative of runtime monitoring gauges are multiversioning gauges, which monitor and analyze different versions of...multiple versions of the same component must be merged by the connector before they are forwarded to their target components. The multiversioning

The impact of safety belt use on liver injuries in motor vehicle crashes: the importance of motor vehicle safety systems.

PubMed

Holbrook, Troy Lisa; Hoyt, David B; Eastman, A Brent; Sise, Michael J; Kennedy, Frank; Velky, Tom; Conroy, Carol; Pacyna, Sharon; Erwin, Steve

2007-08-01

Liver injuries (LIs) are one of the most serious and common consequences of motor vehicle crashes (MVCs). In the unstable patient, early detection of LI based on clinical suspicion will improve acute trauma care and outcomes. The specific objectives of this analysis are to identify crash scene and occupant risk factors for LI from MVC. Crash Injury Research and Engineering Network data were used to identify risk factors for LI; age, sex, safety belt use, air bag deployment, DeltaV (change in velocity), principal direction of force, vehicle crush, and intrusion. Occupants with LI were compared with four control groups without LI; (1) no abdominal (ABD) injury (NO_ABD), (2) any ABD (ANY_ABD), (3) ABD Abbreviated Injury Scale score of 1 to 2 (ABD_1-2), and (4) ABD Abbreviated Injury Scale score of 3 or more (ABD_3+). LI occupants were compared with each control group and odds ratios (OR) for risk of LI were computed. There were 311 Crash Injury Research and Engineering Network subjects aged 5 or more years with LI. The total mean Injury Severity Score was 37.6. LI was strongly and significantly associated with safety belt restraint use without air bag deployment, compared with each control group: Liver injury - restrained + air bag not deployed versus (1) NO_ABD, N = 1,519; OR = 4.4, (2) ANY_ABD, N = 317; OR = 2.6, (3) ABD_1 to 2, N = 155; OR = 3.1, (4) ABD_3+, N = 217; OR = 2.4 (p < 0.001). This association was independent of driver or passenger status and principal direction of force. LIs were also strongly and significantly associated with greater vehicle interior intrusion. LIs were strongly associated with a safety belt restraint in use in the absence of air bag deployment during MVC. This data may have profound importance to the trauma surgeon as an early indicator for LI during resuscitation. These findings also have important implications for future research efforts to improve safety systems in motor vehicles and reduce morbidity and mortality from MVCs in the United States.

Reliability of Lactation Assessment Tools Applied to Overweight and Obese Women.

PubMed

Chapman, Donna J; Doughty, Katherine; Mullin, Elizabeth M; Pérez-Escamilla, Rafael

2016-05-01

The interrater reliability of lactation assessment tools has not been evaluated in overweight/obese women. This study aimed to compare the interrater reliability of 4 lactation assessment tools in this population. A convenience sample of 45 women (body mass index > 27.0) was videotaped while breastfeeding (twice daily on days 2, 4, and 7 postpartum). Three International Board Certified Lactation Consultants independently rated each videotaped session using 4 tools (Infant Breastfeeding Assessment Tool [IBFAT], modified LATCH [mLATCH], modified Via Christi [mVC], and Riordan's Tool [RT]). For each day and tool, we evaluated interrater reliability with 1-way repeated-measures analyses of variance, intraclass correlation coefficients (ICCs), and percentage absolute agreement between raters. Analyses of variance showed significant differences between raters' scores on day 2 (all scales) and day 7 (RT). Intraclass correlation coefficient values reflected good (mLATCH) to excellent reliability (IBFAT, mVC, and RT) on days 2 and 7. All day 4 ICCs reflected good reliability. The ICC for mLATCH was significantly lower than all others on day 2 and was significantly lower than IBFAT (day 7). Percentage absolute interrater agreement for scale components ranged from 31% (day 2: observable swallowing, RT) to 92% (day 7: IBFAT, fixing; and mVC, latch time). Swallowing scores on all scales had the lowest levels of interrater agreement (31%-64%). We demonstrated differences in the interrater reliability of 4 lactation assessment tools when applied to overweight/obese women, with the lowest values observed on day 4. Swallowing assessment was particularly unreliable. Researchers and clinicians using these scales should be aware of the differences in their psychometric behavior. © The Author(s) 2015.

Legal consequences for alcohol-impaired drivers injured in motor vehicle collisions: A systematic review.

PubMed

Green, Robert S; Kureshi, Nelofar; Erdogan, Mete

2015-07-01

The treatment of alcohol-impaired drivers injured in a motor vehicle collision (MVC) is a complex public health issue. We conducted a systematic review to describe the legal consequences for alcohol-impaired drivers injured in a MVC and taken to a hospital or trauma center. Methods We searched MEDLINE, Embase, and CINAHL databases from inception until August 2014. We included studies that reported legal consequences including charges or convictions of injured drivers taken to a hospital or trauma center after a MVC with a blood alcohol concentration (BAC) exceeding the legal limit.Results Twenty-six studies met inclusion criteria; twenty studies were conducted in the USA, five in Canada, and one in Sweden. All were cohort studies (23 retrospective, 3 prospective) and included 11,409 patients overall. A total of 5,127 drivers had a BAC exceeding the legal limit, with legal consequences reported in 4937 cases. The median overall DUI/DWI conviction rate was 13% (range 0-85%). The median percentage of drivers with a previous conviction on their record for driving under the influence (DUI) or driving while intoxicated (DWI) was 15.5% (range 6-40%). The median percentage of drivers convicted again for DUI/DWI during the study period was 3.5% (range 2-10%). Heterogeneity between study designs, legal jurisdictions, institutional procedures and policies for obtaining a legally admissible BAC measurement precluded a meta-analysis. Conclusions The majority of intoxicated drivers injured in MVCs and seen in the emergency department are never charged or convicted. A substantial proportion of injured intoxicated drivers had more than one conviction for DUI/DWI on their police record. Copyright © 2015 Elsevier Ltd. All rights reserved.

Quantifying the Risk of Spinal Injury in Motor Vehicle Collisions According to Ambulatory Status: A Prospective Analytical Study.

PubMed

McCoy, Christopher Eric; Loza-Gomez, Angelica; Lee Puckett, James; Costantini, Samantha; Penalosa, Patrick; Anderson, Craig; Schultz, Carl

2017-02-01

The association between ambulation at the scene of a motor vehicle collision (MVC) and spinal injury has never been quantified. To evaluate the association between ambulation and spinal injury in patients involved in a MVC. Prospective analytical-observational cohort study. Inclusion: patients sustaining traumatic injury in a MVC. Exclusion: < 18 years old, pregnancy. spinal injury defined as injury to the cervical, thoracic, or lumbar spinal cord, bones, or ligaments. Secondary outcome: Injury resulting in neurological deficit, need for surgery, or death. A generalized linear model was used to evaluate the association between outcome and predictor variables. Risk ratios [RR] were reported with a point estimate and 95% confidence interval (CI). A two-tailed alpha of < 0.05 was the threshold for statistical significance. There were 704 patients analyzed. Nonambulatory patients were 2.29 times more likely to sustain a spinal injury, compared to ambulatory patients (RR 2.29, 95% CI 1.34-3.91). Patients ≥ 65 years of age were 3.27 times more likely to sustain a spinal injury (RR 3.27, 95% CI 1.66-6.45). Patients with a Glasgow Coma Scale score ≤ 8 were 4.93 times more likely to sustain a spinal injury (RR 4.93, 95% CI 1.86-13.10). In this prospective analytical-observational study evaluating the association between ambulatory status and spinal injury in patients involved in MVCs, we observed that those patients who were nonambulatory were more than two times as likely to have a spinal injury compared to those patients who were ambulatory at the scene. Copyright © 2016 Elsevier Inc. All rights reserved.

Examination of the impact of airbags on renal injury using a national database.

PubMed

Smith, Thomas G; Wessells, Hunter B; Mack, Chris D; Kaufman, Robert; Bulger, Eileen M; Voelzke, Bryan B

2010-09-01

Little is known about preventative measures to lessen solid organ injury in motor vehicle collisions (MVCs). To evaluate the efficacy of airbags in reducing renal injuries in MVC, we analyzed renal injury rates in vehicles with and without airbags using the Crash Injury Research and Engineering Network (CIREN) database. The CIREN database was queried for MVC and renal injury from 1996 to September 2008. CIREN is weighted toward late model vehicles and selects more severely injured patients. Search fields were primary direction of force (PDOF), presence of airbags, and location of airbags (steering wheel, instrument panel, seat back, door panel, and roof-side curtain). Abdominal Abbreviated Injury Score was converted to AAST renal injury grade. Renal injury rates were compared between vehicles with and without frontal and side airbags. We reviewed 2,864 records and identified 139 renal injuries (28.9% AAST grade III to V). In MVCs with renal injuries, frontal impact was 54.7% of total (n = 76) and side impact was 45.3% of total (n = 63). Most occupants in frontal impact MVCs had exposure to a steering wheel airbag (74.9%); 16.6% had an instrument panel (passenger) airbags. In side impact MVCs, 32.2% of occupants had a side airbag. Compared with the non-airbags cohort, frontal airbags and side airbags were associated with a 45.3% and 52.8% reduction in renal injury, respectively. Passengers in automobiles with frontal and side airbags have a reduced rate of renal injury compared with those without airbags. Our data support further study of the role of airbags in reducing renal injury after MVC. Copyright 2010 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Muscle fascicle behavior during eccentric cycling and its relation to muscle soreness.

PubMed

Peñailillo, Luis; Blazevich, Anthony J; Nosaka, Kazunori

2015-04-01

A single bout of eccentric exercise confers a protective effect against muscle damage and soreness in subsequent eccentric exercise bouts, but the mechanisms underpinning this effect are unclear. This study compared vastus lateralis (VL) muscle-tendon behavior between two eccentric cycling bouts to test the hypothesis that muscle-tendon behavior would be different between bouts and would be associated with the protective effect. Eleven untrained men (27.1 ± 7.0 yr) performed two bouts of eccentric cycling (ECC1 and ECC2) separated by 2 wk for 10 min at 65% of maximal concentric workload (191.9 ± 44.2 W) each. Muscle soreness (by visual analog scale) and maximal voluntary isometric contraction (MVC) torque of the knee extensors were assessed before and 1-2 d after exercise. Using ultrasonography, VL fascicle length and angle changes during cycling were assessed, and tendinous tissue (TT) length changes were estimated. VL EMG amplitude, crank torque, and knee joint angles were measured during cycling. Soreness was greater (P < 0.0001) after ECC1 than ECC2, although MVC changes were not different between bouts (P = 0.47). No significant differences in peak EMG amplitude (normalized to EMG during MVC), crank peak torque, or knee angles were evident between bouts. However, fascicle elongation was 16% less during ECC2 than ECC1 (P < 0.01), indicating less fascicle strain in ECC2. Maximum TT length occurred at a smaller knee joint angle during ECC2 than ECC1 (P = 0.055). These results suggest that a lesser fascicle elongation and earlier TT elongation were associated with reduced muscle soreness after ECC2 than ECC1; thus, changes in muscle-tendon behavior may be an important mechanism underpinning the protective effect.

Effects of pretension on work and power output of the muscle-tendon complex in dynamic elbow flexion.

PubMed

Wakayama, Akinobu; Nagano, Akinori; Hay, Dean; Fukashiro, Senshi

2005-06-01

The purpose of the present study was to investigate the effects of pretension on work and power output of the muscle-tendon complex during dynamic elbow flexion under several submaximal and maximal conditions. The subjects were 10 healthy female students. Randomized trials from 0% to 100% maximal voluntary contraction (MVC) pretension (PT) at 60 degrees elbow flexion were conducted. After about 3 s of static PT, subjects maximally flexed the elbow joint to 90 degrees using a quick release method. The weight was individually selected for each subject to provide an optimal load for the development of maximal power. A Hill-type model was utilized to analyze the performance of the elbow muscle-tendon complex (MTC). PT 0, 30, 60 and 90% MVC data were used for comparison, and all data were expressed as the mean and standard deviation. Multiple paired comparisons between the value of PT 0% MVC and that of the other PT levels were performed post-hoc using Dunnett's method. The work of the series elastic component (SEC) increased gradually with the PT level because elastic energy was stored in the PT phase. However, the work of the contractile component (CC) decreased gradually with an increase in PT level. Moreover, the work of the MTC also decreased, closely related to the CC work decrement. The phenomenon of CC work decrement was caused by force depression and was not related to either the force-length or force-velocity relationships of the CC. EMG activity (agonist and antagonist) showed no significant differences. Muscle geometry changes or intracellular chemical shifts may have occurred in the PT phase.

Reliability of burst superimposed technique to assess central activation failure during fatiguing contraction.

PubMed

Dousset, Erick; Jammes, Yves

2003-04-01

Recording a superimposed electrically-induced contraction at the limit of endurance during voluntary contraction is used as an indicator of failure of muscle activation by the central nervous system and discards the existence of peripheral muscle fatigue. We questioned on the reliability of this method by using other means to explore peripheral muscle failure. Fifteen normal subjects sustained handgrip at 60% of maximal voluntary contraction (MVC) until exhaustion. During sustained contraction, the power spectrum analysis of the flexor digitorum surface electromyogram allowed us to calculate the leftward shift of median frequency (MF). A superimposed 60 Hz 3 s pulse train (burst superimposition) was delivered to the muscle when force levelled off close to the preset value. Immediately after the fatigue trial had ended, the subject was asked to perform a 5 s 60% MVC and we measured the peak contractile response to a 60 Hz 3 s burst stimulation. Recordings of the compound evoked muscle action potential (M-wave) allowed us to explore an impairment of neuromuscular propagation. A superimposed contraction was measured in 7 subjects in their two forearms, whereas it was absent in the 8 others. Despite these discrepancies, all subjects were able to reproduce a 3 s 60% MVC immediately after the fatigue trial ended and there was no post-fatigue decrease of contraction elicited by the 60 Hz 3 s burst stimulation, as well as no M-wave decrease in amplitude and conduction time. Thus, there was no indication of peripheral muscle fatigue. MF decrease was present in all individuals throughout the fatiguing contraction and it was not correlated with the magnitude of superimposed force. These observations indicate that an absence of superimposed electrically-induced muscle contraction does not allow us to conclude the existence of a sole peripheral muscle fatigue in these circumstances.

a Combination of Geospatial and Clinical Analysis in Predicting Disability Outcome after Road Traffic Injury (rti) in a District in Malaysia

NASA Astrophysics Data System (ADS)

Nik Hisamuddin, R.; Ruslan, R.; Syed Hatim, N.; Sharifah Mastura, S. M.

2016-09-01

This was a Prospective Cohort Study commencing from July 2011 until June 2013 involving all injuries related to motor vehicle crashes (MVC) attended Emergency Departments (ED) of two tertiary centers in a district in Malaysia. Selected attributes were geospatially analyzed by using ARCGIS (by ESRI) software version 10.1 licensed to the institution and Google Map free software and multiple logistic regression was performed by using SPSS version 22.0. A total of 439 cases were recruited. The mean age (SD) of the MVC victims was 26.04 years (s.d 15.26). Male comprised of 302 (71.7%) of the cases. Motorcyclists were the commonest type of victims involved [351(80.0%)]. Hotspot MVC locations occurred at certain intersections and on roads within borough of Kenali and Binjai. The number of severely injured and polytrauma are mostly on the road network within speed limit of 60 km/hour. A person with an increase in ISS of one score had a 37 % higher odd to have disability at hospital discharge (95% CI: 1.253, 1.499, p-value < 0.001). Pediatric age group (less than 19 years of age) had 52.1% lesser odds to have disability at discharge from hospital (95% CI: 0.258, 0.889, p-value < 0.001) and patients who underwent operation for definitive management had 4.14 times odds to have disability at discharge from hospital (95% CI: 1.681, 10.218, p-value = 0.002). Overall this study has proven that GIS with a combination of traditional statistical analysis is still a powerful tool in road traffic injury (RTI) related research.

Discharge properties of abductor hallucis before, during, and after an isometric fatigue task.

PubMed

Kelly, Luke A; Racinais, Sebastien; Cresswell, Andrew G

2013-08-01

Abductor hallucis is the largest muscle in the arch of the human foot and comprises few motor units relative to its physiological cross-sectional area. It has been described as a postural muscle, aiding in the stabilization of the longitudinal arch during stance and gait. The purpose of this study was to describe the discharge properties of abductor hallucis motor units during ramp and hold isometric contractions, as well as its discharge characteristics during fatigue. Intramuscular electromyographic recordings from abductor hallucis were made in 5 subjects; from those recordings, 42 single motor units were decomposed. Data were recorded during isometric ramp contractions at 60% maximum voluntary contraction (MVC), performed before and after a submaximal isometric contraction to failure (mean force 41.3 ± 15.3% MVC, mean duration 233 ± 116 s). Motor unit recruitment thresholds ranged from 10.3 to 54.2% MVC. No significant difference was observed between recruitment and derecruitment thresholds or their respective discharge rates for both the initial and postfatigue ramp contractions (all P > 0.25). Recruitment threshold was positively correlated with recruitment discharge rate (r = 0.47, P < 0.03). All motor units attained similar peak discharge rates (14.0 ± 0.25 pulses/s) and were not correlated with recruitment threshold. Thirteen motor units could be followed during the isometric fatigue task, with a decline in discharge rate and increase in discharge rate variability occurring in the final 25% of the task (both P < 0.05). We have shown that abductor hallucis motor units discharge relatively slowly and are considerably resistant to fatigue. These characteristics may be effective for generating and sustaining the substantial level of force that is required to stabilize the longitudinal arch during weight bearing.

Is the thumb a fifth finger? A study of digit interaction during force production tasks

PubMed Central

Olafsdottir, Halla; Zatsiorsky, Vladimir M.; Latash, Mark L.

2010-01-01

We studied indices of digit interaction in single- and multi-digit maximal voluntary contraction (MVC) tests when the thumb acted either in parallel or in opposition to the fingers. The peak force produced by the thumb was much higher when the thumb acted in opposition to the fingers and its share of the total force in the five-digit MVC test increased dramatically. The fingers showed relatively similar peak forces and unchanged sharing patterns in the four-finger MVC task when the thumb acted in parallel and in opposition to the fingers. Enslaving during one-digit tasks showed relatively mild differences between the two conditions, while the differences became large when enslaving was quantified for multi-digit tasks. Force deficit was pronounced when the thumb acted in parallel to the fingers; it showed a monotonic increase with the number of explicitly involved digits up to four digits and then a drop when all five digits were involved. Force deficit all but disappeared when the thumb acted in opposition to the fingers. However, for both thumb positions, indices of digit interaction were similar for groups of digits that did or did not include the thumb. These results suggest that, given a certain hand configuration, the central nervous system treats the thumb as a fifth finger. They provide strong support for the hypothesis that indices of digit interaction reflect neural factors, not the peripheral design of the hand. An earlier formal model was able to account for the data when the thumb acted in parallel to the fingers. However, it failed for the data with the thumb acting in opposition to the fingers. PMID:15322785

Widespread pain following whiplash-associated disorders: incidence, course, and risk factors.

PubMed

Holm, Lena W; Carroll, Linda J; Cassidy, J David; Skillgate, Eva; Ahlbom, Anders

2007-01-01

To investigate the incidence and course of widespread pain (WP) subsequent to localized pain in subjects with whiplash-associated disorders (WAD); and to investigate the influence of depressive symptoms, neck pain intensity, number of whiplash-associated symptoms, and number of painful body areas on such conditions. From a large prospective cohort of injury claimants who reported WAD after motor vehicle collision (MVC; n = 7462), we identified a subgroup with only localized head/neck/back pain, and who responded to one or more followup questionnaires mailed at 6 weeks and 4, 6, and 12 months after the MVC (n = 266). Pain drawings were distributed at the followup, and we defined WP as having 9 or more painful areas, including posterior neck, at any of these occasions. Depressive symptoms were assessed with the Center for Epidemiological Studies Depression Scale and pain intensity with on a visual analog scale (VAS). The cumulative incidence of WP was 21%, and it occurred early after the injury. Continuous WP over the 12 months was rare. The odds for developing WP were greater in those with depressive symptoms (OR 3.2, 95% CI 1.6-6.3), VAS pain intensity 55-100 (OR 3.2, 95% CI 1.3-8.0), reporting > or = 3 pain-associated symptoms (OR 1.9, 95% CI 0.9-3.8), and those reporting 4 or 5 painful body areas (OR 2.6, 95% CI 1.3-5.4). WP occurred early in the course. Even though the cumulative incidence was 21%, continuous WP was rare. Subjects with WAD who report early depressive symptoms and more severe neck injury symptoms are at risk of developing WP after MVC.

Physiological response to submaximal isometric contractions of the paravertebral muscles

NASA Technical Reports Server (NTRS)

Jensen, B. R.; Jorgensen, K.; Hargens, A. R.; Nielsen, P. K.; Nicolaisen, T.

