Sample records for viral coding sequences
-
Using hidden Markov models and observed evolution to annotate viral genomes.
McCauley, Stephen; Hein, Jotun
2006-06-01
ssRNA (single stranded) viral genomes are generally constrained in length and utilize overlapping reading frames to maximally exploit the coding potential within the genome length restrictions. This overlapping coding phenomenon leads to complex evolutionary constraints operating on the genome. In regions which code for more than one protein, silent mutations in one reading frame generally have a protein coding effect in another. To maximize coding flexibility in all reading frames, overlapping regions are often compositionally biased towards amino acids which are 6-fold degenerate with respect to the 64 codon alphabet. Previous methodologies have used this fact in an ad hoc manner to look for overlapping genes by motif matching. In this paper differentiated nucleotide compositional patterns in overlapping regions are incorporated into a probabilistic hidden Markov model (HMM) framework which is used to annotate ssRNA viral genomes. This work focuses on single sequence annotation and applies an HMM framework to ssRNA viral annotation. A description of how the HMM is parameterized, whilst annotating within a missing data framework is given. A Phylogenetic HMM (Phylo-HMM) extension, as applied to 14 aligned HIV2 sequences is also presented. This evolutionary extension serves as an illustration of the potential of the Phylo-HMM framework for ssRNA viral genomic annotation. The single sequence annotation procedure (SSA) is applied to 14 different strains of the HIV2 virus. Further results on alternative ssRNA viral genomes are presented to illustrate more generally the performance of the method. The results of the SSA method are encouraging however there is still room for improvement, and since there is overwhelming evidence to indicate that comparative methods can improve coding sequence (CDS) annotation, the SSA method is extended to a Phylo-HMM to incorporate evolutionary information. The Phylo-HMM extension is applied to the same set of 14 HIV2 sequences which are pre-aligned. The performance improvement that results from including the evolutionary information in the analysis is illustrated.
-
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.
Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H
2017-04-15
Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.
-
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification
Sinclair, Robert M.; Ravantti, Janne J.
2017-01-01
ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979
-
Non-coding RNAs in virology: an RNA genomics approach.
Isaac, Christopher; Patel, Trushar R; Zovoilis, Athanasios
2018-04-01
Advances in sequencing technologies and bioinformatic analysis techniques have greatly improved our understanding of various classes of RNAs and their functions. Despite not coding for proteins, non-coding RNAs (ncRNAs) are emerging as essential biomolecules fundamental for cellular functions and cell survival. Interestingly, ncRNAs produced by viruses not only control the expression of viral genes, but also influence host cell regulation and circumvent host innate immune response. Correspondingly, ncRNAs produced by the host genome can play a key role in host-virus interactions. In this article, we will first discuss a number of types of viral and mammalian ncRNAs associated with viral infections. Subsequently, we also describe the new possibilities and opportunities that RNA genomics and next-generation sequencing technologies provide for studying ncRNAs in virology.
-
Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J
2002-01-01
Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388
-
Exploration of sequence space as the basis of viral RNA genome segmentation.
Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia
2014-05-06
The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.
-
Polyomavirus BK non-coding control region rearrangements in health and disease.
Sharma, Preety M; Gupta, Gaurav; Vats, Abhay; Shapiro, Ron; Randhawa, Parmjeet S
2007-08-01
BK virus is an increasingly recognized pathogen in transplanted patients. DNA sequencing of this virus shows considerable genomic variability. To understand the clinical significance of rearrangements in the non-coding control region (NCCR) of BK virus (BKV), we report a meta-analysis of 507 sequences, including 40 sequences generated in our own laboratory, for associations between rearrangements and disease, tissue tropism, geographic origin, and viral genotype. NCCR rearrangements were less frequent in (a) asymptomatic BKV viruria compared to patients viral nephropathy (1.7% vs. 22.5%), and (b) viral genotype 1 compared to other genotypes (2.4% vs. 11.2%). Rearrangements were commoner in malignancy (78.6%), and Norwegians (45.7%), and less common in East Indians (0%), and Japanese (4.3%). A surprising number of rearranged sequences were reported from mononuclear cells of healthy subjects, whereas most plasma sequences were archetypal. This difference could not be related to potential recombinase activity in lymphocytes, as consensus recombination signal sequences could not be found in the NCCR region. NCCR rearrangements are neither required nor a sufficient condition to produce clinical disease. BKV nephropathy and hemorrhagic cystitis are not associated with any unique NCCR configuration or nucleotide sequence.
-
Lim, Chun Shen; Brown, Chris M
2017-01-01
Structured RNA elements may control virus replication, transcription and translation, and their distinct features are being exploited by novel antiviral strategies. Viral RNA elements continue to be discovered using combinations of experimental and computational analyses. However, the wealth of sequence data, notably from deep viral RNA sequencing, viromes, and metagenomes, necessitates computational approaches being used as an essential discovery tool. In this review, we describe practical approaches being used to discover functional RNA elements in viral genomes. In addition to success stories in new and emerging viruses, these approaches have revealed some surprising new features of well-studied viruses e.g., human immunodeficiency virus, hepatitis C virus, influenza, and dengue viruses. Some notable discoveries were facilitated by new comparative analyses of diverse viral genome alignments. Importantly, comparative approaches for finding RNA elements embedded in coding and non-coding regions differ. With the exponential growth of computer power we have progressed from stem-loop prediction on single sequences to cutting edge 3D prediction, and from command line to user friendly web interfaces. Despite these advances, many powerful, user friendly prediction tools and resources are underutilized by the virology community.
-
Lim, Chun Shen; Brown, Chris M.
2018-01-01
Structured RNA elements may control virus replication, transcription and translation, and their distinct features are being exploited by novel antiviral strategies. Viral RNA elements continue to be discovered using combinations of experimental and computational analyses. However, the wealth of sequence data, notably from deep viral RNA sequencing, viromes, and metagenomes, necessitates computational approaches being used as an essential discovery tool. In this review, we describe practical approaches being used to discover functional RNA elements in viral genomes. In addition to success stories in new and emerging viruses, these approaches have revealed some surprising new features of well-studied viruses e.g., human immunodeficiency virus, hepatitis C virus, influenza, and dengue viruses. Some notable discoveries were facilitated by new comparative analyses of diverse viral genome alignments. Importantly, comparative approaches for finding RNA elements embedded in coding and non-coding regions differ. With the exponential growth of computer power we have progressed from stem-loop prediction on single sequences to cutting edge 3D prediction, and from command line to user friendly web interfaces. Despite these advances, many powerful, user friendly prediction tools and resources are underutilized by the virology community. PMID:29354101
-
Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics
NASA Technical Reports Server (NTRS)
Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.
1995-01-01
We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.
-
de Borba, Luana; Villordo, Sergio M; Iglesias, Nestor G; Filomatori, Claudia V; Gebhard, Leopoldo G; Gamarnik, Andrea V
2015-03-01
The dengue virus genome is a dynamic molecule that adopts different conformations in the infected cell. Here, using RNA folding predictions, chemical probing analysis, RNA binding assays, and functional studies, we identified new cis-acting elements present in the capsid coding sequence that facilitate cyclization of the viral RNA by hybridization with a sequence involved in a local dumbbell structure at the viral 3' untranslated region (UTR). The identified interaction differentially enhances viral replication in mosquito and mammalian cells. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Probing the Structures of Viral RNA Regulatory Elements with SHAPE and Related Methodologies
Rausch, Jason W.; Sztuba-Solinska, Joanna; Le Grice, Stuart F. J.
2018-01-01
Viral RNAs were selected by evolution to possess maximum functionality in a minimal sequence. Depending on the classification of the virus and the type of RNA in question, viral RNAs must alternately be replicated, spliced, transcribed, transported from the nucleus into the cytoplasm, translated and/or packaged into nascent virions, and in most cases, provide the sequence and structural determinants to facilitate these processes. One consequence of this compact multifunctionality is that viral RNA structures can be exquisitely complex, often involving intermolecular interactions with RNA or protein, intramolecular interactions between sequence segments separated by several thousands of nucleotides, or specialized motifs such as pseudoknots or kissing loops. The fluidity of viral RNA structure can also present a challenge when attempting to characterize it, as genomic RNAs especially are likely to sample numerous conformations at various stages of the virus life cycle. Here we review advances in chemoenzymatic structure probing that have made it possible to address such challenges with respect to cis-acting elements, full-length viral genomes and long non-coding RNAs that play a major role in regulating viral gene expression. PMID:29375504
-
Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas
2016-01-01
Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090
-
Oroszlan, Stephen; Henderson, Louis E.; Stephenson, John R.; Copeland, Terry D.; Long, Cedric W.; Ihle, James N.; Gilden, Raymond V.
1978-01-01
The amino- and carboxyl-terminal amino acid sequences of proteins (p10, p12, p15, and p30) coded by the gag gene of Rauscher and AKR murine leukemia viruses were determined. Among these proteins, p15 from both viruses appears to have a blocked amino end. Proline was found to be the common NH2 terminus of both p30s and both p12s, and alanine of both p10s. The amino-terminal sequences of p30s are identical, as are those of p10s, while the p12 sequences are clearly distinctive but also show substantial homology. The carboxyl-terminal amino acids of both viral p30s and p12s are leucine and phenylalanine, respectively. Rauscher leukemia virus p15 has tyrosine as the carboxyl terminus while AKR virus p15 has phenylalanine in this position. The compositional and sequence data provide definite chemical criteria for the identification of analogous gag gene products and for the comparison of viral proteins isolated in different laboratories. On the basis of amino acid sequences and the previously proposed H-p15-p12-p30-p10-COOH peptide sequence in the precursor polyprotein, a model for cleavage sites involved in the post-translational processing of the precursor coded for by the gag gene is proposed. PMID:206897
-
Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban
2013-01-01
The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka.
-
The Effects of Different Representations on Static Structure Analysis of Computer Malware Signatures
Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban
2013-01-01
The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka. PMID:23983644
-
A bicistronic transgene system for genetic modification of Parthenium argentatum
USDA-ARS?s Scientific Manuscript database
Parthenium argentatum (guayule) was transformed with a bicistronic transgene containing a viral 2A cleavage sequence. The transgene includes the coding sequences of two key enzymes of the mevalonate pathway, 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and farnesyl pyrophosphate synthase (FPPS), ...
-
Bendezu Eguis, Jorge; Montesinos, Ricardo; Fernández-Díaz, Manolo
2018-01-01
ABSTRACT We report here the first genome sequence of infectious laryngotracheitis virus isolated in Peru from tracheal tissues of layer chickens. The genome showed 99.98% identity to the J2 strain genome sequence. Single nucleotide polymorphisms were detected in five gene-coding sequences related to vaccine development, virus attachment, and viral immune evasion. PMID:29519822
-
Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko
2010-05-01
The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.
-
Identification of G-quadruplex forming sequences in three manatee papillomaviruses
Zahin, Maryam; Dean, William L.; Ghim, Shin-je; Joh, Joongho; Gray, Robert D.; Khanal, Sujita; Bossart, Gregory D.; Mignucci-Giannoni, Antonio A.; Rouchka, Eric C.; Jenson, Alfred B.; Trent, John O.; Chaires, Jonathan B.
2018-01-01
The Florida manatee (Trichechus manatus latirotris) is a threatened aquatic mammal in United States coastal waters. Over the past decade, the appearance of papillomavirus-induced lesions and viral papillomatosis in manatees has been a concern for those involved in the management and rehabilitation of this species. To date, three manatee papillomaviruses (TmPVs) have been identified in Florida manatees, one forming cutaneous lesions (TmPV1) and two forming genital lesions (TmPV3 and TmPV4). We identified DNA sequences with the potential to form G-quadruplex structures (G4) across the three genomes. G4 were located on both DNA strands and across coding and non-coding regions on all TmPVs, offering multiple targets for viral control. Although G4 have been identified in several viral genomes, including human PVs, most research has focused on canonical structures comprised of three G-tetrads. In contrast, the vast majority of sequences we identified would allow the formation of non-canonical structures with only two G-tetrads. Our biophysical analysis confirmed the formation of G4 with parallel topology in three such sequences from the E2 region. Two of the structures appear comprised of multiple stacked two G-tetrad structures, perhaps serving to increase structural stability. Computational analysis demonstrated enrichment of G4 sequences on all TmPVs on the reverse strand in the E2/E4 region and on both strands in the L2 region. Several G4 sequences occurred at similar regional locations on all PVs, most notably on the reverse strand in the E2 region. In other cases, G4 were identified at similar regional locations only on PVs forming genital lesions. On all TmPVs, G4 sequences were located in the non-coding region near putative E2 binding sites. Together, these findings suggest that G4 are possible regulatory elements in TmPVs. PMID:29630682
-
USDA-ARS?s Scientific Manuscript database
Molecular epidemiology and evolution of foot-and-mouth disease virus (FMDV) are widely studied using genomic sequences encoding VP1, the capsid protein containing the most relevant antigenic domains. Although sequencing of the full viral genome is not used as a routine diagnostic or surveillance too...
-
A Novel Subgenomic Murine Leukemia Virus RNA Transcript Results from Alternative Splicing
Déjardin, Jérôme; Bompard-Maréchal, Guillaume; Audit, Muriel; Hope, Thomas J.; Sitbon, Marc; Mougel, Marylène
2000-01-01
Here we show the existence of a novel subgenomic 4.4-kb RNA in cells infected with the prototypic replication-competent Friend or Moloney murine leukemia viruses (MuLV). This RNA derives by splicing from an alternative donor site (SD′) within the capsid-coding region to the canonical envelope splice acceptor site. The position and the sequence of SD′ was highly conserved among mammalian type C and D oncoviruses. Point mutations used to inactivate SD′ without changing the capsid-coding ability affected viral RNA splicing and reduced viral replication in infected cells. PMID:10729146
-
Liu, Ye; Li, Nan; Zhang, Shoufeng; Zhang, Fei; Lian, Hai; Wang, Ying; Zhang, Jinxia; Hu, Rongliang
2013-12-01
The genome of Irkut virus, isolate IRKV-THChina12, the first non-rabies lyssavirus from China (of bat origin), has been completely sequenced. In general, coding and non-coding regions of this viral genome are similar to those of other lyssaviruses. However, alignment of the deduced amino acid sequences of the structural proteins of IRKV-THChina12 with those of other lyssavirus representatives revealed significant variability between viral species. The nucleoprotein and matrix protein were found to be the most conserved, followed by the large protein, glycoprotein and phosphoprotein. Differences in the antigenic sites in glycoprotein may result in only partial protection of the available rabies biologics against Irkut virus, which is of particular concern for pre- and post-exposure rabies prophylaxis. Copyright © 2013 Elsevier Inc. All rights reserved.
-
Coding Complete Genome for the Mogiana Tick Virus, a Jingmenvirus Isolated from Ticks in Brazil
2017-05-04
sequences for all four genome segments. We downloaded the raw Illumina sequence reads from the NCBI Short Read Archive (GenBank...MGTV genome segments through sequence similarity (BLASTN) to the published genome of Jingmen tick virus (JMTV) isolate SY84 (GenBank: KJ001579-KJ001582...2014. Standards for sequencing viral genomes in the era of high-throughput sequencing . MBio 5:e01360–14. 8. Bankevich A, Nurk S, Antipov
-
Quick, Josh; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2018-01-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples without isolation remains challenging for viruses such as Zika, where metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence complete genomes comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimised library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved starting with clinical samples in 1-2 days following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. PMID:28538739
-
Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2017-06-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.
-
Genome-Wide Networks of Amino Acid Covariances Are Common among Viruses
Donlin, Maureen J.; Szeto, Brandon; Gohara, David W.; Aurora, Rajeev
2012-01-01
Coordinated variation among positions in amino acid sequence alignments can reveal genetic dependencies at noncontiguous positions, but methods to assess these interactions are incompletely developed. Previously, we found genome-wide networks of covarying residue positions in the hepatitis C virus genome (R. Aurora, M. J. Donlin, N. A. Cannon, and J. E. Tavis, J. Clin. Invest. 119:225–236, 2009). Here, we asked whether such networks are present in a diverse set of viruses and, if so, what they may imply about viral biology. Viral sequences were obtained for 16 viruses in 13 species from 9 families. The entire viral coding potential for each virus was aligned, all possible amino acid covariances were identified using the observed-minus-expected-squared algorithm at a false-discovery rate of ≤1%, and networks of covariances were assessed using standard methods. Covariances that spanned the viral coding potential were common in all viruses. In all cases, the covariances formed a single network that contained essentially all of the covariances. The hepatitis C virus networks had hub-and-spoke topologies, but all other networks had random topologies with an unusually large number of highly connected nodes. These results indicate that genome-wide networks of genetic associations and the coordinated evolution they imply are very common in viral genomes, that the networks rarely have the hub-and-spoke topology that dominates other biological networks, and that network topologies can vary substantially even within a given viral group. Five examples with hepatitis B virus and poliovirus are presented to illustrate how covariance network analysis can lead to inferences about viral biology. PMID:22238298
-
Sugai, Akihiro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko
2017-08-01
The regulation of transcription during Nipah virus (NiV) replication is poorly understood. Using a bicistronic minigenome system, we investigated the involvement of non-coding regions (NCRs) in the transcriptional re-initiation efficiency of NiV RNA polymerase. Reporter assays revealed that attenuation of NiV gene expression was not constant at each gene junction, and that the attenuating property was controlled by the 3' NCR. However, this regulation was independent of the gene-end, gene-start and intergenic regions. Northern blot analysis indicated that regulation of viral gene expression by the phosphoprotein (P) and large protein (L) 3' NCRs occurred at the transcription level. We identified uridine-rich tracts within the L 3' NCR that are similar to gene-end signals. These gene-end-like sequences were recognized as weak transcription termination signals by the viral RNA polymerase, thereby reducing downstream gene transcription. Thus, we suggest that NiV has a unique mechanism of transcriptional regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Fun, Axel; Leitner, Thomas; Vandekerckhove, Linos; Däumer, Martin; Thielen, Alexander; Buchholz, Bernd; Hoepelman, Andy I M; Gisolf, Elizabeth H; Schipper, Pauline J; Wensing, Annemarie M J; Nijhuis, Monique
2018-01-05
Emergence of resistance against integrase inhibitor raltegravir in human immunodeficiency virus type 1 (HIV-1) patients is generally associated with selection of one of three signature mutations: Y143C/R, Q148K/H/R or N155H, representing three distinct resistance pathways. The mechanisms that drive selection of a specific pathway are still poorly understood. We investigated the impact of the HIV-1 genetic background and population dynamics on the emergence of raltegravir resistance. Using deep sequencing we analyzed the integrase coding sequence (CDS) in longitudinal samples from five patients who initiated raltegravir plus optimized background therapy at viral loads > 5000 copies/ml. To investigate the role of the HIV-1 genetic background we created recombinant viruses containing the viral integrase coding region from pre-raltegravir samples from two patients in whom raltegravir resistance developed through different pathways. The in vitro selections performed with these recombinant viruses were designed to mimic natural population bottlenecks. Deep sequencing analysis of the viral integrase CDS revealed that the virological response to raltegravir containing therapy inversely correlated with the relative amount of unique sequence variants that emerged suggesting diversifying selection during drug pressure. In 4/5 patients multiple signature mutations representing different resistance pathways were observed. Interestingly, the resistant population can consist of a single resistant variant that completely dominates the population but also of multiple variants from different resistance pathways that coexist in the viral population. We also found evidence for increased diversification after stronger bottlenecks. In vitro selections with low viral titers, mimicking population bottlenecks, revealed that both recombinant viruses and HXB2 reference virus were able to select mutations from different resistance pathways, although typically only one resistance pathway emerged in each individual culture. The generation of a specific raltegravir resistant variant is not predisposed in the genetic background of the viral integrase CDS. Typically, in the early phases of therapy failure the sequence space is explored and multiple resistance pathways emerge and then compete for dominance which frequently results in a switch of the dominant population over time towards the fittest variant or even multiple variants of similar fitness that can coexist in the viral population.
-
Jupille, Henri J.; Oko, Lauren; Stoermer, Kristina A.; Heise, Mark T.; Mahalingam, Suresh; Gunn, Bronwyn M.; Morrison, Thomas E.
2010-01-01
The viral determinants of Alphavirus-induced rheumatic disease have not been elucidated. We identified an RRV strain (DC5692) which, in contrast to the T48 strain, does not induce musculoskeletal inflammation in a mouse model of RRV disease. Substitution of the RRV T48 strain nonstructural protein 1 (nsP1) coding sequence with that from strain DC5692 generated a virus that was attenuated in vivo despite similar viral loads in tissues. In contrast, substitution of the T48 PE2 coding region with the PE2 coding region from DC5692 resulted in attenuation in vivo and reduced viral loads in tissues. In gain of virulence experiments, substitution of the DC5692 strain nsP1 and PE2 coding regions with those from the T48 strain was sufficient to restore full virulence to the DC5692 strain. These findings indicate that determinants in both nsP1 and PE2 have critical and distinct roles in the pathogenesis of RRV-induced musculoskeletal inflammatory disease in mice. PMID:21131014
-
Nakagawa, So; Takahashi, Mahoko Ueda
2016-01-01
In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.
-
Nakagawa, So; Takahashi, Mahoko Ueda
2016-01-01
In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species. Database URL: http://geve.med.u-tokai.ac.jp PMID:27242033
-
DeBoever, Christopher; Reid, Erin G.; Smith, Erin N.; Wang, Xiaoyun; Dumaop, Wilmar; Harismendy, Olivier; Carson, Dennis; Richman, Douglas; Masliah, Eliezer; Frazer, Kelly A.
2013-01-01
Primary central nervous system lymphomas (PCNSL) have a dramatically increased prevalence among persons living with AIDS and are known to be associated with human Epstein Barr virus (EBV) infection. Previous work suggests that in some cases, co-infection with other viruses may be important for PCNSL pathogenesis. Viral transcription in tumor samples can be measured using next generation transcriptome sequencing. We demonstrate the ability of transcriptome sequencing to identify viruses, characterize viral expression, and identify viral variants by sequencing four archived AIDS-related PCNSL tissue samples and analyzing raw sequencing reads. EBV was detected in all four PCNSL samples and cytomegalovirus (CMV), JC polyomavirus (JCV), and HIV were also discovered, consistent with clinical diagnoses. CMV was found to express three long non-coding RNAs recently reported as expressed during active infection. Single nucleotide variants were observed in each of the viruses observed and three indels were found in CMV. No viruses were found in several control tumor types including 32 diffuse large B-cell lymphoma samples. This study demonstrates the ability of next generation transcriptome sequencing to accurately identify viruses, including DNA viruses, in solid human cancer tissue samples. PMID:24023918
-
Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry
2018-01-01
The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.
-
Shah, M S; Ashraf, A; Khan, M I; Rahman, M; Habib, M; Qureshi, J A
2016-01-01
Fowl adenovirus-4 is an infectious agent causing Hydropericardium syndrome in chickens. Adenovirus are non-enveloped virions having linear, double stranded DNA. Viral genome codes for few structural and non structural proteins. 100K is an important non-structural viral protein. Open reading frame for coding sequence of 100K protein was cloned with oligo histidine tag and expressed in Escherichia coli as a fusion protein. Nucleotide sequence of the gene revealed that 100K gene of FAdV-4 has high homology (98%) with the respective gene of FAdV-10. Recombinant 100K protein was expressed in E. coli and purified by nickel affinity chromatography. Immunization of chickens with recombinant 100K protein elicited significant serum antibody titers. However challenge protection test revealed that 100K protein conferred little protection (40%) to the immunized chicken against pathogenic viral challenge. So it was concluded that 100K gene has 2397 bp length and recombinant 100K protein has molecular weight of 95 kDa. It was also found that the recombinant protein has little capacity to affect the immune response because in-spite of having an important role in intracellular transport & folding of viral capsid proteins during viral replication, it is not exposed on the surface of the virus at any stage. Copyright © 2015 The International Alliance for Biological Standardization. All rights reserved.
-
Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A
2010-03-01
During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.
-
Cis-acting RNA elements in the Hepatitis C virus RNA genome
Sagan, Selena M.; Chahal, Jasmin; Sarnow, Peter
2017-01-01
Hepatitis C virus (HCV) infection is a rapidly increasing global health problem with an estimated 170 million people infected worldwide. HCV is a hepatotropic, positive-sense RNA virus of the family Flaviviridae. As a positive-sense RNA virus, the HCV genome itself must serve as a template for translation, replication and packaging. The viral RNA must therefore be a dynamic structure that is able to readily accommodate structural changes to expose different regions of the genome to viral and cellular proteins to carry out the HCV life cycle. The ∼9600 nucleotide viral genome contains a single long open reading frame flanked by 5′ and 3′ non-coding regions that contain cis-acting RNA elements important for viral translation, replication and stability. Additional cis-acting RNA elements have also been identified in the coding sequences as well as in the 3′ end of the negative-strand replicative intermediate. Herein, we provide an overview of the importance of these cis-acting RNA elements in the HCV life cycle. PMID:25576644
-
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng
2014-01-01
ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209
-
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian
2015-01-15
All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul
2005-01-01
Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361
-
Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.
2007-01-01
Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995
-
Widespread signatures of local mRNA folding structure selection in four Dengue virus serotypes
2015-01-01
Background It is known that mRNA folding can affect and regulate various gene expression steps both in living organisms and in viruses. Previous studies have recognized functional RNA structures in the genome of the Dengue virus. However, these studies usually focused either on the viral untranslated regions or on very specific and limited regions at the beginning of the coding sequences, in a limited number of strains, and without considering evolutionary selection. Results Here we performed the first large scale comprehensive genomics analysis of selection for local mRNA folding strength in the Dengue virus coding sequences, based on a total of 1,670 genomes and 4 serotypes. Our analysis identified clusters of positions along the coding regions that may undergo a conserved evolutionary selection for strong or weak local folding maintained across different viral variants. Specifically, 53-66 clusters for strong folding and 49-73 clusters for weak folding (depending on serotype) aggregated of positions with a significant conservation of folding energy signals (related to partially overlapping local genomic regions) were recognized. In addition, up to 7% of these positions were found to be conserved in more than 90% of the viral genomes. Although some of the identified positions undergo frequent synonymous / non-synonymous substitutions, the selection for folding strength therein is preserved, and thus cannot be trivially explained based on sequence conservation alone. Conclusions The fact that many of the positions with significant folding related signals are conserved among different Dengue variants suggests that a better understanding of the mRNA structures in the corresponding regions may promote the development of prospective anti- Dengue vaccination strategies. The comparative genomics approach described here can be employed in the future for detecting functional regions in other pathogens with very high mutations rates. PMID:26449467
-
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-05-01
Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
-
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-01-01
Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913
-
Detection of Merkel Cell Polyomavirus DNA in Serum Samples of Healthy Blood Donors
Mazzoni, Elisa; Rotondo, John C.; Marracino, Luisa; Selvatici, Rita; Bononi, Ilaria; Torreggiani, Elena; Touzé, Antoine; Martini, Fernanda; Tognon, Mauro G.