1999-01-01

STUDY DESIGN: Brief (30-second) isometric trunk extensions at 5%, 20%, 40%, 60%, and 80% of maximal voluntary contraction (MVC) and 3 minutes of prolonged trunk extension (20% MVC) in erect position were studied in nine healthy male subjects. OBJECTIVES: To investigate the intercorrelation between intramuscular pressure and tissue oxygenation of the paravertebral muscles during submaximal isometric contractions and further, to evaluate paravertebral electromyogram and intramuscular pressure as indicators of force development. SUMMARY OF BACKGROUND DATA: Local physiologic responses to muscle contraction are incompletely understood. METHODS: Relative oxygenation was monitored with noninvasive near-infrared spectroscopy, intramuscular pressure was measured with a transducer-tipped catheter, and surface electromyogram was monitored at three recording sites. RESULTS: The root mean square amplitudes of the paravertebral electromyogram (L4, left and right; T12, right) and intramuscular pressure measured in the lumbar multifidus muscle at L4 increased with greater force development in a curvilinear manner. A significant decrease in the oxygenation of the lumbar paravertebral muscle in response to muscle contraction was found at an initial contraction level of 20% MVC. This corresponded to a paravertebral intramuscular pressure of 30-40 mm Hg. However, during prolonged trunk extension, no further decrease in tissue oxygenation was found compared with the tissue oxygenation level at the end of the brief contractions, indicating that homeostatic adjustments (mean blood pressure and heart rate) over time were sufficient to maintain paravertebral muscle oxygen levels. CONCLUSION: At a threshold intramuscular pressure of 30-40 mm Hg during muscle contraction, oxygenation in the paravertebral muscles is significantly reduced. The effect of further increase in intramuscular pressure on tissue oxygenation over time may be compensated for by an increase in blood pressure and heart rate. Surface electromyogram amplitudes and intramuscular pressure can be used as indicators of paravertebral muscle force.

Hip dislocations and concurrent injuries in motor vehicle collisions.

PubMed

Cooper, Joseph; Tilan, Justin; Rounds, Alexis D; Rosario, Santano; Inaba, Kenji; Marecek, Geoffrey S

2018-04-27

Motor Vehicle Collisions (MVC) can cause high energy hip dislocations associated with serious injury profiles impacting triage. Changes in safety and regulation of restraint devices have likely lowered serious injuries from what was previously reported in the 1990s. This study aims to describe modern-day injury profile of patients with traumatic hip dislocations, with special attention to aortic injury. Retrospective review of a prospectively maintained trauma database at an urban level 1 trauma center was conducted. Patients with hip dislocation following MVC between January 2005 and December 2015 were grouped based on seatbelt use and airbag deployment. Patients with unknown restraint use were excluded. Multiple logistic regression was used to identify risk of injury profile between groups. Of 204 patients with hip dislocation after MVC, nearly 57% were unrestrained. Seatbelt alone was used in 36 (17.7%), airbag deployed in 14 (6.9%), and 38 (18.6%) with both. Gender and number of injuries were similar between groups. The most common concomitant injury was acetabular fracture (53.92%) and the abdominopelvic region was the most injured. Use of a seatbelt with airbag deployment was protective of concomitant pelvic ring injury (OR = 0.22). Airbag deployment was significantly protective of lumbar fracture (OR = 0.15) while increasing the likelihood of radial and ulnar fracture or dislocation (OR = 3.27), acetabular fracture (OR = 5.19), and abdominopelvic injury (OR = 5.07). The no restraint group had one patient (0.80%) with an intimal tear of the thoracic aorta identified on CT chest that was successfully medically managed. Hip dislocations are high energy injuries with severe associated injuries despite upgrades in restraint devices. These patients require careful examination and heightened awareness when evaluating for concomitant injuries. Copyright © 2018 Elsevier Ltd. All rights reserved.

Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.

PubMed

Recordon-Pinson, Patricia; Soulié, Cathia; Flandre, Philippe; Descamps, Diane; Lazrek, Mouna; Charpentier, Charlotte; Montes, Brigitte; Trabaud, Mary-Anne; Cottalorda, Jacqueline; Schneider, Véronique; Morand-Joubert, Laurence; Tamalet, Catherine; Desbois, Delphine; Macé, Muriel; Ferré, Virginie; Vabret, Astrid; Ruffault, Annick; Pallier, Coralie; Raymond, Stéphanie; Izopet, Jacques; Reynes, Jacques; Marcelin, Anne-Geneviève; Masquelier, Bernard

2010-08-01

Genotypic algorithms for prediction of HIV-1 coreceptor usage need to be evaluated in a clinical setting. We aimed at studying (i) the correlation of genotypic prediction of coreceptor use in comparison with a phenotypic assay and (ii) the relationship between genotypic prediction of coreceptor use at baseline and the virological response (VR) to a therapy including maraviroc (MVC). Antiretroviral-experienced patients were included in the MVC Expanded Access Program if they had an R5 screening result with Trofile (Monogram Biosciences). V3 loop sequences were determined at screening, and coreceptor use was predicted using 13 genotypic algorithms or combinations of algorithms. Genotypic predictions were compared to Trofile; dual or mixed (D/M) variants were considered as X4 variants. Both genotypic and phenotypic results were obtained for 189 patients at screening, with 54 isolates scored as X4 or D/M and 135 scored as R5 with Trofile. The highest sensitivity (59.3%) for detection of X4 was obtained with the Geno2pheno algorithm, with a false-positive rate set up at 10% (Geno2pheno10). In the 112 patients receiving MVC, a plasma viral RNA load of <50 copies/ml was obtained in 68% of cases at month 6. In multivariate analysis, the prediction of the X4 genotype at baseline with the Geno2pheno10 algorithm including baseline viral load and CD4 nadir was independently associated with a worse VR at months 1 and 3. The baseline weighted genotypic sensitivity score was associated with VR at month 6. There were strong arguments in favor of using genotypic coreceptor use assays for determining which patients would respond to CCR5 antagonist.

Persistent pain after motor vehicle collision: comparative effectiveness of opioids vs nonsteroidal antiinflammatory drugs prescribed from the emergency department-a propensity matched analysis.

PubMed

Beaudoin, Francesca L; Gutman, Roee; Merchant, Roland C; Clark, Melissa A; Swor, Robert A; Jones, Jeffrey S; Lee, David C; Peak, David A; Domeier, Robert M; Rathlev, Niels K; McLean, Samuel A

2017-02-01

Each year millions of Americans present to the emergency department (ED) for care after a motor vehicle collision (MVC); the majority (>90%) are discharged to home after evaluation. Acute musculoskeletal pain is the norm in this population, and such patients are typically discharged to home with prescriptions for oral opioid analgesics or nonsteroidal antiinflammatory drugs (NSAIDs). The influence of acute pain management on subsequent pain outcomes in this common ED population is unknown. We evaluated the effect of opioid analgesics vs NSAIDs initiated from the ED on the presence of moderate to severe musculoskeletal pain and ongoing opioid use at 6 weeks in a large cohort of adult ED patients presenting to the ED after MVC (n = 948). The effect of opioids vs NSAIDs was evaluated using an innovative quasi-experimental design method using propensity scores to account for covariate imbalances between the 2 treatment groups. No difference in risk for moderate to severe musculoskeletal pain at 6 weeks was observed between those discharged with opioid analgesics vs NSAIDs (risk difference = 7.2% [95% confidence interval: -5.2% to 19.5%]). However, at follow-up participants prescribed opioids were more likely than those prescribed NSAIDs to report use of prescription opioids medications at week 6 (risk difference = 17.5% [95% confidence interval: 5.8%-29.3%]). These results suggest that analgesic choice at ED discharge does not influence the development of persistent moderate to severe musculoskeletal pain 6 weeks after an MVC, but may result in continued use of prescription opioids. Supported by NIAMS R01AR056328 and AHRQ 5K12HS022998.

Influence of prolonged static stretching on motor unit firing properties.

PubMed

Ye, Xin; Beck, Travis W; Wages, Nathan P

2016-05-01

The purpose of this study was to examine the influence of a stretching intervention on motor control strategy of the biceps brachii muscle. Ten men performed twelve 100-s passive static stretches of the biceps brachii. Before and after the intervention, isometric strength was tested during maximal voluntary contractions (MVCs) of the elbow flexors. Subjects also performed trapezoid isometric contractions at 30% and 70% of MVC. Surface electromyographic signals from the submaximal contractions were decomposed into individual motor unit action potential trains. Linear regression analysis was used to examine the relationship between motor unit mean firing rate and recruitment threshold. The stretching intervention caused significant decreases in y-intercepts of the linear regression lines. In addition, linear slopes at both intensities remained unchanged. Despite reduced motor unit firing rates following the stretches, the motor control scheme remained unchanged. © 2016 Wiley Periodicals, Inc.

Comparison of hamstring muscle behavior for anterior cruciate ligament (ACL) patient and normal subject during local marching

NASA Astrophysics Data System (ADS)

Amineldin@Aminudin, Nurul Izzaty Bt.; Rambely, A. S.

2014-09-01

This study aims to investigate the hamstring muscle activity after the surgery by carrying out an electromyography experiment on the hamstring and to compare the behavior of the ACL muscle activity between ACL patient and control subject. Electromyography (EMG) is used to study the behavior of muscles during walking activity. Two hamstring muscles involved which are semitendinosus and bicep femoris. The EMG data for both muscles were recorded while the subject did maximum voluntary contraction (MVC) and marching. The study concluded that there were similarities between bicep femoris of the ACL and control subjects. The analysis showed that the biceps femoris muscle of the ACL subject had no abnormality and the pattern is as normal as the control subject. However, ACL patient has poor semitendinosus muscle strength compared to that of control subject because the differences of the forces produced. The force of semitendinosus value for control subject was two times greater than that of the ACL subject as the right semitendinosus muscle of ACL subject was used to replace the anterior cruciate ligament (ACL) that was injured.

Electromyographic signal and force comparisons during maximal voluntary isometric contraction in water and on dry land.

PubMed

Pinto, Stephanie Santana; Liedtke, Giane Veiga; Alberton, Cristine Lima; da Silva, Eduardo Marczwski; Cadore, Eduardo Lusa; Kruel, Luiz Fernando Martins

2010-11-01

This study was designed to compare surface electromyographic (sEMG) signal and force production during maximal voluntary isometric contractions (MVCs) in water and on dry land. The reproducibility of sEMG and isometric force measurements between water and dry land environments was also assessed. Nine women performed MVC for elbow flexion and extension, hip flexion, and extension against identical fixed resistance in both environments. The sEMG signal from biceps brachii, triceps brachii, rectus femoris, and biceps femoris was recorded with waterproof adhesives placed over each electrode. The sEMG and force production showed no significant difference between water and dry land, except for HEX (p = 0.035). In addition, intraclass correlation coefficient values were significant and ranged from moderate to high (0.66-0.96) for sEMG and force production between environments. These results showed that the environment did not influence the sEMG and force in MVC.

EMG parameters and EEG α Index change at fatigue period during different types of muscle contraction

NASA Astrophysics Data System (ADS)

Zhang, Li; Zhou, Bin; Song, Gaoqing

2010-10-01

The purpose of this study is to measure and analyze the characteristics in change of EMG and EEG parameters at muscle fatigue period in participants with different exercise capacity. Twenty participants took part in the tests. They were divided into two groups, Group A (constant exerciser) and Group B (seldom-exerciser). MVC dynamic and 1/3 isometric exercises were performed; EMG and EEG signals were recorded synchronously during different type of muscle contraction. Results indicated that values of MVC, RMS and IEMG in Group A were greater than Group B, but isometric exercise time was shorter than the time of dynamic exercise although its intensity was light. Turning point of IEMG and α Index occurred synchronously during constant muscle contraction of isometric or dynamic exercise. It is concluded that IEMG turning point may be an indication to justify muscle fatigue. Synchronization of EEG and EMG reflects its common characteristics on its bio-electric change.

EMG parameters and EEG α Index change at fatigue period during different types of muscle contraction

NASA Astrophysics Data System (ADS)

Zhang, Li; Zhou, Bin; Song, Gaoqing

2011-03-01

The purpose of this study is to measure and analyze the characteristics in change of EMG and EEG parameters at muscle fatigue period in participants with different exercise capacity. Twenty participants took part in the tests. They were divided into two groups, Group A (constant exerciser) and Group B (seldom-exerciser). MVC dynamic and 1/3 isometric exercises were performed; EMG and EEG signals were recorded synchronously during different type of muscle contraction. Results indicated that values of MVC, RMS and IEMG in Group A were greater than Group B, but isometric exercise time was shorter than the time of dynamic exercise although its intensity was light. Turning point of IEMG and α Index occurred synchronously during constant muscle contraction of isometric or dynamic exercise. It is concluded that IEMG turning point may be an indication to justify muscle fatigue. Synchronization of EEG and EMG reflects its common characteristics on its bio-electric change.

Discomfort Evaluation of Truck Ingress/Egress Motions Based on Biomechanical Analysis

PubMed Central

Choi, Nam-Chul; Lee, Sang Hun

2015-01-01

This paper presents a quantitative discomfort evaluation method based on biomechanical analysis results for human body movement, as well as its application to an assessment of the discomfort for truck ingress and egress. In this study, the motions of a human subject entering and exiting truck cabins with different types, numbers, and heights of footsteps were first measured using an optical motion capture system and load sensors. Next, the maximum voluntary contraction (MVC) ratios of the muscles were calculated through a biomechanical analysis of the musculoskeletal human model for the captured motion. Finally, the objective discomfort was evaluated using the proposed discomfort model based on the MVC ratios. To validate this new discomfort assessment method, human subject experiments were performed to investigate the subjective discomfort levels through a questionnaire for comparison with the objective discomfort levels. The validation results showed that the correlation between the objective and subjective discomforts was significant and could be described by a linear regression model. PMID:26067194

Impact of automobile restraint device utilization on facial fractures and fiscal implications for plastic surgeons.

PubMed

Adkinson, Joshua M; Murphy, Robert X

2011-05-01

In 2009, the National Highway Traffic Safety Administration projected that 33,963 people would die and millions would be injured in motor vehicle collisions (MVC). Multiple studies have evaluated the impact of restraint devices in MVCs. This study examines longitudinal changes in facial fractures after MVC as result of utilization of restraint devices. The Pennsylvania Trauma Systems Foundation-Pennsylvania Trauma Outcomes Study database was queried for MVCs from 1989 to 2009. Restraint device use was noted, and facial fractures were identified by International Classification of Diseases-ninth revision codes. Surgeon cost data were extrapolated. More than 15,000 patients sustained ≥1 facial fracture. Only orbital blowout fractures increased over 20 years. Patients were 2.1% less likely every year to have ≥1 facial fracture, which translated into decreased estimated surgeon charges. Increased use of protective devices by patients involved in MVCs resulted in a change in incidence of different facial fractures with reduced need for reconstructive surgery.

Computation and evaluation of features of surface electromyogram to identify the force of muscle contraction and muscle fatigue.

PubMed

Arjunan, Sridhar P; Kumar, Dinesh K; Naik, Ganesh

2014-01-01

The relationship between force of muscle contraction and muscle fatigue with six different features of surface electromyogram (sEMG) was determined by conducting experiments on thirty-five volunteers. The participants performed isometric contractions at 50%, 75%, and 100% of their maximum voluntary contraction (MVC). Six features were considered in this study: normalised spectral index (NSM5), median frequency, root mean square, waveform length, normalised root mean square (NRMS), and increase in synchronization (IIS) index. Analysis of variance (ANOVA) and linear regression analysis were performed to determine the significance of the feature with respect to the three factors: muscle force, muscle fatigue, and subject. The results show that IIS index of sEMG had the highest correlation with muscle fatigue and the relationship was statistically significant (P < 0.01), while NSM5 associated best with level of muscle contraction (%MVC) (P < 0.01). Both of these features were not affected by the intersubject variations (P > 0.05).

Computation and Evaluation of Features of Surface Electromyogram to Identify the Force of Muscle Contraction and Muscle Fatigue

PubMed Central

Arjunan, Sridhar P.; Kumar, Dinesh K.; Naik, Ganesh

2014-01-01

The relationship between force of muscle contraction and muscle fatigue with six different features of surface electromyogram (sEMG) was determined by conducting experiments on thirty-five volunteers. The participants performed isometric contractions at 50%, 75%, and 100% of their maximum voluntary contraction (MVC). Six features were considered in this study: normalised spectral index (NSM5), median frequency, root mean square, waveform length, normalised root mean square (NRMS), and increase in synchronization (IIS) index. Analysis of variance (ANOVA) and linear regression analysis were performed to determine the significance of the feature with respect to the three factors: muscle force, muscle fatigue, and subject. The results show that IIS index of sEMG had the highest correlation with muscle fatigue and the relationship was statistically significant (P < 0.01), while NSM5 associated best with level of muscle contraction (%MVC) (P < 0.01). Both of these features were not affected by the intersubject variations (P > 0.05). PMID:24995275

Effect of eicosapentaenoic acids-rich fish oil supplementation on motor nerve function after eccentric contractions.

PubMed

Ochi, Eisuke; Tsuchiya, Yosuke; Yanagimoto, Kenichi

2017-01-01

This study investigated the effect of supplementation with fish oil rich in eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) on the M-wave latency of biceps brachii and muscle damage after a single session of maximal elbow flexor eccentric contractions (ECC). Twenty-one men were completed the randomized, double-blind, placebo-controlled, and parallel-design study. The subjects were randomly assigned to the fish oil group ( n  = 10) or control group ( n  = 11). The fish oil group consumed eight 300-mg EPA-rich fish oil softgel capsules (containing, in total, 600 mg EPA and 260 mg DHA) per day for 8 weeks before the exercise, and continued this for a further 5 days. The control group consumed an equivalent number of placebo capsules. The subjects performed six sets of ten eccentric contractions of the elbow flexors using a dumbbell set at 40% of their one repetition maximum. M-wave latency was assessed as the time taken from electrical stimulation applied to Erb's point to the onset of M-wave of the biceps brachii. This was measured before and immediately after exercise, and then after 1, 2, 3, and 5 days. Changes in maximal voluntary isometric contraction (MVC) torque, range of motion (ROM), upper arm circumference, and delayed onset muscle soreness (DOMS) were assessed at the same time points. Compared with the control group, M-wave latency was significantly shorter in the fish oil group immediately after exercise ( p  = 0.040), MVC torque was significantly higher at 1 day after exercise ( p  = 0.049), ROM was significantly greater at post and 2 days after exercise (post; p  = 0.006, day 2; p  = 0.014), and there was significantly less delayed onset muscle soreness at 1 and 2 days after exercise (day 1; p  = 0.049, day 2; p  = 0.023). Eight weeks of EPA and DHA supplementation may play a protective role against motor nerve function and may attenuate muscle damage after eccentric contractions. This trial was registered on July 14th 2015 (https://upload.umin.ac.jp/cgi-open-bin/ctr/index.cgi).

Improving emergency response to motor vehicle crashes : the role of multi-media information.

DOT National Transportation Integrated Search

2013-10-01

The motivation for this study is to reduce the adverse impacts of trauma caused by motor vehicle crash (MVC), including rural regions, where crashes account for a high percentage of trauma injury and death. One key aspect of reducing adverse effects ...

Identification and referral of impaired drivers through emergency department protocols

DOT National Transportation Integrated Search

2002-02-01

Of patients treated in the emergency department (ED) following a motor vehicle crash (MVC), 15-20% are at high risk for alcohol abuse or alcohol dependency (AA/AD), and are likely to drive after drinking. In order to intervene with patients at high r...

Effect of intravenous infusion of an alpha-adrenergic blocking agent on the haemodynamic changes in human masseter muscle induced by cold pressor stimulation.