2017-01-01
Merkel cell polyomavirus (MCPyV) has been detected in 80% of Merkel cell carcinomas (MCC). In the host, the MCPyV reservoir remains elusive. MCPyV DNA sequences were revealed in blood donor buffy coats. In this study, MCPyV DNA sequences were investigated in the sera (n = 190) of healthy blood donors. Two MCPyV DNA sequences, coding for the viral oncoprotein large T antigen (LT), were investigated using polymerase chain reaction (PCR) methods and DNA sequencing. Circulating MCPyV sequences were detected in sera with a prevalence of 2.6% (5/190), at low-DNA viral load, which is in the range of 1–4 and 1–5 copies/μl by real-time PCR and droplet digital PCR, respectively. DNA sequencing carried out in the five MCPyV-positive samples indicated that the two MCPyV LT sequences which were analyzed belong to the MKL-1 strain. Circulating MCPyV LT sequences are present in blood donor sera. MCPyV-positive samples from blood donors could represent a potential vehicle for MCPyV infection in receivers, whereas an increase in viral load may occur with multiple blood transfusions. In certain patient conditions, such as immune-depression/suppression, additional disease or old age, transfusion of MCPyV-positive samples could be an additional risk factor for MCC onset. PMID:29238698
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myhre, Marit Renee; Olsen, Gunn-Hege; Gosert, Rainer
High-level replication of polyomavirus BK (BKV) in kidney transplant recipients is associated with the emergence of BKV variants with rearranged (rr) non-coding control region (NCCR) increasing viral early gene expression and cytopathology. Cloning and sequencing revealed the presence of a BKV quasispecies which included non-functional variants when assayed in a recombinant virus assay. Here we report that the rr-NCCR of BKV variants RH-3 and RH-12, both bearing a NCCR deletion including the 5' end of the agnoprotein coding sequence, mediated early and late viral reporter gene expression in kidney cells. However, in a recombinant virus they failed to produce infectiousmore » progeny despite large T-antigen and VP1 expression and the formation of nuclear virus-like particles. Infectious progeny was generated when the agnogene was reconstructed in cis or agnoprotein provided in trans from a co-existing BKV rr-NCCR variant. We conclude that complementation can rescue non-functional BKV variants in vitro and possibly in vivo.« less
-
Houzet, Laurent; Klase, Zachary; Yeung, Man Lung; Wu, Annie; Le, Shu-Yun; Quiñones, Mariam; Jeang, Kuan-Teh
2012-01-01
MicroRNAs (miRNAs) are 22-nt non-coding RNAs involved in the regulation of cellular gene expression and potential cellular defense against viral infection. Using in silico analyses, we predicted target sites for 22 human miRNAs in the HIV genome. Transfection experiments using synthetic miRNAs showed that five of these miRNAs capably decreased HIV replication. Using one of these five miRNAs, human miR-326 as an example, we demonstrated that the degree of complementarity between the predicted viral sequence and cellular miR-326 correlates, in a Dicer-dependent manner, with the potency of miRNA-mediated restriction of viral replication. Antagomirs to miR-326 that knocked down this cell endogenous miRNA increased HIV-1 replication in cells, suggesting that miR-326 is physiologically functional in moderating HIV-1 replication in human cells. PMID:23042677
-
McFadden, Nora; Arias, Armando; Dry, Inga; Bailey, Dalan; Witteveldt, Jeroen; Evans, David J.; Goodfellow, Ian; Simmonds, Peter
2013-01-01
Mechanisms by which certain RNA viruses, such as hepatitis C virus, establish persistent infections and cause chronic disease are of fundamental importance in viral pathogenesis. Mammalian positive-stranded RNA viruses establishing persistence typically possess genome-scale ordered RNA secondary structure (GORS) in their genomes. Murine norovirus (MNV) persists in immunocompetent mice and provides an experimental model to functionally characterize GORS. Substitution mutants were constructed with coding sequences in NS3/4- and NS6/7-coding regions replaced with sequences with identical coding and (di-)nucleotide composition but disrupted RNA secondary structure (F1, F2, F1/F2 mutants). Mutants replicated with similar kinetics to wild-type (WT) MNV3 in RAW264.7 cells and primary macrophages, exhibited similar (highly restricted) induction and susceptibility to interferon-coupled cellular responses and equal replication fitness by serial passaging of co-cultures. In vivo, both WT and F1/F2 mutant viruses persistently infected mice, although F1, F2 and F1/F2 mutant viruses were rapidly eliminated 1–7 days post-inoculation in competition experiments with WT. F1/F2 mutants recovered from tissues at 9 months showed higher synonymous substitution rates than WT and nucleotide substitutions that potentially restored of RNA secondary structure. GORS plays no role in basic replication of MNV but potentially contributes to viral fitness and persistence in vivo. PMID:23630317
-
Prophage-mediated defense against viral attack and viral counter-defense
Dedrick, Rebekah M.; Jacobs-Sera, Deborah; Guerrero Bustamante, Carlos A.; Garlena, Rebecca A.; Mavrich, Travis N.; Pope, Welkin H.; Reyes, Juan C Cervantes; Russell, Daniel A.; Adair, Tamarah; Alvey, Richard; Bonilla, J. Alfred; Bricker, Jerald S.; Brown, Bryony R.; Byrnes, Deanna; Cresawn, Steven G.; Davis, William B.; Dickson, Leon A.; Edgington, Nicholas P.; Findley, Ann M.; Golebiewska, Urszula; Grose, Julianne H.; Hayes, Cory F.; Hughes, Lee E.; Hutchison, Keith W.; Isern, Sharon; Johnson, Allison A.; Kenna, Margaret A.; Klyczek, Karen K.; Mageeney, Catherine M.; Michael, Scott F.; Molloy, Sally D.; Montgomery, Matthew T.; Neitzel, James; Page, Shallee T.; Pizzorno, Marie C.; Poxleitner, Marianne K.; Rinehart, Claire A.; Robinson, Courtney J.; Rubin, Michael R.; Teyim, Joseph N.; Vazquez, Edwin; Ware, Vassie C.; Washington, Jacqueline; Hatfull, Graham F.
2017-01-01
Temperate phages are common and prophages are abundant residents of sequenced bacterial genomes. Mycobacteriophages are viruses infecting mycobacterial hosts including Mycobacterium tuberculosis and Mycobacterium smegmatis, encompass substantial genetic diversity, and are commonly temperate. Characterization of ten Cluster N temperate mycobacteriophages reveals at least five distinct prophage-expressed viral defense systems that interfere with infection of lytic and temperate phages that are either closely-related (homotypic defense) or unrelated (heterotypic defense). Target specificity is unpredictable, ranging from a single target phage to one-third of those tested. The defense systems include a single-subunit restriction system, a heterotypic exclusion system, and a predicted (p)ppGpp synthetase, which blocks lytic phage growth, promotes bacterial survival, and enables efficient lysogeny. The predicted (p)ppGpp synthetase coded by the Phrann prophage defends against phage Tweety infection, but Tweety codes for a tetrapeptide repeat protein, gp54, that acts as a highly effective counter-defense system. Prophage-mediated viral defense offers an efficient mechanism for bacterial success in host-virus dynamics, and counter-defense promotes phage co-evolution. PMID:28067906
-
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.
-
Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo
2010-02-01
A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.
-
Production of recombinant adenovirus containing human interlukin-4 gene.
Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein
2011-11-01
Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics that made it a good choice for using in cancer gene therapy, controlling inflammatory diseases, and studies on autoimmune diseases. In brief, IL-4 coding sequence was amplified by and cloned in pAd-Track-CMV. Then, by means of homologous recombination between recombinant pAd-Track-CMV and Adeasy-1 plasmid in bacteria, recombinant adenovirus complete genome was made and IL-4 containing shuttle vector was incorporated into the viral backbone. After linearization, for virus packaging, viral genome was transfected into HEK-293 cell line. Viral production was conveniently followed with the aid of green fluorescent protein. Recombinant adenovirus produced here, was capable to infecting cell lines and express interlukin-4 in cell. This system can be used as a powerful, easy, and cost benefit tool in various studies on cancer gene therapy and also studies on immunogenetics.
-
Geldenhuys, Marike; Mortlock, Marinda; Weyer, Jacqueline; Bezuidt, Oliver; Seamark, Ernest C J; Kearney, Teresa; Gleasner, Cheryl; Erkkila, Tracy H; Cui, Helen; Markotter, Wanda
2018-01-01
Species within the Neoromicia bat genus are abundant and widely distributed in Africa. It is common for these insectivorous bats to roost in anthropogenic structures in urban regions. Additionally, Neoromicia capensis have previously been identified as potential hosts for Middle East respiratory syndrome (MERS)-related coronaviruses. This study aimed to ascertain the gastrointestinal virome of these bats, as viruses excreted in fecal material or which may be replicating in rectal or intestinal tissues have the greatest opportunities of coming into contact with other hosts. Samples were collected in five regions of South Africa over eight years. Initial virome composition was determined by viral metagenomic sequencing by pooling samples and enriching for viral particles. Libraries were sequenced on the Illumina MiSeq and NextSeq500 platforms, producing a combined 37 million reads. Bioinformatics analysis of the high throughput sequencing data detected the full genome of a novel species of the Circoviridae family, and also identified sequence data from the Adenoviridae, Coronaviridae, Herpesviridae, Parvoviridae, Papillomaviridae, Phenuiviridae, and Picornaviridae families. Metagenomic sequencing data was insufficient to determine the viral diversity of certain families due to the fragmented coverage of genomes and lack of suitable sequencing depth, as some viruses were detected from the analysis of reads-data only. Follow up conventional PCR assays targeting conserved gene regions for the Adenoviridae, Coronaviridae, and Herpesviridae families were used to confirm metagenomic data and generate additional sequences to determine genetic diversity. The complete coding genome of a MERS-related coronavirus was recovered with additional amplicon sequencing on the MiSeq platform. The new genome shared 97.2% overall nucleotide identity to a previous Neoromicia-associated MERS-related virus, also from South Africa. Conventional PCR analysis detected diverse adenovirus and herpesvirus sequences that were widespread throughout Neoromicia populations in South Africa. Furthermore, similar adenovirus sequences were detected within these populations throughout several years. With the exception of the coronaviruses, the study represents the first report of sequence data from several viral families within a Southern African insectivorous bat genus; highlighting the need for continued investigations in this regard.
-
Geldenhuys, Marike; Mortlock, Marinda; Weyer, Jacqueline; Bezuidt, Oliver; Seamark, Ernest C. J.; Kearney, Teresa; Gleasner, Cheryl; Erkkila, Tracy H.; Cui, Helen; Markotter, Wanda
2018-01-01
Species within the Neoromicia bat genus are abundant and widely distributed in Africa. It is common for these insectivorous bats to roost in anthropogenic structures in urban regions. Additionally, Neoromicia capensis have previously been identified as potential hosts for Middle East respiratory syndrome (MERS)-related coronaviruses. This study aimed to ascertain the gastrointestinal virome of these bats, as viruses excreted in fecal material or which may be replicating in rectal or intestinal tissues have the greatest opportunities of coming into contact with other hosts. Samples were collected in five regions of South Africa over eight years. Initial virome composition was determined by viral metagenomic sequencing by pooling samples and enriching for viral particles. Libraries were sequenced on the Illumina MiSeq and NextSeq500 platforms, producing a combined 37 million reads. Bioinformatics analysis of the high throughput sequencing data detected the full genome of a novel species of the Circoviridae family, and also identified sequence data from the Adenoviridae, Coronaviridae, Herpesviridae, Parvoviridae, Papillomaviridae, Phenuiviridae, and Picornaviridae families. Metagenomic sequencing data was insufficient to determine the viral diversity of certain families due to the fragmented coverage of genomes and lack of suitable sequencing depth, as some viruses were detected from the analysis of reads-data only. Follow up conventional PCR assays targeting conserved gene regions for the Adenoviridae, Coronaviridae, and Herpesviridae families were used to confirm metagenomic data and generate additional sequences to determine genetic diversity. The complete coding genome of a MERS-related coronavirus was recovered with additional amplicon sequencing on the MiSeq platform. The new genome shared 97.2% overall nucleotide identity to a previous Neoromicia-associated MERS-related virus, also from South Africa. Conventional PCR analysis detected diverse adenovirus and herpesvirus sequences that were widespread throughout Neoromicia populations in South Africa. Furthermore, similar adenovirus sequences were detected within these populations throughout several years. With the exception of the coronaviruses, the study represents the first report of sequence data from several viral families within a Southern African insectivorous bat genus; highlighting the need for continued investigations in this regard. PMID:29579103
-
Wang, Jin; Dong, Hongping; Chionh, Yok Hian; McBee, Megan E.; Sirirungruang, Sasilada; Cunningham, Richard P.; Shi, Pei-Yong; Dedon, Peter C.
2016-01-01
The misincorporation of 2′-deoxyribonucleotides (dNs) into RNA has important implications for the function of non-coding RNAs, the translational fidelity of coding RNAs and the mutagenic evolution of viral RNA genomes. However, quantitative appreciation for the degree to which dN misincorporation occurs is limited by the lack of analytical tools. Here, we report a method to hydrolyze RNA to release 2′-deoxyribonucleotide-ribonucleotide pairs (dNrN) that are then quantified by chromatography-coupled mass spectrometry (LC-MS). Using this platform, we found misincorporated dNs occurring at 1 per 103 to 105 ribonucleotide (nt) in mRNA, rRNAs and tRNA in human cells, Escherichia coli, Saccharomyces cerevisiae and, most abundantly, in the RNA genome of dengue virus. The frequency of dNs varied widely among organisms and sequence contexts, and partly reflected the in vitro discrimination efficiencies of different RNA polymerases against 2′-deoxyribonucleoside 5′-triphosphates (dNTPs). Further, we demonstrate a strong link between dN frequencies in RNA and the balance of dNTPs and ribonucleoside 5′-triphosphates (rNTPs) in the cellular pool, with significant stress-induced variation of dN incorporation. Potential implications of dNs in RNA are discussed, including the possibilities of dN incorporation in RNA as a contributing factor in viral evolution and human disease, and as a host immune defense mechanism against viral infections. PMID:27365049
-
Application of viromics: a new approach to the understanding of viral infections in humans.
Ramamurthy, Mageshbabu; Sankar, Sathish; Kannangai, Rajesh; Nandagopal, Balaji; Sridharan, Gopalan
2017-12-01
This review is focused at exploring the strengths of modern technology driven data compiled in the areas of virus gene sequencing, virus protein structures and their implication to viral diagnosis and therapy. The information for virome analysis (viromics) is generated by the study of viral genomes (entire nucleotide sequence) and viral genes (coding for protein). Presently, the study of viral infectious diseases in terms of etiopathogenesis and development of newer therapeutics is undergoing rapid changes. Currently, viromics relies on deep sequencing, next generation sequencing (NGS) data and public domain databases like GenBank and unique virus specific databases. Two commonly used NGS platforms: Illumina and Ion Torrent, recommend maximum fragment lengths of about 300 and 400 nucleotides for analysis respectively. Direct detection of viruses in clinical samples is now evolving using these methods. Presently, there are a considerable number of good treatment options for HBV/HIV/HCV. These viruses however show development of drug resistance. The drug susceptibility regions of the genomes are sequenced and the prediction of drug resistance is now possible from 3 public domains available on the web. This has been made possible through advances in the technology with the advent of high throughput sequencing and meta-analysis through sophisticated and easy to use software and the use of high speed computers for bioinformatics. More recently NGS technology has been improved with single-molecule real-time sequencing. Here complete long reads can be obtained with less error overcoming a limitation of the NGS which is inherently prone to software anomalies that arise in the hands of personnel without adequate training. The development in understanding the viruses in terms of their genome, pathobiology, transcriptomics and molecular epidemiology constitutes viromics. It could be stated that these developments will bring about radical changes and advancement especially in the field of antiviral therapy and diagnostic virology.
-
Genomic Sequencing and Characterization of Cynomolgus Macaque Cytomegalovirus▿
Marsh, Angie K.; Willer, David O.; Ambagala, Aruna P. N.; Dzamba, Misko; Chan, Jacqueline K.; Pilon, Richard; Fournier, Jocelyn; Sandstrom, Paul; Brudno, Michael; MacDonald, Kelly S.
2011-01-01
Cytomegalovirus (CMV) infection is the most common opportunistic infection in immunosuppressed individuals, such as transplant recipients or people living with HIV/AIDS, and congenital CMV is the leading viral cause of developmental disabilities in infants. Due to the highly species-specific nature of CMV, animal models that closely recapitulate human CMV (HCMV) are of growing importance for vaccine development. Here we present the genomic sequence of a novel nonhuman primate CMV from cynomolgus macaques (Macaca fascicularis; CyCMV). CyCMV (Ottawa strain) was isolated from the urine of a healthy, captive-bred, 4-year-old cynomolgus macaque of Philippine origin, and the viral genome was sequenced using next-generation Illumina sequencing to an average of 516-fold coverage. The CyCMV genome is 218,041 bp in length, with 49.5% G+C content and 84% protein-coding density. We have identified 262 putative open reading frames (ORFs) with an average coding length of 789 bp. The genomic organization of CyCMV is largely colinear with that of rhesus macaque CMV (RhCMV). Of the 262 CyCMV ORFs, 137 are homologous to HCMV genes, 243 are homologous to RhCMV 68.1, and 200 are homologous to RhCMV 180.92. CyCMV encodes four ORFs that are not present in RhCMV strain 68.1 or 180.92 but have homologies with HCMV (UL30, UL74A, UL126, and UL146). Similar to HCMV, CyCMV does not produce the RhCMV-specific viral homologue of cyclooxygenase-2. This newly characterized CMV may provide a novel model in which to study CMV biology and HCMV vaccine development. PMID:21994460
-
Zetterberg, Veera; Ustina, Valentina; Liitsola, Kirsi; Zilmer, Kai; Kalikova, Nelli; Sevastianova, Ksenia; Brummer-Korvenkontio, Henrikki; Leinikki, Pauli; Salminen, Mika O
2004-11-01
HIV-1 infection has been rare in Estonia. In 2000, an explosive epidemic among injecting drug users was detected in the Eastern border region, resulting in 3603 newly reported cases by the end of 2003. The molecular epidemiology of the outbreak was studied to establish whether the Estonian epidemic is linked to the epidemics in Eastern Europe. Over 200 newly infected individuals were prospectively sampled from June 2000 to March 2002 in a geographically representative way, with known dates of diagnosis and information of probable route of transmission. Viral regions coding for two viral gene regions were directly sequenced from plasma viral RNA and phylogenetically analyzed. In addition, a larger region coding for the entire env gene was sequenced from one sample and studied for indications of possible recombinant structure. The Estonian HIV outbreak was found to be caused by simultaneous introduction of two strains: a minor subtype A strain very similar to the Eastern European subtype A strain (approximately 8% of cases), and a second major strain (77%) found to be most closely related to the CRF06-cpx strain, previously described only from African countries. The variability in the two clusters was very low, suggesting point source introductions. Ten percent of cases seemed to be newly generated recombinants of the A and CRF06-cpx strains. Analysis of viral diversification over time revealed a rate of change within the V3 region of 0.83%/year for the CRF06-cpx strain, consistent with findings from other subtypes. Due to the relatively frequently found novel recombinant forms, the Estonian HIV-1 epidemic may allow studies of coinfection and intersubtype recombination in detail.
-
Núñez-Hernández, Fernando; Pérez, Lester J; Vera, Gonzalo; Córdoba, Sarai; Segalés, Joaquim; Sánchez, Armand; Núñez, José I
2015-05-01
Porcine circovirus type 2 (PCV2) is a ssDNA virus causing PCV2-systemic disease (PCV2-SD), one of the most important diseases in swine. MicroRNAs (miRNAs) are a new class of small non-coding RNAs that regulate gene expression post-transcriptionally. Viral miRNAs have recently been described and the number of viral miRNAs has been increasing in the past few years. In this study, small RNA libraries were constructed from two tissues of subclinically PCV2 infected pigs to explore if PCV2 can encode viral miRNAs. The deep sequencing data revealed that PCV2 does not express miRNAs in an in vivo subclinical infection.
-
Kikhno, Irina
2014-01-01
Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153
-
Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani
2010-01-01
In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.
-
Kawano, Yasuhiro; Neeley, Shane; Adachi, Kei; Nakai, Hiroyuki
2013-01-01
Overlapping open reading frames (ORFs) in viral genomes undergo co-evolution; however, how individual amino acids coded by overlapping ORFs are structurally, functionally, and co-evolutionarily constrained remains difficult to address by conventional homologous sequence alignment approaches. We report here a new experimental and computational evolution-based methodology to address this question and report its preliminary application to elucidating a mode of co-evolution of the frame-shifted overlapping ORFs in the adeno-associated virus (AAV) serotype 2 viral genome. These ORFs encode both capsid VP protein and non-structural assembly-activating protein (AAP). To show proof of principle of the new method, we focused on the evolutionarily conserved QVKEVTQ and KSKRSRR motifs, a pair of overlapping heptapeptides in VP and AAP, respectively. In the new method, we first identified a large number of capsid-forming VP3 mutants and functionally competent AAP mutants of these motifs from mutant libraries by experimental directed evolution under no co-evolutionary constraints. We used Illumina sequencing to obtain a large dataset and then statistically assessed the viability of VP and AAP heptapeptide mutants. The obtained heptapeptide information was then integrated into an evolutionary algorithm, with which VP and AAP were co-evolved from random or native nucleotide sequences in silico. As a result, we demonstrate that these two heptapeptide motifs could exhibit high degeneracy if coded by separate nucleotide sequences, and elucidate how overlap-evoked co-evolutionary constraints play a role in making the VP and AAP heptapeptide sequences into the present shape. Specifically, we demonstrate that two valine (V) residues and β-strand propensity in QVKEVTQ are structurally important, the strongly negative and hydrophilic nature of KSKRSRR is functionally important, and overlap-evoked co-evolution imposes strong constraints on serine (S) residues in KSKRSRR, despite high degeneracy of the motifs in the absence of co-evolutionary constraints.
-
The complete DNA sequence of lymphocystis disease virus.
Tidona, C A; Darai, G
1997-04-14
Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.
-
Expression of a non-coding RNA in ectromelia virus is required for normal plaque formation.
Esteban, David J; Upton, Chris; Bartow-McKenney, Casey; Buller, R Mark L; Chen, Nanhai G; Schriewer, Jill; Lefkowitz, Elliot J; Wang, Chunlin
2014-02-01
Poxviruses are dsDNA viruses with large genomes. Many genes in the genome remain uncharacterized, and recent studies have demonstrated that the poxvirus transcriptome includes numerous so-called anomalous transcripts not associated with open reading frames. Here, we characterize the expression and role of an apparently non-coding RNA in orthopoxviruses, which we call viral hairpin RNA (vhRNA). Using a bioinformatics approach, we predicted expression of a transcript not associated with an open reading frame that is likely to form a stem-loop structure due to the presence of a 21 nt palindromic sequence. Expression of the transcript as early as 2 h post-infection was confirmed by northern blot and analysis of publicly available vaccinia virus infected cell transcriptomes. The transcription start site was determined by RACE PCE and transcriptome analysis, and early and late promoter sequences were identified. Finally, to test the function of the transcript we generated an ectromelia virus knockout, which failed to form plaques in cell culture. The important role of the transcript in viral replication was further demonstrated using siRNA. Although the function of the transcript remains unknown, our work contributes to evidence of an increasingly complex poxvirus transcriptome, suggesting that transcripts such as vhRNA not associated with an annotated open reading frame can play an important role in viral replication.
-
Production of Recombinant Adenovirus Containing Human Interlukin-4 Gene
Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein
2011-01-01
Objective(s) Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics that made it a good choice for using in cancer gene therapy, controlling inflammatory diseases, and studies on autoimmune diseases. Materials and Methods In brief, IL-4 coding sequence was amplified by and cloned in pAd-Track-CMV. Then, by means of homologous recombination between recombinant pAd-Track-CMV and Adeasy-1 plasmid in bacteria, recombinant adenovirus complete genome was made and IL-4 containing shuttle vector was incorporated into the viral backbone. After linearization, for virus packaging, viral genome was transfected into HEK-293 cell line. Viral production was conveniently followed with the aid of green fluorescent protein. Results Recombinant adenovirus produced here, was capable to infecting cell lines and express interlukin-4 in cell. Conclusion This system can be used as a powerful, easy, and cost benefit tool in various studies on cancer gene therapy and also studies on immunogenetics. PMID:23493491
-
Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin
2012-12-01
Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.
-
Müller, M; Schnitzler, P; Koonin, E V; Darai, G
1995-05-01
Cytoplasmic DNA viruses encode a DNA-dependent RNA polymerase (DdRP) that is essential for transcription of viral genes. The amino acid sequences of the known largest subunits of DdRPs from different species contain highly conserved regions. Oligonucleotide primers, deduced from two conserved domains (RQP[T/S]LH and NADFDGDE) were used for detecting the corresponding gene of fish lymphocystis disease virus (FLCDV), a member of the family Iridoviridae, which replicates in the cytoplasm of infected cells of flatfish. The gene coding for the largest subunit of the DdRP was identified using a PCR-derived probe. The screening of the complete EcoRI gene library of the viral genome led to the identification of the gene locus of the largest subunit of the DdRP within the EcoRI DNA fragment B (12.4 kbp, 0.034 to 0.165 map units). The nucleotide sequence of a part (8334 bp) of the EcoRI DNA fragment B was determined and a large ORF on the lower strand (ATG = 5787; TAA = 2190) was detected which encodes a protein of 1199 amino acids. Comparison of the amino acid sequences of the largest subunits of the DdRP (RPO1) of FLCDV and Chilo iridescent virus (CIV) revealed a dramatic difference in their domain organization. Unlike the 1051 aa RPO1 of CIV, which lacks the C-terminal domain conserved in eukaryotic, eubacterial and other viral RNA polymerases, the 1199 aa RPO1 of FLCDV is fully collinear with its cellular and viral homologues. Despite this difference, comparative analysis of the amino acid sequences of viral and cellular RNA polymerases suggests a common origin for the largest RNA polymerase subunits of FLCDV and CIV.
-
Structural Relationships Between Minor and Major Proteins of Hepatitis B Surface Antigen
Stibbe, Werner; Gerlich, Wolfram H.
1983-01-01
The minor glycoproteins from hepatitis B surface antigen, GP33 and GP36, contain at their carboxy-terminal part the sequence of the major protein P24. They have 55 additional amino acids at the amino-terminal part which are coded by the pre-S region of the viral DNA. Images PMID:6842680
-
Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.
Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F
1984-01-01
The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019
-
May, Jared; Johnson, Philip; Saleem, Huma
2017-01-01
ABSTRACT To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5′ cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo. An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo. Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5′ cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary structure has IRES activity and produces low levels of viral coat protein in vitro and in vivo. Our findings may be applicable to cellular mRNA IRES that also have little or no sequences/structures in common. PMID:28179526
-
Wu, Yueh-Lung; Wu, Carol-P; Huang, Yu-Hui; Huang, Sheng-Ping; Lo, Huei-Ru; Chang, Hao-Shuo; Lin, Pi-Hsiu; Wu, Ming-Cheng; Chang, Chia-Jung; Chao, Yu-Chan
2014-11-01
The p143 gene from Autographa californica multinucleocapsid nucleopolyhedrovirus (AcMNPV) has been found to increase the expression of luciferase, which is driven by the polyhedrin gene promoter, in a plasmid with virus coinfection. Further study indicated that this is due to the presence of a replication origin (ori) in the coding region of this gene. Transient DNA replication assays showed that a specific fragment of the p143 coding sequence, p143-3, underwent virus-dependent DNA replication in Spodoptera frugiperda IPLB-Sf-21 (Sf-21) cells. Deletion analysis of the p143-3 fragment showed that subfragment p143-3.2a contained the essential sequence of this putative ori. Sequence analysis of this region revealed a unique distribution of imperfect palindromes with high AT contents. No sequence homology or similarity between p143-3.2a and any other known ori was detected, suggesting that it is a novel baculovirus ori. Further study showed that the p143-3.2a ori can replicate more efficiently in infected Sf-21 cells than baculovirus homologous regions (hrs), the major baculovirus ori, or non-hr oris during virus replication. Previously, hr on its own was unable to replicate in mammalian cells, and for mammalian viral oris, viral proteins are generally required for their proper replication in host cells. However, the p143-3.2a ori was, surprisingly, found to function as an efficient ori in mammalian cells without the need for any viral proteins. We conclude that p143 contains a unique sequence that can function as an ori to enhance gene expression in not only insect cells but also mammalian cells. Baculovirus DNA replication relies on both hr and non-hr oris; however, so far very little is known about the latter oris. Here we have identified a new non-hr ori, the p143 ori, which resides in the coding region of p143. By developing a novel DNA replication-enhanced reporter system, we have identified and located the core region required for the p143 ori. This ori contains a large number of imperfect inverted repeats and is the most active ori in the viral genome during virus infection in insect cells. We also found that it is a unique ori that can replicate in mammalian cells without the assistance of baculovirus gene products. The identification of this ori should contribute to a better understanding of baculovirus DNA replication. Also, this ori is very useful in assisting with gene expression in mammalian cells. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
-
2011-01-01
Background Small RNA (sRNA) regulatory pathways (SRRPs) are important to anti-viral defence in mosquitoes. To identify critical features of the virus infection process in Dengue serotype 2 (DENV2)-infected Ae. aegypti, we deep-sequenced small non-coding RNAs. Triplicate biological replicates were used so that rigorous statistical metrics could be applied. Results In addition to virus-derived siRNAs (20-23 nts) previously reported for other arbovirus-infected mosquitoes, we show that PIWI pathway sRNAs (piRNAs) (24-30 nts) and unusually small RNAs (usRNAs) (13-19 nts) are produced in DENV-infected mosquitoes. We demonstrate that a major catalytic enzyme of the siRNA pathway, Argonaute 2 (Ago2), co-migrates with a ~1 megadalton complex in adults prior to bloodfeeding. sRNAs were cloned and sequenced from Ago2 immunoprecipitations. Viral sRNA patterns change over the course of infection. Host sRNAs were mapped to the published aedine transcriptome and subjected to analysis using edgeR (Bioconductor). We found that sRNA profiles are altered early in DENV2 infection, and mRNA targets from mitochondrial, transcription/translation, and transport functional categories are affected. Moreover, small non-coding RNAs (ncRNAs), such as tRNAs, spliceosomal U RNAs, and snoRNAs are highly enriched in DENV-infected samples at 2 and 4 dpi. Conclusions These data implicate the PIWI pathway in anti-viral defense. Changes to host sRNA profiles indicate that specific cellular processes are affected during DENV infection, such as mitochondrial function and ncRNA levels. Together, these data provide important progress in understanding the DENV2 infection process in Ae. aegypti. PMID:21356105
-
Crescenzo-Chaigne, Bernadette; Barbezange, Cyril; van der Werf, Sylvie
2008-01-01
Background The transcription/replication of the influenza viruses implicate the terminal nucleotide sequences of viral RNA, which comprise sequences at the extremities conserved among the genomic segments as well as variable 3' and 5' non-coding (NC) regions. The plasmid-based system for the in vivo reconstitution of functional ribonucleoproteins, upon expression of viral-like RNAs together with the nucleoprotein and polymerase proteins has been widely used to analyze transcription/replication of influenza viruses. It was thus shown that the type A polymerase could transcribe and replicate type A, B, or C vRNA templates whereas neither type B nor type C polymerases were able to transcribe and replicate type A templates efficiently. Here we studied the importance of the NC regions from the seven segments of type C influenza virus for efficient transcription/replication by the type A and C polymerases. Results The NC sequences of the seven genomic segments of the type C influenza virus C/Johannesburg/1/66 strain were found to be more variable in length than those of the type A and B viruses. The levels of transcription/replication of viral-like vRNAs harboring the NC sequences of the respective type C virus segments flanking the CAT reporter gene were comparable in the presence of either type C or type A polymerase complexes except for the NS and PB2-like vRNAs. For the NS-like vRNA, the transcription/replication level was higher after introduction of a U residue at position 6 in the 5' NC region as for all other segments. For the PB2-like vRNA the CAT expression level was particularly reduced with the type C polymerase. Analysis of mutants of the 5' NC sequence in the PB2-like vRNA, the shortest 5' NC sequence among the seven segments, showed that additional sequences within the PB2 ORF were essential for the efficiency of transcription but not replication by the type C polymerase complex. Conclusion In the context of a PB2-like reporter vRNA template, the sequence upstream the polyU stretch plays a role in the transcription/replication process by the type C polymerase complex. PMID:18973655
-
Functional RNA elements in the dengue virus genome.