PubMed

Maekawa, K; Kuboki, T; Miyawaki, T; Shimada, M; Yamashita, A; Clark, G T

1999-04-01

This study evaluated the effect of intravenous infusion of a non-selective alpha-adrenergic blocking agent on masseter muscle haemodynamics induced by 4 degrees C cold pressor stimulation (CPS) of the right foot and ankle, which reportedly evokes a rapidly increasing sympathetic nerve activity in human skeletal muscle. Nine healthy non-smoking males (mean age 23.7+/-2.1 year) with no history of chronic muscle pain or migraine participated. The haemoglobin (Hb) concentration in the right masseter was continuously recorded by non-invasive, near-infrared spectroscopy. Heart rate and blood pressure were also recorded. The experiment involved the following sequence: (1) a placebo (physiological saline) with a CPS trial; (2) a 30-sec maximal voluntary clenching (MVC)-only trial; and (3) an alpha-adrenergic blocking agent with a CPS trial. The saline and drug trials each involved continuous recording for 1 min before, 2 min during and 5 min after the CPS. Physiological saline (20 ml) or phentolamine mesylate (20 ml) were infused at the rate of 2 ml/min. This infusion was begun 15 min before baseline recording and participants were not aware which solution (saline or phentolamine) was being infused. For the MVC trial, each participant performed a 30-sec MVC of his jaw-closing muscles followed by a 15-min rest between each trial. The individual Hb data were adjusted so that the baseline at the beginning of the experiment was equal to zero and all data were normalized as a percentage of the individual's highest absolute Hb change seen after the MVC. The mean baseline Hb concentrations 1 min before CPS were significantly higher in the alpha-blocker trial (83.6%) than in the placebo saline trial (P < 0.001). The change in mean Hb concentration from baseline during CPS in the alpha-blocker trial was significantly less than in the placebo trial (P = 0.006). Mean heart rate before CPS was also significantly higher in the alpha-blocker trial (85.2 beats/min) than in the placebo trial (69.6 beats/min) (P < 0.001). There were no significant differences in the mean systolic and diastolic blood pressures between the placebo and alpha-blocker trials in any time period. The results suggest that non-selective alpha-adrenoceptor blockade increases the blood volume in the masseter muscle. This change might be due to a combination of peripheral vasodilation and an increase in cardiac output.

Muscle function and fatigability of trunk flexors in males and females.

PubMed

Deering, Rita E; Senefeld, Jonathon W; Pashibin, Tatyana; Neumann, Donald A; Hunter, Sandra K

2017-01-01

Optimal function of the abdominal muscles is necessary for several life functions including lifting and carrying tasks. Sex differences in strength and fatigability are established for many limb muscles and back extensor muscles, but it is unknown if sex differences exist for the abdominal muscles despite their functional importance. Eighteen females (24.3 ± 4.8 years) and 15 males (24.1 ± 6.6 years) performed (1) isometric trunk flexion maximal voluntary contractions (MVCs) in a range of trunk positions to establish a torque-angle curve and (2) submaximal (50% MVC), intermittent isometric contraction (6 s on, 4 s off) until task failure to determine fatigability of the trunk flexor muscles. Dual X-ray absorptiometry quantified body fat and lean mass. Physical activity levels were quantified with a questionnaire. Torque-angle curves, electromyography (EMG), MVC torque, and torque steadiness were compared with repeated measures ANOVA with sex as a between-subjects factor. For the torque-angle curve, MVC torque was reduced as the trunk angle increased toward flexion ( p  < 0.001). Males had greater MVC torque than females at the extended positions (31% difference), with no sex differences in torque in upright sitting ( p >  0.05). Time-to-task failure for the submaximal fatigability task in upright sitting was similar between males and females (12.4 ± 7 vs 10.5 ± 6 min). Time-to-task failure was positively associated with strength ( r  = 0.473, p  = 0.005) and self-reported physical activity ( r  = 0.456, p  = 0.030). Lean mass in the trunk was positively associated with trunk flexor strength ( r  = 0.378, p  = 0.011) and self-reported physical activity ( r  = 0.486, p  = 0.007). Finally, torque steadiness [coefficient of variation of torque (CV)] during submaximal isometric contractions decreased with contraction intensity and was similar for males and females across all intensities. Unlike many limb muscle groups, males and females had similar fatigability and torque steadiness of the trunk flexor muscles during isometric contractions. Stronger individuals, however, exhibited less fatigability. Lower self-reported physical activity was associated with greater fatigability of trunk flexor muscles. The relationship between strength and fatigability of the trunk flexor muscles and physical activity supports the importance of abdominal muscle strengthening to offset fatigability in both males and females.

Adaptations to Short, Frequent Sessions of Endurance and Strength Training Are Similar to Longer, Less Frequent Exercise Sessions When the Total Volume Is the Same.

PubMed

Kilen, Anders; Hjelvang, Line B; Dall, Niels; Kruse, Nanna L; Nordsborg, Nikolai B

2015-11-01

The hypothesis that the distribution of weekly training across several short sessions, as opposed to fewer longer sessions, enhances maximal strength gain without compromising maximal oxygen uptake was evaluated. Twenty-nine subjects completed an 8-week controlled parallel-group training intervention. One group ("micro training" [MI]: n = 21) performed nine 15-minute training sessions weekly, whereas a second group ("classical training" [CL]: n = 8) completed exactly the same training on a weekly basis but as three 45-minute sessions. For each group, each session comprised exclusively strength, high-intensity cardiovascular training or muscle endurance training. Both groups increased shuttle run performance (MI: 1,373 ± 133 m vs. 1,498 ± 126 m, p ≤ 0.05; CL: 1,074 ± 213 m vs. 1,451 ± 202 m, p < 0.001). In contrast to CL, MI increased peak oxygen uptake (3,744 ± 615 mL·min⁻¹ vs. 3,963 ± 753 mL·min⁻¹, p ≤ 0.05), maximal voluntary isometric (MVC) force of the knee extensors (646 ± 135 N vs. 659 ± 209 N, p < 0.001), MVC of the finger flexors (408 ± 109 N vs. 441 ± 131 N, p ≤ 0.05), and number of lunges performed in 2 minutes (65 ± 3 vs. 73 ± 2, p < 0.001). However, there were no significant differences between MI and CL on any measured parameters before or after the training intervention. In conclusion, similar training adaptations can be obtained with short, frequent exercise sessions or longer, less frequent sessions where the total volume of weekly training performed is the same.

Effects of acute static, ballistic, and PNF stretching exercise on the muscle and tendon tissue properties.

PubMed

Konrad, A; Stafilidis, S; Tilp, M

2017-10-01

The purpose of this study was to investigate the influence of a single static, ballistic, or proprioceptive neuromuscular facilitation (PNF) stretching exercise on the various muscle-tendon parameters of the lower leg and to detect possible differences in the effects between the methods. Volunteers (n = 122) were randomly divided into static, ballistic, and PNF stretching groups and a control group. Before and after the 4 × 30 s stretching intervention, we determined the maximum dorsiflexion range of motion (RoM) with the corresponding fascicle length and pennation angle of the gastrocnemius medialis. Passive resistive torque (PRT) and maximum voluntary contraction (MVC) were measured with a dynamometer. Observation of muscle-tendon junction (MTJ) displacement with ultrasound allowed us to determine the length changes in the tendon and muscle, respectively, and hence to calculate stiffness. Although RoM increased (static: +4.3%, ballistic: +4.5%, PNF: +3.5%), PRT (static: -11.4%, ballistic: -11.5%, PNF: -13,7%), muscle stiffness (static: -13.1%, ballistic: -20.3%, PNF: -20.2%), and muscle-tendon stiffness (static: -11.3%, ballistic: -10.5%, PNF: -13.7%) decreased significantly in all the stretching groups. Only in the PNF stretching group, the pennation angle in the stretched position (-4.2%) and plantar flexor MVC (-4.6%) decreased significantly. Multivariate analysis showed no clinically relevant difference between the stretching groups. The increase in RoM and the decrease in PRT and muscle-tendon stiffness could be explained by more compliant muscle tissue following a single static, ballistic, or PNF stretching exercise. © 2017 The Authors Scandinavian Journal of Medicine & Science In Sports Published by John Wiley & Sons Ltd.

Enhanced Corticospinal Excitability and Volitional Drive in Response to Shortening and Lengthening Strength Training and Changes Following Detraining

PubMed Central

Tallent, Jamie; Goodall, Stuart; Gibbon, Karl C.; Hortobágyi, Tibor; Howatson, Glyn

2017-01-01

There is a limited understanding of the neurological adaptations responsible for changes in strength following shortening and lengthening resistance training and subsequent detraining. The aim of the study was to investigate differences in corticospinal and spinal responses to resistance training of the tibialis anterior muscle between shortening or lengthening muscle contractions for 4 weeks and after 2 weeks of detraining. Thirty-one untrained individuals were assigned to either shortening or lengthening isokinetic resistance training (4 weeks, 3 days/weeks) or a non-training control group. Transcranial magnetic stimulation and peripheral nerve stimulation (PNS) were used to assess corticospinal and spinal changes, respectively, at pre-, mid-, post-resistance training and post detraining. Greater increases changes (P < 0.01) in MVC were found from the respective muscle contraction training. Motor evoked potentials (expressed relative to background EMG) significantly increased in lengthening resistance training group under contraction intensities ranging from 25 to 80% of the shortening and lengthening contraction intensity (P < 0.01). In the shortening resistance training group increases were only seen at 50 and 80% of both contraction type. Volitional drive (V-wave) showed a greater increase following lengthening resistance training (57%) during maximal lengthening contractions compared to maximal shortening contractions following shortening resistance training (23%; P < 0.001). During the detraining period MVC and V-wave did not change (P > 0.05), although MEP amplitude decreased during the detraining period (P < 0.01). No changes in H-reflex were found pre to post resistance training or post detraining. Modulation in V-wave appeared to be contraction specific, whereby greatest increases occurred following lengthening resistance training. Strength and volitional drive is maintained following 2 weeks detraining, however corticospinal excitability appears to decrease when the training stimulus is withdrawn. PMID:28223941

Sweating response to passive stretch of the calf muscle during activation of forearm muscle metaboreceptors in heated humans.

PubMed

Amano, Tatsuro; Ichinose, Masashi; Nishiyasu, Takeshi; Inoue, Yoshimitsu; Koga, Shunsaku; Miwa, Mikio; Kondo, Narihiko

2014-05-15

Activation of muscle metaboreceptors and mechanoreceptors has been shown to independently influence the sweating response, while their integrative control effects remain unclear. We examined the sweating response when the two muscle receptors are concurrently activated in different limbs, as well as the blood pressure response. In total, 27 young males performed passive calf muscle stretches (muscle mechanoreceptor activation) for 30 s in a semisupine position with and without postisometric handgrip exercise muscle ischemia (PEMI, muscle metaboreceptor activation) at exercise intensities of 35 and 50% of maximum voluntary contraction (MVC) under hot conditions (ambient temperature, 35°C, relative humidity, 50%). Passive calf muscle stretching alone increased the mean sweating rate significantly on the forehead, chest, and thigh (SRmean) and mean arterial blood pressure (MAP), but not the heart rate (HR), from prestretching levels by 0.04 ± 0.01 mg·cm(2)·min(-1), 4.0 ± 1.3 mmHg (P < 0.05), and -1.0 ± 0.5 beats/min (P > 0.05), respectively. The SRmean and MAP during PEMI were significantly higher than those at rest. The passive calf muscle stretch during PEMI increased MAP significantly by 3.4 ± 1.0 and 2.0 ± 0.7 mmHg for 35 and 50% of MVC, respectively (P < 0.05), but not that of SRmean or HR at either exercise intensity. These results suggest that sweating and blood pressure responses to concurrent activation of the two muscle receptors in different limbs differ and that the influence of calf muscle mechanoreceptor activation alone on the sweating response disappears during forearm muscle metaboreceptor activation. Copyright © 2014 the American Physiological Society.

Pushbroom Hyperspectral Imaging from AN Unmanned Aircraft System (uas) - Geometric Processingworkflow and Accuracy Assessment

NASA Astrophysics Data System (ADS)

Turner, D.; Lucieer, A.; McCabe, M.; Parkes, S.; Clarke, I.

2017-08-01

In this study, we assess two push broom hyperspectral sensors as carried by small (10-15 kg) multi-rotor Unmanned Aircraft Systems (UAS). We used a Headwall Photonics micro-Hyperspec push broom sensor with 324 spectral bands (4-5 nm FWHM) and a Headwall Photonics nano-Hyperspec sensor with 270 spectral bands (6 nm FWHM) both in the VNIR spectral range (400-1000 nm). A gimbal was used to stabilise the sensors in relation to the aircraft flight dynamics, and for the micro-Hyperspec a tightly coupled dual frequency Global Navigation Satellite System (GNSS) receiver, an Inertial Measurement Unit (IMU), and Machine Vision Camera (MVC) were used for attitude and position determination. For the nano-Hyperspec, a navigation grade GNSS system and IMU provided position and attitude data. This study presents the geometric results of one flight over a grass oval on which a dense Ground Control Point (GCP) network was deployed. The aim being to ascertain the geometric accuracy achievable with the system. Using the PARGE software package (ReSe - Remote Sensing Applications) we ortho-rectify the push broom hyperspectral image strips and then quantify the accuracy of the ortho-rectification by using the GCPs as check points. The orientation (roll, pitch, and yaw) of the sensor is measured by the IMU. Alternatively imagery from a MVC running at 15 Hz, with accurate camera position data can be processed with Structure from Motion (SfM) software to obtain an estimated camera orientation. In this study, we look at which of these data sources will yield a flight strip with the highest geometric accuracy.

Is there any difference in pelvic floor muscles performance between continent and incontinent women?

PubMed

Burti, Juliana Schulze; Hacad, Claudia R; Zambon, João Paulo; Polessi, Emily Assis; Almeida, Fernando G

2015-08-01

To compare pelvic floor muscles (PFMs) performance in women with and without stress urinary incontinence (SUI) during endurance test. It is a prospective case-control clinical trial. After determining PFM maximal voluntary contraction (MVC) by electromyography (EMG), women underwent endurance test, which consisted of consecutively PFM 1-sec fast contractions reaching MVC amplitude followed by 1-sec rest. Training time guided by Borg perceived exertion scale was noted. Heart rate (HR) behavior and EMG variables were assessed before and after training making a physiological analysis in both groups. A total of 56 women, mean age 52.19 years old, were evaluated (26 continent and 30 incontinent women). The time that SUI and continent women took to reach fatigue (Borg 10) was 9.1 ± 4.7 and 14.19 ± 8.32 min, respectively (P = 0.006). Confirming that all women performed similar effort during the test, analysis of variance with repeated measures showed that during the endurance test both groups presented similar increase in HR, showing detectable and significant increase from resting time to Borg 10 (P < 0.001). Besides, there was similar behavior in EMG for continent and SUI women, with a decrease from the baseline resting amplitude (P = 0.003 for SUI women and P = 0.006 for continent women). Women with SUI showed worse performance during an endurance test than continent women. It suggests that women have different capacity to perform PFM training. An initial evaluation based on PFM performance would help to define the best individualized PFM training. © 2014 Wiley Periodicals, Inc.

Eicosapentaenoic and docosahexaenoic acids-rich fish oil supplementation attenuates strength loss and limited joint range of motion after eccentric contractions: a randomized, double-blind, placebo-controlled, parallel-group trial.

PubMed

Tsuchiya, Yosuke; Yanagimoto, Kenichi; Nakazato, Koichi; Hayamizu, Kohsuke; Ochi, Eisuke

2016-06-01

This study investigated the effect of eicosapentaenoic and docosahexaenoic acids-rich fish oil (EPA + DHA) supplementation on eccentric contraction-induced muscle damage. Twenty-four healthy men were randomly assigned to consume the EPA + DHA supplement (EPA, n = 12) or placebo (PL, n = 12) by the double-blind method. Participants consumed EPA + DHA or placebo supplement for 8 weeks prior to exercise and continued it until 5 days after exercise. The EPA group consumed EPA + DHA-rich fish oil containing 600 mg EPA and 260 mg DHA per day. Subjects performed five sets of six maximal eccentric elbow flexion exercises. Changes in the maximal voluntary contraction (MVC) torque, range of motion (ROM), upper arm circumference, muscle soreness as well as serum creatine kinase, myoglobin, IL-6, and TNF-α levels in blood were assessed before, immediately after, and 1, 2, 3, and 5 days after exercise. MVC was significantly higher in the EPA group than in the PL group at 2-5 days after exercise (p < 0.05). ROM was also significantly greater in the EPA group than in the PL group at 1-5 days after exercise (p < 0.05). At only 3 days after exercise, muscle soreness of the brachialis was significantly greater in the PL group than in the EPA group (p < 0.05), with a concomitant increase in serum IL-6 levels in the PL group. Eight-week EPA + DHA supplementation attenuates strength loss and limited ROM after exercise. The supplementation also attenuates muscle soreness and elevates cytokine level, but the effect is limited.

Correlates Between Force and Postural Tremor in Older Individuals with Essential Tremor.

PubMed

Kavanagh, Justin J; Keogh, Justin W L

2016-12-01

Essential tremor (ET) is commonly associated with kinetic tremor. However, other forms of tremor, such as force and postural tremor, may occur in ET with less severity. This study objectively assessed force and postural tremor characteristics in ET with the purpose of identifying the relationships between these tremors. Ten individuals with ET (age 71 ± 5 years) and ten healthy controls (age 70 ± 5 years) participated in the study. Force tremor was quantified as fluctuations in index finger abduction force during isometric contractions at 10 % maximum voluntary contraction (MVC) and 60 % MVC. Postural tremor was quantified as index finger acceleration when the subjects held their entire arm unsupported, and when their arm was supported so that only the index finger could move. Time- and frequency-domain parameters were extracted from tremor data, and then correlations within, and between, tremor subtypes were examined. ET force tremor was dependent on contraction intensity whereas postural tremor was unaffected by the level of limb support. Significant correlations existed between frequency components of postural tremor and force tremor amplitude. Force tremor amplitude normalised to the level of contraction intensity correlated to the proportion of power for postural tremor. These correlations were observed for both contraction intensities and both levels of postural support. The proportion of power represents the output of central oscillators in ET patients and therefore correlated well to force tremor. Given that significant relationships existed between spectral features of postural tremor and the overall force tremor amplitude, it is clear that these tremor modalities are not completely independent in older adults with ET.

Deployment Experiences and Motor Vehicle Crashes Among U.S. Service Members

DTIC Science & Technology

2014-01-01

Excluded were those with a history of an MVC prior to baseline or deployment (because medical codes could not differ- entiate remote versus recent injury...ever told a participant they have hearing loss/ tinnitus . A positive screen for the aggregate physical health symptoms covariate was based on

40 CFR 98.253 - Calculating GHG emissions.

Code of Federal Regulations, 2010 CFR

2010-07-01

... (metric tons/year). 0.98 = Assumed combustion efficiency of a flare. 0.001 = Unit conversion factor... measurement values within the day to calculate a daily average. MVC = Molar volume conversion factor (849.5....001 = Unit conversion factor (metric tons per kilogram, mt/kg). n = Number of measurement periods. The...

Sweating responses to isometric hand-grip exercise and forearm muscle metaboreflex in prepubertal children and elderly.

PubMed

Amano, Tatsuro; Kai, Seiko; Nakajima, Michi; Ichinose-Kuwahara, Tomoko; Gerrett, Nicola; Kondo, Narihiko; Inoue, Yoshimitsu

2017-02-01

What is the central question of this study? Non-thermal factors (e.g. muscle metaboreflex) contribute to the sweating response during exercise. Although it is well recognized that the sweating responses caused by core temperature elevation in prepubertal children and the elderly are attenuated compared with young adults, it is unknown whether non-thermal sweating is also attenuated in these populations. What is the main finding and its importance? The non-thermal sweating response during isometric hand-grip exercise and isolated muscle metaboreflex were attenuated in prepubertal children compared with young adults in a non-uniform manner over the body, but only during the muscle metaboreflex in the elderly. This may explain the maturation- and ageing-related decline of sweating during exercise. The purpose of the present study was to investigate sweating responses to isometric hand-grip (IH) exercise and muscle metaboreflex in prepubertal children and the elderly. In hot conditions (ambient temperature, 35°C; relative humidity, 45%), 13 healthy young adults, 10 prepubertal children and 10 elderly subjects (aged 20.4 ± 1.2, 11.4 ± 0.5 and 63.5 ± 3.1 years, respectively) repeated a three hand-grip exercise protocol that consisted of 1 min IH exercise at 15, 30 or 45% of maximal voluntary contraction (MVC) followed by 2 min postexercise forearm occlusion. Local sweat rates (SRs) on the forehead, chest, forearm, thigh and palm were continuously measured (ventilated capsule method). The forehead SR in prepubertal children during IH exercise at 45% MVC was significantly lower than that of young adults (0.26 ± 0.22 and 0.08 ± 0.15 mg cm -2  min -1 for young adults and children, respectively; P < 0.05) but not of the elderly at any exercise intensities. The SR on the chest (0.22 ± 0.22 and -0.01 ± 0.05 mg cm -2  min -1 for young adults and children, respectively), forearm (0.14 ± 0.12 and 0.03 ± 0.04 mg cm -2  min -1 ) and thigh (0.13 ± 0.10 and 0.02 ± 0.03 mg cm -2  min -1 ) during postexercise occlusion at 45% MVC was significantly lower in children than in young adults (P < 0.05). Elderly subjects showed a significantly lower SR on the forearm (0.04 ± 0.04 and 0.01 ± 0.02 mg cm -2  min -1 for young adults and elderly, respectively) and thigh (0.07 ± 0.07 and 0.01 ± 0.03 mg cm -2  min -1 ) at 15% MVC and on the thigh at 45% MVC (0.13 ± 0.10 and 0.04 ± 0.04 mg cm -2  min -1 ) during postexercise occlusion compared with young adults (P < 0.05). These results suggest that sweating responses to IH exercise and muscle metaboreflex were underdeveloped in prepubertal children and that ageing attenuates the response to the muscle metaboreflex in a way that is not consistent across the body. © 2016 The Authors. Experimental Physiology © 2016 The Physiological Society.

Time to Maximal Voluntary Isometric Contraction (MVC) for Five Different Muscle Groups in College Adults.

ERIC Educational Resources Information Center

Morris, A. F.; And Others

1983-01-01

College men and women were studied to ascertain the force-time components of a rapid voluntary muscle contraction for five muscle groups. Researchers found that the time required for full contraction differs: (1) in men and women; and (2) among the five muscle groups. (Authors/PP)

Using the news media to disseminate seat belt information to the American public : how police interact with the media and how can we improve it.

DOT National Transportation Integrated Search

2010-02-01

"The local news media commonly report motor vehicle crashes (MVC). Police have been : identified as prominent spokespeople during these news stories and when interviewed, convey : more prevention information to the public. Despite this, little is kno...

Effects of ankle joint position and submaximal muscle contraction intensity on soleus H-reflex modulation in young and older adults.

PubMed

Chen, Yung-Sheng; Zhou, Shi; Cartwright, Colleen

2014-04-01

This study investigated the effects of ankle joint position and submaximal contraction intensity on soleus (SOL) H-reflex modulation. Twenty young (25.1 ± 4.8 years) and 20 older adults (74.2 ± 5.1 years) performed plantar flexions during 10%, 30% and 50% maximal voluntary contractions (MVC) and at ankle positions of neutral (0°), plantar flexion (20°) and dorsiflexion (-20°) in a sitting position. The SOL H-reflex gain in older adults was relatively lower than that in young adults during 10%, 30% and 50% MVC. The SOL H-reflex gain was significantly affected by the intensity of plantar flexion in the respective ankle joint position in both age groups. The latency of H-reflex was prolonged in older adults and was ankle joint dependent in young adults. Young adults demonstrated a shorter duration of the H-reflex response than that of older adults. The results indicated that there were age-related changes in the SOL H-reflex during the ankle plantar flexors activities.

Influence on muscle oxygenation to EMG parameters at different skeletal muscle contraction

NASA Astrophysics Data System (ADS)

Zhang, Li; Song, Gaoqing

2010-02-01

The purpose of this study is to investigate the influence of muscle oxygenation on EMG parameters during isometric and incremental exercises and to observe the relationship between EMG parameters and muscle oxygenation. Twelve rowers took part in the tests. Near infrared spectrometer was utilized for measurements of muscle oxygenation on lateral quadriceps. sEMG measurement is performed for EMG parameters during isometric and incremental exercises. Results indicated that Oxy-Hb decrease significantly correlated with IEMG, E/T ratio and frequency of impulse signal during 1/3 MVC and 2/3 MVC isometric exercise, and it is also correlated with IEMG, E/T ratio and frequency of impulse signal. Increase of IEMG occurred at the time after Oxy-Hb decrease during incremental exercise and highly correlated with BLa. It is concluded that no matter how heavy the intensity is, Oxy-Hb dissociation may play an important role in affecting EMG parameters of muscle fatigue during isometric exercise. 2) EMG parameters may be influenced by Oxy-Hb dissociation and blood lactate concentration during dynamic exercise.

Influence on muscle oxygenation to EMG parameters at different skeletal muscle contraction

NASA Astrophysics Data System (ADS)

Zhang, Li; Song, Gaoqing

2009-10-01

The purpose of this study is to investigate the influence of muscle oxygenation on EMG parameters during isometric and incremental exercises and to observe the relationship between EMG parameters and muscle oxygenation. Twelve rowers took part in the tests. Near infrared spectrometer was utilized for measurements of muscle oxygenation on lateral quadriceps. sEMG measurement is performed for EMG parameters during isometric and incremental exercises. Results indicated that Oxy-Hb decrease significantly correlated with IEMG, E/T ratio and frequency of impulse signal during 1/3 MVC and 2/3 MVC isometric exercise, and it is also correlated with IEMG, E/T ratio and frequency of impulse signal. Increase of IEMG occurred at the time after Oxy-Hb decrease during incremental exercise and highly correlated with BLa. It is concluded that no matter how heavy the intensity is, Oxy-Hb dissociation may play an important role in affecting EMG parameters of muscle fatigue during isometric exercise. 2) EMG parameters may be influenced by Oxy-Hb dissociation and blood lactate concentration during dynamic exercise.

Comparison between the effects of 4 different electrical stimulation current waveforms on isometric knee extension torque and perceived discomfort in healthy women.

PubMed

Dantas, Lucas Ogura; Vieira, Amilton; Siqueira, Aristides Leite; Salvini, Tania Fatima; Durigan, João Luiz Quagliotti

2015-01-01

We studied the effects of different neuromuscular electrical stimulation (NMES) currents, 2 kHz-frequency alternating currents (KACs, Russian and Aussie) and 2 pulsed currents (PCs), on isometric knee extension torque and discomfort level, both in isolation and combined, with maximum voluntary contraction (MVC). Twenty-one women (age 21.6 ± 2.5 years) were studied. We evaluated torque evoked by NMES or NMES combined with maximum voluntary contraction of the quadriceps muscle of healthy women. Discomfort level was measured using a visual analog pain scale. Despite comparable levels of discomfort, evoked torque was lower for Russian current compared with the other modalities (Russian 50.8%, Aussie 71.7%, PC500 76.9%, and PC200 70.1%; P < 0.001). There was no advantage in combining NMES with MVC compared with isolated NMES. The Aussie and PC approaches proved superior to Russian current for inducing isometric knee extension torque. This information is important in guiding decision making with regard to NMES protocols for muscle strengthening. © 2014 Wiley Periodicals, Inc.

A novel method for pair-matching using three-dimensional digital models of bone: mesh-to-mesh value comparison.

PubMed

Karell, Mara A; Langstaff, Helen K; Halazonetis, Demetrios J; Minghetti, Caterina; Frelat, Mélanie; Kranioti, Elena F

2016-09-01

The commingling of human remains often hinders forensic/physical anthropologists during the identification process, as there are limited methods to accurately sort these remains. This study investigates a new method for pair-matching, a common individualization technique, which uses digital three-dimensional models of bone: mesh-to-mesh value comparison (MVC). The MVC method digitally compares the entire three-dimensional geometry of two bones at once to produce a single value to indicate their similarity. Two different versions of this method, one manual and the other automated, were created and then tested for how well they accurately pair-matched humeri. Each version was assessed using sensitivity and specificity. The manual mesh-to-mesh value comparison method was 100 % sensitive and 100 % specific. The automated mesh-to-mesh value comparison method was 95 % sensitive and 60 % specific. Our results indicate that the mesh-to-mesh value comparison method overall is a powerful new tool for accurately pair-matching commingled skeletal elements, although the automated version still needs improvement.

Impact of resistance exercise during bed rest on skeletal muscle sarcopenia and myosin isoform distribution

NASA Technical Reports Server (NTRS)

Bamman, M. M.; Clarke, M. S.; Feeback, D. L.; Talmadge, R. J.; Stevens, B. R.; Lieberman, S. A.; Greenisen, M. C.

1998-01-01

Because resistance exercise (REx) and bed-rest unloading (BRU) are associated with opposing adaptations, our purpose was to test the efficacy of REx against the effects of 14 days of BRU on the knee-extensor muscle group. Sixteen healthy men were randomly assigned to no exercise (NoEx; n = 8) or REx (n = 8). REx performed five sets of leg press exercise with 80-85% of one repetition maximum (1 RM) every other day during BRU. Muscle samples were removed from the vastus lateralis muscle by percutaneous needle biopsy. Myofiber distribution was determined immunohistochemically with three monoclonal antibodies against myosin heavy chain (MHC) isoforms (I, IIa, IIx). MHC distribution was further assessed by quantitative gel electrophoresis. Dynamic 1-RM leg press and unilateral maximum voluntary isometric contraction (MVC) were determined. Maximal neural activation (root mean squared electromyogram) and rate of torque development (RTD) were measured during MVC. Reductions (P < 0.05) in type I (15%) and type II (17%) myofiber cross-sectional areas were found in NoEx but not in REx. Electrophoresis revealed no changes in MHC isoform distribution. The percentage of type IIx myofibers decreased (P < 0.05) in REx from 9 to 2% and did not change in NoEx. 1 RM was reduced (P < 0.05) by 9% in NoEx but was unchanged in REx. MVC fell by 15 and 13% in NoEx and REx, respectively. The agonist-to-antagonist root mean squared electromyogram ratio decreased (P < 0.05) 19% in REx. RTD slowed (P < 0.05) by 54% in NoEx only. Results indicate that REx prevented BRU-induced myofiber atrophy and also maintained training-specific strength. Unlike spaceflight, BRU did not induce shifts in myosin phenotype. The reported benefits of REx may prove useful in prescribing exercise for astronauts in microgravity.

Post-fire vegetation recovery in Portugal based on spot/vegetation data

NASA Astrophysics Data System (ADS)

Gouveia, C.; Dacamara, C. C.; Trigo, R. M.

2010-04-01

A procedure is presented that allows identifying large burned scars and the monitoring of vegetation recovery in the years following major fire episodes. The procedure relies on 10-day fields of Maximum Value Composites of Normalized Difference Vegetation Index (MVC-NDVI), with a 1 km×1 km spatial resolution obtained from the VEGETATION instrument. The identification of fire scars during the extremely severe 2003 fire season is performed based on cluster analysis of NDVI anomalies that persist during the vegetative cycle of the year following the fire event. Two regions containing very large burned scars were selected, located in Central and Southwestern Portugal, respectively, and time series of MVC-NDVI analysed before the fire events took place and throughout the post-fire period. It is shown that post-fire vegetation dynamics in the two selected regions may be characterised based on maps of recovery rates as estimated by fitting a monoparametric model of vegetation recovery to MVC-NDVI data over each burned scar. Results indicated that the recovery process in the region located in Central Portugal is mostly related to fire damage rather than to vegetation density before 2003, whereas the latter seems to have a more prominent role than vegetation conditions after the fire episode, e.g. in the case of the region in Southwestern Portugal. These differences are consistent with the respective predominant types of vegetation. The burned area located in Central Portugal is dominated by Pinus Pinaster whose natural regeneration crucially depends on the destruction of seeds present on the soil surface during the fire, whereas the burned scar in Southwestern Portugal was populated by Eucalyptus that may quickly re-sprout from buds after fire. Besides its simplicity, the monoparametric model of vegetation recovery has the advantage of being easily adapted to other low-resolution satellite data, as well as to other types of vegetation indices.

Muscle vibration sustains motor unit firing rate during submaximal isometric fatigue in humans

PubMed Central

Griffin, L; Garland, S J; Ivanova, T; Gossen, E R

2001-01-01

In keeping with the ‘muscular wisdom hypothesis’, many studies have documented that the firing rate of the majority of motor units decreased during fatiguing isometric contractions. The present study investigated whether the application of periodic muscle vibration, which strongly activates muscle spindles, would alter the modulation of motor unit firing rate during submaximal fatiguing isometric contractions. Thirty-three motor units from the lateral head of the triceps brachii muscle were recorded from 10 subjects during a sustained isometric 20 % maximal voluntary contraction (MVC) of the elbow extensors. Vibration was interposed on the contraction for 2 s every 10 s. Twenty-two motor units were recorded from the beginning of the fatigue task. The discharge rate of the majority of motor units remained constant (12/22) or increased (4/22) with fatigue. Six motor units demonstrated a reduction in discharge rate that later returned toward initial values; these motor units had higher initial discharge rates than the other 16 motor units. In a second series of experiments, four subjects held a sustained isometric 20 % MVC for 2 min and then vibration was applied as above for the remainder of the contraction. In this case, motor units initially demonstrated a decrease in firing rate that increased after the vibration was applied. Thus muscle spindle disfacilitation of the motoneurone pool may be associated with the decline of motor unit discharge rate observed during the first 2 min of the contraction. In a third set of experiments, seven subjects performed the main experiment on one occasion and repeated the fatigue task without vibration on a second occasion. Neither the endurance time of the fatiguing contraction nor the MVC torque following fatigue was affected by the application of vibration. This finding calls into question the applicability of the muscular wisdom hypothesis to submaximal contractions. PMID:11559785

Neuromuscular adaptations associated with knee joint angle-specific force change.

PubMed

Noorkõiv, Marika; Nosaka, Kazunori; Blazevich, Anthony J

2014-08-01

Neuromuscular adaptations to joint angle-specific force increases after isometric training have not yet been fully elucidated. This study examined angle-specific neuromuscular adaptations in response to isometric knee extension training at short (SL, joint angle 38.1° ± 3.7°) versus long (LL, 87.5° ± 6.0°) muscle lengths. Sixteen men trained three times a week for 6 wk either at SL (n = 8) or LL (n = 8). Voluntary maximal isometric knee extensor (MVC) force, doublet twitch force, EMG amplitudes (EMG/Mmax), and voluntary activation during MVC force (VA%) were measured at eight knee joint angles (30°-100°) at weeks 0, 3, and 6. Muscle volume and cross-sectional area (CSA) were measured from magnetic resonance imaging scans, and fascicle length (Lf) was assessed using ultrasonography before and after training. Clear joint angle specificity of force increase was seen in SL but not in LL. The 13.4% ± 9.7% (P = 0.01) force increase around the training angle in SL was related to changes in vastus lateralis and vastus medialis EMG/Mmax around the training angle (r = 0.84-0.88, P < 0.05), without changes in the doublet twitch force-angle relation or muscle size. In LL, muscle volume and CSA increased and the changes in CSA at specific muscle regions were correlated with changes in MVC force. A 5.4% ± 4.9% (P = 0.001) increase in Lf found in both groups was not associated with angle-specific force changes. There were no angle-specific changes in VA%. The EMG/Mmax, although not VA%, results suggest that neural adaptations underpinned training-related changes at short quadriceps lengths, but hypertrophic changes predominated after training at long lengths. The findings of this study should contribute to the development of more effective and evidence-based rehabilitation and strength training protocols.

Are routine pelvic radiographs in major pediatric blunt trauma necessary?

PubMed

Lagisetty, Jyothi; Slovis, Thomas; Thomas, Ronald; Knazik, Stephen; Stankovic, Curt

2012-07-01

Screening pelvic radiographs to rule out pelvic fractures are routinely used for the initial evaluation of pediatric blunt trauma. Recently, the utility of routine pelvic radiographs in certain subsets of patients with blunt trauma has been questioned. There is a growing amount of evidence that shows the clinical exam is reliable enough to obviate the need for routine screening pelvic radiographs in children. To identify variables that help predict the presence or absence of pelvic fractures in pediatric blunt trauma. We conducted a retrospective study from January 2005 to January 2010 using the trauma registry at a level 1 pediatric trauma center. We analyzed all level 1 and level 2 trauma victims, evaluating history, exam and mechanism of injury for association with the presence or absence of a pelvic fracture. Of 553 level 1 and 2 trauma patients who presented during the study period, 504 were included in the study. Most of these children, 486/504 (96.4%), showed no evidence of a pelvic fracture while 18/504 (3.6%) had a pelvic fracture. No factors were found to be predictive of a pelvic fracture. However, we developed a pelvic fracture screening tool that accurately rules out the presence of a pelvic fracture P = 0.008, NPV 99, sensitivity 96, 8.98 (1.52-52.8). This screening tool combines eight high-risk clinical findings (pelvic tenderness, laceration, ecchymosis, abrasion, GCS <14, positive urinalysis, abdominal pain/tenderness, femur fracture) and five high-risk mechanisms of injury (unrestrained motor vehicle collision [MVC], MVC with ejection, MVC rollover, auto vs. pedestrian, auto vs. bicycle). Pelvic fractures in pediatric major blunt trauma can reliably be ruled out by using our pelvic trauma screening tool. Although no findings accurately identified the presence of a pelvic fracture, the screening tool accurately identified the absence of a fracture, suggesting that pelvic radiographs are not warranted in this subset of patients.

Low level laser therapy before eccentric exercise reduces muscle damage markers in humans.

PubMed

Baroni, Bruno Manfredini; Leal Junior, Ernesto Cesar Pinto; De Marchi, Thiago; Lopes, André Luiz; Salvador, Mirian; Vaz, Marco Aurélio

2010-11-01

The purpose of the present study was to determine the effect of low level laser therapy (LLLT) treatment before knee extensor eccentric exercise on indirect markers of muscle damage. Thirty-six healthy men were randomized in LLLT group (n = 18) and placebo group (n = 18). After LLLT or placebo treatment, subjects performed 75 maximal knee extensors eccentric contractions (five sets of 15 repetitions; velocity = 60° seg(-1); range of motion = 60°). Muscle soreness (visual analogue scale--VAS), lactate dehydrogenase (LDH) and creatine kinase (CK) levels were measured prior to exercise, and 24 and 48 h after exercise. Muscle function (maximal voluntary contraction--MVC) was measured before exercise, immediately after, and 24 and 48 h post-exercise. Groups had no difference on kineanthropometric characteristics and on eccentric exercise performance. They also presented similar baseline values of VAS (0.00 mm for LLLT and placebo groups), LDH (LLLT = 186 IU/l; placebo = 183 IU/l), CK (LLLT = 145 IU/l; placebo = 155 IU/l) and MVC (LLLT = 293 Nm; placebo = 284 Nm). VAS data did not show group by time interaction (P = 0.066). In the other outcomes, LLLT group presented (1) smaller increase on LDH values 48 h post-exercise (LLLT = 366 IU/l; placebo = 484 IU/l; P = 0.017); (2) smaller increase on CK values 24 h (LLLT = 272 IU/l; placebo = 498 IU/l; P = 0.020) and 48 h (LLLT = 436 IU/l; placebo = 1328 IU/l; P < 0.001) post-exercise; (3) smaller decrease on MVC immediately after exercise (LLLT = 189 Nm; placebo = 154 Nm; P = 0.011), and 24 h (LLLT = 249 Nm; placebo = 205 Nm; P = 0.004) and 48 h (LLLT = 267 Nm; placebo = 216 Nm; P = 0.001) post-exercise compared with the placebo group. In conclusion, LLLT treatment before eccentric exercise was effective in terms of attenuating the increase of muscle proteins in the blood serum and the decrease in muscle force.

Comment on: `The quest for a consistent signal in ground and GRACE gravity time-series', by Michel Van Camp, Olivier de Viron, Laurent Metivier, Bruno Meurers and Olivier Francis

NASA Astrophysics Data System (ADS)

Crossley, D. J.; Boy, J.-P.; Hinderer, J.; Jahr, T.; Weise, A.; Wziontek, H.; Abe, M.; Förste, C.

2014-12-01

The paper in question by Van Camp and co-authors [MVC] challenges previous work showing that ground gravity data arising from hydrology can provide a consistent signal for the comparison with satellite gravity data. The data sets used are similar to those used previously, that is, the gravity field as measured by the GRACE satellites versus ground-based data from superconducting gravimeters (SGs) over the same continental area, in this case Central Europe. One of the main impediments in this paper is the presentation that is frequently confusing and misleading as to what the data analysis really shows, for example, the irregular treatment of annual components that are first subtracted then reappear in the analysis. More importantly, we disagree on specific points. Two calculations are included in our comment to illustrate where we believe that the processing in [MVC] paper is deficient. The first deals with their erroneous treatment of the global hydrology using a truncated spherical harmonic approach which explains almost a factor 2 error in their computation of the loading. The second shows the effect of making the wrong assumption in the GRACE/hydrology/surface gravity comparison by inverting the whole of the hydrology loading for underground stations. We also challenge their claims that empirical orthogonal function techniques cannot be done in the presence of periodic components, and that SG data cannot be corrected for comparisons with GRACE data. The main conclusion of their paper, that there is little coherence between ground gravity stations and this invalidates GRACE comparisons, is therefore questionable. There is nothing in [MVC] that contradicts any of the previous papers that have shown clearly a strong relation between seasonal signals obtained from both ground gravity and GRACE satellite data.

Identifying injuries and motor vehicle collision characteristics that together are suggestive of diaphragmatic rupture.