Gebhard, Leopoldo G; Filomatori, Claudia V; Gamarnik, Andrea V
2011-09-01
Dengue virus (DENV) genome amplification is a process that involves the viral RNA, cellular and viral proteins, and a complex architecture of cellular membranes. The viral RNA is not a passive template during this process; it plays an active role providing RNA signals that act as promoters, enhancers and/or silencers of the replication process. RNA elements that modulate RNA replication were found at the 5' and 3' UTRs and within the viral coding sequence. The promoter for DENV RNA synthesis is a large stem loop structure located at the 5' end of the genome. This structure specifically interacts with the viral polymerase NS5 and promotes RNA synthesis at the 3' end of a circularized genome. The circular conformation of the viral genome is mediated by long range RNA-RNA interactions that span thousands of nucleotides. Recent studies have provided new information about the requirement of alternative, mutually exclusive, structures in the viral RNA, highlighting the idea that the viral genome is flexible and exists in different conformations. In this article, we describe elements in the promoter SLA and other RNA signals involved in NS5 polymerase binding and activity, and provide new ideas of how dynamic secondary and tertiary structures of the viral RNA participate in the viral life cycle.
-
Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike
2018-01-01
ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396
-
Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S
2018-01-01
Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.
-
Comparative analysis of viral RNA signatures on different RIG-I-like receptors
Sanchez David, Raul Y; Combredet, Chantal; Sismeiro, Odile; Dillies, Marie-Agnès; Jagla, Bernd; Coppée, Jean-Yves; Mura, Marie; Guerbois Galla, Mathilde; Despres, Philippe; Tangy, Frédéric; Komarova, Anastassia V
2016-01-01
The RIG-I-like receptors (RLRs) play a major role in sensing RNA virus infection to initiate and modulate antiviral immunity. They interact with particular viral RNAs, most of them being still unknown. To decipher the viral RNA signature on RLRs during viral infection, we tagged RLRs (RIG-I, MDA5, LGP2) and applied tagged protein affinity purification followed by next-generation sequencing (NGS) of associated RNA molecules. Two viruses with negative- and positive-sense RNA genome were used: measles (MV) and chikungunya (CHIKV). NGS analysis revealed that distinct regions of MV genome were specifically recognized by distinct RLRs: RIG-I recognized defective interfering genomes, whereas MDA5 and LGP2 specifically bound MV nucleoprotein-coding region. During CHIKV infection, RIG-I associated specifically to the 3’ untranslated region of viral genome. This study provides the first comparative view of the viral RNA ligands for RIG-I, MDA5 and LGP2 in the presence of infection. DOI: http://dx.doi.org/10.7554/eLife.11275.001 PMID:27011352
-
Demongeot, Jacques; Glade, Nicolas; Moreira, Andrés; Vial, Laurent
2009-01-01
A number of small RNA sequences, located in different non-coding sequences and highly preserved across the tree of life, have been suggested to be molecular fossils, of ancient (and possibly primordial) origin. On the other hand, recent years have revealed the existence of ubiquitous roles for small RNA sequences in modern organisms, in functions ranging from cell regulation to antiviral activity. We propose that a single thread can be followed from the beginning of life in RNA structures selected only for stability reasons through the RNA relics and up to the current coevolution of RNA sequences; such an understanding would shed light both on the history and on the present development of the RNA machinery and interactions. After presenting the evidence (by comparing their sequences) that points toward a common thread, we discuss a scenario of genome coevolution (with emphasis on viral infectious processes) and finally propose a plan for the reevaluation of the stereochemical theory of the genetic code; we claim that it may still be relevant, and not only for understanding the origin of life, but also for a comprehensive picture of regulation in present-day cells. PMID:20111682
-
O'Neill, F J; Gao, Y; Xu, X
1993-11-01
The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant monomolecular genomes. These and other findings indicate that the bipartite genome state can sustain many mutations which wtSV40 cannot directly sustain. However, the mutations can later be introduced into the wild type genomes when the E- and L-SV40 DNAs recombine to generate a new monomolecular genome structure.
-
Li, Na; Yan, Yunhuan; Zhang, Angke; Gao, Jiming; Zhang, Chong; Wang, Xue; Hou, Gaopeng; Zhang, Gaiping; Jia, Jinbu; Zhou, En-Min; Xiao, Shuqi
2016-12-13
Many viruses encode microRNAs (miRNAs) that are small non-coding single-stranded RNAs which play critical roles in virus-host interactions. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most economically impactful viruses in the swine industry. The present study sought to determine whether PRRSV encodes miRNAs that could regulate PRRSV replication. Four viral small RNAs (vsRNAs) were mapped to the stem-loop structures in the ORF1a, ORF1b and GP2a regions of the PRRSV genome by bioinformatics prediction and experimental verification. Of these, the structures with the lowest minimum free energy (MFE) values predicted for PRRSV-vsRNA1 corresponded to typical stem-loop, hairpin structures. Inhibition of PRRSV-vsRNA1 function led to significant increases in viral replication. Transfection with PRRSV-vsRNA1 mimics significantly inhibited PRRSV replication in primary porcine alveolar macrophages (PAMs). The time-dependent increase in the abundance of PRRSV-vsRNA1 mirrored the gradual upregulation of PRRSV RNA expression. Knockdown of proteins associated with cellular miRNA biogenesis demonstrated that Drosha and Argonaute (Ago2) are involved in PRRSV-vsRNA1 biogenesis. Moreover, PRRSV-vsRNA1 bound specifically to the nonstructural protein 2 (NSP2)-coding sequence of PRRSV genome RNA. Collectively, the results reveal that PRRSV encodes a functional PRRSV-vsRNA1 which auto-regulates PRRSV replication by directly targeting and suppressing viral NSP2 gene expression. These findings not only provide new insights into the mechanism of the pathogenesis of PRRSV, but also explore a potential avenue for controlling PRRSV infection using viral small RNAs.
-
Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.
Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang
2014-10-01
MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs. © FASEB.
-
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
-
Hadsbjerg, Johanne; Friis, Martin B; Fahnøe, Ulrik; Nielsen, Jens; Belsham, Graham J; Rasmussen, Thomas Bruun
2016-08-30
Classical swine fever virus (CSFV) causes an economically important disease of swine. Four different viruses were rescued from full-length cloned cDNAs derived from the Paderborn strain of CSFV. Three of these viruses had been modified by mutagenesis (with 7 or 8 nt changes) within stem 2 of the subdomain IIIf of the internal ribosome entry site (IRES) that directs the initiation of protein synthesis. Rescued viruses were inoculated into pigs. The rescued vPader10 virus, without modifications in the IRES, induced clinical disease in pigs that was very similar to that observed previously with the parental field strain and transmission to in-contact pigs occurred. Two sequence reversions, in the NS2 and NS5B coding regions, became dominant within the virus populations in these infected pigs. Rescued viruses, with mutant IRES elements, did not induce disease and only very limited circulation of viral RNA could be detected. However, the animals inoculated with these mutant viruses seroconverted against CSFV. Thus, these mutant viruses were highly attenuated in vivo. All 4 rescued viruses were also passaged up to 20 times in cell culture. Using full genome sequencing, the same two adaptations within each of four independent virus populations were observed that restored the coding sequence to that of the parental field strain. These adaptations occurred with different kinetics. The combination of reverse genetics and in depth, full genome sequencing provides a powerful approach to analyse virus adaptation and to identify key determinants of viral replication efficiency in cells and within host animals. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Recombination and Population Mosaic of a Multifunctional Viral Gene, Adeno-Associated Virus cap
Takeuchi, Yasuhiro; Myers, Richard; Danos, Olivier
2008-01-01
Homologous recombination is a dominant force in evolution and results in genetic mosaics. To detect evidence of recombination events and assess the biological significance of genetic mosaics, genome sequences for various viral populations of reasonably large size are now available in the GenBank. We studied a multi-functional viral gene, the adeno-associated virus (AAV) cap gene, which codes for three capsid proteins, VP1, VP2 and VP3. VP1-3 share a common C-terminal domain corresponding to VP3, which forms the viral core structure, while the VP1 unique N-terminal part contains an enzymatic domain with phospholipase A2 activity. Our recombinant detection program (RecI) revealed five novel recombination events, four of which have their cross-over points in the N-terminal, VP1 and VP2 unique region. Comparison of phylogenetic trees for different cap gene regions confirmed discordant phylogenies for the recombinant sequences. Furthermore, differences in the phylogenetic tree structures for the VP1 unique (VP1u) region and the rest of cap highlighted the mosaic nature of cap gene in the AAV population: two dominant forms of VP1u sequences were identified and these forms are linked to diverse sequences in the rest of cap gene. This observation together with the finding of frequent recombination in the VP1 and 2 unique regions suggests that this region is a recombination hot spot. Recombination events in this region preserve protein blocks of distinctive functions and contribute to convergence in VP1u and divergence of the rest of cap. Additionally the possible biological significance of two dominant VP1u forms is inferred. PMID:18286191
-
DNA transposons have colonized the genome of the giant virus Pandoravirus salinus.
Sun, Cheng; Feschotte, Cédric; Wu, Zhiqiang; Mueller, Rachel Lockridge
2015-06-12
Transposable elements are mobile DNA sequences that are widely distributed in prokaryotic and eukaryotic genomes, where they represent a major force in genome evolution. However, transposable elements have rarely been documented in viruses, and their contribution to viral genome evolution remains largely unexplored. Pandoraviruses are recently described DNA viruses with genome sizes that exceed those of some prokaryotes, rivaling parasitic eukaryotes. These large genomes appear to include substantial noncoding intergenic spaces, which provide potential locations for transposable element insertions. However, no mobile genetic elements have yet been reported in pandoravirus genomes. Here, we report a family of miniature inverted-repeat transposable elements (MITEs) in the Pandoravirus salinus genome, representing the first description of a virus populated with a canonical transposable element family that proliferated by transposition within the viral genome. The MITE family, which we name Submariner, includes 30 copies with all the hallmarks of MITEs: short length, terminal inverted repeats, TA target site duplication, and no coding capacity. Submariner elements show signs of transposition and are undetectable in the genome of Pandoravirus dulcis, the closest known relative Pandoravirus salinus. We identified a DNA transposon related to Submariner in the genome of Acanthamoeba castellanii, a species thought to host pandoraviruses, which contains remnants of coding sequence for a Tc1/mariner transposase. These observations suggest that the Submariner MITEs of P. salinus belong to the widespread Tc1/mariner superfamily and may have been mobilized by an amoebozoan host. Ten of the 30 MITEs in the P. salinus genome are located within coding regions of predicted genes, while others are close to genes, suggesting that these transposons may have contributed to viral genetic novelty. Our discovery highlights the remarkable ability of DNA transposons to colonize and shape genomes from all domains of life, as well as giant viruses. Our findings continue to blur the division between viral and cellular genomes, adhering to the emerging view that the content, dynamics, and evolution of the genomes of giant viruses do not substantially differ from those of cellular organisms.
-
Samsa, Marcelo M.; Mondotte, Juan A.; Caramelo, Julio J.
2012-01-01
Little is known about the mechanism of flavivirus genome encapsidation. Here, functional elements of the dengue virus (DENV) capsid (C) protein were investigated. Study of the N-terminal region of DENV C has been limited by the presence of overlapping cis-acting RNA elements within the protein-coding region. To dissociate these two functions, we used a recombinant DENV RNA with a duplication of essential RNA structures outside the C coding sequence. By the use of this system, the highly conserved amino acids FNML, which are encoded in the RNA cyclization sequence 5′CS, were found to be dispensable for C function. In contrast, deletion of the N-terminal 18 amino acids of C impaired DENV particle formation. Two clusters of basic residues (R5-K6-K7-R9 and K17-R18-R20-R22) were identified as important. A systematic mutational analysis indicated that a high density of positive charges, rather than particular residues at specific positions, was necessary. Furthermore, a differential requirement of N-terminal sequences of C for viral particle assembly was observed in mosquito and human cells. While no viral particles were observed in human cells with a virus lacking the first 18 residues of C, DENV propagation was detected in mosquito cells, although to a level about 50-fold less than that observed for a wild-type (WT) virus. We conclude that basic residues at the N terminus of C are necessary for efficient particle formation in mosquito cells but that they are crucial for propagation in human cells. This is the first report demonstrating that the N terminus of C plays a role in DENV particle formation. In addition, our results suggest that this function of C is differentially modulated in different host cells. PMID:22072762
-
Pruss, G; Ge, X; Shi, X M; Carrington, J C; Bowman Vance, V
1997-01-01
Synergistic viral diseases of higher plants are caused by the interaction of two independent viruses in the same host and are characterized by dramatic increases in symptoms and in accumulation of one of the coinfecting viruses. In potato virus X (PVX)/potyviral synergism, increased pathogenicity and accumulation of PVX are mediated by the expression of potyviral 5' proximal sequences encoding P1, the helper component proteinase (HC-Pro), and a fraction of P3. Here, we report that the same potyviral sequence (termed P1/HC-Pro) enhances the pathogenicity and accumulation of two other heterologous viruses: cucumber mosaic virus and tobacco mosaic virus. In the case of PVX-potyviral synergism, we show that the expression of the HC-Pro gene product, but not the RNA sequence itself, is sufficient to induce the increase in PVX pathogenicity and that both P1 and P3 coding sequences are dispensable for this aspect of the synergistic interaction. In protoplasts, expression of the potyviral P1/HC-Pro region prolongs the accumulation of PVX (-) strand RNA and transactivates expression of a reporter gene from a PVX subgenomic promoter. Unlike the synergistic enhancement of PVX pathogenicity, which requires only expression of HC-Pro, the enhancement of PVX (-) strand RNA accumulation in protoplasts is significantly greater when the entire P1/HC-Pro sequence is expressed. These results indicate that the potyviral P1/HC-Pro region affects a step in disease development that is common to a broad range of virus infections and suggest a mechanism involving transactivation of viral replication. PMID:9212462
-
Bào, Yīmíng; Kuhn, Jens H
2018-01-01
During the last decade, genome sequence-based classification of viruses has become increasingly prominent. Viruses can be even classified based on coding-complete genome sequence data alone. Nevertheless, classification remains arduous as experts are required to establish phylogenetic trees to depict the evolutionary relationships of such sequences for preliminary taxonomic placement. Pairwise sequence comparison (PASC) of genomes is one of several novel methods for establishing relationships among viruses. This method, provided by the US National Center for Biotechnology Information as an open-access tool, circumvents phylogenetics, and yet PASC results are often in agreement with those of phylogenetic analyses. Computationally inexpensive, PASC can be easily performed by non-taxonomists. Here we describe how to use the PASC tool for the preliminary classification of novel viral hemorrhagic fever-causing viruses.
-
NASA Astrophysics Data System (ADS)
Sun, S. M.; Slightom, J. L.; Hall, T. C.
1981-01-01
A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.
-
Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.
Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan
2011-09-01
The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.
-
Siqueira, Juliana D; Ng, Terry F; Miller, Melissa; Li, Linlin; Deng, Xutao; Dodd, Erin; Batac, Francesca; Delwart, Eric
2017-07-01
Over the past century, the southern sea otter (SSO; Enhydra lutris nereis) population has been slowly recovering from near extinction due to overharvest. The SSO is a threatened subspecies under federal law and a fully protected species under California law, US. Through a multiagency collaborative program, stranded animals are rehabilitated and released, while deceased animals are necropsied and tissues are cryopreserved to facilitate scientific study. Here, we processed archival tissues to enrich particle-associated viral nucleic acids, which we randomly amplified and deeply sequenced to identify viral genomes through sequence similarities. Anelloviruses and endogenous retroviral sequences made up over 50% of observed viral sequences. Polyomavirus, parvovirus, and adenovirus sequences made up most of the remaining reads. We characterized and phylogenetically analyzed the full genome of sea otter polyomavirus 1 and the complete coding sequence of sea otter parvovirus 1 and found that the closest known viruses infect primates and domestic pigs ( Sus scrofa domesticus), respectively. We tested archived tissues from 69 stranded SSO necropsied over 14 yr (2000-13) by PCR. Polyomavirus, parvovirus, and adenovirus infections were detected in 51, 61, and 29% of examined animals, respectively, with no significant increase in frequency over time, suggesting endemic infection. We found that 80% of tested SSO were infected with at least one of the three DNA viruses, whose tissue distribution we determined in 261 tissue samples. Parvovirus DNA was most frequently detected in mesenteric lymph node, polyomavirus DNA in spleen, and adenovirus DNA in multiple tissues (spleen, retropharyngeal and mesenteric lymph node, lung, and liver). This study describes the virome in tissues of a threatened species and shows that stranded SSO are frequently infected with multiple viruses, warranting future research to investigate associations between these infections and observed lesions.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuhn, R.J.; Tada, H.; Ypma-Wong, M.F.
1988-01-01
By following a strategy of genetic analysis of poliovirus, the authors have constructed a synthetic mutagenesis cartridge spanning the genome-linked viral protein coding region and flanking cleavage sites in an infectious cDNA clone of the type I (Mahoney) genome. The insertion of new restriction sites within the infectious clone has allowed them to replace the wild-type sequences with short complementary pairs of synthetic oligonucleotides containing various mutations. A set of mutations have been made that create methionine codons within the genome-linked viral protein region. The resulting viruses have growth characteristics similar to wild type. Experiments that led to an alterationmore » of the tyrosine residue responsible for the linkage to RNA have resulted in nonviable virus. In one mutant, proteolytic processing assayed in vitro appeared unimpaired by the mutation. They suggest that the position of the tyrosine residue is important for genome-linked viral protein function(s).« less
-
... Public Home » Hepatitis C » Hepatitis C Treatment Viral Hepatitis Menu Menu Viral Hepatitis Viral Hepatitis Home For ... Enter ZIP code here Enter ZIP code here Hepatitis C Treatment for Veterans and the Public Treatment ...
-
Hidden Structural Codes in Protein Intrinsic Disorder.
Borkosky, Silvia S; Camporeale, Gabriela; Chemes, Lucía B; Risso, Marikena; Noval, María Gabriela; Sánchez, Ignacio E; Alonso, Leonardo G; de Prat Gay, Gonzalo
2017-10-17
Intrinsic disorder is a major structural category in biology, accounting for more than 30% of coding regions across the domains of life, yet consists of conformational ensembles in equilibrium, a major challenge in protein chemistry. Anciently evolved papillomavirus genomes constitute an unparalleled case for sequence to structure-function correlation in cases in which there are no folded structures. E7, the major transforming oncoprotein of human papillomaviruses, is a paradigmatic example among the intrinsically disordered proteins. Analysis of a large number of sequences of the same viral protein allowed for the identification of a handful of residues with absolute conservation, scattered along the sequence of its N-terminal intrinsically disordered domain, which intriguingly are mostly leucine residues. Mutation of these led to a pronounced increase in both α-helix and β-sheet structural content, reflected by drastic effects on equilibrium propensities and oligomerization kinetics, and uncovers the existence of local structural elements that oppose canonical folding. These folding relays suggest the existence of yet undefined hidden structural codes behind intrinsic disorder in this model protein. Thus, evolution pinpoints conformational hot spots that could have not been identified by direct experimental methods for analyzing or perturbing the equilibrium of an intrinsically disordered protein ensemble.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Depto, A.S.; Stenberg, R.M.
1989-03-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less
-
Bigot, Diane; Atyame, Célestine M; Weill, Mylène; Justy, Fabienne
2018-01-01
Abstract In the global context of arboviral emergence, deep sequencing unlocks the discovery of new mosquito-borne viruses. Mosquitoes of the species Culex pipiens, C. torrentium, and C. hortensis were sampled from 22 locations worldwide for transcriptomic analyses. A virus discovery pipeline was used to analyze the dataset of 0.7 billion reads comprising 22 individual transcriptomes. Two closely related 6.8 kb viral genomes were identified in C. pipiens and named as Culex pipiens associated tunisia virus (CpATV) strains Ayed and Jedaida. The CpATV genome contained four ORFs. ORF1 possessed helicase and RNA-dependent RNA polymerase (RdRp) domains related to new viral sequences recently found mainly in dipterans. ORF2 and 4 contained a capsid protein domain showing strong homology with Virgaviridae plant viruses. ORF3 displayed similarities with eukaryotic Rhoptry domain and a merozoite surface protein (MSP7) domain only found in mosquito-transmitted Plasmodium, suggesting possible interactions between CpATV and vertebrate cells. Estimation of a strong purifying selection exerted on each ORFs and the presence of a polymorphism maintained in the coding region of ORF3 suggested that both CpATV sequences are genuine functional viruses. CpATV is part of an entirely new and highly diversified group of viruses recently found in insects, and that bears the genomic hallmarks of a new viral family. PMID:29340209
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
López, José L.; Golemba, Marcelo; Hernández, Edgardo
Rhodopsins are broadly distributed. In this work, we analyzed 23 metagenomes corresponding to marine sediment samples from four regions that share cold climate conditions (Norway; Sweden; Argentina and Antarctica). In order to investigate the genes evolution of viral rhodopsins, an initial set of 6224 bacterial rhodopsin sequences according to COG5524 were retrieved from the 23 metagenomes. After selection by the presence of transmembrane domains and alignment, 123 viral (51) and non-viral (72) sequences (>50 amino acids) were finally included in further analysis. Viral rhodopsin genes were homologs of Phaeocystis globosa virus and Organic lake Phycodnavirus. Non-viral microbial rhodopsin genes weremore » ascribed to Bacteroidetes, Planctomycetes, Firmicutes, Actinobacteria, Cyanobacteria, Proteobacteria, Deinococcus-Thermus and Cryptophyta and Fungi. A rescreening using Blastp, using as queries the viral sequences previously described, retrieved 30 sequences (>100 amino acids). Phylogeographic analysis revealed a geographical clustering of the sequences affiliated to the viral group. This clustering was not observed for the microbial non-viral sequences. The phylogenetic reconstruction allowed us to propose the existence of a putative ancestor of viral rhodopsin genes related to Actinobacteria and Chloroflexi. This is the first report about the existence of a phylogeographic association of the viral rhodopsin sequences from marine sediments.« less
-
A Functional Link between RNA Replication and Virion Assembly in the Potyvirus Plum Pox Virus.
Gallo, Araiz; Valli, Adrian; Calvo, María; García, Juan Antonio
2018-05-01
Accurate assembly of viral particles in the potyvirus Plum pox virus (PPV) has been shown to depend on the contribution of the multifunctional viral protein HCPro. In this study, we show that other viral factors, in addition to the capsid protein (CP) and HCPro, are necessary for the formation of stable PPV virions. The CP produced in Nicotiana benthamiana leaves from a subviral RNA termed LONG, which expresses a truncated polyprotein that lacks P1 and HCPro, together with HCPro supplied in trans , was assembled into virus-like particles and remained stable after in vitro incubation. In contrast, deletions in multiple regions of the LONG coding sequence prevented the CP stabilization mediated by HCPro. In particular, we demonstrated that the first 178 amino acids of P3, but not a specific nucleotide sequence coding for them, are required for CP stability and proper assembly of PPV particles. Using a sequential coagroinfiltration assay, we observed that the subviral LONG RNA replicates and locally spreads in N. benthamiana leaves expressing an RNA silencing suppressor. The analysis of the effect of both point and deletion mutations affecting RNA replication in LONG and full-length PPV demonstrated that this process is essential for the assembly of stable viral particles. Interestingly, in spite of this requirement, the CP produced by a nonreplicating viral RNA can be stably assembled into virions as long as it is coexpressed with a replication-proficient RNA. Altogether, these results highlight the importance of coupling encapsidation to other viral processes to secure a successful infection. IMPORTANCE Viruses of the family Potyviridae are among the most dangerous threats for basically every important crop, and such socioeconomical relevance has made them a subject of many research studies. In spite of this, very little is currently known about proteins and processes controlling viral genome encapsidation by the coat protein. In the case of Plum pox virus (genus Potyvirus ), for instance, we have previously shown that the multitasking viral factor HCPro plays a role in the production of stable virions. Here, by using this potyvirus as a model, we move further to show that additional factors are also necessary for the efficient production of potyviral particles. More importantly, a comprehensive screening for such factors led us to the identification of a functional link between virus replication and packaging, unraveling a previously unknown connection of these two key events of the potyviral infection cycle. Copyright © 2018 American Society for Microbiology.
-
de Souza, C R; Aragão, F J; Moreira, E C O; Costa, C N M; Nascimento, S B; Carvalho, L J
2009-03-24
Cassava is one of the most important tropical food crops for more than 600 million people worldwide. Transgenic technologies can be useful for increasing its nutritional value and its resistance to viral diseases and insect pests. However, tissue-specific promoters that guarantee correct expression of transgenes would be necessary. We used inverse polymerase chain reaction to isolate a promoter sequence of the Mec1 gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in cassava storage roots. In silico analysis revealed putative cis-acting regulatory elements within this promoter sequence, including root-specific elements that may be required for its expression in vascular tissues. Transient expression experiments showed that the Mec1 promoter is functional, since this sequence was able to drive GUS expression in bean embryonic axes. Results from our computational analysis can serve as a guide for functional experiments to identify regions with tissue-specific Mec1 promoter activity. The DNA sequence that we identified is a new promoter that could be a candidate for genetic engineering of cassava roots.
-
Chen, Tsung-Chi; Li, Ju-Ting; Fan, Ya-Shu; Yeh, Yi-Chun; Yeh, Shyi-Dong; Kormelink, Richard
2013-06-01
Tomato yellow ring virus (TYRV), first isolated from tomato in Iran, was classified as a non-approved species of the genus Tospovirus based on the characterization of its genomic S RNA. In the current study, the complete sequences of the genomic L and M RNAs of TYRV were determined and analyzed. The L RNA has 8,877 nucleotides (nt) and codes in the viral complementary (vc) strand for the putative RNA-dependent RNA polymerase (RdRp) of 2,873 amino acids (aa) (331 kDa). The RdRp of TYRV shares the highest aa sequence identity (88.7 %) with that of Iris yellow spot virus (IYSV), and contains conserved motifs shared with those of the animal-infecting bunyaviruses. The M RNA contains 4,786 nt and codes in ambisense arrangement for the NSm protein of 308 aa (34.5 kDa) in viral sense, and the Gn/Gc glycoprotein precursor (GP) of 1,310 aa (128 kDa) in vc-sense. Phylogenetic analyses indicated that TYRV is closely clustered with IYSV and Polygonum ringspot virus (PolRSV). The NSm and GP of TYRV share the highest aa sequence identity with those of IYSV and PolRSV (89.9 and 80.2-86.5 %, respectively). Moreover, the GPs of TYRV, IYSV, and PolRSV share highly similar characteristics, among which an identical deduced N-terminal protease cleavage site that is distinct from all tospoviral GPs analyzed thus far. Taken together, the elucidation of the complete genome sequence and biological features of TYRV support a close ancestral relationship with IYSV and PolRSV.
-
Analysis of the Genome of the Sexually Transmitted Insect Virus Helicoverpa zea Nudivirus 2
Burand, John P.; Kim, Woojin; Afonso, Claudio L.; Tulman, Edan R.; Kutish, Gerald F.; Lu, Zhiqiang; Rock, Daniel L.
2012-01-01
The sexually transmitted insect virus Helicoverpa zea nudivirus 2 (HzNV-2) was determined to have a circular double-stranded DNA genome of 231,621 bp coding for an estimated 113 open reading frames (ORFs). HzNV-2 is most closely related to the nudiviruses, a sister group of the insect baculoviruses. Several putative ORFs that share homology with the baculovirus core genes were identified in the viral genome. However, HzNV-2 lacks several key genetic features of baculoviruses including the late transcriptional regulation factor, LEF-1 and the palindromic hrs, which serve as origins of replication. The HzNV-2 genome was found to code for three ORFs that had significant sequence homology to cellular genes which are not generally found in viral genomes. These included a presumed juvenile hormone esterase gene, a gene coding for a putative zinc-dependent matrix metalloprotease, and a major facilitator superfamily protein gene; all of which are believed to play a role in the cellular proliferation and the tissue hypertrophy observed in the malformation of reproductive organs observed in HzNV-2 infected corn earworm moths, Helicoverpa zea. PMID:22355451
-
Analysis of the genome of the sexually transmitted insect virus Helicoverpa zea nudivirus 2.
Burand, John P; Kim, Woojin; Afonso, Claudio L; Tulman, Edan R; Kutish, Gerald F; Lu, Zhiqiang; Rock, Daniel L
2012-01-01
The sexually transmitted insect virus Helicoverpa zea nudivirus 2 (HzNV-2) was determined to have a circular double-stranded DNA genome of 231,621 bp coding for an estimated 113 open reading frames (ORFs). HzNV-2 is most closely related to the nudiviruses, a sister group of the insect baculoviruses. Several putative ORFs that share homology with the baculovirus core genes were identified in the viral genome. However, HzNV-2 lacks several key genetic features of baculoviruses including the late transcriptional regulation factor, LEF-1 and the palindromic hrs, which serve as origins of replication. The HzNV-2 genome was found to code for three ORFs that had significant sequence homology to cellular genes which are not generally found in viral genomes. These included a presumed juvenile hormone esterase gene, a gene coding for a putative zinc-dependent matrix metalloprotease, and a major facilitator superfamily protein gene; all of which are believed to play a role in the cellular proliferation and the tissue hypertrophy observed in the malformation of reproductive organs observed in HzNV-2 infected corn earworm moths, Helicoverpa zea.
-
[Hepatitis C virus: sequence homology of a European isolate and divergence from the prototype].
Seelig, R; Seelig, H P; Renz, M
1991-08-01
The polymerase chain reaction (PCR) detected specific hepatitis C viral (HCV) RNA sequences in liver biopsies from two patients with chronic hepatitis, in the tissue of a liver implantate, in plasma from four chronic non-A, non-B hepatitis (NANBH) patients and, for the first time, in an infectious anti-D-immunoglobulin preparation. A comparison of the viral sequences coding for a region for the nonstructural NS3 protein from the liver tissues revealed only a very small degree of sequence divergence on the cDNA as well as on the amino acid level (between 0 and 5%). The sequence similarities of the RNA isolated from plasma of the four chronic NANBH patients and the anti-D-immunoglobulin preparation were partly somewhat lower but altogether also high (between 90 and 100%). In contrast, all eight cDNA and amino acid sequences exhibited a significantly higher degree of divergence in comparison with the HCV prototype sequence (between 29 and 32%) than among themselves (between 0 and 10%). This unexpected high sequence similarity of the eight European isolates and their low homology to the Northamerican prototype sequence is indicative for the existence of different types of HCV. This will be important not only for epidemiological studies but also for the development of effective diagnostic procedures and vaccines. Concerning the pathogenesis of NANBH, a double infection or a helper mechanism has to be considered: in addition to the C virus, sequences of an other virus particle were found in the infectious IgG preparation as well as in the liver biopsies.
-
Ultra-deep mutant spectrum profiling: improving sequencing accuracy using overlapping read pairs.
Chen-Harris, Haiyin; Borucki, Monica K; Torres, Clinton; Slezak, Tom R; Allen, Jonathan E
2013-02-12
High throughput sequencing is beginning to make a transformative impact in the area of viral evolution. Deep sequencing has the potential to reveal the mutant spectrum within a viral sample at high resolution, thus enabling the close examination of viral mutational dynamics both within- and between-hosts. The challenge however, is to accurately model the errors in the sequencing data and differentiate real viral mutations, particularly those that exist at low frequencies, from sequencing errors. We demonstrate that overlapping read pairs (ORP) -- generated by combining short fragment sequencing libraries and longer sequencing reads -- significantly reduce sequencing error rates and improve rare variant detection accuracy. Using this sequencing protocol and an error model optimized for variant detection, we are able to capture a large number of genetic mutations present within a viral population at ultra-low frequency levels (<0.05%). Our rare variant detection strategies have important implications beyond viral evolution and can be applied to any basic and clinical research area that requires the identification of rare mutations.
-
Comparing viral metagenomics methods using a highly multiplexed human viral pathogens reagent
Li, Linlin; Deng, Xutao; Mee, Edward T.; Collot-Teixeira, Sophie; Anderson, Rob; Schepelmann, Silke; Minor, Philip D.; Delwart, Eric
2014-01-01
Unbiased metagenomic sequencing holds significant potential as a diagnostic tool for the simultaneous detection of any previously genetically described viral nucleic acids in clinical samples. Viral genome sequences can also inform on likely phenotypes including drug susceptibility or neutralization serotypes. In this study, different variables of the laboratory methods often used to generate viral metagenomics libraries on the efficiency of viral detection and virus genome coverage were compared. A biological reagent consisting of 25 different human RNA and DNA viral pathogens was used to estimate the effect of filtration and nuclease digestion, DNA/RNA extraction methods, pre-amplification and the use of different library preparation kits on the detection of viral nucleic acids. Filtration and nuclease treatment led to slight decreases in the percentage of viral sequence reads and number of viruses detected. For nucleic acid extractions silica spin columns improved viral sequence recovery relative to magnetic beads and Trizol extraction. Pre-amplification using random RT-PCR while generating more viral sequence reads resulted in detection of fewer viruses, more overlapping sequences, and lower genome coverage. The ScriptSeq library preparation method retrieved more viruses and a greater fraction of their genomes than the TruSeq and Nextera methods. Viral metagenomics sequencing was able to simultaneously detect up to 22 different viruses in the biological reagent analyzed including all those detected by qPCR. Further optimization will be required for the detection of viruses in biologically more complex samples such as tissues, blood, or feces. PMID:25497414
-
Origins and challenges of viral dark matter.
Krishnamurthy, Siddharth R; Wang, David
2017-07-15
The accurate classification of viral dark matter - metagenomic sequences that originate from viruses but do not align to any reference virus sequences - is one of the major obstacles in comprehensively defining the virome. Depending on the sample, viral dark matter can make up from anywhere between 40 and 90% of sequences. This review focuses on the specific nature of dark matter as it relates to viral sequences. We identify three factors that contribute to the existence of viral dark matter: the divergence and length of virus sequences, the limitations of alignment based classification, and limited representation of viruses in reference sequence databases. We then discuss current methods that have been developed to at least partially circumvent these limitations and thereby reduce the extent of viral dark matter. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Cheng, Chun-Pei; Lan, Kuo-Lun; Liu, Wen-Chun; Chang, Ting-Tsung; Tseng, Vincent S
2016-12-01
Hepatitis B viral (HBV) infection is strongly associated with an increased risk of liver diseases like cirrhosis or hepatocellular carcinoma (HCC). Many lines of evidence suggest that deletions occurring in HBV genomic DNA are highly associated with the activity of HBV via the interplay between aberrant viral proteins release and human immune system. Deletions finding on the HBV whole genome sequences is thus a very important issue though there exist underlying the challenges in mining such big and complex biological data. Although some next generation sequencing (NGS) tools are recently designed for identifying structural variations such as insertions or deletions, their validity is generally committed to human sequences study. This design may not be suitable for viruses due to different species. We propose a graphics processing unit (GPU)-based data mining method called DeF-GPU to efficiently and precisely identify HBV deletions from large NGS data, which generally contain millions of reads. To fit the single instruction multiple data instructions, sequencing reads are referred to as multiple data and the deletion finding procedure is referred to as a single instruction. We use Compute Unified Device Architecture (CUDA) to parallelize the procedures, and further validate DeF-GPU on 5 synthetic and 1 real datasets. Our results suggest that DeF-GPU outperforms the existing commonly-used method Pindel and is able to exactly identify the deletions of our ground truth in few seconds. The source code and other related materials are available at https://sourceforge.net/projects/defgpu/. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Inferring Short-Range Linkage Information from Sequencing Chromatograms
Beggel, Bastian; Neumann-Fraune, Maria; Kaiser, Rolf; Verheyen, Jens; Lengauer, Thomas
2013-01-01
Direct Sanger sequencing of viral genome populations yields multiple ambiguous sequence positions. It is not straightforward to derive linkage information from sequencing chromatograms, which in turn hampers the correct interpretation of the sequence data. We present a method for determining the variants existing in a viral quasispecies in the case of two nearby ambiguous sequence positions by exploiting the effect of sequence context-dependent incorporation of dideoxynucleotides. The computational model was trained on data from sequencing chromatograms of clonal variants and was evaluated on two test sets of in vitro mixtures. The approach achieved high accuracies in identifying the mixture components of 97.4% on a test set in which the positions to be analyzed are only one base apart from each other, and of 84.5% on a test set in which the ambiguous positions are separated by three bases. In silico experiments suggest two major limitations of our approach in terms of accuracy. First, due to a basic limitation of Sanger sequencing, it is not possible to reliably detect minor variants with a relative frequency of no more than 10%. Second, the model cannot distinguish between mixtures of two or four clonal variants, if one of two sets of linear constraints is fulfilled. Furthermore, the approach requires repetitive sequencing of all variants that might be present in the mixture to be analyzed. Nevertheless, the effectiveness of our method on the two in vitro test sets shows that short-range linkage information of two ambiguous sequence positions can be inferred from Sanger sequencing chromatograms without any further assumptions on the mixture composition. Additionally, our model provides new insights into the established and widely used Sanger sequencing technology. The source code of our method is made available at http://bioinf.mpi-inf.mpg.de/publications/beggel/linkageinformation.zip. PMID:24376502
-
Seligmann, Hervé
2018-05-01
Genetic codes mainly evolve by reassigning punctuation codons, starts and stops. Previous analyses assuming that undefined amino acids translate stops showed greater divergence between nuclear and mitochondrial genetic codes. Here, three independent methods converge on which amino acids translated stops at split between nuclear and mitochondrial genetic codes: (a) alignment-free genetic code comparisons inserting different amino acids at stops; (b) alignment-based blast analyses of hypothetical peptides translated from non-coding mitochondrial sequences, inserting different amino acids at stops; (c) biases in amino acid insertions at stops in proteomic data. Hence short-term protein evolution models reconstruct long-term genetic code evolution. Mitochondria reassign stops to amino acids otherwise inserted at stops by codon-anticodon mismatches (near-cognate tRNAs). Hence dual function (translation termination and translation by codon-anticodon mismatch) precedes mitochondrial reassignments of stops to amino acids. Stop ambiguity increases coded information, compensates endocellular mitogenome reduction. Mitochondrial codon reassignments might prevent viral infections. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
-
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
-
Sunita, S; Schwartz, Samantha L; Conn, Graeme L
2015-11-20
Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is an important component of the innate immune system that presents a crucial first line of defense against viral infection. PKR has a modular architecture comprising a regulatory N-terminal dsRNA binding domain and a C-terminal kinase domain interposed by an unstructured ∼80-residue interdomain linker (IDL). Guided by sequence alignment, we created IDL deletions in human PKR (hPKR) and regulatory/kinase domain swap human-rat chimeric PKRs to assess the contributions of each domain and the IDL to regulation of the kinase activity by RNA. Using circular dichroism spectroscopy, limited proteolysis, kinase assays, and isothermal titration calorimetry, we show that each PKR protein is properly folded with similar domain boundaries and that each exhibits comparable polyinosinic-cytidylic (poly(rI:rC)) dsRNA activation profiles and binding affinities for adenoviral virus-associated RNA I (VA RNAI) and HIV-1 trans-activation response (TAR) RNA. From these results we conclude that the IDL of PKR is not required for RNA binding or mediating changes in protein conformation or domain interactions necessary for PKR regulation by RNA. In contrast, inhibition of rat PKR by VA RNAI and TAR RNA was found to be weaker than for hPKR by 7- and >300-fold, respectively, and each human-rat chimeric domain-swapped protein showed intermediate levels of inhibition. These findings indicate that PKR sequence or structural elements in the kinase domain, present in hPKR but absent in rat PKR, are exploited by viral non-coding RNAs to accomplish efficient inhibition of PKR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Global Organization of a Positive-strand RNA Virus Genome
Wu, Baodong; Grigull, Jörg; Ore, Moriam O.; Morin, Sylvie; White, K. Andrew
2013-01-01
The genomes of plus-strand RNA viruses contain many regulatory sequences and structures that direct different viral processes. The traditional view of these RNA elements are as local structures present in non-coding regions. However, this view is changing due to the discovery of regulatory elements in coding regions and functional long-range intra-genomic base pairing interactions. The ∼4.8 kb long RNA genome of the tombusvirus tomato bushy stunt virus (TBSV) contains these types of structural features, including six different functional long-distance interactions. We hypothesized that to achieve these multiple interactions this viral genome must utilize a large-scale organizational strategy and, accordingly, we sought to assess the global conformation of the entire TBSV genome. Atomic force micrographs of the genome indicated a mostly condensed structure composed of interconnected protrusions extending from a central hub. This configuration was consistent with the genomic secondary structure model generated using high-throughput selective 2′-hydroxyl acylation analysed by primer extension (i.e. SHAPE), which predicted different sized RNA domains originating from a central region. Known RNA elements were identified in both domain and inter-domain regions, and novel structural features were predicted and functionally confirmed. Interestingly, only two of the six long-range interactions known to form were present in the structural model. However, for those interactions that did not form, complementary partner sequences were positioned relatively close to each other in the structure, suggesting that the secondary structure level of viral genome structure could provide a basic scaffold for the formation of different long-range interactions. The higher-order structural model for the TBSV RNA genome provides a snapshot of the complex framework that allows multiple functional components to operate in concert within a confined context. PMID:23717202
-
Breaking the 1000-gene barrier for Mimivirus using ultra-deep genome and transcriptome sequencing.
Legendre, Matthieu; Santini, Sébastien; Rico, Alain; Abergel, Chantal; Claverie, Jean-Michel
2011-03-04
Mimivirus, a giant dsDNA virus infecting Acanthamoeba, is the prototype of the mimiviridae family, the latest addition to the family of the nucleocytoplasmic large DNA viruses (NCLDVs). Its 1.2 Mb-genome was initially predicted to encode 917 genes. A subsequent RNA-Seq analysis precisely mapped many transcript boundaries and identified 75 new genes. We now report a much deeper analysis using the SOLiD™ technology combining RNA-Seq of the Mimivirus transcriptome during the infectious cycle (202.4 Million reads), and a complete genome re-sequencing (45.3 Million reads). This study corrected the genome sequence and identified several single nucleotide polymorphisms. Our results also provided clear evidence of previously overlooked transcription units, including an important RNA polymerase subunit distantly related to Euryarchea homologues. The total Mimivirus gene count is now 1018, 11% greater than the original annotation. This study highlights the huge progress brought about by ultra-deep sequencing for the comprehensive annotation of virus genomes, opening the door to a complete one-nucleotide resolution level description of their transcriptional activity, and to the realistic modeling of the viral genome expression at the ultimate molecular level. This work also illustrates the need to go beyond bioinformatics-only approaches for the annotation of short protein and non-coding genes in viral genomes.
-
Co-Circulation and Evolution of Polioviruses and Species C Enteroviruses in a District of Madagascar
Rakoto-Andrianarivelo, Mala; Guillot, Sophie; Iber, Jane; Balanant, Jean; Blondel, Bruno; Riquet, Franck; Martin, Javier; Kew, Olen; Randriamanalina, Bakolalao; Razafinimpiasa, Lalatiana; Rousset, Dominique; Delpeyroux, Francis
2007-01-01
Between October 2001 and April 2002, five cases of acute flaccid paralysis (AFP) associated with type 2 vaccine-derived polioviruses (VDPVs) were reported in the southern province of the Republic of Madagascar. To determine viral factors that favor the emergence of these pathogenic VDPVs, we analyzed in detail their genomic and phenotypic characteristics and compared them with co-circulating enteroviruses. These VDPVs appeared to belong to two independent recombinant lineages with sequences from the type 2 strain of the oral poliovaccine (OPV) in the 5′-half of the genome and sequences derived from unidentified species C enteroviruses (HEV-C) in the 3′-half. VDPV strains showed characteristics similar to those of wild neurovirulent viruses including neurovirulence in poliovirus-receptor transgenic mice. We looked for other VDPVs and for circulating enteroviruses in 316 stools collected from healthy children living in the small area where most of the AFP cases occurred. We found vaccine PVs, two VDPVs similar to those found in AFP cases, some echoviruses, and above all, many serotypes of coxsackie A viruses belonging to HEV-C, with substantial genetic diversity. Several coxsackie viruses A17 and A13 carried nucleotide sequences closely related to the 2C and the 3Dpol coding regions of the VDPVs, respectively. There was also evidence of multiple genetic recombination events among the HEV-C resulting in numerous recombinant genotypes. This indicates that co-circulation of HEV-C and OPV strains is associated with evolution by recombination, resulting in unexpectedly extensive viral diversity in small human populations in some tropical regions. This probably contributed to the emergence of recombinant VDPVs. These findings give further insight into viral ecosystems and the evolutionary processes that shape viral biodiversity. PMID:18085822
-
Korber, B T; Kunstman, K J; Patterson, B K; Furtado, M; McEvilly, M M; Levy, R; Wolinsky, S M
1994-01-01
Human immunodeficiency virus type 1 (HIV-1) sequences were generated from blood and from brain tissue obtained by stereotactic biopsy from six patients undergoing a diagnostic neurosurgical procedure. Proviral DNA was directly amplified by nested PCR, and 8 to 36 clones from each sample were sequenced. Phylogenetic analysis of intrapatient envelope V3-V5 region HIV-1 DNA sequence sets revealed that brain viral sequences were clustered relative to the blood viral sequences, suggestive of tissue-specific compartmentalization of the virus in four of the six cases. In the other two cases, the blood and brain virus sequences were intermingled in the phylogenetic analyses, suggesting trafficking of virus between the two tissues. Slide-based PCR-driven in situ hybridization of two of the patients' brain biopsy samples confirmed our interpretation of the intrapatient phylogenetic analyses. Interpatient V3 region brain-derived sequence distances were significantly less than blood-derived sequence distances. Relative to the tip of the loop, the set of brain-derived viral sequences had a tendency towards negative or neutral charge compared with the set of blood-derived viral sequences. Entropy calculations were used as a measure of the variability at each position in alignments of blood and brain viral sequences. A relatively conserved set of positions were found, with a significantly lower entropy in the brain-than in the blood-derived viral sequences. These sites constitute a brain "signature pattern," or a noncontiguous set of amino acids in the V3 region conserved in viral sequences derived from brain tissue. This brain-derived signature pattern was also well preserved among isolates previously characterized in vitro as macrophage tropic. Macrophage-monocyte tropism may be the biological constraint that results in the conservation of the viral brain signature pattern. Images PMID:7933130
-
Schaeffer, E; Sninsky, J J
1984-01-01
Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835
-
Gutiérrez, Pablo A; Alzate, Juan F; Montoya, Mauricio Marín
2015-06-01
Transcriptome analysis of a Cape gooseberry (Physalis peruviana) plant with leaf symptoms of a mild yellow mosaic typical of a viral disease revealed an infection with Potato virus X (PVX). The genome sequence of the PVX-Physalis isolate comprises 6435 nt and exhibits higher sequence similarity to members of the Eurasian group of PVX (~95 %) than to the American group (~77 %). Genome organization is similar to other PVX isolates with five open reading frames coding for proteins RdRp, TGBp1, TGBp2, TGBp3, and CP. 5' and 3' untranslated regions revealed all regulatory motifs typically found in PVX isolates. The PVX-Physalis genome is the only complete sequence available for a Potexvirus in Colombia and is a new addition to the restricted number of available sequences of PVX isolates infecting plant species different to potato.
-
Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina
2014-01-01
Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348
-
Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter
2012-01-01
Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672
-
Liu, Zhong-Yu; Li, Xiao-Feng; Jiang, Tao; Deng, Yong-Qiang; Zhao, Hui; Wang, Hong-Jiang; Ye, Qing; Zhu, Shun-Ya; Qiu, Yang; Zhou, Xi; Qin, E-De; Qin, Cheng-Feng
2013-06-01
cis-Acting elements in the viral genome RNA (vRNA) are essential for the translation, replication, and/or encapsidation of RNA viruses. In this study, a novel conserved cis-acting element was identified in the capsid-coding region of mosquito-borne flavivirus. The downstream of 5' cyclization sequence (5'CS) pseudoknot (DCS-PK) element has a three-stem pseudoknot structure, as demonstrated by structure prediction and biochemical analysis. Using dengue virus as a model, we show that DCS-PK enhances vRNA replication and that its function depends on its secondary structure and specific primary sequence. Mutagenesis revealed that the highly conserved stem 1 and loop 2, which are involved in potential loop-helix interactions, are crucial for DCS-PK function. A predicted loop 1-stem 3 base triple interaction is important for the structural stability and function of DCS-PK. Moreover, the function of DCS-PK depends on its position relative to the 5'CS, and the presence of DCS-PK facilitates the formation of 5'-3' RNA complexes. Taken together, our results reveal that the cis-acting element DCS-PK enhances vRNA replication by regulating genome cyclization, and DCS-PK might interplay with other cis-acting elements to form a functional vRNA cyclization domain, thus playing critical roles during the flavivirus life cycle and evolution.
-
Liu, Zhong-Yu; Li, Xiao-Feng; Jiang, Tao; Deng, Yong-Qiang; Zhao, Hui; Wang, Hong-Jiang; Ye, Qing; Zhu, Shun-Ya; Qiu, Yang; Zhou, Xi; Qin, E-De
2013-01-01
cis-Acting elements in the viral genome RNA (vRNA) are essential for the translation, replication, and/or encapsidation of RNA viruses. In this study, a novel conserved cis-acting element was identified in the capsid-coding region of mosquito-borne flavivirus. The downstream of 5′ cyclization sequence (5′CS) pseudoknot (DCS-PK) element has a three-stem pseudoknot structure, as demonstrated by structure prediction and biochemical analysis. Using dengue virus as a model, we show that DCS-PK enhances vRNA replication and that its function depends on its secondary structure and specific primary sequence. Mutagenesis revealed that the highly conserved stem 1 and loop 2, which are involved in potential loop-helix interactions, are crucial for DCS-PK function. A predicted loop 1-stem 3 base triple interaction is important for the structural stability and function of DCS-PK. Moreover, the function of DCS-PK depends on its position relative to the 5′CS, and the presence of DCS-PK facilitates the formation of 5′-3′ RNA complexes. Taken together, our results reveal that the cis-acting element DCS-PK enhances vRNA replication by regulating genome cyclization, and DCS-PK might interplay with other cis-acting elements to form a functional vRNA cyclization domain, thus playing critical roles during the flavivirus life cycle and evolution. PMID:23576500
-
Exploring viral infection using single-cell sequencing.
Rato, Sylvie; Golumbeanu, Monica; Telenti, Amalio; Ciuffi, Angela
2017-07-15
Single-cell sequencing (SCS) has emerged as a valuable tool to study cellular heterogeneity in diverse fields, including virology. By studying the viral and cellular genome and/or transcriptome, the dynamics of viral infection can be investigated at single cell level. Most studies have explored the impact of cell-to-cell variation on the viral life cycle from the point of view of the virus, by analyzing viral sequences, and from the point of view of the cell, mainly by analyzing the cellular host transcriptome. In this review, we will focus on recent studies that use single-cell sequencing to explore viral diversity and cell variability in response to viral replication. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
-
CRISPR/Cas9 Inhibits Multiple Steps of HIV-1 Infection.
Yin, Lijuan; Hu, Siqi; Mei, Shan; Sun, Hong; Xu, Fengwen; Li, Jian; Zhu, Weijun; Liu, Xiaoman; Zhao, Fei; Zhang, Di; Cen, Shan; Liang, Chen; Guo, Fei
2018-05-09
CRISPR/Cas9 is an adaptive immune system where bacteria and archaea have evolved to resist the invading viruses and plasmid DNA by creating site-specific double-strand breaks in DNA. This study tested this gene editing system in inhibiting human immunodeficiency virus type 1 (HIV-1) infection by targeting the viral long terminal repeat and the gene coding sequences. Strong inhibition of HIV-1 infection by Cas9/gRNA was observed, which resulted not only from insertions and deletions (indels) that were introduced into viral DNA due to Cas9 cleavage, but also from the marked decrease in the levels of the late viral DNA products and the integrated viral DNA. This latter defect might have reflected the degradation of viral DNA that has not been immediately repaired after Cas9 cleavage. It was further observed that Cas9, when solely located in the cytoplasm, inhibits HIV-1 as strongly as the nuclear Cas9, except that the cytoplasmic Cas9 does not act on the integrated HIV-1 DNA and thus cannot be used to excise the latent provirus. Together, the results suggest that Cas9/gRNA is able to target and edit HIV-1 DNA both in the cytoplasm and in the nucleus. The inhibitory effect of Cas9 on HIV-1 is attributed to both the indels in viral DNA and the reduction in the levels of viral DNA.
-
Brüwer, Jan D.
2018-01-01
Current research posits that all multicellular organisms live in symbioses with associated microorganisms and form so-called metaorganisms or holobionts. Cnidarian metaorganisms are of specific interest given that stony corals provide the foundation of the globally threatened coral reef ecosystems. To gain first insight into viruses associated with the coral model system Aiptasia (sensu Exaiptasia pallida), we analyzed an existing RNA-Seq dataset of aposymbiotic, partially populated, and fully symbiotic Aiptasia CC7 anemones with Symbiodinium. Our approach included the selective removal of anemone host and algal endosymbiont sequences and subsequent microbial sequence annotation. Of a total of 297 million raw sequence reads, 8.6 million (∼3%) remained after host and endosymbiont sequence removal. Of these, 3,293 sequences could be assigned as of viral origin. Taxonomic annotation of these sequences suggests that Aiptasia is associated with a diverse viral community, comprising 116 viral taxa covering 40 families. The viral assemblage was dominated by viruses from the families Herpesviridae (12.00%), Partitiviridae (9.93%), and Picornaviridae (9.87%). Despite an overall stable viral assemblage, we found that some viral taxa exhibited significant changes in their relative abundance when Aiptasia engaged in a symbiotic relationship with Symbiodinium. Elucidation of viral taxa consistently present across all conditions revealed a core virome of 15 viral taxa from 11 viral families, encompassing many viruses previously reported as members of coral viromes. Despite the non-random selection of viral genetic material due to the nature of the sequencing data analyzed, our study provides a first insight into the viral community associated with Aiptasia. Similarities of the Aiptasia viral community with those of corals corroborate the application of Aiptasia as a model system to study coral holobionts. Further, the change in abundance of certain viral taxa across different symbiotic states suggests a role of viruses in the algal endosymbiosis, but the functional significance of this remains to be determined. PMID:29507840
-
Rattay, Stephanie; Trilling, Mirko; Megger, Dominik A; Sitek, Barbara; Meyer, Helmut E; Hengel, Hartmut; Le-Trilling, Vu Thuy Khanh
2015-08-01
Transcription of mouse cytomegalovirus (MCMV) immediate early ie1 and ie3 is controlled by the major immediate early promoter/enhancer (MIEP) and requires differential splicing. Based on complete loss of genome replication of an MCMV mutant carrying a deletion of the ie3-specific exon 5, the multifunctional IE3 protein (611 amino acids; pIE611) is considered essential for viral replication. Our analysis of ie3 transcription resulted in the identification of novel ie3 isoforms derived from alternatively spliced ie3 transcripts. Construction of an IE3-hemagglutinin (IE3-HA) virus by insertion of an in-frame HA epitope sequence allowed detection of the IE3 isoforms in infected cells, verifying that the newly identified transcripts code for proteins. This prompted the construction of an MCMV mutant lacking ie611 but retaining the coding capacity for the newly identified isoforms ie453 and ie310. Using Δie611 MCMV, we demonstrated the dispensability of the canonical ie3 gene product pIE611 for viral replication. To determine the role of pIE611 for viral gene expression during MCMV infection in an unbiased global approach, we used label-free quantitative mass spectrometry to delineate pIE611-dependent changes of the MCMV proteome. Interestingly, further analysis revealed transcriptional as well as posttranscriptional regulation of MCMV gene products by pIE611. Cytomegaloviruses are pathogenic betaherpesviruses persisting in a lifelong latency from which reactivation can occur under conditions of immunosuppression, immunoimmaturity, or inflammation. The switch from latency to reactivation requires expression of immediate early genes. Therefore, understanding of immediate early gene regulation might add insights into viral pathogenesis. The mouse cytomegalovirus (MCMV) immediate early 3 protein (611 amino acids; pIE611) is considered essential for viral replication. The identification of novel protein isoforms derived from alternatively spliced ie3 transcripts prompted the construction of an MCMV mutant lacking ie611 but retaining the coding capacity for the newly identified isoforms ie453 and ie310. Using Δie611 MCMV, we demonstrated the dispensability of the canonical ie3 gene product pIE611 for viral replication and delineated pIE611-dependent changes of the MCMV proteome. Our findings have fundamental implications for the interpretation of earlier studies on pIE3 functions and highlight the complex orchestration of MCMV gene regulation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Laboratory procedures to generate viral metagenomes.
Thurber, Rebecca V; Haynes, Matthew; Breitbart, Mya; Wegley, Linda; Rohwer, Forest
2009-01-01
This collection of laboratory protocols describes the steps to collect viruses from various samples with the specific aim of generating viral metagenome sequence libraries (viromes). Viral metagenomics, the study of uncultured viral nucleic acid sequences from different biomes, relies on several concentration, purification, extraction, sequencing and heuristic bioinformatic methods. No single technique can provide an all-inclusive approach, and therefore the protocols presented here will be discussed in terms of hypothetical projects. However, care must be taken to individualize each step depending on the source and type of viral-particles. This protocol is a description of the processes we have successfully used to: (i) concentrate viral particles from various types of samples, (ii) eliminate contaminating cells and free nucleic acids and (iii) extract, amplify and purify viral nucleic acids. Overall, a sample can be processed to isolate viral nucleic acids suitable for high-throughput sequencing in approximately 1 week.