PubMed

Reiff, Donald A; McGwin, Gerald; Metzger, Jesse; Windham, Samuel T; Doss, Marilyn; Rue, Loring W

2002-12-01

Diaphragmatic rupture (DR) remains a diagnostic challenge because of the lack of an accurate test demonstrating the injury. Our purpose was to identify motor vehicle collision (MVC) characteristics and patient injuries that collectively could identify the presence of a DR. The National Automotive Sampling System was used to identify occupants involved in MVCs from 1995 to 1999 who sustained abdominal (Abbreviated Injury Scale score >or= 2) and/or thoracic injuries (Abbreviated Injury Scale score >or= 2). Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated to quantify the association between patient injuries, vehicle collision characteristics, and DR. Sensitivity and specificity were also calculated to determine the ability of organ injury and MVC characteristics to correctly classify patients with and without DR. Overall, occupants sustaining a DR had a significantly higher delta-V (DeltaV) (49.8 kilometers per hour [kph] vs. 33.8 kph, p< 0.0001) and a greater degree of occupant compartment intrusion (70.6 cm vs. 48.3 cm, p< 0.0001). Specific abdominal and thoracic organ injuries were associated with DR, including thoracic aortic tears (OR, 5.2; 95% CI, 2.2-12.5), splenic injury (OR, 8.4; 95% CI, 3.9-17.8), pelvic fractures (OR, 4.7; 95% CI, 2.7-8.0), and hepatic injuries (OR, 4.2; 95% CI, 1.7-10.6). Combining frontal or near-side lateral occupant compartment intrusion >or= 30 cm or DeltaV >or= 40 kph with specific organ injuries generated a sensitivity for indicating the likelihood of diaphragm injury ranging from 68% to 89%. Patients with any of the following characteristics had a sensitivity for detecting DR of 91%: splenic injury, pelvic fracture, DeltaV >or= 40 kph, or occupant compartment intrusion from any direction >or= 30 cm. Specific MVC characteristics combined with patient injuries have been identified that are highly suggestive of DR. For this subpopulation, additional invasive procedures including exploratory laparotomy, laparoscopy, or thoracoscopy may be warranted to exclude DR.

ACTN3 genotype is associated with increases in muscle strength in response to resistance training in women.

PubMed

Clarkson, Priscilla M; Devaney, Joseph M; Gordish-Dressman, Heather; Thompson, Paul D; Hubal, Monica J; Urso, Maria; Price, Thomas B; Angelopoulos, Theodore J; Gordon, Paul M; Moyna, Niall M; Pescatello, Linda S; Visich, Paul S; Zoeller, Robert F; Seip, Richard L; Hoffman, Eric P

2005-07-01

The alpha-actinin 3 (ACTN3) gene encodes a protein of the Z disk of myofibers, and a polymorphism of ACTN3 results in complete loss of the protein. The ACTN3 genotype (R577X) has been found to be associated with performance in Australian elite athletes (Yang N, MacArthur DG, Gulbin JP, Hahn AG, Beggs AH, Easteal S, and North K. Am J Hum Genet 73: 627-631, 2003). We studied associations between ACTN3 genotype and muscle size [cross-sectional area of the biceps brachii via magnetic resonance imaging (MRI)] and elbow flexor isometric (MVC) and dynamic [1-repetition maximum (1-RM)] strength in a large group of men (N = 247) and women (N = 355) enrolled in a 12-wk standardized elbow flexor/extensor resistance training program of the nondominant arm at one of eight study centers. We found no association between ACTN3 R577X genotype and muscle phenotype in men. However, women homozygous for the ACTN3 577X allele (XX) had lower baseline MVC compared with heterozygotes (P < 0.05) when adjusted for body mass and age. Women homozygous for the mutant allele (577X) demonstrated greater absolute and relative 1-RM gains compared with the homozygous wild type (RR) after resistance training when adjusted for body mass and age (P < 0.05). There was a trend for a dose-response with genotype such that gains were greatest for XX and least for RR. Significant associations were validated in at least one ethnic subpopulation (Caucasians, Asians) and were independent of training volume. About 2% of baseline MVC and of 1-RM strength gain after training were attributable to ACTN3 genotype (likelihood-ratio test P value, P = 0.01), suggesting that ACTN3 is one of many genes contributing to genetic variation in muscle performance and adaptation to exercise.

Treatment intensification with maraviroc (CCR5 antagonist) leads to declines in CD16-expressing monocytes in cART-suppressed chronic HIV-infected subjects and is associated with improvements in neurocognitive test performance: implications for HIV-associated neurocognitive disease (HAND).

PubMed

Ndhlovu, Lishomwa C; Umaki, Tracie; Chew, Glen M; Chow, Dominic C; Agsalda, Melissa; Kallianpur, Kalpana J; Paul, Robert; Zhang, Guangxiang; Ho, Erika; Hanks, Nancy; Nakamoto, Beau; Shiramizu, Bruce T; Shikuma, Cecilia M

2014-12-01

HIV-associated neurocognitive disorders (HAND) continues to be prevalent (30-50%) despite plasma HIV-RNA suppression with combination antiretroviral therapy (cART). There is no proven therapy for individuals on suppressive cART with HAND. We have shown that the degree of HIV reservoir burden (HIV DNA) in monocytes appear to be linked to cognitive outcomes. HIV infection of monocytes may therefore be critical in the pathogenesis of HAND. A single arm, open-labeled trial was conducted to examine the effect of maraviroc (MVC) intensification on monocyte inflammation and neuropsychological (NP) performance in 15 HIV subjects on stable 6-month cART with undetectable plasma HIV RNA (<48 copies/ml) and detectable monocyte HIV DNA (>10 copies/10(6) cells). MVC was added to their existing cART regimen for 24 weeks. Post-intensification change in monocytes was assessed using multiparametric flow cytometry, monocyte HIV DNA content by PCR, soluble CD163 (sCD163) by an ELISA, and NP performance over 24 weeks. In 12 evaluable subjects, MVC intensification resulted in a decreased proportion of circulating intermediate (median; 3.06% (1.93, 6.45) to 1.05% (0.77, 2.26)) and nonclassical (5.2% (3.8, 7.9) to 3.2% (1.8, 4.8)) CD16-expressing monocytes, a reduction in monocyte HIV DNA content to zero log10 copies/10(6) cells and in levels of sCD163 of 43% by 24 weeks. This was associated with significant improvement in NP performance among six subjects who entered the study with evidence of mild to moderate cognitive impairment. The results of this study suggest that antiretroviral therapy with potency against monocytes may have efficacy against HAND.

Muscle vibration sustains motor unit firing rate during submaximal isometric fatigue in humans.

PubMed

Griffin, L; Garland, S J; Ivanova, T; Gossen, E R

2001-09-15

1. In keeping with the 'muscular wisdom hypothesis', many studies have documented that the firing rate of the majority of motor units decreased during fatiguing isometric contractions. The present study investigated whether the application of periodic muscle vibration, which strongly activates muscle spindles, would alter the modulation of motor unit firing rate during submaximal fatiguing isometric contractions. 2. Thirty-three motor units from the lateral head of the triceps brachii muscle were recorded from 10 subjects during a sustained isometric 20 % maximal voluntary contraction (MVC) of the elbow extensors. Vibration was interposed on the contraction for 2 s every 10 s. Twenty-two motor units were recorded from the beginning of the fatigue task. The discharge rate of the majority of motor units remained constant (12/22) or increased (4/22) with fatigue. Six motor units demonstrated a reduction in discharge rate that later returned toward initial values; these motor units had higher initial discharge rates than the other 16 motor units. 3. In a second series of experiments, four subjects held a sustained isometric 20 % MVC for 2 min and then vibration was applied as above for the remainder of the contraction. In this case, motor units initially demonstrated a decrease in firing rate that increased after the vibration was applied. Thus muscle spindle disfacilitation of the motoneurone pool may be associated with the decline of motor unit discharge rate observed during the first 2 min of the contraction. 4. In a third set of experiments, seven subjects performed the main experiment on one occasion and repeated the fatigue task without vibration on a second occasion. Neither the endurance time of the fatiguing contraction nor the MVC torque following fatigue was affected by the application of vibration. This finding calls into question the applicability of the muscular wisdom hypothesis to submaximal contractions.

Intramuscular Pressure of Tibialis Anterior Reflects Ankle Torque but Does Not Follow Joint Angle-Torque Relationship.

PubMed

Ateş, Filiz; Davies, Brenda L; Chopra, Swati; Coleman-Wood, Krista; Litchy, William J; Kaufman, Kenton R

2018-01-01

Intramuscular pressure (IMP) is the hydrostatic fluid pressure that is directly related to muscle force production. Electromechanical delay (EMD) provides a link between mechanical and electrophysiological quantities and IMP has potential to detect local electromechanical changes. The goal of this study was to assess the relationship of IMP with the mechanical and electrical characteristics of the tibialis anterior muscle (TA) activity at different ankle positions. We hypothesized that (1) the TA IMP and the surface EMG (sEMG) and fine-wire EMG (fwEMG) correlate to ankle joint torque, (2) the isometric force of TA increases at increased muscle lengths, which were imposed by a change in ankle angle and IMP follows the length-tension relationship characteristics, and (3) the electromechanical delay (EMD) is greater than the EMD of IMP during isometric contractions. Fourteen healthy adults [7 female; mean ( SD ) age = 26.9 (4.2) years old with 25.9 (5.5) kg/m 2 body mass index] performed (i) three isometric dorsiflexion (DF) maximum voluntary contraction (MVC) and (ii) three isometric DF ramp contractions from 0 to 80% MVC at rate of 15% MVC/second at DF, Neutral, and plantarflexion (PF) positions. Ankle torque, IMP, TA fwEMG, and TA sEMG were measured simultaneously. The IMP, fwEMG, and sEMG were significantly correlated to the ankle torque during ramp contractions at each ankle position tested. This suggests that IMP captures in vivo mechanical properties of active muscles. The ankle torque changed significantly at different ankle positions however, the IMP did not reflect the change. This is explained with the opposing effects of higher compartmental pressure at DF in contrast to the increased force at PF position. Additionally, the onset of IMP activity is found to be significantly earlier than the onset of force which indicates that IMP can be designed to detect muscular changes in the course of neuromuscular diseases impairing electromechanical transmission.

BMI and risk of serious upper body injury following motor vehicle crashes: concordance of real-world and computer-simulated observations.

PubMed

Zhu, Shankuan; Kim, Jong-Eun; Ma, Xiaoguang; Shih, Alan; Laud, Purushottam W; Pintar, Frank; Shen, Wei; Heymsfield, Steven B; Allison, David B

2010-03-30

Men tend to have more upper body mass and fat than women, a physical characteristic that may predispose them to severe motor vehicle crash (MVC) injuries, particularly in certain body regions. This study examined MVC-related regional body injury and its association with the presence of driver obesity using both real-world data and computer crash simulation. Real-world data were from the 2001 to 2005 National Automotive Sampling System Crashworthiness Data System. A total of 10,941 drivers who were aged 18 years or older involved in frontal collision crashes were eligible for the study. Sex-specific logistic regression models were developed to analyze the associations between MVC injury and the presence of driver obesity. In order to confirm the findings from real-world data, computer models of obese subjects were constructed and crash simulations were performed. According to real-world data, obese men had a substantially higher risk of injury, especially serious injury, to the upper body regions including head, face, thorax, and spine than normal weight men (all p<0.05). A U-shaped relation was found between body mass index (BMI) and serious injury in the abdominal region for both men and women (p<0.05 for both BMI and BMI(2)). In the high-BMI range, men were more likely to be seriously injured than were women for all body regions except the extremities and abdominal region (all p<0.05 for interaction between BMI and sex). The findings from the computer simulation were generally consistent with the real-world results in the present study. Obese men endured a much higher risk of injury to upper body regions during MVCs. This higher risk may be attributed to differences in body shape, fat distribution, and center of gravity between obese and normal-weight subjects, and between men and women. Please see later in the article for the Editors' Summary.

Disability risk in pediatric motor vehicle crash occupants.

PubMed

Doud, Andrea N; Schoell, Samantha L; Weaver, Ashley A; Talton, Jennifer W; Barnard, Ryan T; Petty, John K; Stitzel, Joel D

2017-05-01

Mortality rates among children in motor vehicle crashes (MVCs) are typically low; however, nonfatal injuries can vary in severity by imposing differing levels of short- and long-term disability. To better discriminate the severity of nonfatal MVC injuries, a pediatric-specific disability risk (DR) metric was created. The National Automotive Sampling System 2000 to 2011 was used to define the top 95% most common Abbreviated Injury Scale (AIS) 2+ injuries among pediatric MVC occupants. Functional Independence Measure scores were abstracted from the National Trauma Data Bank 2002 to 2006. Multiple imputation was used to account for missing data. The DR and coinjury-adjusted DR (DRMAIS) of the most common AIS 2+ MVC-induced injuries were calculated for 7-year-old to 18-year-old children by determining the proportion of those disabled after an injury to those sustaining the injury. DR and DRMAIS values ranged from 0 to 1, representing 0% to 100% DR. The mean DR and DRMAIS of all injuries were 0.290 and 0.191, respectively. DR and DRMAIS were greatest for injuries to the head (DR, 0.340; DRMAIS, 0.279), thorax (DR, 0.320; DRMAIS, 0.233), and spine (DR, 0.315; DRMAIS, 0.200). The mean DR and DRMAIS increased with increasing AIS severity but there was significant variation and overlapping values across AIS severity levels. Comparison of DRMAIS to coinjury-adjusted mortality risk (MRMAIS) revealed that among 118 injuries with MRMAIS of 0.000, DRMAIS ranged from 0.000 to 0.429. Incorporation of DR metrics into injury severity metrics may improve the ability to distinguish between the severity of different nonfatal injuries. This is especially crucial in the pediatric population where permanent disability can result in a high number of years lost due to disability. The accuracy of such severity metrics is crucial to the success of pediatric triage algorithms such as Advanced Automatic Crash Notification algorithms. Epidemiologic/prognostic study, level III.

Differences in pelvic floor morphology between continent, stress urinary incontinent, and mixed urinary incontinent elderly women: An MRI study.

PubMed

Pontbriand-Drolet, Stéphanie; Tang, An; Madill, Stephanie J; Tannenbaum, Cara; Lemieux, Marie-Claude; Corcos, Jacques; Dumoulin, Chantale

2016-04-01

To compare magnetic resonance imaging (MRI) of the pelvic floor musculature (PFM), bladder neck and urethral sphincter morphology under three conditions (rest, PFM maximal voluntary contraction (MVC), and straining) in older women with symptoms of stress (SUI) or mixed urinary incontinence (MUI) or without incontinence. This 2008-2012 exploratory observational cohort study was conducted with community-dwelling women aged 60 and over. Sixty six women (22 per group), mean age of 67.7 ± 5.2 years, participated in the study. A 3 T MRI examination was conducted under three conditions: rest, PFM MVC, and straining. ANOVA or Kruskal-Wallis tests (data not normally distributed) were conducted, with Bonferroni correction, to compare anatomical measurements between groups. Women with MUI symptoms had a lower PFM resting position (M-Line P = 0.010 and PC/H-line angle P = 0.026) and lower pelvic organ support (urethrovesical junction height P = 0.013) than both continent and SUI women. Women with SUI symptoms were more likely to exhibit bladder neck funneling and a larger posterior urethrovesical angle at rest than both continent and MUI women (P = 0.026 and P = 0.008, respectively). There were no significant differences between groups on PFM MVC or straining. Women with SUI and MUI symptoms present different morphological defects at rest. These observations emphasize the need to tailor UI interventions to specific pelvic floor defects and UI type in older women. Older women with UI demonstrate different problems with their pelvic organ support structures depending on the type of UI. These new findings should be taken into consideration for future research into developing new treatment strategies for UI in older women. Neurourol. Urodynam. 35:515-521, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Cold water immersion recovery after simulated collision sport exercise.

PubMed

Pointon, Monique; Duffield, Rob

2012-02-01

This investigation examined the effects of cold water immersion (CWI) recovery after simulated collision sport exercise. Ten male rugby athletes performed three sessions consisting of a 2 × 30-min intermittent-sprint exercise (ISE) protocol with either tackling (T) or no tackling (CONT), followed by a 20-min CWI intervention (TCWI) or passive recovery (TPASS and CONT) in a randomized order. The ISE consisted of a 15-m sprint every minute separated by self-paced bouts of hard running, jogging, and walking for the remainder of the minute. Every sixth rotation, participants performed 5 × 10-m runs, receiving a shoulder-led tackle to the lower body on each effort. Sprint time and distance covered during ISE were recorded, with voluntary (maximal voluntary contraction; MVC) and evoked neuromuscular function (voluntary activation; VA), electromyogram (root mean square (RMS)), ratings of perceived muscle soreness (MS), capillary and venous blood markers for metabolites and muscle damage, respectively measured before and after exercise, immediately after recovery, and 2 and 24 h after recovery. Total distance covered during exercise was significantly greater in CONT (P = 0.01), without differences between TPASS and TCWI (P > 0.05). TCWI resulted in increased MVC, VA, and RMS immediately after recovery (P < 0.05). M-wave amplitude and peak twitch were significantly increased after recovery and 2 h after recovery, respectively, in TCWI (P < 0.05). Although TCWI had no effect on the elevation in blood markers for muscle damage (P > 0.05), lactate was significantly reduced after recovery compared with TPASS (P = 0.04). CWI also resulted in reduced MS 2 h after recovery compared with TPASS (P < 0.05). The introduction of body contact reduces exercise performance, whereas the use of CWI results in a faster recovery of MVC, VA, and RMS and improves muscle contractile properties and perceptions of soreness after collision-based exercise.

Differential Motor Unit Changes after Endurance or High-Intensity Interval Training.

PubMed

Martinez-Valdes, Eduardo; Falla, Deborah; Negro, Francesco; Mayer, Frank; Farina, Dario

2017-06-01

Using a novel technique of high-density surface EMG decomposition and motor unit (MU) tracking, we compared changes in the properties of vastus medialis and vastus lateralis MU after endurance (END) and high-intensity interval training (HIIT). Sixteen men were assigned to the END or the HIIT group (n = 8 each) and performed six training sessions for 14 d. Each session consisted of 8-12 × 60-s intervals at 100% peak power output separated by 75 s of recovery (HIIT) or 90-120 min continuous cycling at ~65% V˙O2peak (END). Pre- and postintervention, participants performed 1) incremental cycling to determine V˙O2peak and peak power output and 2) maximal, submaximal (10%, 30%, 50%, and 70% maximum voluntary contraction [MVC]), and sustained (until task failure at 30% MVC) isometric knee extensions while high-density surface EMG signals were recorded from the vastus medialis and vastus lateralis. EMG signals were decomposed (submaximal contractions) into individual MU by convolutive blind source separation. Finally, MU were tracked across sessions by semiblind source separation. After training, END and HIIT improved V˙O2peak similarly (by 5.0% and 6.7%, respectively). The HIIT group showed enhanced maximal knee extension torque by ~7% (P = 0.02) and was accompanied by an increase in discharge rate for high-threshold MU (≥50% knee extension MVC) (P < 0.05). By contrast, the END group increased their time to task failure by ~17% but showed no change in MU discharge rates (P > 0.05). HIIT and END induce different adjustments in MU discharge rate despite similar improvements in cardiopulmonary fitness. Moreover, the changes induced by HIIT are specific for high-threshold MU. For the first time, we show that HIIT and END induce specific neuromuscular adaptations, possibly related to differences in exercise load intensity and training volume.

Comparison between maximal lengthening and shortening contractions for biceps brachii muscle oxygenation and hemodynamics.

PubMed

Muthalib, Makii; Lee, Hoseong; Millet, Guillaume Y; Ferrari, Marco; Nosaka, Kazunori

2010-09-01

Eccentric contractions (ECC) require lower systemic oxygen (O2) and induce greater symptoms of muscle damage than concentric contractions (CON); however, it is not known if local muscle oxygenation is lower in ECC than CON during and following exercise. This study compared between ECC and CON for changes in biceps brachii muscle oxygenation [tissue oxygenation index (TOI)] and hemodynamics [total hemoglobin volume (tHb)=oxygenated-Hb+deoxygenated-Hb], determined by near-infrared spectroscopy over 10 sets of 6 maximal contractions of the elbow flexors of 10 healthy subjects. This study also compared between ECC and CON for changes in TOI and tHb during a 10-s sustained and 30-repeated maximal isometric contraction (MVC) task measured immediately before and after and 1-3 days following exercise. The torque integral during ECC was greater (P<0.05) than that during CON by approximately 30%, and the decrease in TOI was smaller (P<0.05) by approximately 50% during ECC than CON. Increases in tHb during the relaxation phases were smaller (P<0.05) by approximately 100% for ECC than CON; however, the decreases in tHb during the contraction phases were not significantly different between sessions. These results suggest that ECC utilizes a lower muscle O2 relative to O2 supply compared with CON. Following exercise, greater (P<0.05) decreases in MVC strength and increases in plasma creatine kinase activity and muscle soreness were evident 1-3 days after ECC than CON. Torque integral, TOI, and tHb during the sustained and repeated MVC tasks decreased (P<0.01) only after ECC, suggesting that muscle O2 demand relative to O2 supply during the isometric tasks was decreased after ECC. This could mainly be due to a lower maximal muscle mass activated as a consequence of muscle damage; however, an increase in O2 supply due to microcirculation dysfunction and/or inflammatory vasodilatory responses after ECC is recognized.