-
IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses
Paez-Espino, David; Chen, I. -Min A.; Palaniappan, Krishna; ...
2016-10-30
Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from > 6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs aremore » grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparingwith external sequences, thus serving as an essential resource in the viral genomics community.« less
-
IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paez-Espino, David; Chen, I. -Min A.; Palaniappan, Krishna
Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from > 6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs aremore » grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparingwith external sequences, thus serving as an essential resource in the viral genomics community.« less
-
Venuti, A; Di Russo, C; del Grosso, N; Patti, A M; Ruggeri, F; De Stasio, P R; Martiniello, M G; Pagnotti, P; Degener, A M; Midulla, M
1985-01-01
A fast-growing strain of human hepatitis A virus was selected and characterized. The virus has the unusual property of developing a strong cytopathic effect in tissue culture in 7 to 10 days. Sequences of the viral genome were cloned into recombinant plasmids with the double-stranded replicative form as a template for the reverse transcription of cDNA. Restriction analysis and direct sequencing indicate that this strain is different from that described by Ticehurst et al. (Proc. Natl. Acad. Sci. USA 80:5885-5889, 1983) in the region that presumptively codes for the major capsid protein VP1, but both isolates have conserved large areas of homology in the untranslated 5'-terminal sequences of the genome. Images PMID:2997478
-
Khrustalev, Vladislav Victorovich
2009-01-01
Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).
-
Helper-Dependent Adenoviral Vectors.
Rosewell, Amanda; Vetrini, Francesco; Ng, Philip
2011-10-29
Helper-dependent adenoviral vectors are devoid of all viral coding sequences, possess a large cloning capacity, and can efficiently transduce a wide variety of cell types from various species independent of the cell cycle to mediate long-term transgene expression without chronic toxicity. These non-integrating vectors hold tremendous potential for a variety of gene transfer and gene therapy applications. Here, we review the production technologies, applications, obstacles to clinical translation and their potential resolutions, and the future challenges and unanswered questions regarding this promising gene transfer technology.
-
Helper-Dependent Adenoviral Vectors
Rosewell, Amanda; Vetrini, Francesco; Ng, Philip
2012-01-01
Helper-dependent adenoviral vectors are devoid of all viral coding sequences, possess a large cloning capacity, and can efficiently transduce a wide variety of cell types from various species independent of the cell cycle to mediate long-term transgene expression without chronic toxicity. These non-integrating vectors hold tremendous potential for a variety of gene transfer and gene therapy applications. Here, we review the production technologies, applications, obstacles to clinical translation and their potential resolutions, and the future challenges and unanswered questions regarding this promising gene transfer technology. PMID:24533227
-
Recoding method that removes inhibitory sequences and improves HIV gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rabadan, Raul; Krasnitz, Michael; Robins, Harlan
The invention relates to inhibitory nucleotide signal sequences or "INS" sequences in the genomes of lentiviruses. In particular the invention relates to the AGG motif present in all viral genomes. The AGG motif may have an inhibitory effect on a virus, for example by reducing the levels of, or maintaining low steady-state levels of, viral RNAs in host cells, and inducing and/or maintaining in viral latency. In one aspect, the invention provides vaccines that contain, or are produced from, viral nucleic acids in which the AGG sequences have been mutated. In another aspect, the invention provides methods and compositions formore » affecting the function of the AGG motif, and methods for identifying other INS sequences in viral genomes.« less
-
Study of RNA-A Initiation Translation of The Infectious Pancreatic Necrosis Virus.
Rivas-Aravena, Andrea; Muñoz, Patricio; Jorquera, Patricia; Diaz, Alvaro; Reinoso, Claudia; González-Catrilelbún, Sebastián; Sandino, Ana María
2017-08-15
The infectious pancreatic necrosis virus (IPNV) is a salmonid pathogen that causes significant economic losses to the aquaculture industry. IPNV is a non-enveloped virus containing two uncapped and non-polyadenylated double strand RNA genomic segments, RNA-A and RNA-B. The viral protein Vpg is covalently attached to the 5' end of both segments. There is little knowledge about its viral cycle, particularly about the translation of the RNAs. Through experiments using mono and bicistronic reporters, in this work we show that the 120-nucleotide-long 5'-UTR of RNA-A contains an internal ribosome entry site (IRES) that functions efficiently both in vitro and in salmon cells. IRES activity is strongly dependent on temperature. Also, the IRES structure is confined to the 5'UTR and is not affected by the viral coding sequence. This is the first report of IRES activity in a fish virus and can give us tools to generate antivirals to attack the virus without affecting fish directly. Copyright © 2017. Published by Elsevier B.V.
-
2018-01-01
ABSTRACT Herpes simplex virus 1 (HSV-1) establishes latent infection in neurons via a variety of epigenetic mechanisms that silence its genome. The cellular CCCTC-binding factor (CTCF) functions as a mediator of transcriptional control and chromatin organization and has binding sites in the HSV-1 genome. We constructed an HSV-1 deletion mutant that lacked a pair of CTCF-binding sites (CTRL2) within the latency-associated transcript (LAT) coding sequences and found that loss of these CTCF-binding sites did not alter lytic replication or levels of establishment of latent infection, but their deletion reduced the ability of the virus to reactivate from latent infection. We also observed increased heterochromatin modifications on viral chromatin over the LAT promoter and intron. We therefore propose that CTCF binding at the CTRL2 sites acts as a chromatin insulator to keep viral chromatin in a form that is poised for reactivation, a state which we call poised latency. PMID:29437926
-
ZFP36 RNA-binding proteins restrain T-cell activation and anti-viral immunity.
Moore, Michael J; Blachere, Nathalie E; Fak, John J; Park, Christopher Y; Sawicka, Kirsty; Parveen, Salina; Zucker-Scharff, Ilana; Moltedo, Bruno; Rudensky, Alexander Y; Darnell, Robert B
2018-05-31
Dynamic post-transcriptional control of RNA expression by RNA-binding proteins (RBPs) is critical during immune response. ZFP36 RBPs are prominent inflammatory regulators linked to autoimmunity and cancer, but functions in adaptive immunity are less clear. We used HITS-CLIP to define ZFP36 targets in mouse T cells, revealing unanticipated actions in regulating T cell activation, proliferation, and effector functions. Transcriptome and ribosome profiling showed that ZFP36 represses mRNA target abundance and translation, notably through novel AU-rich sites in coding sequence. Functional studies revealed that ZFP36 regulates early T cell activation kinetics cell autonomously, by attenuating activation marker expression, limiting T cell expansion, and promoting apoptosis. Strikingly, loss of ZFP36 in vivo accelerated T cell responses to acute viral infection and enhanced anti-viral immunity. These findings uncover a critical role for ZFP36 RBPs in restraining T cell expansion and effector functions, and suggest ZFP36 inhibition as a strategy to enhance immune-based therapies. © 2018, Moore et al.
-
Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando
2017-06-15
African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently available. Remarkably, ASFV is the only known mammalian virus that putatively codes for a histone-like protein (pA104R) that shares extensive sequence homology with bacterial histone-like proteins. In this study, we characterized the DNA-binding properties of pA104R, analyzed the functional importance of two conserved residues, and showed that pA104R and ASFV topoisomerase II cooperate and display DNA-supercoiling activity. Moreover, pA104R is expressed during the late phase of infection and accumulates in viral DNA replication sites, and its downregulation revealed that pA104R is required for viral DNA replication and transcription. These results suggest that pA104R participates in the modulation of viral DNA topology and genome packaging, indicating that A104R deletion mutants may be a good strategy for vaccine development against ASFV. Copyright © 2017 American Society for Microbiology.
-
King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach
2014-01-01
Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.
-
Replication of poliovirus RNA and subgenomic RNA transcripts in transfected cells.
Collis, P S; O'Donnell, B J; Barton, D J; Rogers, J A; Flanegan, J B
1992-01-01
Full-length and subgenomic poliovirus RNAs were transcribed in vitro and transfected into HeLa cells to study viral RNA replication in vivo. RNAs with deletion mutations were analyzed for the ability to replicate in either the absence or the presence of helper RNA by using a cotransfection procedure and Northern (RNA) blot analysis. An advantage of this approach was that viral RNA replication and genetic complementation could be characterized without first isolating conditional-lethal mutants. A subgenomic RNA with a large in-frame deletion in the capsid coding region (P1) replicated more efficiently than full-length viral RNA transcripts. In cotransfection experiments, both the full-length and subgenomic RNAs replicated at slightly reduced levels and appeared to interfere with each other's replication. In contrast, a subgenomic RNA with a similarly sized out-of-frame deletion in P1 did not replicate in transfected cells, either alone or in the presence of helper RNA. Similar results were observed with an RNA transcript containing a large in-frame deletion spanning the P1, P2, and P3 coding regions. A mutant RNA with an in-frame deletion in the P1-2A coding sequence was self-replicating but at a significantly reduced level. The replication of this RNA was fully complemented after cotransfection with a helper RNA that provided 2A in trans. A P1-2A-2B in-frame deletion, however, totally blocked RNA replication and was not complemented. Control experiments showed that all of the expected viral proteins were both synthesized and processed when the RNA transcripts were translated in vitro. Thus, our results indicated that 2A was a trans-acting protein and that 2B and perhaps other viral proteins were cis acting during poliovirus RNA replication in vivo. Our data support a model for poliovirus RNA replication which directly links the translation of a molecule of plus-strand RNA with the formation of a replication complex for minus-strand RNA synthesis. Images PMID:1328676
-
Continuous Influx of Genetic Material from Host to Virus Populations
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane
2016-01-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124
-
Continuous Influx of Genetic Material from Host to Virus Populations.
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A
2016-02-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.
-
IMG/VR: a database of cultured and uncultured DNA Viruses and retroviruses.
Paez-Espino, David; Chen, I-Min A; Palaniappan, Krishna; Ratner, Anna; Chu, Ken; Szeto, Ernest; Pillay, Manoj; Huang, Jinghua; Markowitz, Victor M; Nielsen, Torben; Huntemann, Marcel; K Reddy, T B; Pavlopoulos, Georgios A; Sullivan, Matthew B; Campbell, Barbara J; Chen, Feng; McMahon, Katherine; Hallam, Steve J; Denef, Vincent; Cavicchioli, Ricardo; Caffrey, Sean M; Streit, Wolfgang R; Webster, John; Handley, Kim M; Salekdeh, Ghasem H; Tsesmetzis, Nicolas; Setubal, Joao C; Pope, Phillip B; Liu, Wen-Tso; Rivers, Adam R; Ivanova, Natalia N; Kyrpides, Nikos C
2017-01-04
Viruses represent the most abundant life forms on the planet. Recent experimental and computational improvements have led to a dramatic increase in the number of viral genome sequences identified primarily from metagenomic samples. As a result of the expanding catalog of metagenomic viral sequences, there exists a need for a comprehensive computational platform integrating all these sequences with associated metadata and analytical tools. Here we present IMG/VR (https://img.jgi.doe.gov/vr/), the largest publicly available database of 3908 isolate reference DNA viruses with 264 413 computationally identified viral contigs from >6000 ecologically diverse metagenomic samples. Approximately half of the viral contigs are grouped into genetically distinct quasi-species clusters. Microbial hosts are predicted for 20 000 viral sequences, revealing nine microbial phyla previously unreported to be infected by viruses. Viral sequences can be queried using a variety of associated metadata, including habitat type and geographic location of the samples, or taxonomic classification according to hallmark viral genes. IMG/VR has a user-friendly interface that allows users to interrogate all integrated data and interact by comparing with external sequences, thus serving as an essential resource in the viral genomics community. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
viGEN: An Open Source Pipeline for the Detection and Quantification of Viral RNA in Human Tumors.
Bhuvaneshwar, Krithika; Song, Lei; Madhavan, Subha; Gusev, Yuriy
2018-01-01
An estimated 17% of cancers worldwide are associated with infectious causes. The extent and biological significance of viral presence/infection in actual tumor samples is generally unknown but could be measured using human transcriptome (RNA-seq) data from tumor samples. We present an open source bioinformatics pipeline viGEN, which allows for not only the detection and quantification of viral RNA, but also variants in the viral transcripts. The pipeline includes 4 major modules: The first module aligns and filter out human RNA sequences; the second module maps and count (remaining un-aligned) reads against reference genomes of all known and sequenced human viruses; the third module quantifies read counts at the individual viral-gene level thus allowing for downstream differential expression analysis of viral genes between case and controls groups. The fourth module calls variants in these viruses. To the best of our knowledge, there are no publicly available pipelines or packages that would provide this type of complete analysis in one open source package. In this paper, we applied the viGEN pipeline to two case studies. We first demonstrate the working of our pipeline on a large public dataset, the TCGA cervical cancer cohort. In the second case study, we performed an in-depth analysis on a small focused study of TCGA liver cancer patients. In the latter cohort, we performed viral-gene quantification, viral-variant extraction and survival analysis. This allowed us to find differentially expressed viral-transcripts and viral-variants between the groups of patients, and connect them to clinical outcome. From our analyses, we show that we were able to successfully detect the human papilloma virus among the TCGA cervical cancer patients. We compared the viGEN pipeline with two metagenomics tools and demonstrate similar sensitivity/specificity. We were also able to quantify viral-transcripts and extract viral-variants using the liver cancer dataset. The results presented corresponded with published literature in terms of rate of detection, and impact of several known variants of HBV genome. This pipeline is generalizable, and can be used to provide novel biological insights into microbial infections in complex diseases and tumorigeneses. Our viral pipeline could be used in conjunction with additional type of immuno-oncology analysis based on RNA-seq data of host RNA for cancer immunology applications. The source code, with example data and tutorial is available at: https://github.com/ICBI/viGEN/.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bouzar, Baya Amel; Rea, Angela; Hoc-Villet, Stephanie
Caprine arthritis encephalitis virus (CAEV) is the natural lentivirus of goats, well known for its tropism for macrophages and its inability to cause infection in lymphocytes. The viral genome lacks nef, tat, vpu and vpx coding sequences. To test the hypothesis that when nef is expressed by the viral genome, the virus became toxic for lymphocytes during replication in macrophages, we inserted the SIVsmm PBj14 nef coding sequences into the genome of CAEV thereby generating CAEV-nef. This recombinant virus is not infectious for lymphocytes but is fully replication competent in goat macrophages in which it constitutively expresses the SIV Nef.more » We found that goat lymphocytes cocultured with CAEV-nef-infected macrophages became activated, showing increased expression of the interleukin-2 receptor (IL-2R). Activation correlated with increased proliferation of the cells. Interestingly, a dual effect in terms of apoptosis regulation was observed in exposed goat lymphocytes. Nef was found first to induce a protection of lymphocytes from apoptosis during the first few days following exposure to infected macrophages, but later it induced increased apoptosis in the activated lymphocytes. This new recombinant virus provides a model to study the functions of Nef in the context of infection of macrophages, but in absence of infection of T lymphocytes and brings new insights into the biological effects of Nef on lymphocytes.« less
-
The web server of IBM's Bioinformatics and Pattern Discovery group.
Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo
2003-07-01
We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.
-
The web server of IBM's Bioinformatics and Pattern Discovery group
Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo
2003-01-01
We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:12824385
-
Discovery of DNA viruses in wild-caught mosquitoes using small RNA high throughput sequencing.
Ma, Maijuan; Huang, Yong; Gong, Zhengda; Zhuang, Lu; Li, Cun; Yang, Hong; Tong, Yigang; Liu, Wei; Cao, Wuchun
2011-01-01
Mosquito-borne infectious diseases pose a severe threat to public health in many areas of the world. Current methods for pathogen detection and surveillance are usually dependent on prior knowledge of the etiologic agents involved. Hence, efficient approaches are required for screening wild mosquito populations to detect known and unknown pathogens. In this study, we explored the use of Next Generation Sequencing to identify viral agents in wild-caught mosquitoes. We extracted total RNA from different mosquito species from South China. Small 18-30 bp length RNA molecules were purified, reverse-transcribed into cDNA and sequenced using Illumina GAIIx instrumentation. Bioinformatic analyses to identify putative viral agents were conducted and the results confirmed by PCR. We identified a non-enveloped single-stranded DNA densovirus in the wild-caught Culex pipiens molestus mosquitoes. The majority of the viral transcripts (.>80% of the region) were covered by the small viral RNAs, with a few peaks of very high coverage obtained. The +/- strand sequence ratio of the small RNAs was approximately 7∶1, indicating that the molecules were mainly derived from the viral RNA transcripts. The small viral RNAs overlapped, enabling contig assembly of the viral genome sequence. We identified some small RNAs in the reverse repeat regions of the viral 5'- and 3' -untranslated regions where no transcripts were expected. Our results demonstrate for the first time that high throughput sequencing of small RNA is feasible for identifying viral agents in wild-caught mosquitoes. Our results show that it is possible to detect DNA viruses by sequencing the small RNAs obtained from insects, although the underlying mechanism of small viral RNA biogenesis is unclear. Our data and those of other researchers show that high throughput small RNA sequencing can be used for pathogen surveillance in wild mosquito vectors.
-
Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G
1998-01-01
With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.
-
The oncogenic potential of BK-polyomavirus is linked to viral integration into the human genome.
Kenan, Daniel J; Mieczkowski, Piotr A; Burger-Calderon, Raquel; Singh, Harsharan K; Nickeleit, Volker
2015-11-01
It has been suggested that BK-polyomavirus is linked to oncogenesis via high expression levels of large T-antigen in some urothelial neoplasms arising following kidney transplantation. However, a causal association between BK-polyomavirus, large T-antigen expression and oncogenesis has never been demonstrated in humans. Here we describe an investigation using high-throughput sequencing of tumour DNA obtained from an urothelial carcinoma arising in a renal allograft. We show that a novel BK-polyomavirus strain, named CH-1, is integrated into exon 26 of the myosin-binding protein C1 gene (MYBPC1) on chromosome 12 in tumour cells but not in normal renal cells. Integration of the BK-polyomavirus results in a number of discrete alterations in viral gene expression, including: (a) disruption of VP1 protein expression and robust expression of large T-antigen; (b) preclusion of viral replication; and (c) deletions in the non-coding control region (NCCR), with presumed alterations in promoter feedback loops. Viral integration disrupts one MYBPC1 gene copy and likely alters its expression. Circular episomal BK-polyomavirus gene sequences are not found, and the renal allograft shows no productive polyomavirus infection or polyomavirus nephropathy. These findings support the hypothesis that integration of polyomaviruses is essential to tumourigenesis. It is likely that dysregulation of large T-antigen, with persistent over-expression in non-lytic cells, promotes cell growth, genetic instability and neoplastic transformation. © 2015 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.
-
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
-
Goldsmith, Dawn B.; Parsons, Rachel J.; Beyene, Damitu; Salamon, Peter
2015-01-01
Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS) site in the summer (September) and winter (March) of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity) were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years. PMID:26157645
-
Vaccination against a Virus-Encoded Cytokine Significantly Restricts Viral Challenge
Eberhardt, Meghan K.; Deshpande, Ashlesha; Chang, W. L. William; Barthold, Stephen W.
2013-01-01
Identification of immune correlates of protection for viral vaccines is complicated by multiple factors, but there is general consensus on the importance of antibodies that neutralize viral attachment to susceptible cells. Development of new viral vaccines has mostly followed this neutralizing antibody paradigm, but as a recent clinical trial of human cytomegalovirus (HCMV) vaccination demonstrated, this singular approach can yield limited protective efficacy. Since HCMV devotes >50% of its coding capacity to proteins that modulate host immunity, it is hypothesized that expansion of vaccine targets to include this part of the viral proteome will disrupt viral natural history. HCMV and rhesus cytomegalovirus (RhCMV) each encode an ortholog to the cellular interleukin-10 (cIL-10) cytokine: cmvIL-10 and rhcmvIL10, respectively. Despite extensive sequence divergence from their host's cIL-10, each viral IL-10 retains nearly identical functionality to cIL-10. Uninfected rhesus macaques were immunized with engineered, nonfunctional rhcmvIL-10 variants, which were constructed by site-directed mutagenesis to abolish binding to the cIL-10 receptor. Vaccinees developed antibodies that neutralized rhcmvIL-10 function with no cross-neutralization of cIL-10. Following subcutaneous RhCMV challenge, the vaccinees exhibited both reduced RhCMV replication locally at the inoculation site and systemically and significantly reduced RhCMV shedding in bodily fluids compared to controls. Attenuation of RhCMV infection by rhcmvIL-10 vaccination argues that neutralization of viral immunomodulation may be a new vaccine paradigm for HCMV by expanding potential vaccine targets. PMID:23946461
-
Gallei, Andreas; Rümenapf, Till; Thiel, Heinz-Jürgen; Becher, Paul
2005-01-01
Molecular analyses revealed that most cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In contrast to bovine viral diarrhea virus (BVDV), cp classical swine fever virus (CSFV) field isolates were rarely detected and always represented helper virus-dependent subgenomes. To investigate RNA recombination in more detail, we recently established an in vivo system allowing the efficient generation of recombinant cp BVDV strains in cell culture after transfecting a synthetic subgenomic and nonreplicatable transcript into cells being infected with noncp BVDV (A. Gallei, A. Pankraz, H.-J. Thiel, and P. Becher, J. Virol. 78:6271-6281, 2004). Using an analogous approach, the first helper virus-independent cp CSFV strain (CP G1) has now been generated by RNA recombination. Accordingly, this study demonstrates the applicability of RNA recombination for designing new viral RNA genomes. The genomic RNA of CP G1 has a calculated size of 18.139 kb, almost 6 kb larger than all previously described CSFV genomes. It contains cellular sequences encoding a polyubiquitin fragment directly upstream of the nonstructural protein NS3 coding gene together with a duplication of viral sequences. CP G1 induces a cytopathic effect on different tissue culture cell lines from pigs and cattle. Subsequent analyses addressed growth kinetics, expression of NS3, and genetic stability of CP G1. PMID:15681445
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siegel, A.
Previous work had demonstrated the presence of a unique low-molecular-weight RNA component (LMC) in extracts of tobacco mosaic virus (TMV) infected tissue. Enough of this component has been isolated during the past year to ascertain that it has a molecular weight of 250,000 daltons and that it acts as an in vitro messenger for the synthesis of TMV capsid protein. Thus, we conclude that at least one monocistronic messenger RNA for a virion coded product is generated during TMV infection. Strains of TMV were classified according to nucleotide sequence homology of their RNAs. The strains fall into groups by themore » test employed. No differences were observed between strains within a group, whereas no homology was detected between groups. Using this information, it was possible, in part, to relate differences in capsid protein amino acid sequences to the degree of nomology of their nucleotide coding sequences. A study was initiated into the Pot Y virus group infection mechanism. In contrast to TMV infection, it was determined that for both tobacco etch and potato virus Y that: viral RNA synthesis is inhibited by actinomycin B and synthesis by virus-related proteins is inhibited by chloramphenicol.« less
-
Zhu, Yuan O; Aw, Pauline P K; de Sessions, Paola Florez; Hong, Shuzhen; See, Lee Xian; Hong, Lewis Z; Wilm, Andreas; Li, Chen Hao; Hue, Stephane; Lim, Seng Gee; Nagarajan, Niranjan; Burkholder, William F; Hibberd, Martin
2017-10-27
Viral populations are complex, dynamic, and fast evolving. The evolution of groups of closely related viruses in a competitive environment is termed quasispecies. To fully understand the role that quasispecies play in viral evolution, characterizing the trajectories of viral genotypes in an evolving population is the key. In particular, long-range haplotype information for thousands of individual viruses is critical; yet generating this information is non-trivial. Popular deep sequencing methods generate relatively short reads that do not preserve linkage information, while third generation sequencing methods have higher error rates that make detection of low frequency mutations a bioinformatics challenge. Here we applied BAsE-Seq, an Illumina-based single-virion sequencing technology, to eight samples from four chronic hepatitis B (CHB) patients - once before antiviral treatment and once after viral rebound due to resistance. With single-virion sequencing, we obtained 248-8796 single-virion sequences per sample, which allowed us to find evidence for both hard and soft selective sweeps. We were able to reconstruct population demographic history that was independently verified by clinically collected data. We further verified four of the samples independently through PacBio SMRT and Illumina Pooled deep sequencing. Overall, we showed that single-virion sequencing yields insight into viral evolution and population dynamics in an efficient and high throughput manner. We believe that single-virion sequencing is widely applicable to the study of viral evolution in the context of drug resistance and host adaptation, allows differentiation between soft or hard selective sweeps, and may be useful in the reconstruction of intra-host viral population demographic history.
-
Dill, Veronika; Hoffmann, Bernd; Zimmer, Aline; Beer, Martin; Eschbaumer, Michael
2018-03-16
Suspension culture of BHK cells allows large-scale virus propagation and cost-efficient vaccine production, while the shift to animal-component-free cell culture media without serum is beneficial for the quality and downstream processing of the product. Foot-and-mouth disease virus is still endemic in many parts of the world and high-quality vaccines are essential for the eradication of this highly contagious and economically devastating disease. Changes to the viral genome sequence during passaging in an adherent and a suspension cell culture system were compared and the impact of amino acid substitutions on receptor tropism, antigenicity and particle stability was examined. Virus production in suspension cells in animal-component-free media and in serum-containing media as well as in adherent cells in serum-containing media was compared. Infection kinetics were determined and the yield of intact viral particles was estimated in all systems using sucrose density gradient centrifugation. Capsid protein sequence alterations were serotype-specific, but varied between cell lines. But The A 24 -2P virus variant had expanded its receptor tropism, but virus neutralization tests found no changes in the antigenic profile in comparison to the original viruses. There were no differences in viral titer between a suspension and an adherent cell culture system, independent of the type of media used. Also, the usage of a serum-free suspension culture system promoted viral growth and allowed an earlier harvest. For serotype O isolates, no differences were seen in the yield of 146S particles. Serotype A preparations revealed a decreased yield of 146S particles in suspension cells independent of the culture media. The selective pressure of the available surface receptors in different cell culture systems may be responsible for alterations in the capsid coding sequence of culture-grown virus. Important vaccine potency characteristics such as viral titer and the neutralization profile were unaffected, but the 146S particle yield differed for one of the tested serotypes.
-
The agents of natural genome editing.
Witzany, Guenther
2011-06-01
The DNA serves as a stable information storage medium and every protein which is needed by the cell is produced from this blueprint via an RNA intermediate code. More recently it was found that an abundance of various RNA elements cooperate in a variety of steps and substeps as regulatory and catalytic units with multiple competencies to act on RNA transcripts. Natural genome editing on one side is the competent agent-driven generation and integration of meaningful DNA nucleotide sequences into pre-existing genomic content arrangements, and the ability to (re-)combine and (re-)regulate them according to context-dependent (i.e. adaptational) purposes of the host organism. Natural genome editing on the other side designates the integration of all RNA activities acting on RNA transcripts without altering DNA-encoded genes. If we take the genetic code seriously as a natural code, there must be agents that are competent to act on this code because no natural code codes itself as no natural language speaks itself. As code editing agents, viral and subviral agents have been suggested because there are several indicators that demonstrate viruses competent in both RNA and DNA natural genome editing.
-
Brody, Thomas; Yavatkar, Amarendra S; Park, Dong Sun; Kuzin, Alexander; Ross, Jermaine; Odenwald, Ward F
2017-06-01
Flavivirus and Filovirus infections are serious epidemic threats to human populations. Multi-genome comparative analysis of these evolving pathogens affords a view of their essential, conserved sequence elements as well as progressive evolutionary changes. While phylogenetic analysis has yielded important insights, the growing number of available genomic sequences makes comparisons between hundreds of viral strains challenging. We report here a new approach for the comparative analysis of these hemorrhagic fever viruses that can superimpose an unlimited number of one-on-one alignments to identify important features within genomes of interest. We have adapted EvoPrinter alignment algorithms for the rapid comparative analysis of Flavivirus or Filovirus sequences including Zika and Ebola strains. The user can input a full genome or partial viral sequence and then view either individual comparisons or generate color-coded readouts that superimpose hundreds of one-on-one alignments to identify unique or shared identity SNPs that reveal ancestral relationships between strains. The user can also opt to select a database genome in order to access a library of pre-aligned genomes of either 1,094 Flaviviruses or 460 Filoviruses for rapid comparative analysis with all database entries or a select subset. Using EvoPrinter search and alignment programs, we show the following: 1) superimposing alignment data from many related strains identifies lineage identity SNPs, which enable the assessment of sublineage complexity within viral outbreaks; 2) whole-genome SNP profile screens uncover novel Dengue2 and Zika recombinant strains and their parental lineages; 3) differential SNP profiling identifies host cell A-to-I hyper-editing within Ebola and Marburg viruses, and 4) hundreds of superimposed one-on-one Ebola genome alignments highlight ultra-conserved regulatory sequences, invariant amino acid codons and evolutionarily variable protein-encoding domains within a single genome. EvoPrinter allows for the assessment of lineage complexity within Flavivirus or Filovirus outbreaks, identification of recombinant strains, highlights sequences that have undergone host cell A-to-I editing, and identifies unique input and database SNPs within highly conserved sequences. EvoPrinter's ability to superimpose alignment data from hundreds of strains onto a single genome has allowed us to identify unique Zika virus sublineages that are currently spreading in South, Central and North America, the Caribbean, and in China. This new set of integrated alignment programs should serve as a useful addition to existing tools for the comparative analysis of these viruses.
-
NASA Astrophysics Data System (ADS)
Shekhar, Karthik; Ruberman, Claire F.; Ferguson, Andrew L.; Barton, John P.; Kardar, Mehran; Chakraborty, Arup K.
2013-12-01
Mutational escape from vaccine-induced immune responses has thwarted the development of a successful vaccine against AIDS, whose causative agent is HIV, a highly mutable virus. Knowing the virus' fitness as a function of its proteomic sequence can enable rational design of potent vaccines, as this information can focus vaccine-induced immune responses to target mutational vulnerabilities of the virus. Spin models have been proposed as a means to infer intrinsic fitness landscapes of HIV proteins from patient-derived viral protein sequences. These sequences are the product of nonequilibrium viral evolution driven by patient-specific immune responses and are subject to phylogenetic constraints. How can such sequence data allow inference of intrinsic fitness landscapes? We combined computer simulations and variational theory á la Feynman to show that, in most circumstances, spin models inferred from patient-derived viral sequences reflect the correct rank order of the fitness of mutant viral strains. Our findings are relevant for diverse viruses.
-
Hanke, Dennis; Pohlmann, Anne; Sauter-Louis, Carola; Höper, Dirk; Stadler, Julia; Ritzmann, Mathias; Steinrigl, Adi; Schwarz, Bernd-Andreas; Akimkin, Valerij; Fux, Robert; Blome, Sandra; Beer, Martin
2017-07-06
Porcine epidemic diarrhea (PED) is an acute and highly contagious enteric disease of swine caused by the eponymous virus (PEDV) which belongs to the genus Alphacoronavirus within the Coronaviridae virus family. Following the disastrous outbreaks in Asia and the United States, PEDV has been detected also in Europe. In order to better understand the overall situation, the molecular epidemiology, and factors that might influence the most variable disease impact; 40 samples from swine feces were collected from different PED outbreaks in Germany and other European countries and sequenced by shot-gun next-generation sequencing. A total of 38 new PEDV complete coding sequences were generated. When compared on a global scale, all investigated sequences from Central and South-Eastern Europe formed a rather homogeneous PEDV S INDEL cluster, suggesting a recent re-introduction. However, in-detail analyses revealed two new clusters and putative ancestor strains. Based on the available background data, correlations between clusters and location, farm type or clinical presentation could not be established. Additionally, the impact of secondary infections was explored using the metagenomic data sets. While several coinfections were observed, no correlation was found with disease courses. However, in addition to the PEDV genomes, ten complete viral coding sequences from nine different data sets were reconstructed each representing new virus strains. In detail, three pasivirus A strains, two astroviruses, a porcine sapelovirus, a kobuvirus, a porcine torovirus, a posavirus, and an enterobacteria phage were almost fully sequenced.
-
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
-
Zhang, Qian; Jun, Se -Ran; Leuze, Michael; ...
2017-01-19
The development of rapid, economical genome sequencing has shed new light on the classification of viruses. As of October 2016, the National Center for Biotechnology Information (NCBI) database contained >2 million viral genome sequences and a reference set of ~4000 viral genome sequences that cover a wide range of known viral families. Whole-genome sequences can be used to improve viral classification and provide insight into the viral tree of life . However, due to the lack of evolutionary conservation amongst diverse viruses, it is not feasible to build a viral tree of life using traditional phylogenetic methods based on conservedmore » proteins. In this study, we used an alignment-free method that uses k-mers as genomic features for a large-scale comparison of complete viral genomes available in RefSeq. To determine the optimal feature length, k (an essential step in constructing a meaningful dendrogram), we designed a comprehensive strategy that combines three approaches: (1) cumulative relative entropy, (2) average number of common features among genomes, and (3) the Shannon diversity index. This strategy was used to determine k for all 3,905 complete viral genomes in RefSeq. Lastly, the resulting dendrogram shows consistency with the viral taxonomy of the ICTV and the Baltimore classification of viruses.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Qian; Jun, Se -Ran; Leuze, Michael
The development of rapid, economical genome sequencing has shed new light on the classification of viruses. As of October 2016, the National Center for Biotechnology Information (NCBI) database contained >2 million viral genome sequences and a reference set of ~4000 viral genome sequences that cover a wide range of known viral families. Whole-genome sequences can be used to improve viral classification and provide insight into the viral tree of life . However, due to the lack of evolutionary conservation amongst diverse viruses, it is not feasible to build a viral tree of life using traditional phylogenetic methods based on conservedmore » proteins. In this study, we used an alignment-free method that uses k-mers as genomic features for a large-scale comparison of complete viral genomes available in RefSeq. To determine the optimal feature length, k (an essential step in constructing a meaningful dendrogram), we designed a comprehensive strategy that combines three approaches: (1) cumulative relative entropy, (2) average number of common features among genomes, and (3) the Shannon diversity index. This strategy was used to determine k for all 3,905 complete viral genomes in RefSeq. Lastly, the resulting dendrogram shows consistency with the viral taxonomy of the ICTV and the Baltimore classification of viruses.« less
-
Zhang, Qian; Jun, Se-Ran; Leuze, Michael; Ussery, David; Nookaew, Intawat
2017-01-01
The development of rapid, economical genome sequencing has shed new light on the classification of viruses. As of October 2016, the National Center for Biotechnology Information (NCBI) database contained >2 million viral genome sequences and a reference set of ~4000 viral genome sequences that cover a wide range of known viral families. Whole-genome sequences can be used to improve viral classification and provide insight into the viral “tree of life”. However, due to the lack of evolutionary conservation amongst diverse viruses, it is not feasible to build a viral tree of life using traditional phylogenetic methods based on conserved proteins. In this study, we used an alignment-free method that uses k-mers as genomic features for a large-scale comparison of complete viral genomes available in RefSeq. To determine the optimal feature length, k (an essential step in constructing a meaningful dendrogram), we designed a comprehensive strategy that combines three approaches: (1) cumulative relative entropy, (2) average number of common features among genomes, and (3) the Shannon diversity index. This strategy was used to determine k for all 3,905 complete viral genomes in RefSeq. The resulting dendrogram shows consistency with the viral taxonomy of the ICTV and the Baltimore classification of viruses. PMID:28102365
-
Lenzmeier, B A; Giebler, H A; Nyborg, J K
1998-02-01
Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.
-
Long-term excretion of vaccine-derived poliovirus by a healthy child.
Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D
2004-12-01
A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.
-
A multidimensional platform for the purification of non-coding RNA species
Chionh, Yok Hian; Ho, Chia-Hua; Pruksakorn, Dumnoensun; Ramesh Babu, I.; Ng, Chee Sheng; Hia, Fabian; McBee, Megan E.; Su, Dan; Pang, Yan Ling Joy; Gu, Chen; Dong, Hongping; Prestwich, Erin G.; Shi, Pei-Yong; Preiser, Peter Rainer; Alonso, Sylvie; Dedon, Peter C.
2013-01-01
A renewed interest in non-coding RNA (ncRNA) has led to the discovery of novel RNA species and post-transcriptional ribonucleoside modifications, and an emerging appreciation for the role of ncRNA in RNA epigenetics. Although much can be learned by amplification-based analysis of ncRNA sequence and quantity, there is a significant need for direct analysis of RNA, which has led to numerous methods for purification of specific ncRNA molecules. However, no single method allows purification of the full range of cellular ncRNA species. To this end, we developed a multidimensional chromatographic platform to resolve, isolate and quantify all canonical ncRNAs in a single sample of cells or tissue, as well as novel ncRNA species. The applicability of the platform is demonstrated in analyses of ncRNA from bacteria, human cells and plasmodium-infected reticulocytes, as well as a viral RNA genome. Among the many potential applications of this platform are a system-level analysis of the dozens of modified ribonucleosides in ncRNA, characterization of novel long ncRNA species, enhanced detection of rare transcript variants and analysis of viral genomes. PMID:23907385
-
Kumar, Rakesh; Mandal, B; Geetanjali, A S; Jain, R K; Jaiwal, P K
2010-08-01
Watermelon bud necrosis virus (WBNV), a member of the genus Tospovirus, family Bunyaviridae is an important viral pathogen in watermelon cultivation in India. The complete genome sequence properties of WBNV are not available. In the present study, the complete M RNA sequence and the genome organisation of a WBNV isolate infecting watermelon in Delhi (WBNV-wDel) were determined. The M RNA was 4,794 nucleotides (nt) long and potentially coded for a movement protein (NSm) of 34.22 kDa (307 amino acids) on the viral sense strand and a Gn/Gc glycoprotein precursor of 127.15 kDa (1,121 amino acids) on the complementary strand. The two open reading frames were separated by an intergenic region of 402 nt. The 5' and 3' untranslated regions were 55 and 47 nt long, respectively, containing complementary termini typical of tospoviruses. WBNV-wDel was most closely related (79.1% identity) to Groundnut bud necrosis virus, an important tospovirus that occurs in several crops in India, and was different (63.3-75.2% identity) from the other cucurbit-infecting tospoviruses known to occur in Taiwan and Japan. Sequence analysis of NSm and Gn/Gc revealed phylogenetic incongruence between WBNV-wDel and another isolate originating from central India (WBNV-Wm-Som isolate). The Wm-Som isolate showed evolutionary divergence from the wDel isolate in the Gn/Gc protein (74.6% identity) potentially due to recombination with the other tospoviruses that are known to occur in India. This is the first report of a comparison of complete sequences of M RNA of WBNV.
-
de Oliveira, Renata Carvalho; Padula, Paula J; Gomes, Raphael; Martinez, Valeria P; Bellomo, Carla; Bonvicino, Cibele R; Freire e Lima, Danúbia Inês; Bragagnolo, Camila; Caldas, Antônio C S; D'Andrea, Paulo S; de Lemos, Elba R S
2011-03-01
An ecological assessment of reservoir species was conducted in a rural area (Jaborá) in the mid-west of the state of Santa Catarina in southern Brazil, where hantavirus pulmonary syndrome is endemic, to evaluate the prevalence of hantavirus infection in wild rodents. Blood and tissue samples were collected from 507 rodents during seven field trips from March 2004 to April 2006. Some of the animals were karyotyped to confirm morphological identification. Phylogenetic reconstructions of rodent specimens, based on the mitochondrial DNA cytochrome b gene sequences, were also obtained. Hantavirus antibody was found in 22 (4.3%) of the 507 rodents: 5 Akodon montensis, 2 Akodon paranaensis, 14 Oligoryzomys nigripes, and 1 Sooretamys angouya. Viral RNAs detected in O. nigripes and A. montensis were amplified and sequenced. O. nigripes virus genome was 97.5% (nt) and 98.4% (nt) identical to sequences published for Araucaria (Juquitiba-like) virus based on N and G2 fragment sequences. Viral sequences from A. montensis strain showed 89% and 88% nucleotide identities in a 905-nt fragment of the nucleocapsid (N) protein-coding region of the S segment when it was compared with two other Akodontine rodent-associated viruses from Paraguay, A. montensis and Akodon cursor, respectively. Phylogenetic analysis showed the cocirculation of two genetic hantavirus lineages in the state of Santa Catarina, one from O. nigripes and the other from A. montensis, previously characterized in Brazil and Paraguay, respectively. The hantavirus associated with A. montensis, designed Jaborá virus, represents a distinct phylogenetic lineage among the Brazilian hantaviruses.
-
Rousvoal, Sylvie; Bouyer, Betty; López-Cristoffanini, Camilo; Boyen, Catherine; Collén, Jonas
2016-08-01
Chondrus crispus Stackhouse (Gigartinales) is a red seaweed found on North Atlantic rocky shores. Electrophoresis of RNA extracts showed a prominent band with a size of around 6,000 bp. Sequencing of the band revealed several sequences with similarity to totiviruses, double-stranded RNA viruses that normally infect fungi. This virus-like entity was named C. crispus virus (CcV). It should probably be regarded as an extreme viral quasispecies or a mutant swarm since low identity (<65%) was found between sequences. Totiviruses typically code for two genes: one capsid gene (gag) and one RNA-dependent RNA polymerase gene (pol) with a pseudoknot structure between the genes. Both the genes and the intergenic structures were found in the CcV sequences. A nonidentical gag gene was also found in the nuclear genome of C. crispus, with associated expressed sequence tags (EST) and upstream regulatory features. The gene was presumably horizontally transferred from the virus to the alga. Similar dsRNA bands were seen in extracts from different life cycle stages of C. crispus and from all geographic locations tested. In addition, similar bands were also observed in RNA extractions from other red algae; however, the significance of this apparently widespread phenomenon is unknown. Neither phenotype caused by the infection nor any virus particles or capsid proteins were identified; thus, the presence of viral particles has not been validated. These findings increase the known host range of totiviruses to include marine red algae. © 2016 Phycological Society of America.
-
Leung, Preston; Eltahla, Auda A; Lloyd, Andrew R; Bull, Rowena A; Luciani, Fabio
2017-07-15
With the advent of affordable deep sequencing technologies, detection of low frequency variants within genetically diverse viral populations can now be achieved with unprecedented depth and efficiency. The high-resolution data provided by next generation sequencing technologies is currently recognised as the gold standard in estimation of viral diversity. In the analysis of rapidly mutating viruses, longitudinal deep sequencing datasets from viral genomes during individual infection episodes, as well as at the epidemiological level during outbreaks, now allow for more sophisticated analyses such as statistical estimates of the impact of complex mutation patterns on the evolution of the viral populations both within and between hosts. These analyses are revealing more accurate descriptions of the evolutionary dynamics that underpin the rapid adaptation of these viruses to the host response, and to drug therapies. This review assesses recent developments in methods and provide informative research examples using deep sequencing data generated from rapidly mutating viruses infecting humans, particularly hepatitis C virus (HCV), human immunodeficiency virus (HIV), Ebola virus and influenza virus, to understand the evolution of viral genomes and to explore the relationship between viral mutations and the host adaptive immune response. Finally, we discuss limitations in current technologies, and future directions that take advantage of publically available large deep sequencing datasets. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Vipie: web pipeline for parallel characterization of viral populations from multiple NGS samples.
Lin, Jake; Kramna, Lenka; Autio, Reija; Hyöty, Heikki; Nykter, Matti; Cinek, Ondrej
2017-05-15
Next generation sequencing (NGS) technology allows laboratories to investigate virome composition in clinical and environmental samples in a culture-independent way. There is a need for bioinformatic tools capable of parallel processing of virome sequencing data by exactly identical methods: this is especially important in studies of multifactorial diseases, or in parallel comparison of laboratory protocols. We have developed a web-based application allowing direct upload of sequences from multiple virome samples using custom parameters. The samples are then processed in parallel using an identical protocol, and can be easily reanalyzed. The pipeline performs de-novo assembly, taxonomic classification of viruses as well as sample analyses based on user-defined grouping categories. Tables of virus abundance are produced from cross-validation by remapping the sequencing reads to a union of all observed reference viruses. In addition, read sets and reports are created after processing unmapped reads against known human and bacterial ribosome references. Secured interactive results are dynamically plotted with population and diversity charts, clustered heatmaps and a sortable and searchable abundance table. The Vipie web application is a unique tool for multi-sample metagenomic analysis of viral data, producing searchable hits tables, interactive population maps, alpha diversity measures and clustered heatmaps that are grouped in applicable custom sample categories. Known references such as human genome and bacterial ribosomal genes are optionally removed from unmapped ('dark matter') reads. Secured results are accessible and shareable on modern browsers. Vipie is a freely available web-based tool whose code is open source.
-
State-of-the-art on viral microRNAs in HPV infection and cancer development.
Poltronieri, Palmiro; Sun, Binlian; Huang, Kai-Yao; Chang, Tzu-Hao; Lee, Tzong-Yi
2018-03-27
high-risk HPV subtypes are driving forces for human cancer development: HPV-16 and HPV-18 are responsible for most HPV-caused cancers. This review describes the present knowledge on HR-HPV genomes coding potential for viral miRNAs. HPV subtypes miRNA database, VIRmiRtar, has been constructed applying bioinformatics and a computational method, ViralMir, exploiting structural features, presence of hairpins, and validation by comparison with RNA sequencing datasets. Several miRNA candidates have been localised in the genomes of high-risk HPV subtypes. Among these, HPV-16 miR-1, miR-2 and miR-3. The database contains a list of host candidate gene targets that may be responsible for the oncogenesis in the various cellular environments. miRNA silencing therapies, based on specific cellular uptake of miRNA mimics and antagomiRs, directed towards HPV encoded miRNAs and/or microRNAs deregulated in the host cells, could be a valuable approach to support pharmaceutical interventions in the treatment of HPV dependent cancers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
-
Lewis, Jo E.; Brameld, John M.; Hill, Phil; Barrett, Perry; Ebling, Francis J.P.; Jethwa, Preeti H.
2015-01-01
Introduction The viral 2A sequence has become an attractive alternative to the traditional internal ribosomal entry site (IRES) for simultaneous over-expression of two genes and in combination with recombinant adeno-associated viruses (rAAV) has been used to manipulate gene expression in vitro. New method To develop a rAAV construct in combination with the viral 2A sequence to allow long-term over-expression of the vgf gene and fluorescent marker gene for tracking of the transfected neurones in vivo. Results Transient transfection of the AAV plasmid containing the vgf gene, viral 2A sequence and eGFP into SH-SY5Y cells resulted in eGFP fluorescence comparable to a commercially available reporter construct. This increase in fluorescent cells was accompanied by an increase in VGF mRNA expression. Infusion of the rAAV vector containing the vgf gene, viral 2A sequence and eGFP resulted in eGFP fluorescence in the hypothalamus of both mice and Siberian hamsters, 32 weeks post infusion. In situ hybridisation confirmed that the location of VGF mRNA expression in the hypothalamus corresponded to the eGFP pattern of fluorescence. Comparison with old method The viral 2A sequence is much smaller than the traditional IRES and therefore allowed over-expression of the vgf gene with fluorescent tracking without compromising viral capacity. Conclusion The use of the viral 2A sequence in the AAV plasmid allowed the simultaneous expression of both genes in vitro. When used in combination with rAAV it resulted in long-term over-expression of both genes at equivalent locations in the hypothalamus of both Siberian hamsters and mice, without any adverse effects. PMID:26300182
-
Laassri, Majid; Dragunsky, Eugenia; Enterline, Joan; Eremeeva, Tatiana; Ivanova, Olga; Lottenbach, Kathleen; Belshe, Robert; Chumakov, Konstantin
2005-01-01
Sabin strains of poliovirus used in the manufacture of oral poliovirus vaccine (OPV) are prone to genetic variations that occur during growth in cell cultures and the organisms of vaccine recipients. Such derivative viruses often have increased neurovirulence and transmissibility, and in some cases they can reestablish chains of transmission in human populations. Monitoring for vaccine-derived polioviruses is an important part of the worldwide campaign to eradicate poliomyelitis. Analysis of vaccine-derived polioviruses requires, as a first step, their isolation in cell cultures, which takes significant time and may yield viral stocks that are not fully representative of the strains present in the original sample. Here we demonstrate that full-length viral cDNA can be PCR amplified directly from stool samples and immediately subjected to genomic analysis by oligonucleotide microarray hybridization and nucleotide sequencing. Most fecal samples from healthy children who received OPV were found to contain variants of Sabin vaccine viruses. Sequence changes in the 5′ untranslated region were common, as were changes in the VP1-coding region, including changes in a major antigenic site. Analysis of stool samples taken from cases of acute flaccid paralysis revealed the presence of mixtures of recombinant polioviruses, in addition to the emergence of new sequence variants. Avoiding the need for cell culture isolation dramatically shortened the time needed for identification and analysis of vaccine-derived polioviruses and could be useful for preliminary screening of clinical samples. The amplified full-length viral cDNA can be archived and used to recover live virus for further virological studies. PMID:15956413
-
Bjorklund, H.V.; Higman, K.H.; Kurath, G.
1996-01-01
The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.
-
Bjorklund, H.V.; Higman, K.H.; Kurath, G.
1996-01-01
The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.
-
The web server of IBM's Bioinformatics and Pattern Discovery group: 2004 update.
Huynh, Tien; Rigoutsos, Isidore
2004-07-01
In this report, we provide an update on the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server, which is operational around the clock, provides access to a large number of methods that have been developed and published by the group's members. There is an increasing number of problems that these tools can help tackle; these problems range from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences, the identification--directly from sequence--of structural deviations from alpha-helicity and the annotation of amino acid sequences for antimicrobial activity. Additionally, annotations for more than 130 archaeal, bacterial, eukaryotic and viral genomes are now available on-line and can be searched interactively. The tools and code bundles continue to be accessible from http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.
-
Rheum emodin inhibits enterovirus 71 viral replication and affects the host cell cycle environment
Zhong, Ting; Zhang, Li-ying; Wang, Zeng-yan; Wang, Yue; Song, Feng-mei; Zhang, Ya-hong; Yu, Jing-hua
2017-01-01
Human enterovirus 71 (EV71) is the primary causative agent of recent large-scale outbreaks of hand, foot, and mouth disease (HFMD) in Asia. Currently, there are no drugs available for the prevention and treatment of HFMD. In this study, we compared the anti-EV71 activities of three natural compounds, rheum emodin, artemisinin and astragaloside extracted from Chinese herbs Chinese rhubarb, Artemisia carvifolia and Astragalus, respectively, which have been traditionally used for the treatment and prevention of epidemic diseases. Human lung fibroblast cell line MRC5 was mock-infected or infected with EV71, and treated with drugs. The cytotoxicity of the drugs was detected with MTT assay. The cytopathic effects such as cell death and condensed nuclei were morphologically observed. The VP1-coding sequence required for EV71 genome replication was assayed with qRT-PCR. Viral protein expression was analyzed with Western blotting. Viral TCID50 was determined to evaluate EV71 virulence. Flow cytometry analysis of propidium iodide staining was performed to analyze the cell cycle distribution of MRC5 cells. Rheum emodin (29.6 μmol/L) effectively protected MRC5 cells from EV71-induced cytopathic effects, which resulted from the inhibiting viral replication: rheum emodin treatment decreased viral genomic levels by 5.34-fold, viral protein expression by less than 30-fold and EV71 virulence by 0.33107-fold. The fact that inhibition of rheum emodin on viral virulence was much stronger than its effects on genomic levels and viral protein expression suggested that rheum emodin inhibited viral maturation. Furthermore, rheum emodin treatment markedly diminished cell cycle arrest at S phase in MRC5 cells, which was induced by EV71 infection and favored the viral replication. In contrast, neither astragaloside (50 μmol/L) nor artemisinin (50 μmol/L) showed similar anti-EV71 activities. Among the three natural compounds tested, rheum emodin effectively suppressed EV71 viral replication, thus is a candidate anti-HFMD drug. PMID:27840410
-
Rheum emodin inhibits enterovirus 71 viral replication and affects the host cell cycle environment.
Zhong, Ting; Zhang, Li-Ying; Wang, Zeng-Yan; Wang, Yue; Song, Feng-Mei; Zhang, Ya-Hong; Yu, Jing-Hua
2017-03-01
Human enterovirus 71 (EV71) is the primary causative agent of recent large-scale outbreaks of hand, foot, and mouth disease (HFMD) in Asia. Currently, there are no drugs available for the prevention and treatment of HFMD. In this study, we compared the anti-EV71 activities of three natural compounds, rheum emodin, artemisinin and astragaloside extracted from Chinese herbs Chinese rhubarb, Artemisia carvifolia and Astragalus, respectively, which have been traditionally used for the treatment and prevention of epidemic diseases. Human lung fibroblast cell line MRC5 was mock-infected or infected with EV71, and treated with drugs. The cytotoxicity of the drugs was detected with MTT assay. The cytopathic effects such as cell death and condensed nuclei were morphologically observed. The VP1-coding sequence required for EV71 genome replication was assayed with qRT-PCR. Viral protein expression was analyzed with Western blotting. Viral TCID50 was determined to evaluate EV71 virulence. Flow cytometry analysis of propidium iodide staining was performed to analyze the cell cycle distribution of MRC5 cells. Rheum emodin (29.6 μmol/L) effectively protected MRC5 cells from EV71-induced cytopathic effects, which resulted from the inhibiting viral replication: rheum emodin treatment decreased viral genomic levels by 5.34-fold, viral protein expression by less than 30-fold and EV71 virulence by 0.33107-fold. The fact that inhibition of rheum emodin on viral virulence was much stronger than its effects on genomic levels and viral protein expression suggested that rheum emodin inhibited viral maturation. Furthermore, rheum emodin treatment markedly diminished cell cycle arrest at S phase in MRC5 cells, which was induced by EV71 infection and favored the viral replication. In contrast, neither astragaloside (50 μmol/L) nor artemisinin (50 μmol/L) showed similar anti-EV71 activities. Among the three natural compounds tested, rheum emodin effectively suppressed EV71 viral replication, thus is a candidate anti-HFMD drug.
-
Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.
2015-01-01
Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117
-
Juranic Lisnic, Vanda; Babic Cac, Marina; Lisnic, Berislav; Trsan, Tihana; Mefferd, Adam; Das Mukhopadhyay, Chitrangada; Cook, Charles H.; Jonjic, Stipan; Trgovcich, Joanne
2013-01-01
Major gaps in our knowledge of pathogen genes and how these gene products interact with host gene products to cause disease represent a major obstacle to progress in vaccine and antiviral drug development for the herpesviruses. To begin to bridge these gaps, we conducted a dual analysis of Murine Cytomegalovirus (MCMV) and host cell transcriptomes during lytic infection. We analyzed the MCMV transcriptome during lytic infection using both classical cDNA cloning and sequencing of viral transcripts and next generation sequencing of transcripts (RNA-Seq). We also investigated the host transcriptome using RNA-Seq combined with differential gene expression analysis, biological pathway analysis, and gene ontology analysis. We identify numerous novel spliced and unspliced transcripts of MCMV. Unexpectedly, the most abundantly transcribed viral genes are of unknown function. We found that the most abundant viral transcript, recently identified as a noncoding RNA regulating cellular microRNAs, also codes for a novel protein. To our knowledge, this is the first viral transcript that functions both as a noncoding RNA and an mRNA. We also report that lytic infection elicits a profound cellular response in fibroblasts. Highly upregulated and induced host genes included those involved in inflammation and immunity, but also many unexpected transcription factors and host genes related to development and differentiation. Many top downregulated and repressed genes are associated with functions whose roles in infection are obscure, including host long intergenic noncoding RNAs, antisense RNAs or small nucleolar RNAs. Correspondingly, many differentially expressed genes cluster in biological pathways that may shed new light on cytomegalovirus pathogenesis. Together, these findings provide new insights into the molecular warfare at the virus-host interface and suggest new areas of research to advance the understanding and treatment of cytomegalovirus-associated diseases. PMID:24086132
-
Proposed revision to the taxonomy of the genus Pestivirus, family Flaviviridae.
Smith, Donald B; Meyers, Gregor; Bukh, Jens; Gould, Ernest A; Monath, Thomas; Scott Muerhoff, A; Pletnev, Alexander; Rico-Hesse, Rebecca; Stapleton, Jack T; Simmonds, Peter; Becher, Paul
2017-08-01
We propose the creation of seven new species in the genus Pestivirus (family Flaviviridae) in addition to the four existing species, and naming species in a host-independent manner using the format Pestivirus X. Only the virus species names would change; virus isolates would still be referred to by their original names. The original species would be re-designated as Pestivirus A (original designation Bovine viral diarrhea virus 1), Pestivirus B (Bovine viral diarrhea virus 2), Pestivirus C (Classical swine fever virus) and Pestivirus D (Border disease virus). The seven new species (and example isolates) would be Pestivirus E (pronghorn pestivirus), Pestivirus F (Bungowannah virus), Pestivirus G (giraffe pestivirus), Pestivirus H (Hobi-like pestivirus), Pestivirus I (Aydin-like pestivirus), Pestivirus J (rat pestivirus) and Pestivirus K (atypical porcine pestivirus). A bat-derived virus and pestiviruses identified from sheep and goat (Tunisian sheep pestiviruses), which lack complete coding region sequences, may represent two additional species.