BMI and Risk of Serious Upper Body Injury Following Motor Vehicle Crashes: Concordance of Real-World and Computer-Simulated Observations

PubMed Central

Zhu, Shankuan; Kim, Jong-Eun; Ma, Xiaoguang; Shih, Alan; Laud, Purushottam W.; Pintar, Frank; Shen, Wei; Heymsfield, Steven B.; Allison, David B.

2010-01-01

Background Men tend to have more upper body mass and fat than women, a physical characteristic that may predispose them to severe motor vehicle crash (MVC) injuries, particularly in certain body regions. This study examined MVC-related regional body injury and its association with the presence of driver obesity using both real-world data and computer crash simulation. Methods and Findings Real-world data were from the 2001 to 2005 National Automotive Sampling System Crashworthiness Data System. A total of 10,941 drivers who were aged 18 years or older involved in frontal collision crashes were eligible for the study. Sex-specific logistic regression models were developed to analyze the associations between MVC injury and the presence of driver obesity. In order to confirm the findings from real-world data, computer models of obese subjects were constructed and crash simulations were performed. According to real-world data, obese men had a substantially higher risk of injury, especially serious injury, to the upper body regions including head, face, thorax, and spine than normal weight men (all p<0.05). A U-shaped relation was found between body mass index (BMI) and serious injury in the abdominal region for both men and women (p<0.05 for both BMI and BMI2). In the high-BMI range, men were more likely to be seriously injured than were women for all body regions except the extremities and abdominal region (all p<0.05 for interaction between BMI and sex). The findings from the computer simulation were generally consistent with the real-world results in the present study. Conclusions Obese men endured a much higher risk of injury to upper body regions during MVCs. This higher risk may be attributed to differences in body shape, fat distribution, and center of gravity between obese and normal-weight subjects, and between men and women. Please see later in the article for the Editors' Summary PMID:20361024

The Impact of Child Safety Restraint Status and Age in Motor Vehicle Collisions in Predicting Type and Severity of Bone Fractures and Traumatic Injuries.

PubMed

Loftis, Christopher M; Sawyer, Jeffrey R; Eubanks, James W; Kelly, Derek M

2017-12-01

Although morbidity and mortality in children increases in motor vehicle collisions (MVC) if child restraints are not used, no data exist correlating specific injuries with proper or improper use of safety restraints or age. The purpose of this study was to evaluate correlations between childhood MVC injuries, age, and restraint status. A medical record search for pediatric patients involved in a MVC was conducted at a pediatric hospital (level 1 trauma). Charts were reviewed for demographics and injury-specific information. Patients were grouped by age, restraint use, and injuries. Nine hundred sixty-seven patients ≤12 years (average age 6.39 y) were identified. Being properly restrained was most common in all age groups except the 4- to 8-year age group in which being improperly restrained was most common. Unrestrained patients were most commonly found in the 9- to 12-year age group. A statistically significant difference was not observed for orthopaedic injuries among the restraint groups, but internal thoracic injuries, open head wound, and open upper extremity wounds were significantly more common in improperly or unrestrained patients. Improperly restrained infants had a significantly higher rate of intracranial bleeds and abrasions than those properly restrained. Unrestrained and improperly restrained 9- to 12-year olds had significantly more open head, open upper extremity, and vascular injuries. When comparing injury types with age groups, upper extremity fractures, femoral fractures, dislocations, and spinal fractures were found to be significantly higher in older children. Preventing orthopaedic injuries in older children may be accomplished by changes in regulations or automotive safety equipment. Rear-facing child safety seats could possibly be improved to prevent head trauma in the youngest patients. There is a continued need to reinforce the importance of proper use of child safety devices to parents. Knowledge of the patient's age, along with restraint status, might aid in diagnosis of less obvious MCV injuries. Level III.

Short-term transcutaneous electrical nerve stimulation reduces pain and improves the masticatory muscle activity in temporomandibular disorder patients: a randomized controlled trial

PubMed Central

FERREIRA, Ana Paula de Lima; da COSTA, Dayse Regina Alves; de OLIVEIRA, Ana Izabela Sobral; CARVALHO, Elyson Adam Nunes; CONTI, Paulo César Rodrigues; COSTA, Yuri Martins; BONJARDIM, Leonardo Rigoldi

2017-01-01

Abstract Studies to assess the effects of therapies on pain and masticatory muscle function are scarce. Objective To investigate the short-term effect of transcutaneous electrical nerve stimulation (TENS) by examining pain intensity, pressure pain threshold (PPT) and electromyography (EMG) activity in patients with temporomandibular disorder (TMD). Material and Methods Forty patients with myofascial TMD were enrolled in this randomized placebo-controlled trial and were divided into two groups: active (n=20) and placebo (n=20) TENS. Outcome variables assessed at baseline (T0), immediately after (T2) and 48 hours after treatment (T1) were: pain intensity with the aid of a visual analogue scale (VAS); PPT of masticatory and cervical structures; EMG activity during mandibular rest position (MR), maximal voluntary contraction (MVC) and habitual chewing (HC). Two-way ANOVA for repeated measures was applied to the data and the significance level was set at 5%. Results There was a decrease in the VAS values at T1 and T2 when compared with T0 values in the active TENS group (p<0.050). The PPT between-group differences were significant at T1 assessment of the anterior temporalis and sternocleidomastoid (SCM) and T2 for the masseter and the SCM (p<0.050). A significant EMG activity reduction of the masseter and anterior temporalis was presented in the active TENS during MR at T1 assessment when compared with T0 (p<0.050). The EMG activity of the anterior temporalis was significantly higher in the active TENS during MVC at T1 and T2 when compared with placebo (p<0.050). The EMG activity of the masseter and anterior temporalis muscle was significantly higher in the active TENS during HC at T1 when compared with placebo (p<0.050). Conclusions The short-term therapeutic effects of TENS are superior to those of the placebo, because of reported facial pain, deep pain sensitivity and masticatory muscle EMG activity improvement. PMID:28403351

Improvements in force variability and structure from vision- to memory-guided submaximal isometric knee extension in subacute stroke.

PubMed

Chow, John W; Stokic, Dobrivoje S

2018-03-01

We examined changes in variability, accuracy, frequency composition, and temporal regularity of force signal from vision-guided to memory-guided force-matching tasks in 17 subacute stroke and 17 age-matched healthy subjects. Subjects performed a unilateral isometric knee extension at 10, 30, and 50% of peak torque [maximum voluntary contraction (MVC)] for 10 s (3 trials each). Visual feedback was removed at the 5-s mark in the first two trials (feedback withdrawal), and 30 s after the second trial the subjects were asked to produce the target force without visual feedback (force recall). The coefficient of variation and constant error were used to quantify force variability and accuracy. Force structure was assessed by the median frequency, relative spectral power in the 0-3-Hz band, and sample entropy of the force signal. At 10% MVC, the force signal in subacute stroke subjects became steadier, more broadband, and temporally more irregular after the withdrawal of visual feedback, with progressively larger error at higher contraction levels. Also, the lack of modulation in the spectral frequency at higher force levels with visual feedback persisted in both the withdrawal and recall conditions. In terms of changes from the visual feedback condition, the feedback withdrawal produced a greater difference between the paretic, nonparetic, and control legs than the force recall. The overall results suggest improvements in force variability and structure from vision- to memory-guided force control in subacute stroke despite decreased accuracy. Different sensory-motor memory retrieval mechanisms seem to be involved in the feedback withdrawal and force recall conditions, which deserves further study. NEW & NOTEWORTHY We demonstrate that in the subacute phase of stroke, force signals during a low-level isometric knee extension become steadier, more broadband in spectral power, and more complex after removal of visual feedback. Larger force errors are produced when recalling target forces than immediately after withdrawing visual feedback. Although visual feedback offers better accuracy, it worsens force variability and structure in subacute stroke. The feedback withdrawal and force recall conditions seem to involve different memory retrieval mechanisms.

Effects of experimental muscle pain on muscle activity and co-ordination during static and dynamic motor function.

PubMed

Graven-Nielsen, T; Svensson, P; Arendt-Nielsen, L

1997-04-01

The relation between muscle pain, muscle activity, and muscle co-ordination is still controversial. The present human study investigates the influence of experimental muscle pain on resting, static, and dynamic muscle activity. In the resting and static experiments, the electromyography (EMG) activity and the contraction force of m. tibialis anterior were assessed before and after injection of 0.5 ml hypertonic saline (5%) into the same muscle. In the dynamic experiment, injections of 0.5 ml hypertonic saline (5%) were performed into either m. tibialis anterior (TA) or m. gastrocnemius (GA) and the muscle activity and co-ordination were investigated during gait on a treadmill by EMG recordings from m. TA and m. GA. At rest no evidence of EMG hyperactivity was found during muscle pain. The maximal voluntary contraction (MVC) during muscle pain was significantly lower than the control condition (P < 0.05). During a static contraction at 80% of the pre-pain MVC muscle pain caused a significant reduction in endurance time (P < 0.043). During dynamic contractions, muscle pain resulted in a significant decrease of the EMG activity in the muscle, agonistic to the painful muscle (P < 0.05), and a significant increase of the EMG activity of the muscle, antagonistic to the painful muscle (P < 0.05). Muscle pain seems to cause a general protection of painful muscles during both static and dynamic contractions. The increased EMG activity of the muscle antagonistic to the painful muscle is probably a functional adaptation of muscle co-ordination in order to limit movements. Modulation of muscle activity by muscle pain could be controlled via inhibition of muscles agonistic to the movement and/or excitation of muscles antagonistic to the movement. The present results are in accordance with the pain-adaptation model (Lund, J.P., Stohler, C.S. and Widmer, C.G. In: H. Vaerøy and H. Merskey (Eds.), Progress in Fibromyalgia and Myofascial Pain. Elsevier, Amsterdam, 1993, pp. 311-327.) which predicts increased activity of antagonistic muscle and decreased activity of agonistic muscle during experimental and clinical muscle pain.

Assessment of the paraspinal muscles of subjects presenting an idiopathic scoliosis: an EMG pilot study

PubMed Central

Gaudreault, Nathaly; Arsenault, A Bertrand; Larivière, Christian; DeSerres, Sophie J; Rivard, Charles-Hilaire

2005-01-01

Background It is known that the back muscles of scoliotic subjects present abnormalities in their fiber type composition. Some researchers have hypothesized that abnormal fiber composition can lead to paraspinal muscle dysfunction such as poor neuromuscular efficiency and muscle fatigue. EMG parameters were used to evaluate these impairments. The purpose of the present study was to examine the clinical potential of different EMG parameters such as amplitude (RMS) and median frequency (MF) of the power spectrum in order to assess the back muscles of patients presenting idiopathic scoliosis in terms of their neuromuscular efficiency and their muscular fatigue. Methods L5/S1 moments during isometric efforts in extension were measured in six subjects with idiopathic scoliosis and ten healthy controls. The subjects performed three 7 s ramp contractions ranging from 0 to 100% maximum voluntary contraction (MVC) and one 30 s sustained contraction at 75% MVC. Surface EMG activity was recorded bilaterally from the paraspinal muscles at L5, L3, L1 and T10. The slope of the EMG RMS/force (neuromuscular efficiency) and MF/force (muscle composition) relationships were computed during the ramp contractions while the slope of the EMG RMS/time and MF/time relationships (muscle fatigue) were computed during the sustained contraction. Comparisons were performed between the two groups and between the left and right sides for the EMG parameters. Results No significant group or side differences between the slopes of the different measures used were found at the level of the apex (around T10) of the major curve of the spine. However, a significant side difference was seen at a lower level (L3, p = 0.01) for the MF/time parameter. Conclusion The EMG parameters used in this study could not discriminate between the back muscles of scoliotic subjects and those of control subject regarding fiber type composition, neuromuscular efficiency and muscle fatigue at the level of the apex. The results of this pilot study indicate that compensatory strategies are potentially seen at lower level of the spine with these EMG parameters. PMID:15760468

The effect of long-term confinement and the efficacy of exercise countermeasures on muscle strength during a simulated mission to Mars: data from the Mars500 study.

PubMed

Gaffney, Christopher J; Fomina, Elena; Babich, Dennis; Kitov, Vladimir; Uskov, Konstantin; Green, David A

2017-11-13

Isolation and long duration spaceflight are associated with musculoskeletal deconditioning. Mars500 was a unique, high-fidelity analogue of the psychological challenges of a 520-day manned mission to Mars. We aimed to explore the effect of musculoskeletal deconditioning on three outcome measures: (1) if lower limb muscle strength was reduced during the 520-day isolation; (2) if type I or II muscle fibres were differentially affected; and (3) whether any 70-day exercise interventions prevented any isolation-induced loss of strength. Six healthy male subjects (mean ± SEM) (34 ± 3 years; 1.76 ± 0.02 metres; 83.7 ± 4.8 kg) provided written, informed consent to participate. The subjects' maximal voluntary contraction (MVC) was assessed isometrically in the calf (predominantly type I fibres), and maximal voluntary isokinetic force (MVIF) was assessed in the quadriceps/hamstrings (predominantly type II fibres) at 0.2 and 0.4 ms -1 using the Multifunctional Dynamometer for Space (MDS) at 35-day intervals throughout Mars500. Exercise interventions were completed 3-7 days/week throughout the 520-day isolation in a counterbalanced design excluding 142-177 days (rest period) and 251-284 days (simulated Mars landing). Exercise interventions included motorized treadmill running, non-motorized treadmill running, cycle ergometry, elastomer-based resistance exercise, whole-body vibration (WBV), and resistance exercise using MDS. Calf MVC did not reduce across the 520-day isolation and MDS increased strength by 18% compared to before that of 70-day exercise intervention. In contrast, there was a significant bilateral loss of MVIF across the 520 days at both 0.2 ms -1 (R 2  = 0.53; P = 0.001) and 0.4 ms -1 (0.4 ms -1 ; R 2  = 0.42; P = 0.007). WBV (+ 3.7 and 8.8%) and MDS (+ 4.9 and 5.2%) afforded the best protection against isolation-induced loss of MVIF, although MDS was the only intervention to prevent bilateral loss of calf MVC and leg MVIF at 0.2 and 0.4 ms -1 . Mars500 induced significant loss of quadriceps/hamstrings MVIF but not calf MVC. Collectively, these data suggest that muscles with predominantly type I fibres were affected less by isolation compared to type II dominant muscles. MDS and WBV afforded the best protection against isolation-induced loss of strength and thus may have virtue in exploration class missions.

Shortening-induced torque depression in old men: implications for age-related power loss.

PubMed

Power, Geoffrey A; Makrakos, Demetri P; Stevens, Daniel E; Herzog, Walter; Rice, Charles L; Vandervoort, Anthony A

2014-09-01

Following active muscle shortening, the steady-state isometric torque at the final muscle length is lower than the steady-state torque obtained for a purely isometric contraction at that same final muscle length. This well-documented property of skeletal muscle is termed shortening-induced torque depression (TD). Despite many investigations into the mechanisms of weakness and power loss in old age, the influence of muscle shortening on the history dependence of isometric torque production remains to be elucidated. Thus, it is unclear whether older adults are disadvantaged for torque and power production following a dynamic shortening contraction. The purpose of this study was to evaluate shortening-induced TD in older adults, and to determine whether shortening-induced TD is related to power loss. Maximal voluntary isometric dorsiflexion contractions (MVC; 10s) in 8 young (25.5±3.7years) and 9 old (76.1±5.4years) men were performed on a HUMAC NORM dynamometer as a reference, and then again following an active shortening of 40° joint excursion (40°PF-0°PF) at angular velocities of 15°/s and 120°/s. Work and instantaneous power were derived during shortening. Shortening-induced TD was calculated and expressed as a percentage by determining the mean torque value over 1s during the isometric steady state of the MVC following shortening, divided by the mean torque value for the same 1s time period during the isometric reference MVC. To assess muscle activation, electromyography (root mean square; EMGRMS) of the tibialis anterior (TA) and soleus (SOL) was calculated at identical time points used in assessing shortening-induced TD, and voluntary activation (VA) was assessed using the interpolated twitch technique. Old were 18% weaker than young for MVC, and ~40% less powerful for 15°/s and 120°/s of shortening. Old produced 37% and 21% less work for 15°/s and 120°/s than young, respectively. Furthermore, old experienced 60% and 70% greater shortening-induced TD than young for 15°/s and 120°/s, respectively with similar EMGRMS and VA across all conditions. A significant relationship between shortening-induced TD and instantaneous power was found only at the fast angular velocity for both the old (R(2)=0.32) and young (R(2)=0.45) men. The older men experienced greater shortening-induced TD than young while maintaining similar levels of voluntary activation. This previously unaccounted for history-dependent property of muscle may provide insight into power loss in old age. Copyright © 2014 Elsevier Inc. All rights reserved.

Reliability of muscle blood flow and oxygen consumption response from exercise using near-infrared spectroscopy.

PubMed

Lucero, Adam A; Addae, Gifty; Lawrence, Wayne; Neway, Beemnet; Credeur, Daniel P; Faulkner, James; Rowlands, David; Stoner, Lee

2018-01-01

What is the central question of this study? Continuous-wave near-infrared spectroscopy, coupled with venous and arterial occlusions, offers an economical, non-invasive alternative to measuring skeletal muscle blood flow and oxygen consumption, but its reliability during exercise has not been established. What is the main finding and its importance? Continuous-wave near-infrared spectroscopy devices can reliably assess local skeletal muscle blood flow and oxygen consumption from the vastus lateralis in healthy, physically active adults. The patterns of response exhibited during exercise of varying intensity agree with other published results using similar methodologies, meriting potential applications in clinical diagnosis and therapeutic assessment. Near-infrared spectroscopy (NIRS), coupled with rapid venous and arterial occlusions, can be used for the non-invasive estimation of resting local skeletal muscle blood flow (mBF) and oxygen consumption (mV̇O2), respectively. However, the day-to-day reliability of mBF and mV̇O2 responses to stressors such as incremental dynamic exercise has not been established. The aim of this study was to determine the reliability of NIRS-derived mBF and mV̇O2 responses from incremental dynamic exercise. Measurements of mBF and mV̇O2 were collected in the vastus lateralis of 12 healthy, physically active adults [seven men and five women; 25 (SD 6) years old] during three non-consecutive visits within 10 days. After 10 min rest, participants performed 3 min of rhythmic isotonic knee extension (one extension every 4 s) at 5, 10, 15, 20, 25 and 30% of maximal voluntary contraction (MVC), before four venous occlusions and then two arterial occlusions. The mBF and mV̇O2 increased proportionally with intensity [from 0.55 to 7.68 ml min -1  (100 ml) -1 and from 0.05 to 1.86 ml O 2  min -1  (100 g) -1 , respectively] up to 25% MVC, where they began to plateau at 30% MVC. Moreover, an mBF/mV̇O2 muscle oxygen consumption ratio of ∼5 was consistent for all exercise stages. The intraclass correlation coefficient for mBF indicated high to very high reliability for 10-30% MVC (0.82-0.9). There was very high reliability for mV̇O2 across all exercise stages (intraclass correlation coefficient 0.91-0.96). In conclusion, NIRS can reliably assess muscle blood flow and oxygen consumption responses to low- to moderate-intensity exercise, meriting potential applications in clinical diagnosis and therapeutic assessment. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.

Effects on Hamstring Muscle Extensibility, Muscle Activity, and Balance of Different Stretching Techniques

PubMed Central

Lim, Kyoung-Il; Nam, Hyung-Chun; Jung, Kyoung-Sim

2014-01-01

[Purpose] The purpose of this study was to investigate the effects of two different stretching techniques on range of motion (ROM), muscle activation, and balance. [Subjects] For the present study, 48 adults with hamstring muscle tightness were recruited and randomly divided into three groups: a static stretching group (n=16), a PNF stretching group (n=16), a control group (n=16). [Methods] Both of the stretching techniques were applied to the hamstring once. Active knee extension angle, muscle activation during maximum voluntary isometric contraction (MVC), and static balance were measured before and after the application of each stretching technique. [Results] Both the static stretching and the PNF stretching groups showed significant increases in knee extension angle compared to the control group. However, there were no significant differences in muscle activation or balance between the groups. [Conclusion] Static stretching and PNF stretching techniques improved ROM without decrease in muscle activation, but neither of them exerted statistically significant effects on balance. PMID:24648633

Validity and Reliability of Surface Electromyography Measurements from a Wearable Athlete Performance System

PubMed Central

Lynn, Scott K.; Watkins, Casey M.; Wong, Megan A.; Balfany, Katherine; Feeney, Daniel F.

2018-01-01

The Athos ® wearable system integrates surface electromyography (sEMG ) electrodes into the construction of compression athletic apparel. The Athos system reduces the complexity and increases the portability of collecting EMG data and provides processed data to the end user. The objective of the study was to determine the reliability and validity of Athos as compared with a research grade sEMG system. Twelve healthy subjects performed 7 trials on separate days (1 baseline trial and 6 repeated trials). In each trial subjects wore the wearable sEMG system and had a research grade sEMG system’s electrodes placed just distal on the same muscle, as close as possible to the wearable system’s electrodes. The muscles tested were the vastus lateralis (VL), vastus medialis (VM), and biceps femoris (BF). All testing was done on an isokinetic dynamometer. Baseline testing involved performing isometric 1 repetition maximum tests for the knee extensors and flexors and three repetitions of concentric-concentric knee flexion and extension at MVC for each testing speed: 60, 180, and 300 deg/sec. Repeated trials 2-7 each comprised 9 sets where each set included three repetitions of concentric-concentric knee flexion-extension. Each repeated trial (2-7) comprised one set at each speed and percent MVC (50%, 75%, 100%) combination. The wearable system and research grade sEMG data were processed using the same methods and aligned in time. The amplitude metrics calculated from the sEMG for each repetition were the peak amplitude, sum of the linear envelope, and 95th percentile. Validity results comprise two main findings. First, there is not a significant effect of system (Athos or research grade system) on the repetition amplitude metrics (95%, peak, or sum). Second, the relationship between torque and sEMG is not significantly different between Athos and the research grade system. For reliability testing, the variation across trials and averaged across speeds was 0.8%, 7.3%, and 0.2% higher for Athos from BF, VL and VM, respectively. Also, using the standard deviation of the MVC normalized repetition amplitude, the research grade system showed 10.7% variability while Athos showed 12%. The wearable technology (Athos) provides sEMG measures that are consistent with controlled, research grade technologies and data collection procedures. Key points Surface EMG embedded into athletic garments (Athos) had similar validity and reliability when compared with a research grade system There was no difference in the torque-EMG relationship between the two systems No statistically significant difference in reliability across 6 trials between the two systems The validity and reliability of Athos demonstrates the potential for sEMG to be applied in dynamic rehabilitation and sports settings PMID:29769821

Towards the integration, annotation and association of historical microarray experiments with RNA-seq.

PubMed

Chavan, Shweta S; Bauer, Michael A; Peterson, Erich A; Heuck, Christoph J; Johann, Donald J

2013-01-01

Transcriptome analysis by microarrays has produced important advances in biomedicine. For instance in multiple myeloma (MM), microarray approaches led to the development of an effective disease subtyping via cluster assignment, and a 70 gene risk score. Both enabled an improved molecular understanding of MM, and have provided prognostic information for the purposes of clinical management. Many researchers are now transitioning to Next Generation Sequencing (NGS) approaches and RNA-seq in particular, due to its discovery-based nature, improved sensitivity, and dynamic range. Additionally, RNA-seq allows for the analysis of gene isoforms, splice variants, and novel gene fusions. Given the voluminous amounts of historical microarray data, there is now a need to associate and integrate microarray and RNA-seq data via advanced bioinformatic approaches. Custom software was developed following a model-view-controller (MVC) approach to integrate Affymetrix probe set-IDs, and gene annotation information from a variety of sources. The tool/approach employs an assortment of strategies to integrate, cross reference, and associate microarray and RNA-seq datasets. Output from a variety of transcriptome reconstruction and quantitation tools (e.g., Cufflinks) can be directly integrated, and/or associated with Affymetrix probe set data, as well as necessary gene identifiers and/or symbols from a diversity of sources. Strategies are employed to maximize the annotation and cross referencing process. Custom gene sets (e.g., MM 70 risk score (GEP-70)) can be specified, and the tool can be directly assimilated into an RNA-seq pipeline. A novel bioinformatic approach to aid in the facilitation of both annotation and association of historic microarray data, in conjunction with richer RNA-seq data, is now assisting with the study of MM cancer biology.

Mirror illusion reduces motor cortical inhibition in the ipsilateral primary motor cortex during forceful unilateral muscle contractions.

PubMed

Zult, Tjerk; Goodall, Stuart; Thomas, Kevin; Hortobágyi, Tibor; Howatson, Glyn

2015-04-01

Forceful, unilateral contractions modulate corticomotor paths targeting the resting, contralateral hand. However, it is unknown whether mirror-viewing of a slowly moving but forcefully contracting hand would additionally affect these paths. Here we examined corticospinal excitability and short-interval intracortical inhibition (SICI) of the right-ipsilateral primary motor cortex (M1) in healthy young adults under no-mirror and mirror conditions at rest and during right wrist flexion at 60% maximal voluntary contraction (MVC). During the no-mirror conditions neither hand was visible, whereas in the mirror conditions participants looked at the right hand's reflection in the mirror. Corticospinal excitability increased during contractions in the left flexor carpi radialis (FCR) (contraction 0.41 mV vs. rest 0.21 mV) and extensor carpi radialis (ECR) (contraction 0.56 mV vs. rest 0.39 mV), but there was no mirror effect (FCR: P = 0.743, ηp (2) = 0.005; ECR: P = 0.712, ηp (2) = 0.005). However, mirror-viewing of the contracting and moving wrist attenuated SICI relative to test pulse in the left FCR by ∼9% compared with the other conditions (P < 0.05, d ≥ 0.62). Electromyographic activity in the resting left hand prior to stimulation was not affected by the mirror (FCR: P = 0.255, ηp (2) = 0.049; ECR: P = 0.343, ηp (2) = 0.035) but increased twofold during contractions. Thus viewing the moving hand in the mirror and not just the mirror image of the nonmoving hand seems to affect motor cortical inhibitory networks in the M1 associated with the mirror image. Future studies should determine whether the use of a mirror could increase interlimb transfer produced by cross-education, especially in patient groups with unilateral orthopedic and neurological conditions. Copyright © 2015 the American Physiological Society.

Mirror illusion reduces motor cortical inhibition in the ipsilateral primary motor cortex during forceful unilateral muscle contractions

PubMed Central

Goodall, Stuart; Thomas, Kevin; Hortobágyi, Tibor; Howatson, Glyn

2015-01-01

Forceful, unilateral contractions modulate corticomotor paths targeting the resting, contralateral hand. However, it is unknown whether mirror-viewing of a slowly moving but forcefully contracting hand would additionally affect these paths. Here we examined corticospinal excitability and short-interval intracortical inhibition (SICI) of the right-ipsilateral primary motor cortex (M1) in healthy young adults under no-mirror and mirror conditions at rest and during right wrist flexion at 60% maximal voluntary contraction (MVC). During the no-mirror conditions neither hand was visible, whereas in the mirror conditions participants looked at the right hand's reflection in the mirror. Corticospinal excitability increased during contractions in the left flexor carpi radialis (FCR) (contraction 0.41 mV vs. rest 0.21 mV) and extensor carpi radialis (ECR) (contraction 0.56 mV vs. rest 0.39 mV), but there was no mirror effect (FCR: P = 0.743, ηp2 = 0.005; ECR: P = 0.712, ηp2 = 0.005). However, mirror-viewing of the contracting and moving wrist attenuated SICI relative to test pulse in the left FCR by ∼9% compared with the other conditions (P < 0.05, d ≥ 0.62). Electromyographic activity in the resting left hand prior to stimulation was not affected by the mirror (FCR: P = 0.255, ηp2 = 0.049; ECR: P = 0.343, ηp2 = 0.035) but increased twofold during contractions. Thus viewing the moving hand in the mirror and not just the mirror image of the nonmoving hand seems to affect motor cortical inhibitory networks in the M1 associated with the mirror image. Future studies should determine whether the use of a mirror could increase interlimb transfer produced by cross-education, especially in patient groups with unilateral orthopedic and neurological conditions. PMID:25632077

EMG activity of hip and trunk muscles during deep-water running.

PubMed

Kaneda, Koichi; Sato, Daisuke; Wakabayashi, Hitoshi; Nomura, Takeo

2009-12-01

The present study used synchronized motion analysis to investigate the activity of hip and trunk muscles during deep-water running (DWR) relative to land walking (LW) and water walking (WW). Nine healthy men performed each exercise at self-determined slow, moderate, and fast paces, and surface electromyography was used to investigate activity of the adductor longus, gluteus maxima, gluteus medius, rectus abdominis, oblique externus abdominis, and erector spinae. The following kinematic parameters were calculated: the duration of one cycle, range of motion (ROM) of the hip joint, and absolute angles of the pelvis and trunk with respect to the vertical axis in the sagittal plane. The percentages of maximal voluntary contraction (%MVC) of each muscle were higher during DWR than during LW and WW. The %MVC of the erector spinae during WW increased concomitant with the pace increment. The hip joint ROMs were larger in DWR than in LW and WW. Forward inclinations of the trunk were apparent for DWR and fast-paced WW. The pelvis was inclined forward in DWR and WW. In conclusion, the higher-level activities during DWR are affected by greater hip joint motion and body inclinations with an unstable floating situation.

Multivariable Dynamic Ankle Mechanical Impedance With Active Muscles

PubMed Central

Lee, Hyunglae; Krebs, Hermano Igo; Hogan, Neville

2015-01-01

Multivariable dynamic ankle mechanical impedance in two coupled degrees-of-freedom (DOFs) was quantified when muscles were active. Measurements were performed at five different target activation levels of tibialis anterior and soleus, from 10% to 30% of maximum voluntary contraction (MVC) with increments of 5% MVC. Interestingly, several ankle behaviors characterized in our previous study of the relaxed ankle were observed with muscles active: ankle mechanical impedance in joint coordinates showed responses largely consistent with a second-order system consisting of inertia, viscosity, and stiffness; stiffness was greater in the sagittal plane than in the frontal plane at all activation conditions for all subjects; and the coupling between dorsiflexion–plantarflexion and inversion–eversion was small—the two DOF measurements were well explained by a strictly diagonal impedance matrix. In general, ankle stiffness increased linearly with muscle activation in all directions in the 2-D space formed by the sagittal and frontal planes, but more in the sagittal than in the frontal plane, resulting in an accentuated “peanut shape.” This characterization of young healthy subjects’ ankle mechanical impedance with active muscles will serve as a baseline to investigate pathophysiological ankle behaviors of biomechanically and/or neurologically impaired patients. PMID:25203497

Comparison of Thoracic and Lumbar Erector Spinae Muscle Activation Before and After a Golf Practice Session.

PubMed

Sorbie, Graeme G; Grace, Fergal M; Gu, Yaodong; Baker, Julien S; Ugbolue, Ukadike C

2017-08-01

Lower back pain is commonly associated with golfers. The study aimed: to determine whether thoracic- and lumbar-erector-spinae muscle display signs of muscular fatigue after completing a golf practice session, and to examine the effect of the completed practice session on club head speed, ball speed and absolute carry distance performance variables. Fourteen right-handed male golfers participated in the laboratory-based-study. Surface electromyography (EMG) data was collected from the lead and trail sides of the thoracic- and lumbar-erector-spinae muscle. Normalized root mean squared (RMS) EMG activation levels and performance variables for the golf swings were compared before and after the session. Fatigue was assessed using median frequency (MDF) and RMS during the maximum voluntary contraction (MVC) performed before and after the session. No significant differences were observed in RMS thoracic- and lumbar-erector-spinae muscle activation levels during the five phases of the golf swing and performance variables before and after the session (p > .05). Significant changes were displayed in MDF and RMS when comparing the MVC performed before and after the session (p < .05). Fatigue was evident in the trail side of the erector-spinae muscle after the session.

Costs, mortality likelihood and outcomes of hospitalized US children with traumatic brain injuries.

PubMed

Shi, Junxin; Xiang, Huiyun; Wheeler, Krista; Smith, Gary A; Stallones, Lorann; Groner, Jonathan; Wang, Zengzhen

2009-07-01

To examine the hospitalization costs and discharge outcomes of US children with TBI and to evaluate a severity measure, the predictive mortality likelihood level. Data from the 2006 Healthcare Cost and Utilization Project Kids' Inpatient Database (KID) were used to report the national estimates and characteristics of TBI-associated hospitalizations among US children < or =20 years of age. The percentage of children with TBI caused by motor vehicle crashes (MVC) and falls was calculated according to the predictive mortality likelihood levels (PMLL), death in hospital and discharge into long-term rehabilitation facilities. Associations with the PMLL, discharge outcomes and average hospital charges were examined. In 2006, there were an estimated 58 900 TBI-associated hospitalizations among US children, accounting for $2.56 billion in hospital charges. MVCs caused 38.9% and falls caused 21.2% of TBI hospitalizations. The PMLL was strongly associated with TBI type, length of hospital stay, hospital charges and discharge disposition. About 4% of children with fall or MVC related TBIs died in hospital and 9% were discharged into long-term facilities. The PMLL may provide a useful tool to assess characteristics and treatment outcomes of hospitalized TBI children, but more research is still needed.

Patterning of sympathetic nerve activity in response to vestibular stimulation

NASA Technical Reports Server (NTRS)

Kerman, I. A.; McAllen, R. M.; Yates, B. J.

2000-01-01

Growing evidence suggests a role for the vestibular system in regulation of autonomic outflow during postural adjustments. In the present paper we review evidence for the patterning of sympathetic nerve activity elicited by vestibular stimulation. In response to electrical activation of vestibular afferents, firing of sympathetic nerves located throughout the body is altered. However, activity of the renal nerve is most sensitive to vestibular inputs. In contrast, high-intensity simultaneous activation of cutaneous and muscle inputs elicits equivalent changes in firing of the renal, superior mesenteric and lumbar colonic nerves. Responses of muscle vasoconstrictor (MVC) efferents to vestibular stimulation are either inhibitory (Type I) or are comprised of a combination of excitation and inhibition (Type II). Interestingly, single MVC units located in the hindlimb exhibited predominantly Type I responses while those located in the forelimb and face exhibited Type II responses. Furthermore, brachial and femoral arterial blood flows were dissociated in response to vestibular stimulation, such that brachial vascular resistance increased while femoral resistance decreased. These studies demonstrate that vestibulosympathetic reflexes are patterned according to both the anatomical location and innervation target of a particular sympathetic nerve, and can lead to distinct changes in local blood flow.

Ankle voluntary movement enhancement following robotic-assisted locomotor training in spinal cord injury.

PubMed

Varoqui, Deborah; Niu, Xun; Mirbagheri, Mehdi M

2014-03-31

In incomplete spinal cord injury (iSCI), sensorimotor impairments result in severe limitations to ambulation. To improve walking capacity, physical therapies using robotic-assisted locomotor devices, such as the Lokomat, have been developed. Following locomotor training, an improvement in gait capabilities-characterized by increases in the over-ground walking speed and endurance-is generally observed in patients. To better understand the mechanisms underlying these improvements, we studied the effects of Lokomat training on impaired ankle voluntary movement, known to be an important limiting factor in gait for iSCI patients. Fifteen chronic iSCI subjects performed twelve 1-hour sessions of Lokomat training over the course of a month. The voluntary movement was qualified by measuring active range of motion, maximal velocity peak and trajectory smoothness for the spastic ankle during a movement from full plantar-flexion (PF) to full dorsi-flexion (DF) at the patient's maximum speed. Dorsi- and plantar-flexor muscle strength was quantified by isometric maximal voluntary contraction (MVC). Clinical assessments were also performed using the Timed Up and Go (TUG), the 10-meter walk (10MWT) and the 6-minute walk (6MWT) tests. All evaluations were performed both before and after the training and were compared to a control group of fifteen iSCI patients. After the Lokomat training, the active range of motion, the maximal velocity, and the movement smoothness were significantly improved in the voluntary movement. Patients also exhibited an improvement in the MVC for their ankle dorsi- and plantar-flexor muscles. In terms of functional activity, we observed an enhancement in the mobility (TUG) and the over-ground gait velocity (10MWT) with training. Correlation tests indicated a significant relationship between ankle voluntary movement performance and the walking clinical assessments. The improvements of the kinematic and kinetic parameters of the ankle voluntary movement, and their correlation with the functional assessments, support the therapeutic effect of robotic-assisted locomotor training on motor impairment in chronic iSCI.

Can Cognitive Activities during Breaks in Repetitive Manual Work Accelerate Recovery from Fatigue? A Controlled Experiment

PubMed Central

Mathiassen, Svend Erik; Hallman, David M.; Lyskov, Eugene; Hygge, Staffan

2014-01-01

Neurophysiologic theory and some empirical evidence suggest that fatigue caused by physical work may be more effectively recovered during “diverting” periods of cognitive activity than during passive rest; a phenomenon of great interest in working life. We investigated the extent to which development and recovery of fatigue during repeated bouts of an occupationally relevant reaching task was influenced by the difficulty of a cognitive activity between these bouts. Eighteen male volunteers performed three experimental sessions, consisting of six 7-min bouts of reaching alternating with 3 minutes of a memory test differing in difficulty between sessions. Throughout each session, recordings were made of upper trapezius muscle activity using electromyography (EMG), heart rate and heart rate variability (HRV) using electrocardiography, arterial blood pressure, and perceived fatigue (Borg CR10 scale and SOFI). A test battery before, immediately after and 1 hour after the work period included measurements of maximal shoulder elevation strength (MVC), pressure pain threshold (PPT) over the trapezius muscles, and a submaximal isometric contraction. As expected, perceived fatigue and EMG amplitude increased during the physical work bouts. Recovery did occur between the bouts, but fatigue accumulated throughout the work period. Neither EMG changes nor recovery of perceived fatigue during breaks were influenced by cognitive task difficulty, while heart rate and HRV recovered the most during breaks with the most difficult task. Recovery of perceived fatigue after the 1 hour work period was also most pronounced for the most difficult cognitive condition, while MVC and PPT showed ambiguous patterns, and EMG recovered similarly after all three cognitive protocols. Thus, we could confirm that cognitive tasks between bouts of fatiguing physical work can, indeed, accelerate recovery of some factors associated with fatigue, even if benefits may be moderate and some responses may be equivocal. Our results encourage further research into combinations of physical and mental tasks in an occupational context. PMID:25375644

Age-related differences in factors associated with cervical spine injuries in children.

PubMed

Leonard, Julie C; Jaffe, David M; Olsen, Cody S; Kuppermann, Nathan

2015-04-01

The Pediatric Emergency Care Applied Research Network (PECARN) investigators previously identified risk factors associated with cervical spine injuries (CSIs) in children. Anatomic maturation and age-related variation in mechanisms of injury suggested the need to explore factors separately for younger versus older children. The purpose of this substudy was to investigate CSI risk factors in age subgroups within the PECARN study cohort. This was an age-stratified case-control analysis of children younger than 16 years presenting to 17 PECARN hospitals following blunt trauma between January 1, 2000 and December 31, 2004. Data were abstracted for children with CSIs and randomly selected CSI-free children. Age-stratified multivariable logistic regression was performed to identify factors associated with CSI within three age groups: younger than 2, 2 to 7, and 8 to 15 years. Sensitivity and specificity for CSI were estimated for both the age-specific and original (altered mental status, focal neurologic findings, neck pain, torticollis, substantial torso injury, predisposing conditions, diving, and high-risk motor vehicle crash [MVC]) models. Among 540 children with CSIs, 27 were younger than 2 years, 140 were 2 to 7 years, and 373 were 8 to 15 years. Focal neurologic deficits and high-risk MVC were associated with CSIs in all age-specific models. Other age-specific factors included the following: younger than 2 years, none; 2 to 7 years, altered mental status, neck pain, torticollis; and 8 to 15 years, altered mental status, neck pain, diving. Age-specific models had comparable sensitivity to the original model among the older groups, but had lower sensitivity and higher specificity among the youngest children. While this analysis supports the original PECARN model for CSI, there were subtle age variations in factors associated with CSIs in children that warrant future investigation. © 2015 by the Society for Academic Emergency Medicine.

Vastus lateralis single motor unit EMG at the same absolute torque production at different knee angles.

PubMed

Altenburg, T M; de Haan, A; Verdijk, P W L; van Mechelen, W; de Ruiter, C J

2009-07-01

Single motor unit electromyographic (EMG) activity of the knee extensors was investigated at different knee angles with subjects (n = 10) exerting the same absolute submaximal isometric torque at each angle. Measurements were made over a 20 degrees range around the optimum angle for torque production (AngleTmax) and, where feasible, over a wider range (50 degrees ). Forty-six vastus lateralis (VL) motor units were recorded at 20.7 +/- 17.9 %maximum voluntary contraction (%MVC) together with the rectified surface EMG (rsEMG) of the superficial VL muscle. Due to the lower maximal torque capacity at positions more flexed and extended than AngleTmax, single motor unit recruitment thresholds were expected to decrease and discharge rates were expected to increase at angles above and below AngleTmax. Unexpectedly, the recruitment threshold was higher (P < 0.05) at knee angles 10 degrees more extended (43.7 +/- 22.2 N.m) and not different (P > 0.05) at knee angles 10 degrees more flexed (35.2 +/- 17.9 N.m) compared with recruitment threshold at AngleTmax (41.8 +/- 21.4 N.m). Also, unexpectedly the discharge rates were similar (P > 0.05) at the three angles: 11.6 +/- 2.2, 11.6 +/- 2.1, and 12.3 +/- 2.1 Hz. Similar angle independent discharge rates were also found for 12 units (n = 5; 7.4 +/- 5.4 %MVC) studied over the wider (50 degrees ) range, while recruitment threshold only decreased at more flexed angles. In conclusion, the similar recruitment threshold and discharge behavior of VL motor units during submaximal isometric torque production suggests that net motor unit activation did not change very much along the ascending limb of the knee-angle torque relationship. Several factors such as length-dependent twitch potentiation, which may contribute to this unexpected aspect of motor control, are discussed.