-
Proposed revision to the taxonomy of the genus Pestivirus, family Flaviviridae
Meyers, Gregor; Bukh, Jens; Gould, Ernest A.; Monath, Thomas; Muerhoff, A. Scott; Pletnev, Alexander; Rico-Hesse, Rebecca; Stapleton, Jack T.; Simmonds, Peter; Becher, Paul
2017-01-01
We propose the creation of seven new species in the genus Pestivirus (family Flaviviridae) in addition to the four existing species, and naming species in a host-independent manner using the format Pestivirus X. Only the virus species names would change; virus isolates would still be referred to by their original names. The original species would be re-designated as Pestivirus A (original designation Bovine viral diarrhea virus 1), Pestivirus B (Bovine viral diarrhea virus 2), Pestivirus C (Classical swine fever virus) and Pestivirus D (Border disease virus). The seven new species (and example isolates) would be Pestivirus E (pronghorn pestivirus), Pestivirus F (Bungowannah virus), Pestivirus G (giraffe pestivirus), Pestivirus H (Hobi-like pestivirus), Pestivirus I (Aydin-like pestivirus), Pestivirus J (rat pestivirus) and Pestivirus K (atypical porcine pestivirus). A bat-derived virus and pestiviruses identified from sheep and goat (Tunisian sheep pestiviruses), which lack complete coding region sequences, may represent two additional species. PMID:28786787
-
Mao, Yaping; Wang, Jigui; Hou, Qiang; Xi, Ji; Zhang, Xiaomei; Bian, Dawei; Yu, Yongle; Wang, Xi; Liu, Weiquan
2016-06-01
A virus isolated from mink showing clinical signs of enteritis was identified as a high virulent mink enteritis parvovirus (MEV) based on its biological characteristics in vivo and in vitro. Mink, challenged with this strain named MEV-LHV, exhibited severe pathological lesions as compared to those challenged with attenuated strain MEV-L. MEV-LHV also showed higher infection and replication efficiencies in vitro than MEV-L. Sequence of the complete genome of MEV-LHV was determined and analyzed in comparison with those in GenBank, which revealed that MEV-LHV shared high homology with virulent strain MEV SD12/01, whereas MEV-L was closely related to Abashiri and vaccine strain MEVB, and belonged to a different branch of the phylogenetic tree. The genomes of the two strains differed by insertions and deletions in their palindromic termini and specific unique mutations (especially VP2 300) in coding sequences which may be involved in viral replication and pathogenicity. The results of this study provide a better understanding of the biological and genomic characteristics of MEV and identify certain regions and sites that may be involved in viral replication and pathogenicity.
-
Detecting consistent patterns of directional adaptation using differential selection codon models.
Parto, Sahar; Lartillot, Nicolas
2017-06-23
Phylogenetic codon models are often used to characterize the selective regimes acting on protein-coding sequences. Recent methodological developments have led to models explicitly accounting for the interplay between mutation and selection, by modeling the amino acid fitness landscape along the sequence. However, thus far, most of these models have assumed that the fitness landscape is constant over time. Fluctuations of the fitness landscape may often be random or depend on complex and unknown factors. However, some organisms may be subject to systematic changes in selective pressure, resulting in reproducible molecular adaptations across independent lineages subject to similar conditions. Here, we introduce a codon-based differential selection model, which aims to detect and quantify the fine-grained consistent patterns of adaptation at the protein-coding level, as a function of external conditions experienced by the organism under investigation. The model parameterizes the global mutational pressure, as well as the site- and condition-specific amino acid selective preferences. This phylogenetic model is implemented in a Bayesian MCMC framework. After validation with simulations, we applied our method to a dataset of HIV sequences from patients with known HLA genetic background. Our differential selection model detects and characterizes differentially selected coding positions specifically associated with two different HLA alleles. Our differential selection model is able to identify consistent molecular adaptations as a function of repeated changes in the environment of the organism. These models can be applied to many other problems, ranging from viral adaptation to evolution of life-history strategies in plants or animals.
-
Cornelissen, Marion; Gall, Astrid; Vink, Monique; Zorgdrager, Fokla; Binter, Špela; Edwards, Stephanie; Jurriaans, Suzanne; Bakker, Margreet; Ong, Swee Hoe; Gras, Luuk; van Sighem, Ard; Bezemer, Daniela; de Wolf, Frank; Reiss, Peter; Kellam, Paul; Berkhout, Ben; Fraser, Christophe; van der Kuyl, Antoinette C
2017-07-15
The BEEHIVE (Bridging the Evolution and Epidemiology of HIV in Europe) project aims to analyse nearly-complete viral genomes from >3000 HIV-1 infected Europeans using high-throughput deep sequencing techniques to investigate the virus genetic contribution to virulence. Following the development of a computational pipeline, including a new de novo assembler for RNA virus genomes, to generate larger contiguous sequences (contigs) from the abundance of short sequence reads that characterise the data, another area that determines genome sequencing success is the quality and quantity of the input RNA. A pilot experiment with 125 patient plasma samples was performed to investigate the optimal method for isolation of HIV-1 viral RNA for long amplicon genome sequencing. Manual isolation with the QIAamp Viral RNA Mini Kit (Qiagen) was superior over robotically extracted RNA using either the QIAcube robotic system, the mSample Preparation Systems RNA kit with automated extraction by the m2000sp system (Abbott Molecular), or the MagNA Pure 96 System in combination with the MagNA Pure 96 Instrument (Roche Diagnostics). We scored amplification of a set of four HIV-1 amplicons of ∼1.9, 3.6, 3.0 and 3.5kb, and subsequent recovery of near-complete viral genomes. Subsequently, 616 BEEHIVE patient samples were analysed to determine factors that influence successful amplification of the genome in four overlapping amplicons using the QIAamp Viral RNA Kit for viral RNA isolation. Both low plasma viral load and high sample age (stored before 1999) negatively influenced the amplification of viral amplicons >3kb. A plasma viral load of >100,000 copies/ml resulted in successful amplification of all four amplicons for 86% of the samples, this value dropped to only 46% for samples with viral loads of <20,000 copies/ml. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
-
Pyviko: an automated Python tool to design gene knockouts in complex viruses with overlapping genes.
Taylor, Louis J; Strebel, Klaus
2017-01-07
Gene knockouts are a common tool used to study gene function in various organisms. However, designing gene knockouts is complicated in viruses, which frequently contain sequences that code for multiple overlapping genes. Designing mutants that can be traced by the creation of new or elimination of existing restriction sites further compounds the difficulty in experimental design of knockouts of overlapping genes. While software is available to rapidly identify restriction sites in a given nucleotide sequence, no existing software addresses experimental design of mutations involving multiple overlapping amino acid sequences in generating gene knockouts. Pyviko performed well on a test set of over 240,000 gene pairs collected from viral genomes deposited in the National Center for Biotechnology Information Nucleotide database, identifying a point mutation which added a premature stop codon within the first 20 codons of the target gene in 93.2% of all tested gene-overprinted gene pairs. This shows that Pyviko can be used successfully in a wide variety of contexts to facilitate the molecular cloning and study of viral overprinted genes. Pyviko is an extensible and intuitive Python tool for designing knockouts of overlapping genes. Freely available as both a Python package and a web-based interface ( http://louiejtaylor.github.io/pyViKO/ ), Pyviko simplifies the experimental design of gene knockouts in complex viruses with overlapping genes.
-
Investigating intra-host and intra-herd sequence diversity of foot-and-mouth disease virus.
King, David J; Freimanis, Graham L; Orton, Richard J; Waters, Ryan A; Haydon, Daniel T; King, Donald P
2016-10-01
Due to the poor-fidelity of the enzymes involved in RNA genome replication, foot-and-mouth disease (FMD) virus samples comprise of unique polymorphic populations. In this study, deep sequencing was utilised to characterise the diversity of FMD virus (FMDV) populations in 6 infected cattle present on a single farm during the series of outbreaks in the UK in 2007. A novel RT-PCR method was developed to amplify a 7.6kb nucleotide fragment encompassing the polyprotein coding region of the FMDV genome. Illumina sequencing of each sample identified the fine polymorphic structures at each nucleotide position, from consensus level changes to variants present at a 0.24% frequency. These data were used to investigate population dynamics of FMDV at both herd and host levels, evaluate the impact of host on the viral swarm structure and to identify transmission links with viruses recovered from other farms in the same series of outbreaks. In 7 samples, from 6 different animals, a total of 5 consensus level variants were identified, in addition to 104 sub-consensus variants of which 22 were shared between 2 or more animals. Further analysis revealed differences in swarm structures from samples derived from the same animal suggesting the presence of distinct viral populations evolving independently at different lesion sites within the same infected animal. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
-
Fatal acute hepatic failure in a family infected with the hepatitis A virus subgenotype IB
Yoshida, Yuichi; Okada, Yohei; Suzuki, Akiko; Kakisaka, Keisuke; Miyamoto, Yasuhiro; Miyasaka, Akio; Takikawa, Yasuhiro; Nishizawa, Tsutomu; Okamoto, Hiroaki
2017-01-01
Abstract Rationale: Hepatitis A viral infection is a well-known cause of subclinical or acute self-limited hepatitis. Few cases of hepatitis A virus (HAV)–associated acute liver failure (ALF) have been reported in low HAV endemic countries annually. Patients concerns: To investigate the possible factors that affected the severity of HAV infection, a family cluster infected with the HAV subgenotype IB strain, which is not common in Japan, was described. Diagnoses: This family consisted of five members who all were infected with HAV. Interventions: Four of the five patients hospitalized except for an asymptomatic patient. Outcomes: Two of the five patients, men in their 50s and 60s, developed ALF, and one patient died. Various host factors, including sex (male), age, and a high bilirubin level, may affect the outcomes. Based on viral factors, HAV RNA was higher in the fatal case compared with others, and it decreased within a short period of time. The similarity of the nucleotide sequences was 99.9% among the HAV isolates based on an entire genomic sequence. Deletions and/or insertions on the HAV protein-coding sequences that caused a frameshift were found in surviving cases but not in the fatal case. Lessons: The rapid clearance of increased HAV and the absence of defective HAV might be closely associated with the onset of liver failure. PMID:28858094
-
Yoshida, Yuichi; Okada, Yohei; Suzuki, Akiko; Kakisaka, Keisuke; Miyamoto, Yasuhiro; Miyasaka, Akio; Takikawa, Yasuhiro; Nishizawa, Tsutomu; Okamoto, Hiroaki
2017-09-01
Hepatitis A viral infection is a well-known cause of subclinical or acute self-limited hepatitis. Few cases of hepatitis A virus (HAV)-associated acute liver failure (ALF) have been reported in low HAV endemic countries annually. To investigate the possible factors that affected the severity of HAV infection, a family cluster infected with the HAV subgenotype IB strain, which is not common in Japan, was described. This family consisted of five members who all were infected with HAV. Four of the five patients hospitalized except for an asymptomatic patient. Two of the five patients, men in their 50s and 60s, developed ALF, and one patient died. Various host factors, including sex (male), age, and a high bilirubin level, may affect the outcomes. Based on viral factors, HAV RNA was higher in the fatal case compared with others, and it decreased within a short period of time. The similarity of the nucleotide sequences was 99.9% among the HAV isolates based on an entire genomic sequence. Deletions and/or insertions on the HAV protein-coding sequences that caused a frameshift were found in surviving cases but not in the fatal case. The rapid clearance of increased HAV and the absence of defective HAV might be closely associated with the onset of liver failure.
-
Li, Linlin; Joseph, G. Victoria; Wang, Chunlin; Jones, Morris; Fellers, Gary M.; Kunz, Thomas H.; Delwart, Eric
2010-01-01
Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmissions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34% and 58% of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densovirinae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fall outside existing taxonomic groups. This initial characterization of the bat guano virome, the first metagenomic analysis of viruses in wild mammals using second-generation sequencing, therefore showed the presence of previously unidentified viral species, genera, and possibly families. Viral metagenomics is a useful tool for genetically characterizing viruses present in animals with the known capability of direct or indirect viral zoonosis to humans.
-
Li, Linlin; Victoria, Joseph G.; Wang, Chunlin; Jones, Morris; Fellers, Gary M.; Kunz, Thomas H.; Delwart, Eric
2010-01-01
Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmissions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34% and 58% of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densovirinae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fall outside existing taxonomic groups. This initial characterization of the bat guano virome, the first metagenomic analysis of viruses in wild mammals using second-generation sequencing, therefore showed the presence of previously unidentified viral species, genera, and possibly families. Viral metagenomics is a useful tool for genetically characterizing viruses present in animals with the known capability of direct or indirect viral zoonosis to humans. PMID:20463061
-
Li, Linlin; Victoria, Joseph G; Wang, Chunlin; Jones, Morris; Fellers, Gary M; Kunz, Thomas H; Delwart, Eric
2010-07-01
Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmissions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34% and 58% of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densovirinae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fall outside existing taxonomic groups. This initial characterization of the bat guano virome, the first metagenomic analysis of viruses in wild mammals using second-generation sequencing, therefore showed the presence of previously unidentified viral species, genera, and possibly families. Viral metagenomics is a useful tool for genetically characterizing viruses present in animals with the known capability of direct or indirect viral zoonosis to humans.
-
Thanapati, Subrat; Hande, Aparna; Das, Rumki; Gurav, Yogesh; Tripathy, Anuradha S
2014-05-01
Genes coding for human leukocyte antigen (HLA) class II molecules are polymorphic and have been shown to influence susceptibility to viral diseases. One hundred patients with acute chikungunya with and without viral load and 250 chikungunya negative controls from western India were studied for the distribution of HLA class II alleles by PCR with sequence-specific primer (SSP) method. Frequency of DRB1*11 allele group (patients vs controls: p=0.002, Pc=0.036, OR=0.21) and haplotype DRB1*11/DQB1*03 (patients vs controls: p=0.007, OR=0.15) were significantly low, while haplotype DRB1*04/DQB1*03 (patients vs controls: p=0.042, OR=1.94) was significantly high in the patient population. HLA DQB1*04 allele was found only in the patient group with viral load (n=17), suggesting possible involvement of the same with chikungunya virus (CHIKV) replication. Association of HLA-DRB1*11 and the emergence of DRB1*11/DQB1*03 & DRB1*04/DQB1*03 as resistant and susceptible haplotypes towards CHIKV infection is being reported for the first time. Our results suggest that genetic susceptibility and/or resistance to chikungunya infection may be modulated by HLA class II alleles.
-
Nosocomial transmission of respiratory syncytial virus in an outpatient cancer center.
Chu, Helen Y; Englund, Janet A; Podczervinski, Sara; Kuypers, Jane; Campbell, Angela P; Boeckh, Michael; Pergam, Steven A; Casper, Corey
2014-06-01
Respiratory syncytial virus (RSV) outbreaks in inpatient settings are associated with poor outcomes in cancer patients. The use of molecular epidemiology to document RSV transmission in the outpatient setting has not been well described. We performed a retrospective cohort study of 2 nosocomial outbreaks of RSV at the Seattle Cancer Care Alliance. Subjects included patients seen at the Seattle Cancer Care Alliance with RSV detected in 2 outbreaks in 2007-2008 and 2012 and all employees with respiratory viruses detected in the 2007-2008 outbreak. A subset of samples was sequenced using semi-nested PCR targeting the RSV attachment glycoprotein coding region. Fifty-one cases of RSV were identified in 2007-2008. Clustering of identical viral strains was detected in 10 of 15 patients (67%) with RSV sequenced from 2007 to 2008. As part of a multimodal infection control strategy implemented as a response to the outbreak, symptomatic employees had nasal washes collected. Of 254 employee samples, 91 (34%) tested positive for a respiratory virus, including 14 with RSV. In another RSV outbreak in 2012, 24 cases of RSV were identified; 9 of 10 patients (90%) had the same viral strain, and 1 (10%) had another viral strain. We document spread of clonal strains within an outpatient cancer care setting. Infection control interventions should be implemented in outpatient, as well as inpatient, settings to reduce person-to-person transmission and limit progression of RSV outbreaks. Copyright © 2014 American Society for Blood and Marrow Transplantation. All rights reserved.
-
Nosocomial Transmission of Respiratory Syncytial Virus in an Outpatient Cancer Center
Chu, Helen Y.; Englund, Janet A.; Podczervinski, Sara; Kuypers, Jane; Campbell, Angela P.; Boeckh, Michael; Pergam, Steven A.; Casper, Crey
2014-01-01
Background Respiratory syncytial virus (RSV) outbreaks in inpatient settings are associated with poor outcomes in cancer patients. The use of molecular epidemiology to document RSV transmission in the outpatient setting has not been well described. Methods We performed a retrospective cohort study of two nosocomial outbreaks of RSV at the Seattle Cancer Care Alliance (SCCA). Subjects included patients seen at the SCCA with RSV detected in two outbreaks in 2007-2008 and 2012, and all employees with respiratory viruses detected in the 2007-2008 outbreak. A subset of samples was sequenced using semi-nested polymerase chain reaction targeting the RSV attachment glycoprotein coding region. Results Fifty-one cases of RSV were identified in 2007-2008. Clustering of identical viral strains was detected in 10 (67%) of 15 patients with RSV sequenced from 2007-2008. As part of a multimodal infection control strategy implemented as a response to the outbreak, symptomatic employees had nasal washes collected. Of 254 employee samples, 91 (34%) tested positive for a respiratory virus, including 14 with RSV. In another RSV outbreak in 2012, 24 cases of RSV were identified; nine (90%) of 10 patients had the same viral strain, and 1 (10%) had another viral strain. Conclusions We document spread of clonal strains within an outpatient cancer care setting. Infection control interventions should be implemented in outpatient, as well as inpatient, settings to reduce person-to-person transmission and limit progression of RSV outbreaks. PMID:24607551
-
Leke, Walter N; Khatabi, Behnam; Fondong, Vincent N; Brown, Judith K
2016-08-01
The complete genome sequence was determined and characterized for a previously unreported bipartite begomovirus from fluted pumpkin (Telfairia occidentalis, family Cucurbitaceae) plants displaying mosaic symptoms in Cameroon. The DNA-A and DNA-B components were ~2.7 kb and ~2.6 kb in size, and the arrangement of viral coding regions on the genomic components was like those characteristic of other known bipartite begomoviruses originating in the Old World. While the DNA-A component was more closely related to that of chayote yellow mosaic virus (ChaYMV), at 78 %, the DNA-B component was more closely related to that of soybean chlorotic blotch virus (SbCBV), at 64 %. This newly discovered bipartite Old World virus is herein named telfairia mosaic virus (TelMV).
-
Chutiwitoonchai, Nopporn; Kakisaka, Michinori; Yamada, Kazunori; Aida, Yoko
2014-01-01
The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES) consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ) residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4) was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues) within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function during viral replication.
-
Association of coral algal symbionts with a diverse viral community responsive to heat shock.
Brüwer, Jan D; Agrawal, Shobhit; Liew, Yi Jin; Aranda, Manuel; Voolstra, Christian R
2017-08-17
Stony corals provide the structural foundation of coral reef ecosystems and are termed holobionts given they engage in symbioses, in particular with photosynthetic dinoflagellates of the genus Symbiodinium. Besides Symbiodinium, corals also engage with bacteria affecting metabolism, immunity, and resilience of the coral holobiont, but the role of associated viruses is largely unknown. In this regard, the increase of studies using RNA sequencing (RNA-Seq) to assess gene expression provides an opportunity to elucidate viral signatures encompassed within the data via careful delineation of sequence reads and their source of origin. Here, we re-analyzed an RNA-Seq dataset from a cultured coral symbiont (Symbiodinium microadriaticum, Clade A1) across four experimental treatments (control, cold shock, heat shock, dark shock) to characterize associated viral diversity, abundance, and gene expression. Our approach comprised the filtering and removal of host sequence reads, subsequent phylogenetic assignment of sequence reads of putative viral origin, and the assembly and analysis of differentially expressed viral genes. About 15.46% (123 million) of all sequence reads were non-host-related, of which <1% could be classified as archaea, bacteria, or virus. Of these, 18.78% were annotated as virus and comprised a diverse community consistent across experimental treatments. Further, non-host related sequence reads assembled into 56,064 contigs, including 4856 contigs of putative viral origin that featured 43 differentially expressed genes during heat shock. The differentially expressed genes included viral kinases, ubiquitin, and ankyrin repeat proteins (amongst others), which are suggested to help the virus proliferate and inhibit the algal host's antiviral response. Our results suggest that a diverse viral community is associated with coral algal endosymbionts of the genus Symbiodinium, which prompts further research on their ecological role in coral health and resilience.
-
Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.
Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I
2014-03-01
In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Geisler, Christoph
2018-02-07
Adventitious viral contamination in cell substrates used for biologicals production is a major safety concern. A powerful new approach that can be used to identify adventitious viruses is a combination of bioinformatics tools with massively parallel sequencing technology. Typically, this involves mapping or BLASTN searching individual reads against viral nucleotide databases. Although extremely sensitive for known viruses, this approach can easily miss viruses that are too dissimilar to viruses in the database. Moreover, it is computationally intensive and requires reference cell genome databases. To avoid these drawbacks, we set out to develop an alternative approach. We reasoned that searching genome and transcriptome assemblies for adventitious viral contaminants using TBLASTN with a compact viral protein database covering extant viral diversity as the query could be fast and sensitive without a requirement for high performance computing hardware. We tested our approach on Spodoptera frugiperda Sf-RVN, a recently isolated insect cell line, to determine if it was contaminated with one or more adventitious viruses. We used Illumina reads to assemble the Sf-RVN genome and transcriptome and searched them for adventitious viral contaminants using TBLASTN with our viral protein database. We found no evidence of viral contamination, which was substantiated by the fact that our searches otherwise identified diverse sequences encoding virus-like proteins. These sequences included Maverick, R1 LINE, and errantivirus transposons, all of which are common in insect genomes. We also identified previously described as well as novel endogenous viral elements similar to ORFs encoded by diverse insect viruses. Our results demonstrate TBLASTN searching massively parallel sequencing (MPS) assemblies with a compact, manually curated viral protein database is more sensitive for adventitious virus detection than BLASTN, as we identified various sequences that encoded virus-like proteins, but had no similarity to viral sequences at the nucleotide level. Moreover, searches were fast without requiring high performance computing hardware. Our study also documents the enhanced biosafety profile of Sf-RVN as compared to other Sf cell lines, and supports the notion that Sf-RVN is highly suitable for the production of safe biologicals.
-
VirSorter: mining viral signal from microbial genomic data.
Roux, Simon; Enault, Francois; Hurwitz, Bonnie L; Sullivan, Matthew B
2015-01-01
Viruses of microbes impact all ecosystems where microbes drive key energy and substrate transformations including the oceans, humans and industrial fermenters. However, despite this recognized importance, our understanding of viral diversity and impacts remains limited by too few model systems and reference genomes. One way to fill these gaps in our knowledge of viral diversity is through the detection of viral signal in microbial genomic data. While multiple approaches have been developed and applied for the detection of prophages (viral genomes integrated in a microbial genome), new types of microbial genomic data are emerging that are more fragmented and larger scale, such as Single-cell Amplified Genomes (SAGs) of uncultivated organisms or genomic fragments assembled from metagenomic sequencing. Here, we present VirSorter, a tool designed to detect viral signal in these different types of microbial sequence data in both a reference-dependent and reference-independent manner, leveraging probabilistic models and extensive virome data to maximize detection of novel viruses. Performance testing shows that VirSorter's prophage prediction capability compares to that of available prophage predictors for complete genomes, but is superior in predicting viral sequences outside of a host genome (i.e., from extrachromosomal prophages, lytic infections, or partially assembled prophages). Furthermore, VirSorter outperforms existing tools for fragmented genomic and metagenomic datasets, and can identify viral signal in assembled sequence (contigs) as short as 3kb, while providing near-perfect identification (>95% Recall and 100% Precision) on contigs of at least 10kb. Because VirSorter scales to large datasets, it can also be used in "reverse" to more confidently identify viral sequence in viral metagenomes by sorting away cellular DNA whether derived from gene transfer agents, generalized transduction or contamination. Finally, VirSorter is made available through the iPlant Cyberinfrastructure that provides a web-based user interface interconnected with the required computing resources. VirSorter thus complements existing prophage prediction softwares to better leverage fragmented, SAG and metagenomic datasets in a way that will scale to modern sequencing. Given these features, VirSorter should enable the discovery of new viruses in microbial datasets, and further our understanding of uncultivated viral communities across diverse ecosystems.
-
VirSorter: mining viral signal from microbial genomic data
Roux, Simon; Enault, Francois; Hurwitz, Bonnie L.
2015-01-01
Viruses of microbes impact all ecosystems where microbes drive key energy and substrate transformations including the oceans, humans and industrial fermenters. However, despite this recognized importance, our understanding of viral diversity and impacts remains limited by too few model systems and reference genomes. One way to fill these gaps in our knowledge of viral diversity is through the detection of viral signal in microbial genomic data. While multiple approaches have been developed and applied for the detection of prophages (viral genomes integrated in a microbial genome), new types of microbial genomic data are emerging that are more fragmented and larger scale, such as Single-cell Amplified Genomes (SAGs) of uncultivated organisms or genomic fragments assembled from metagenomic sequencing. Here, we present VirSorter, a tool designed to detect viral signal in these different types of microbial sequence data in both a reference-dependent and reference-independent manner, leveraging probabilistic models and extensive virome data to maximize detection of novel viruses. Performance testing shows that VirSorter’s prophage prediction capability compares to that of available prophage predictors for complete genomes, but is superior in predicting viral sequences outside of a host genome (i.e., from extrachromosomal prophages, lytic infections, or partially assembled prophages). Furthermore, VirSorter outperforms existing tools for fragmented genomic and metagenomic datasets, and can identify viral signal in assembled sequence (contigs) as short as 3kb, while providing near-perfect identification (>95% Recall and 100% Precision) on contigs of at least 10kb. Because VirSorter scales to large datasets, it can also be used in “reverse” to more confidently identify viral sequence in viral metagenomes by sorting away cellular DNA whether derived from gene transfer agents, generalized transduction or contamination. Finally, VirSorter is made available through the iPlant Cyberinfrastructure that provides a web-based user interface interconnected with the required computing resources. VirSorter thus complements existing prophage prediction softwares to better leverage fragmented, SAG and metagenomic datasets in a way that will scale to modern sequencing. Given these features, VirSorter should enable the discovery of new viruses in microbial datasets, and further our understanding of uncultivated viral communities across diverse ecosystems. PMID:26038737
-
González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco
2018-05-21
To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.
-
Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael
2017-02-01
We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.
-
An insight into the sialome of the horse fly, Tabanus bromius
Ribeiro, José M.C.; Kazimirova, Maria; Takac, Peter; Andersen, John F.; Francischetti, Ivo M.B.
2015-01-01
Blood feeding animals face their host's defenses against tissue injury and blood loss while attempting to feed. One adaptation to surmount these barriers involves the evolution of a salivary potion that disarms their host's inflammatory and anti-hemostatic processes. The composition of the peptide moiety of this potion, or sialome (from the Greek sialo=saliva), can be deducted in part by proper interpretation of the blood feeder' sialotranscriptome. In this work we disclose the sialome of the blood feeding adult female Tabanus bromius. Following assembly of over 75 million Illumina reads (101 nt long) 16,683 contigs were obtained from which 4,078 coding sequences were extracted. From these, 320 were assigned as coding for putative secreted proteins. These 320 contigs mapped 85% of the reads. The antigen-5 proteins family was studied in detail, indicating three Tabanus specific clades with and without disintegrin domains, as well as with and without leukotriene binding domains. Defensins were also detailed; a clade of salivary tabanid peptides was found lacking the propeptide domain ending in the KR dipeptide signaling furin cleavage. Novel protein families were also disclosed. Viral transcripts were identified closely matching the Kotonkan virus capsid proteins. Full length Mariner transposases were also identified. A total of 3,043 coding sequences and their protein products were deposited in Genbank. Hyperlinked excel spreadsheets containing the coding sequences and their annotation are available at http://exon.niaid.nih.gov/transcriptome/T_bromius/Tbromius-web.xlsx (hyperlinked excel spreadsheet, 11 MB) and http://exon.niaid.nih.gov/transcriptome/T_bromius/Tbromius-SA.zip (Standalone excel with all local links, 360 MB). These sequences provide for a platform from which further proteomic studies may be designed to identify salivary proteins from T. bromius that are of pharmacological interest or used as immunological markers of host exposure. PMID:26369729
-
Potential Links between Hepadnavirus and Bornavirus Sequences in the Host Genome and Cancer.
Honda, Tomoyuki
2017-01-01
Various viruses leave their sequences in the host genomes during infection. Such events occur mainly in retrovirus infection but also sometimes in DNA and non-retroviral RNA virus infections. If viral sequences are integrated into the genomes of germ line cells, the sequences can become inherited as endogenous viral elements (EVEs). The integration events of viral sequences may have oncogenic potential. Because proviral integrations of some retroviruses and/or reactivation of endogenous retroviruses are closely linked to cancers, viral insertions related to non-retroviral viruses also possibly contribute to cancer development. This article focuses on genomic viral sequences derived from two non-retroviral viruses, whose endogenization is already reported, and discusses their possible contributions to cancer. Viral insertions of hepatitis B virus play roles in the development of hepatocellular carcinoma. Endogenous bornavirus-like elements, the only non-retroviral RNA virus-related EVEs found in the human genome, may also be involved in cancer formation. In addition, the possible contribution of the interactions between viruses and retrotransposons, which seem to be a major driving force for generating EVEs related to non-retroviral RNA viruses, to cancers will be discussed. Future studies regarding the possible links described here may open a new avenue for the development of novel therapeutics for tumor virus-related cancers and/or provide novel insights into EVE functions.
-
Metagenomic characterization of viral communities in Goseong Bay, Korea
NASA Astrophysics Data System (ADS)
Hwang, Jinik; Park, So Yun; Park, Mirye; Lee, Sukchan; Jo, Yeonhwa; Cho, Won Kyong; Lee, Taek-Kyun
2016-12-01
In this study, seawater samples were collected from Goseong Bay, Korea in March 2014 and viral populations were examined by metagenomics assembly. Enrichment of marine viral particles using FeCl3 followed by next-generation sequencing produced numerous sequences. De novo assembly and BLAST search showed that most of the obtained contigs were unknown sequences and only 0.74% of sequences were associated with known viruses. As a result, 138 viruses, including bacteriophages (87%), viruses infecting algae and others (13%) were identified. The identified 138 viruses were divided into 11 orders, 14 families, 34 genera, and 133 species. The dominant viruses were Pelagibacter phage HTVC010P and Roseobacter phage SIO1. The viruses infecting algae, including the Ostreococcus species, accounted for 9.4% of total identified viruses. In addition, we identified pathogenic herpes viruses infecting fishes and giant viruses infecting parasitic acanthamoeba species. This is a comprehensive study to reveal the viral populations in the Goseong Bay using metagenomics. The information associated with the marine viral community in Goseong Bay, Korea will be useful for comparative analysis in other marine viral communities.