In vivo and in vitro evidence that intrinsic upper- and lower-limb skeletal muscle function is unaffected by ageing and disuse in oldest-old humans.

PubMed

Venturelli, M; Saggin, P; Muti, E; Naro, F; Cancellara, L; Toniolo, L; Tarperi, C; Calabria, E; Richardson, R S; Reggiani, C; Schena, F

2015-09-01

To parse out the impact of advanced ageing and disuse on skeletal muscle function, we utilized both in vivo and in vitro techniques to comprehensively assess upper- and lower-limb muscle contractile properties in 8 young (YG; 25 ± 6 years) and 8 oldest-old mobile (OM; 87 ± 5 years) and 8 immobile (OI; 88 ± 4 years) women. In vivo, maximal voluntary contraction (MVC), electrically evoked resting twitch force (RT), and physiological cross-sectional area (PCSA) of the quadriceps and elbow flexors were assessed. Muscle biopsies of the vastus lateralis and biceps brachii facilitated the in vitro assessment of single fibre-specific tension (Po). In vivo, compared to the young, both the OM and OI exhibited a more pronounced loss of MVC in the lower limb [OM (-60%) and OI (-75%)] than the upper limb (OM = -51%; OI = -47%). Taking into account the reduction in muscle PCSA (OM = -10%; OI = -18%), only evident in the lower limb, by calculating voluntary muscle-specific force, the lower limb of the OI (-40%) was more compromised than the OM (-13%). However, in vivo, RT in both upper and lower limbs (approx. 9.8 N m cm(-2) ) and Po (approx. 123 mN mm(-2) ), assessed in vitro, implies preserved intrinsic contractile function in all muscles of the oldest-old and were well correlated (r = 0.81). These findings suggest that in the oldest-old, neither advanced ageing nor disuse, per se, impacts intrinsic skeletal muscle function, as assessed in vitro. However, in vivo, muscle function is attenuated by age and exacerbated by disuse, implicating factors other than skeletal muscle, such as neuromuscular control, in this diminution of function. © 2015 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

Effects of the time of day on repeated all-out cycle performance and short-term recovery patterns.

PubMed

Giacomoni, M; Billaut, F; Falgairette, G

2006-06-01

The effect of the time of day on repeated cycle sprint performance and short-term recovery patterns was investigated in 12 active male subjects (23+/-2 years, 76.4+/-4.2 kg, 1.80+/-0.06 m, 9.5+/-4.5 h . week (-1) of physical activity). Subjects performed ten 6-s maximal sprints inter-spaced by 30 s rest in the morning (08 : 00-10 : 00 h) and in the evening (17 : 00-19 : 00 h) on separate days. During the intermittent exercise, peak power output (P (PO), watts), total mechanical work (W, kJ), peak pedalling rate (P (PR), rev . min (-1)), and peak efficient torque (P (TCK), Nm) were recorded. The values at the 1st, the 5th, and the 10th sprints were used as mechanical indices of fatigue occurrence. Intra-aural temperature and maximal voluntary contraction of knee extensors muscles (MVC) were measured before (pre), immediately after (post) the cycle bouts and following a 5-min passive recovery period (post 5). The MVC indices were used to further confirm occurrence of neuromuscular fatigue and to assess short-term recovery patterns from all-out intermittent effort. During the MVC, electromyographic activity of the vastus lateralis muscle was recorded and analysed as its root mean square (RMS). The torque produced per unit RMS was calculated and used as index of neuromuscular efficiency (NME). A main effect for the sprint number was observed for all cycle performance parameters (p<0.05). The main effect for the time of day was not significant for any biomechanical indices of neuromuscular performance. A significant interaction effect of the time of day and the sprint repetition was demonstrated on P (TCK) ( F(2,22)=4.3, p<0.05). The decrease in P (TCK) consecutive to sprint repetition was sharper in the evening compared to the morning (sprint 10[% of sprint 1]:-9.5 % in the evening vs. - 2.2 % in the morning, p<0.05). Significant interaction effects of the time of day and the condition (i. e. pre, post, post 5) were also demonstrated for RMS ( F(2,22)=3.6, p<0.05) and NME ( F(2,22)=4.5, p<0.05) during MVC. These interactions were characterised by similar patterns of fatigue occurrence (i. e. post vs. pre condition) in the morning (+7.5 % for RMS, - 19.6 % for NME) as in the evening (+10.2 % for RMS, -19.4 % for NME) but different patterns of short-term recovery (i. e. post 5 vs. post condition; p<0.05) in the morning (-7.3 % for RMS, +13.7 % for NME) compared to the evening (+3.3 % for RMS, -1.8 % for NME). These results suggest that short-term recovery patterns of neuromuscular function are slower in the evening compared to the morning.

PTSD in Limb Trauma and Recovery

DTIC Science & Technology

2012-10-01

to walking, each subject’s maximum voluntary contraction (MVC) for each muscle was recorded during a 10 second maximum effort, isometric ...robotic knee coupled to a conventional energy storage and release carbon- fiber prosthetic foot. The knee itself (mechanism and electronics) fits...and gait improvements of the AAA Knee over conventional prosthetic knee systems (standard of care knee with carbon- fiber foot). To that end, the

Installing and Executing Information Object Analysis, Intent, Dissemination, and Enhancement (IOAIDE) and Its Dependencies

DTIC Science & Technology

2017-02-01

Image Processing Web Server Administration ...........................17 Fig. 18 Microsoft ASP.NET MVC 4 installation...algorithms are made into client applications that can be accessed from an image processing web service2 developed following Representational State...Transfer (REST) standards by a mobile app, laptop PC, and other devices. Similarly, weather tweets can be accessed via the Weather Digest Web Service

A Spine Loading Model of Women in the Military

DTIC Science & Technology

1996-10-01

latissimuss dorsi, posterior abdominal internal obliques, rectus abdomini and the abdominal external obliques (5,19). MVC exertions consisting of...Women tend to possess greater hip breadth and narrower abdominal depth than men (9). The sacroiliac joint is positioned several centimeters anteriorly...internal obliques, external obliques, rectus abdomini, and psoas major. The sizes and area centriods are also quantified for the vertebral body and the

Effects of different duration isometric contractions on tendon elasticity in human quadriceps muscles

PubMed Central

Kubo, Keitaro; Kanehisa, Hiroaki; Fukunaga, Tetsuo

2001-01-01

The present study aimed to investigate the influence of isometric training protocols with long- and short-duration contractions on the elasticity of human tendon structures in vivo. The elasticity was assessed through in vivo determination of the elongation (L) of the tendons and aponeuroses using ultrasonography, while the subjects performed ramp isometric exercise up to maximum voluntary contraction (MVC).Eight young males completed 12 weeks (4 days per week) of a unilateral isometric training programme on knee extensors, which consisted of two different combinations of contraction and relaxation times at 70 % MVC: one leg was trained using a short-duration protocol (3 sets of 50 repetitions of contraction for 1 s and relaxation for 2 s), and the other leg was trained using a long-duration protocol (4 sets of a combination of contraction for 20 s and relaxation for 1 min). The training volume per session, expressed as the integrated torque, was the same for the two protocols.Both protocols resulted in a significant increase in MVC: 31.8 ± 17.2 % for the short-duration protocol and 33.9 ± 14.4 % for the long-duration protocol. Moreover, the training produced significant increases in the muscle volume of the constituents of the quadriceps femoris, with similar relative gains for the two protocols: 7.4 ± 3.9 % for the short-duration protocol and 7.6 ± 4.3 % for the long-duration protocol.The short-duration protocol produced no significant change in L values at any of the force production levels. For the long-duration protocol, however, the L values above 550 N were significantly shorter after training. Analysis revealed that the group × test time interaction effect on tendon stiffness was significant. Stiffness increased significantly for the long-duration protocol, but not for the short-duration protocol.The present study demonstrates a greater increase in stiffness of human tendon structures following isometric training using longer duration contractions compared to shorter contractions. This suggests that the changes in the elasticity of the tendon structures after resistance training may be affected by the duration of muscle contraction. PMID:11600697

Contractile function and motor unit firing rates of the human hamstrings.

PubMed

Kirk, Eric A; Rice, Charles L

2017-01-01

Neuromuscular properties of the lower limb in health, aging, and disease are well described for major lower limb muscles comprising the quadriceps, triceps surae, and dorsiflexors, with the notable exception of the posterior thigh (hamstrings). The purpose of this study was to further characterize major muscles of the lower limb by comprehensively exploring contractile properties in relation to spinal motor neuron output expressed as motor unit firing rates (MUFRs) in the hamstrings of 11 (26.5 ± 3.8) young men. Maximal isometric voluntary contraction (MVC), voluntary activation, stimulated contractile properties including a force-frequency relationship, and MUFRs from submaximal to maximal voluntary contractile intensities were assessed in the hamstrings. Strength and MUFRs were assessed at two presumably different muscle lengths by varying the knee joint angles (90° and 160°). Knee flexion MVCs were 60-70% greater in the extended position (160°). The frequency required to elicit 50% of maximum tetanic torque was 16-17 Hz. Mean MUFRs at 25-50% MVC were 9-31% less in the biceps femoris compared with the semimembranosus-semitendinosus group. Knee joint angle (muscle length) influenced MUFRs such that mean MUFRs were greater in the shortened (90°) position at 50% and 100% MVC. Compared with previous reports, mean maximal MUFRs in the hamstrings are greater than those in the quadriceps and triceps surae and somewhat less than those in the tibialis anterior. Mean maximal MUFRs in the hamstrings are influenced by changes in knee joint angle, with lower firing rates in the biceps femoris compared with the semimembranosus-semitendinosus muscle group. We studied motor unit firing rates (MUFRs) at various voluntary contraction intensities in the hamstrings, one of the only major lower limb muscles to have MUFRs affected by muscle length changes. Within the hamstrings muscle-specific differences have greater impact on MUFRs than length changes, with the biceps femoris having reduced neural drive compared with the semimembranosus-semimembranosus. Comparing our results to other lower limb muscles, flexors have inherently higher firing rate compared with extensors. Copyright © 2017 the American Physiological Society.

Contractile function and motor unit firing rates of the human hamstrings

PubMed Central

Kirk, Eric A.

2016-01-01

Neuromuscular properties of the lower limb in health, aging, and disease are well described for major lower limb muscles comprising the quadriceps, triceps surae, and dorsiflexors, with the notable exception of the posterior thigh (hamstrings). The purpose of this study was to further characterize major muscles of the lower limb by comprehensively exploring contractile properties in relation to spinal motor neuron output expressed as motor unit firing rates (MUFRs) in the hamstrings of 11 (26.5 ± 3.8) young men. Maximal isometric voluntary contraction (MVC), voluntary activation, stimulated contractile properties including a force-frequency relationship, and MUFRs from submaximal to maximal voluntary contractile intensities were assessed in the hamstrings. Strength and MUFRs were assessed at two presumably different muscle lengths by varying the knee joint angles (90° and 160°). Knee flexion MVCs were 60–70% greater in the extended position (160°). The frequency required to elicit 50% of maximum tetanic torque was 16–17 Hz. Mean MUFRs at 25–50% MVC were 9–31% less in the biceps femoris compared with the semimembranosus-semitendinosus group. Knee joint angle (muscle length) influenced MUFRs such that mean MUFRs were greater in the shortened (90°) position at 50% and 100% MVC. Compared with previous reports, mean maximal MUFRs in the hamstrings are greater than those in the quadriceps and triceps surae and somewhat less than those in the tibialis anterior. Mean maximal MUFRs in the hamstrings are influenced by changes in knee joint angle, with lower firing rates in the biceps femoris compared with the semimembranosus-semitendinosus muscle group. NEW & NOTEWORTHY We studied motor unit firing rates (MUFRs) at various voluntary contraction intensities in the hamstrings, one of the only major lower limb muscles to have MUFRs affected by muscle length changes. Within the hamstrings muscle-specific differences have greater impact on MUFRs than length changes, with the biceps femoris having reduced neural drive compared with the semimembranosus-semimembranosus. Comparing our results to other lower limb muscles, flexors have inherently higher firing rate compared with extensors. PMID:27784806

Voluntary activation failure is detectable in some myositis patients with persisting quadriceps femoris weakness: an observational study

PubMed Central

Molloy, Catherine B; Al-Omar, Ahmed O; Edge, Kathryn T; Cooper, Robert G

2006-01-01

This cross-sectional, observational study was undertaken to examine whether voluntary activation failure could contribute to the persisting weakness observed in some patients with treated idiopathic inflammatory myositis. In 20 patients with myositis of more than six months' duration (5 males, 15 females; mean [± 1 SD] age 53 [11] years) and 102 normal subjects (44 males, 58 females; mean age 32 [8] years), isometric maximum voluntary contractions (MVCs) of the dominant quadriceps femoris (QF) were quantified. Absolute MVC results of normal subjects and patients were then normalised with respect to lean body mass (force per units of lean body mass), giving a result in Newtons per kilogram. Based on mass-normalised force data of normal subjects, patients were arbitrarily stratified into "weak" and "not weak" subgroups. During further MVC attempts, the "twitch interpolation" technique was used to assess whether the QF voluntary activation of patients was complete. This technique relies on the fact that, because muscle activation is incomplete during submaximal voluntary contractions, electrical stimulation of the muscle can induce force increments superimposed on the submaximal voluntary force being generated. No between-gender differences were seen in the mass-normalised MVC results of healthy subjects, so the gender-combined results of 6.6 (1.5) N/kg were used for patient stratification. No between-gender difference was found for mass-normalised MVCs in patients: males 5.4 (3.2) and females 3.0 (1.7) N/kg (p > 0.05). Mass-normalised MVCs of male patients were as great as those of normal subjects (p > 0.05), but mass-normalised MVCs of female patients were significantly smaller than those of the normal subjects (p < 0.001). Only one of the six "not weak" patients exhibited interpolated twitches during electrical stimulation, but six of the 14 "weak" patients did, the biggest twitches being seen in the weakest patient. That interpolated twitches can be induced in some myositis patients with ongoing QF weakness during supposed MVCs clearly suggests that voluntary activation failure does contribute to QF weakness in those patients. PMID:16606441

Underutilization of occupant restraint systems in motor vehicle injury crashes: A quantitative analysis from Qatar.

PubMed

El-Menyar, Ayman; Consunji, Rafael; Asim, Mohammad; Abdelrahman, Husham; Zarour, Ahmad; Parchani, Ashok; Peralta, Ruben; Al-Thani, Hassan

2016-01-01

Restraint systems (seat belts and airbags) are important tools that improve vehicle occupant safety during motor vehicle crashes (MVCs). We aimed to identify the pattern and impact of the utilization of passenger restraint systems on the outcomes of MVC victims in Qatar. A retrospective study was conducted for all admitted patients who sustained MVC-related injuries between March 2011 and March 2014 inclusive. Out of 2,730 road traffic injury cases, 1,830 (67%) sustained MVC-related injuries, of whom 88% were young males, 70% were expatriates, and 53% were drivers. The use of seat belts and airbags was documented in 26 and 2.5% of cases, respectively. Unrestrained passengers had greater injury severity scores, longer hospital stays, and higher rates of pneumonia and mortality compared to restrained passengers (P = .001 for all). There were 311 (17%) ejected cases. Seat belt use was significantly lower and the mortality rate was 3-fold higher in the ejected group compared to the nonejected group (P = .001). The overall mortality was 8.3%. On multivariate regression analysis, predictors of not using a seat belt were being a front seat passenger, driver, or Qatari national and young age. Unrestrained males had a 3-fold increase in mortality in comparison to unrestrained females. The risk of severe injury (relative risk [RR] = 1.82, 95% confidence interval [CI], 1.49-2.26, P = .001) and death (RR = 4.13, 95% CI, 2.31-7.38, P = .001) was significantly greater among unrestrained passengers. The nonuse of seat belts is associated with worse outcomes during MVCs in Qatar. Our study highlights the lower rate of seat belt compliance in young car occupants that results in more severe injuries, longer hospital stays, and higher mortality rates. Therefore, we recommend more effective seat belt awareness and education campaigns, the enforcement of current seat belt laws, their extension to all vehicle occupants, and the adoption of proven interventions that will assure sustained behavioral changes toward improvements in seat belt use in Qatar.

Determining Changes in Electromyography Indices when Measuring Maximum Acceptable Weight of Lift in Iranian Male Students.

PubMed

Salehi Sahl Abadi, A; Mazloumi, A; Nasl Saraji, G; Zeraati, H; Hadian, M R; Jafari, A H

2018-03-01

In spite of the increasing degree of automation in industry, manual material handling (MMH) is still performed in many occupational settings. The aim of the current study was to determine the maximum acceptable weight of lift using psychophysical and electromyography indices. This experimental study was conducted among 15 male students recruited from Tehran University of Medical Sciences. Each participant performed 18 different lifting tasks which involved three lifting frequencies, three lifting heights and two box sizes. Each set of experiments was conducted during the 20 min work period using free-style lifting technique and subjective as well as objective assessment methodologies. SPSS version 18 software was used for descriptive and analytical analyses by Friedman, Wilcoxon and Spearman correlation techniques. The results demonstrated that muscle activity increased with increasing frequency, height of lift and box size (P<0.05). Meanwhile, MAWLs obtained in this study are lower than those in Snook table (P<0.05). In this study, the level of muscle activity in percent MVC in relation to the erector spine muscles in L3 and T9 regions as well as left and right abdominal external oblique muscles were at 38.89%, 27.78%, 11.11% and 5.55% in terms of muscle activity is more than 70% MVC, respectively. The results of Wilcoxon test revealed that for both small and large boxes under all conditions, significant differences were detected between the beginning and end of the test values for MPF of erector spine in L3 and T9 regions, and left and right abdominal external oblique muscles (P<0.05). The results of Spearman correlation test showed that there was a significant relation between the MAWL, RMS and MPF of the muscles in all test conditions (P<0.05). Based on the results of this study, it was concluded if muscle activity is more than 70% of MVC, the values of Snook tables should be revisited. Furthermore, the biomechanical perspective should receive special attention in determining the standards for MMH.

Neuromuscular demand in a soccer match assessed by a continuous electromyographic recording.

PubMed

Montini, Marco; Felici, Francesco; Nicolò, Andrea; Sacchetti, Massimo; Bazzucchi, Ilenia

2017-04-01

The bulk of research investigating soccer player's performance has been concentrated on the metabolic demand, while only few studies focused on the neuromuscular activation. The present study aimed at investigating the activation profile of the leg muscles throughout a 90- minute soccer match. Fifteen football players (18.3±0.7 years) performed: 1) an isometric maximal voluntary contraction (MVC) before the game [MVCpre]; 2) a 90-minute soccer match (composed of two 45-minute periods separated by a 15-minute rest); 3) a second MVC after the match [MVCpost]. Electromyographic (EMG) activity of the Vastus Lateralis (VL) muscle of the dominant leg was recorded during the match. The root mean square (RMS) of the EMG signals was normalized for the maximal RMS obtained during the MVCpre (100%RMSmax) and six intensity classes were created in order to represent the %RMS distribution during the match (1st: 0-20%RMSmax; 2nd: 20-40%RMSmax; 3rd: 40-60%RMSmax; 4th: 60-80%RMSmax; 5th: 80-100%RMSmax; 6th: 100-120%RMSmax). After the 90-minute soccer match, knee extensor MVC failed to show any statistical difference from pre-game values (-4.2%; P>0.05) whilst the neuromuscular activation demonstrated a significant reduction (-26.3%, P<0.01). During the game, the mean total distribution of RMS of the players was: 84.8±7.1% of total time in the 1st class, 8.5±3.9% in the 2nd, 3.6±1.6% in the 3rd, 1.7±1.0% in the 4th, 0.9±0.6% in the 5th and 0.4±0.5% in the 6th class of intensity. There was a significant difference (P<0.05) between the first versus the second half for the classes 1st, 3rd and 4th. This represents the first attempt to characterize the neuromuscular activation profile during a 90-minute soccer match. Integrating this approach with more traditional ones may help further our understanding of the physiological demand of competitive soccer.