-
Viral dark matter and virus–host interactions resolved from publicly available microbial genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roux, Simon; Hallam, Steven J.; Woyke, Tanja
The ecological importance of viruses is now widely recognized, yet our limited knowledge of viral sequence space and virus–host interactions precludes accurate prediction of their roles and impacts. In this study, we mined publicly available bacterial and archaeal genomic data sets to identify 12,498 high-confidence viral genomes linked to their microbial hosts. These data augment public data sets 10-fold, provide first viral sequences for 13 new bacterial phyla including ecologically abundant phyla, and help taxonomically identify 7–38% of ‘unknown’ sequence space in viromes. Genome- and network-based classification was largely consistent with accepted viral taxonomy and suggested that (i) 264 newmore » viral genera were identified (doubling known genera) and (ii) cross-taxon genomic recombination is limited. Further analyses provided empirical data on extrachromosomal prophages and coinfection prevalences, as well as evaluation of in silico virus–host linkage predictions. Together these findings illustrate the value of mining viral signal from microbial genomes.« less
-
Viral dark matter and virus-host interactions resolved from publicly available microbial genomes.
Roux, Simon; Hallam, Steven J; Woyke, Tanja; Sullivan, Matthew B
2015-07-22
The ecological importance of viruses is now widely recognized, yet our limited knowledge of viral sequence space and virus-host interactions precludes accurate prediction of their roles and impacts. In this study, we mined publicly available bacterial and archaeal genomic data sets to identify 12,498 high-confidence viral genomes linked to their microbial hosts. These data augment public data sets 10-fold, provide first viral sequences for 13 new bacterial phyla including ecologically abundant phyla, and help taxonomically identify 7-38% of 'unknown' sequence space in viromes. Genome- and network-based classification was largely consistent with accepted viral taxonomy and suggested that (i) 264 new viral genera were identified (doubling known genera) and (ii) cross-taxon genomic recombination is limited. Further analyses provided empirical data on extrachromosomal prophages and coinfection prevalences, as well as evaluation of in silico virus-host linkage predictions. Together these findings illustrate the value of mining viral signal from microbial genomes.
-
Viral dark matter and virus–host interactions resolved from publicly available microbial genomes
Roux, Simon; Hallam, Steven J.; Woyke, Tanja; ...
2015-07-22
The ecological importance of viruses is now widely recognized, yet our limited knowledge of viral sequence space and virus–host interactions precludes accurate prediction of their roles and impacts. In this study, we mined publicly available bacterial and archaeal genomic data sets to identify 12,498 high-confidence viral genomes linked to their microbial hosts. These data augment public data sets 10-fold, provide first viral sequences for 13 new bacterial phyla including ecologically abundant phyla, and help taxonomically identify 7–38% of ‘unknown’ sequence space in viromes. Genome- and network-based classification was largely consistent with accepted viral taxonomy and suggested that (i) 264 newmore » viral genera were identified (doubling known genera) and (ii) cross-taxon genomic recombination is limited. Further analyses provided empirical data on extrachromosomal prophages and coinfection prevalences, as well as evaluation of in silico virus–host linkage predictions. Together these findings illustrate the value of mining viral signal from microbial genomes.« less
-
Lewis, Jo E; Brameld, John M; Hill, Phil; Barrett, Perry; Ebling, Francis J P; Jethwa, Preeti H
2015-12-30
The viral 2A sequence has become an attractive alternative to the traditional internal ribosomal entry site (IRES) for simultaneous over-expression of two genes and in combination with recombinant adeno-associated viruses (rAAV) has been used to manipulate gene expression in vitro. To develop a rAAV construct in combination with the viral 2A sequence to allow long-term over-expression of the vgf gene and fluorescent marker gene for tracking of the transfected neurones in vivo. Transient transfection of the AAV plasmid containing the vgf gene, viral 2A sequence and eGFP into SH-SY5Y cells resulted in eGFP fluorescence comparable to a commercially available reporter construct. This increase in fluorescent cells was accompanied by an increase in VGF mRNA expression. Infusion of the rAAV vector containing the vgf gene, viral 2A sequence and eGFP resulted in eGFP fluorescence in the hypothalamus of both mice and Siberian hamsters, 32 weeks post infusion. In situ hybridisation confirmed that the location of VGF mRNA expression in the hypothalamus corresponded to the eGFP pattern of fluorescence. The viral 2A sequence is much smaller than the traditional IRES and therefore allowed over-expression of the vgf gene with fluorescent tracking without compromising viral capacity. The use of the viral 2A sequence in the AAV plasmid allowed the simultaneous expression of both genes in vitro. When used in combination with rAAV it resulted in long-term over-expression of both genes at equivalent locations in the hypothalamus of both Siberian hamsters and mice, without any adverse effects. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
-
Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor
2014-01-01
Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40–100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data. PMID:24415932
-
Carnegie, Nicole Bohme; Wang, Rui; Novitsky, Vladimir; De Gruttola, Victor
2014-01-01
Linkage analysis is useful in investigating disease transmission dynamics and the effect of interventions on them, but estimates of probabilities of linkage between infected people from observed data can be biased downward when missingness is informative. We investigate variation in the rates at which subjects' viral genotypes link across groups defined by viral load (low/high) and antiretroviral treatment (ART) status using blood samples from household surveys in the Northeast sector of Mochudi, Botswana. The probability of obtaining a sequence from a sample varies with viral load; samples with low viral load are harder to amplify. Pairwise genetic distances were estimated from aligned nucleotide sequences of HIV-1C env gp120. It is first shown that the probability that randomly selected sequences are linked can be estimated consistently from observed data. This is then used to develop estimates of the probability that a sequence from one group links to at least one sequence from another group under the assumption of independence across pairs. Furthermore, a resampling approach is developed that accounts for the presence of correlation across pairs, with diagnostics for assessing the reliability of the method. Sequences were obtained for 65% of subjects with high viral load (HVL, n = 117), 54% of subjects with low viral load but not on ART (LVL, n = 180), and 45% of subjects on ART (ART, n = 126). The probability of linkage between two individuals is highest if both have HVL, and lowest if one has LVL and the other has LVL or is on ART. Linkage across groups is high for HVL and lower for LVL and ART. Adjustment for missing data increases the group-wise linkage rates by 40-100%, and changes the relative rates between groups. Bias in inferences regarding HIV viral linkage that arise from differential ability to genotype samples can be reduced by appropriate methods for accommodating missing data.
-
Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier
2016-01-01
Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline. PMID:26910355
-
Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier
2016-03-01
Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline.
-
Coffey, Lark L; Page, Brady L; Greninger, Alexander L; Herring, Belinda L; Russell, Richard C; Doggett, Stephen L; Haniotis, John; Wang, Chunlin; Deng, Xutao; Delwart, Eric L
2014-01-05
Viral metagenomics characterizes known and identifies unknown viruses based on sequence similarities to any previously sequenced viral genomes. A metagenomics approach was used to identify virus sequences in Australian mosquitoes causing cytopathic effects in inoculated mammalian cell cultures. Sequence comparisons revealed strains of Liao Ning virus (Reovirus, Seadornavirus), previously detected only in China, livestock-infecting Stretch Lagoon virus (Reovirus, Orbivirus), two novel dimarhabdoviruses, named Beaumont and North Creek viruses, and two novel orthobunyaviruses, named Murrumbidgee and Salt Ash viruses. The novel virus proteomes diverged by ≥ 50% relative to their closest previously genetically characterized viral relatives. Deep sequencing also generated genomes of Warrego and Wallal viruses, orbiviruses linked to kangaroo blindness, whose genomes had not been fully characterized. This study highlights viral metagenomics in concert with traditional arbovirus surveillance to characterize known and new arboviruses in field-collected mosquitoes. Follow-up epidemiological studies are required to determine whether the novel viruses infect humans. © 2013 Elsevier Inc. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Shih, Shin-Ru; Nemeroff, Martin E.; Krug, Robert M.
1995-07-01
The influenza virus M1 mRNA has two alternative 5' splice sites: a distal 5' splice site producing mRNA_3 that has the coding potential for 9 amino acids and a proximal 5' splice site producing M2 mRNA encoding the essential M2 ion-channel protein. Only mRNA_3 was made in uninfected cells transfected with DNA expressing M1 mRNA. Similarly, using nuclear extracts from uninfected cells, in vitro splicing of M1 mRNA yielded only mRNA_3. Only when the mRNA_3 5' splice site was inactivated by mutation was M2 mRNA made in uninfected cells and in uninfected cell extracts. In influenza virus-infected cells, M2 mRNA was made, but only after a delay, suggesting that newly synthesized viral gene product(s) were needed to activate the M2 5' splice site. We present strong evidence that these gene products are the complex of the three polymerase proteins, the same complex that functions in the transcription and replication of the viral genome. Gel shift experiments showed that the viral polymerase complex bound to the 5' end of the viral M1 mRNA in a sequence-specific and cap-dependent manner. During in vitro splicing catalyzed by uninfected cell extracts, the binding of the viral polymerase complex blocked the mRNA_3 5' splice site, resulting in the switch to the M2 mRNA 5' splice site and the production of M2 mRNA.
-
Vidal, R; González, R; Gil, F
2015-06-10
Innate pathway activation is fundamental for early anti-viral defense in fish, but currently there is insufficient understanding of how salmonid fish identify viral molecules and activate these pathways. The Toll-like receptor (TLR) is believed to play a crucial role in host defense of pathogenic microbes in the innate immune system. In the present study, the full-length cDNA of Salmo salar TLR3 (ssTLR3) was cloned. The ssTLR3 cDNA sequence was 6071 bp long, containing an open reading frame of 2754 bp and encoding 971 amino acids. The TLR group motifs, such as leucine-rich repeat (LRR) domains and Toll-interleukin-1 receptor (TIR) domains, were maintained in ssTLR3, with sixteen LRR domains and one TIR domain. In contrast to descriptions of the TLR3 in rainbow trout and the murine (TATA-less), we found a putative TATA box in the proximal promoter region 29 bp upstream of the transcription start point of ssTLR3. Multiple-sequence alignment analysis of the ssTLR3 protein-coding sequence with other known TLR3 sequences showed the sequence to be conserved among all species analyzed, implying that the function of the TLR3 had been sustained throughout evolution. The ssTLR3 mRNA expression patterns were measured using real-time PCR. The results revealed that TLR3 is widely expressed in various healthy tissues. Individuals challenged with infectious pancreatic necrosis virus and immunostimulated with polyinosinic:polycytidylic acid exhibited increased expression of TLR3 at the mRNA level, indicating that ssTLR3 may be involved in pathogen recognition in the early innate immune system.
-
Freudenberger, Nora; Meyer, Tina; Groitl, Peter; Dobner, Thomas; Schreiner, Sabrina
2018-02-15
Human adenoviruses (HAdV) are nonenveloped viruses containing a linear, double-stranded DNA genome surrounded by an icosahedral capsid. To allow proper viral replication, the genome is imported through the nuclear pore complex associated with viral core proteins. Until now, the role of these incoming virion proteins during the early phase of infection was poorly understood. The core protein V is speculated to bridge the core and the surrounding capsid. It binds the genome in a sequence-independent manner and localizes in the nucleus of infected cells, accumulating at nucleoli. Here, we show that protein V contains conserved SUMO conjugation motifs (SCMs). Mutation of these consensus motifs resulted in reduced SUMOylation of the protein; thus, protein V represents a novel target of the host SUMOylation machinery. To understand the role of protein V SUMO posttranslational modification during productive HAdV infection, we generated a replication-competent HAdV with SCM mutations within the protein V coding sequence. Phenotypic analyses revealed that these SCM mutations are beneficial for adenoviral replication. Blocking protein V SUMOylation at specific sites shifts the onset of viral DNA replication to earlier time points during infection and promotes viral gene expression. Simultaneously, the altered kinetics within the viral life cycle are accompanied by more efficient proteasomal degradation of host determinants and increased virus progeny production than that observed during wild-type infection. Taken together, our studies show that protein V SUMOylation reduces virus growth; hence, protein V SUMOylation represents an important novel aspect of the host antiviral strategy to limit virus replication and thereby points to potential intervention strategies. IMPORTANCE Many decades of research have revealed that HAdV structural proteins promote viral entry and mainly physical stability of the viral genome in the capsid. Our work over the last years showed that this concept needs expansion as the functions are more diverse. We showed that capsid protein VI regulates the antiviral response by modulation of the transcription factor Daxx during infection. Moreover, core protein VII interacts with SPOC1 restriction factor, which is beneficial for efficient viral gene expression. Here, we were able to show that core protein V also represents a novel substrate of the host SUMOylation machinery and contains several conserved SCMs; mutation of these consensus motifs reduced SUMOylation of the protein. Unexpectedly, we observed that introducing these mutations into HAdV promotes adenoviral replication. In conclusion, we offer novel insights into adenovirus core proteins and provide evidence that SUMOylation of HAdV factors regulates replication efficiency. Copyright © 2018 American Society for Microbiology.
-
Biological Information Transfer Beyond the Genetic Code: The Sugar Code
NASA Astrophysics Data System (ADS)
Gabius, H.-J.
In the era of genetic engineering, cloning, and genome sequencing the focus of research on the genetic code has received an even further accentuation in the public eye. In attempting, however, to understand intra- and intercellular recognition processes comprehensively, the two biochemical dimensions established by nucleic acids and proteins are not sufficient to satisfactorily explain all molecular events in, for example, cell adhesion or routing. The consideration of further code systems is essential to bridge this gap. A third biochemical alphabet forming code words with an information storage capacity second to no other substance class in rather small units (words, sentences) is established by monosaccharides (letters). As hardware oligosaccharides surpass peptides by more than seven orders of magnitude in the theoretical ability to build isomers, when the total of conceivable hexamers is calculated. In addition to the sequence complexity, the use of magnetic resonance spectroscopy and molecular modeling has been instrumental in discovering that even small glycans can often reside in not only one but several distinct low-energy conformations (keys). Intriguingly, conformers can display notably different capacities to fit snugly into the binding site of nonhomologous receptors (locks). This process, experimentally verified for two classes of lectins, is termed "differential conformer selection." It adds potential for shifts of the conformer equilibrium to modulate ligand properties dynamically and reversibly to the well-known changes in sequence (including anomeric positioning and linkage points) and in pattern of substitution, for example, by sulfation. In the intimate interplay with sugar receptors (lectins, enzymes, and antibodies) the message of coding units of the sugar code is deciphered. Their recognition will trigger postbinding signaling and the intended biological response. Knowledge about the driving forces for the molecular rendezvous, i.e., contributions of bidentate or cooperative hydrogen bonds, dispersion forces, stacking, and solvent rearrangement, will enable the design of high-affinity ligands or mimetics thereof. They embody clinical applications reaching from receptor localization in diagnostic pathology to cell type-selective targeting of drugs and inhibition of undesired cell adhesion in bacterial/viral infections, inflammation, or metastasis.
-
Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz
2013-01-01
Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.
-
Goz, Eli; Zafrir, Zohar; Tuller, Tamir
2018-04-30
Understanding how viruses co-evolve with their hosts and adapt various genomic level strategies in order to ensure their fitness may have essential implications in unveiling the secrets of viral evolution, and in developing new vaccines and therapeutic approaches. Here, based on a novel genomic analysis of 2,625 different viruses and 439 corresponding host organisms, we provide evidence of universal evolutionary selection for high dimensional 'silent' patterns of information hidden in the redundancy of viral genetic code. Our model suggests that long substrings of nucleotides in the coding regions of viruses from all classes, often also repeat in the corresponding viral hosts from all domains of life. Selection for these substrings cannot be explained only by such phenomena as codon usage bias, horizontal gene transfer, and the encoded proteins. Genes encoding structural proteins responsible for building the core of the viral particles were found to include more host-repeating substrings, and these substrings tend to appear in the middle parts of the viral coding regions. In addition, in human viruses these substrings tend to be enriched with motives related to transcription factors and RNA binding proteins. The host-repeating substrings are possibly related to the evolutionary pressure on the viruses to effectively interact with host's intracellular factors and to efficiently escape from the host's immune system. tamirtul@post.tau.ac.il (TT). Supplementary data are available at Bioinformatics online.
-
Vector platforms for gene therapy of inherited retinopathies
Trapani, Ivana; Puppo, Agostina; Auricchio, Alberto
2014-01-01
Inherited retinopathies (IR) are common untreatable blinding conditions. Most of them are inherited as monogenic disorders, due to mutations in genes expressed in retinal photoreceptors (PR) and in retinal pigment epithelium (RPE). The retina’s compatibility with gene transfer has made transduction of different retinal cell layers in small and large animal models via viral and non-viral vectors possible. The ongoing identification of novel viruses as well as modifications of existing ones based either on rational design or directed evolution have generated vector variants with improved transduction properties. Dozens of promising proofs of concept have been obtained in IR animal models with both viral and non-viral vectors, and some of them have been relayed to clinical trials. To date, recombinant vectors based on the adeno-associated virus (AAV) represent the most promising tool for retinal gene therapy, given their ability to efficiently deliver therapeutic genes to both PR and RPE and their excellent safety and efficacy profiles in humans. However, AAVs’ limited cargo capacity has prevented application of the viral vector to treatments requiring transfer of genes with a coding sequence larger than 5 kb. Vectors with larger capacity, i.e. nanoparticles, adenoviral and lentiviral vectors are being exploited for gene transfer to the retina in animal models and, more recently, in humans. This review focuses on the available platforms for retinal gene therapy to fight inherited blindness, highlights their main strengths and examines the efforts to overcome some of their limitations. PMID:25124745
-
Structure, sequence and expression of the hepatitis delta (δ) viral genome
NASA Astrophysics Data System (ADS)
Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael
1986-10-01
Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.
-
Arita, Minetaro; Zhu, Shuang-Li; Yoshida, Hiromu; Yoneyama, Tetsuo; Miyamura, Tatsuo; Shimizu, Hiroyuki
2005-01-01
Outbreaks of poliomyelitis caused by circulating vaccine-derived polioviruses (cVDPVs) have been reported in areas where indigenous wild polioviruses (PVs) were eliminated by vaccination. Most of these cVDPVs contained unidentified sequences in the nonstructural protein coding region which were considered to be derived from human enterovirus species C (HEV-C) by recombination. In this study, we report isolation of a Sabin 3-derived PV recombinant (Cambodia-02) from an acute flaccid paralysis (AFP) case in Cambodia in 2002. We attempted to identify the putative recombination counterpart of Cambodia-02 by sequence analysis of nonpolio enterovirus isolates from AFP cases in Cambodia from 1999 to 2003. Based on the previously estimated evolution rates of PVs, the recombination event resulting in Cambodia-02 was estimated to have occurred within 6 months after the administration of oral PV vaccine (99.3% nucleotide identity in VP1 region). The 2BC and the 3Dpol coding regions of Cambodia-02 were grouped into the genetic cluster of indigenous coxsackie A virus type 17 (CAV17) (the highest [87.1%] nucleotide identity) and the cluster of indigenous CAV13-CAV18 (the highest [94.9%] nucleotide identity) by the phylogenic analysis of the HEV-C isolates in 2002, respectively. CAV13-CAV18 and CAV17 were the dominant HEV-C serotypes in 2002 but not in 2001 and in 2003. We found a putative recombination between CAV13-CAV18 and CAV17 in the 3CDpro coding region of a CAV17 isolate. These results suggested that a part of the 3Dpol coding region of PV3(Cambodia-02) was derived from a HEV-C strain genetically related to indigenous CAV13-CAV18 strains in 2002 in Cambodia. PMID:16188967
-
Nouri, Shahideh; Salem, Nidá; Nigg, Jared C.
2015-01-01
ABSTRACT The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. IMPORTANCE Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. PMID:26676774
-
Nouri, Shahideh; Salem, Nidá; Nigg, Jared C; Falk, Bryce W
2015-12-16
The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
-
Barrero, Roberto A; Napier, Kathryn R; Cunnington, James; Liefting, Lia; Keenan, Sandi; Frampton, Rebekah A; Szabo, Tamas; Bulman, Simon; Hunter, Adam; Ward, Lisa; Whattam, Mark; Bellgard, Matthew I
2017-01-11
Detection and preventing entry of exotic viruses and viroids at the border is critical for protecting plant industries trade worldwide. Existing post entry quarantine screening protocols rely on time-consuming biological indicators and/or molecular assays that require knowledge of infecting viral pathogens. Plants have developed the ability to recognise and respond to viral infections through Dicer-like enzymes that cleave viral sequences into specific small RNA products. Many studies reported the use of a broad range of small RNAs encompassing the product sizes of several Dicer enzymes involved in distinct biological pathways. Here we optimise the assembly of viral sequences by using specific small RNA subsets. We sequenced the small RNA fractions of 21 plants held at quarantine glasshouse facilities in Australia and New Zealand. Benchmarking of several de novo assembler tools yielded SPAdes using a kmer of 19 to produce the best assembly outcomes. We also found that de novo assembly using 21-25 nt small RNAs can result in chimeric assemblies of viral sequences and plant host sequences. Such non-specific assemblies can be resolved by using 21-22 nt or 24 nt small RNAs subsets. Among the 21 selected samples, we identified contigs with sequence similarity to 18 viruses and 3 viroids in 13 samples. Most of the viruses were assembled using only 21-22 nt long virus-derived siRNAs (viRNAs), except for one Citrus endogenous pararetrovirus that was more efficiently assembled using 24 nt long viRNAs. All three viroids found in this study were fully assembled using either 21-22 nt or 24 nt viRNAs. Optimised analysis workflows were customised within the Yabi web-based analytical environment. We present a fully automated viral surveillance and diagnosis web-based bioinformatics toolkit that provides a flexible, user-friendly, robust and scalable interface for the discovery and diagnosis of viral pathogens. We have implemented an automated viral surveillance and diagnosis (VSD) bioinformatics toolkit that produces improved viruses and viroid sequence assemblies. The VSD toolkit provides several optimised and reusable workflows applicable to distinct viral pathogens. We envisage that this resource will facilitate the surveillance and diagnosis viral pathogens in plants, insects and invertebrates.
-
Gourraud, P A; Karaouni, A; Woo, J M; Schmidt, T; Oksenberg, J R; Hecht, F M; Liegler, T J; Barbour, J D
2011-03-01
We examined single nucleotide polymorphisms (SNP) in the APOBEC3 locus on chromosome 22, paired with population sequences of pro-viral human immunodeficiency virus-1 (HIV-1) vif from peripheral blood mononuclear cells, from 96 recently HIV-1-infected treatment-naive adults. We found evidence for the existence of an APOBEC3H linkage disequilibrium (LD) block associated with variation in GA → AA, or APOBEC3F/H signature, sequence changes in pro-viral HIV-1 vif sequence (top 10 significant SNPs with a significant p = 4.8 × 10(-3)). We identified a common five position risk haplotype distal to APOBEC3H (A3Hrh). These markers were in high LD (D' = 1; r(2) = 0.98) to a previously described A3H "RED" haplotype containing a variant (E121) with enhanced susceptibility to HIV-1 Vif. This association was confirmed by a haplotype analysis. Homozygote carriers of the A3Hrh had lower GA->AA (A3F/H) sequence editing upon pro-viral HIV-1 vif sequence (p = 0.01), and lower HIV-1 RNA levels over time during early, untreated HIV-1 infection, (p = 0.015 mixed effects model). This effect may be due to enhanced susceptibility of A3H forms to HIV-1 Vif mediated viral suppression of sequence editing activity, slowing viral diversification and escape from immune responses. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
-
Germer, Jeffrey J.; Ankoudinova, Irina; Belousov, Yevgeniy S.; Mahoney, Walt; Dong, Chen; Meng, Jihong; Mandrekar, Jayawant N.
2017-01-01
ABSTRACT Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A chimeric bovine viral diarrhea virus construct containing an HEV RNA insert (SynTura HEV) was developed, value assigned with the first World Health Organization (WHO) international standard for HEV RNA (code 6329/10), and used to prepare working assay calibrators and controls, which supported an assay quantification range of 100 to 5,000,000 IU/ml. The analytical sensitivity (95% detection rate) of this assay was 25.2 IU/ml (95% confidence interval [CI], 19.2 to 44.1 IU/ml). The assay successfully amplified 16 different HEV sequences with significant nucleotide mismatching in primer/probe binding regions, while evaluation of a WHO international reference panel for HEV genotypes (code 8578/13) showed viral load results falling within the result ranges generated by WHO collaborative study participants for all panel members (genotypes 1 to 4). Broadly reactive RT-qPCR primers targeting HEV ORF2/3 were successfully adapted for use in an assay based on Pleiades probe chemistry. The availability of secondary standards calibrated to the WHO HEV international standard can improve the standardization and performance of assays for the detection and quantification of HEV RNA. PMID:28228493
-
Li, Yan; Khalafalla, Abdelmalik Ibrahim; Paden, Clinton R; Yusof, Mohammed F; Eltahir, Yassir M; Al Hammadi, Zulaikha M; Tao, Ying; Queen, Krista; Hosani, Farida Al; Gerber, Susan I; Hall, Aron J; Al Muhairi, Salama; Tong, Suxiang
2017-01-01
Camels are known carriers for many viral pathogens, including Middle East respiratory syndrome coronavirus (MERS-CoV). It is likely that there are additional, as yet unidentified viruses in camels with the potential to cause disease in humans. In this study, we performed metagenomic sequencing analysis on nasopharyngeal swab samples from 108 MERS-CoV-positive dromedary camels from a live animal market in Abu Dhabi, United Arab Emirates. We obtained a total of 846.72 million high-quality reads from these nasopharyngeal swab samples, of which 2.88 million (0.34%) were related to viral sequences while 512.63 million (60.5%) and 50.87 million (6%) matched bacterial and eukaryotic sequences, respectively. Among the viral reads, sequences related to mammalian viruses from 13 genera in 10 viral families were identified, including Coronaviridae, Nairoviridae, Paramyxoviridae, Parvoviridae, Polyomaviridae, Papillomaviridae, Astroviridae, Picornaviridae, Poxviridae, and Genomoviridae. Some viral sequences belong to known camel or human viruses and others are from potentially novel camel viruses with only limited sequence similarity to virus sequences in GenBank. A total of five potentially novel virus species or strains were identified. Co-infection of at least two recently identified camel coronaviruses was detected in 92.6% of the camels in the study. This study provides a comprehensive survey of viruses in the virome of upper respiratory samples in camels that have extensive contact with the human population.
-
Silin, D; Lyubomska, O; Ludlow, M; Duprex, W P; Rima, B K
2007-12-01
We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a "quick response" in vaccine development against well-known and "new" viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems.
-
Silin, D.; Lyubomska, O.; Ludlow, M.; Duprex, W. P.; Rima, B. K.
2007-01-01
We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a “quick response” in vaccine development against well-known and “new” viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems. PMID:17898047
-
Investigating the viral ecology of global bee communities with high-throughput metagenomics.
Galbraith, David A; Fuller, Zachary L; Ray, Allyson M; Brockmann, Axel; Frazier, Maryann; Gikungu, Mary W; Martinez, J Francisco Iturralde; Kapheim, Karen M; Kerby, Jeffrey T; Kocher, Sarah D; Losyev, Oleksiy; Muli, Elliud; Patch, Harland M; Rosa, Cristina; Sakamoto, Joyce M; Stanley, Scott; Vaudo, Anthony D; Grozinger, Christina M
2018-06-11
Bee viral ecology is a fascinating emerging area of research: viruses exert a range of effects on their hosts, exacerbate impacts of other environmental stressors, and, importantly, are readily shared across multiple bee species in a community. However, our understanding of bee viral communities is limited, as it is primarily derived from studies of North American and European Apis mellifera populations. Here, we examined viruses in populations of A. mellifera and 11 other bee species from 9 countries, across 4 continents and Oceania. We developed a novel pipeline to rapidly and inexpensively screen for bee viruses. This pipeline includes purification of encapsulated RNA/DNA viruses, sequence-independent amplification, high throughput sequencing, integrated assembly of contigs, and filtering to identify contigs specifically corresponding to viral sequences. We identified sequences for (+)ssRNA, (-)ssRNA, dsRNA, and ssDNA viruses. Overall, we found 127 contigs corresponding to novel viruses (i.e. previously not observed in bees), with 27 represented by >0.1% of the reads in a given sample, and 7 contained an RdRp or replicase sequence which could be used for robust phylogenetic analysis. This study provides a sequence-independent pipeline for viral metagenomics analysis, and greatly expands our understanding of the diversity of viruses found in bee communities.
-
Herbert, Kristina M.; Nag, Anita
2016-01-01
Viral infection initiates an array of changes in host gene expression. Many viruses dampen host protein expression and attempt to evade the host anti-viral defense machinery. Host gene expression is suppressed at several stages of host messenger RNA (mRNA) formation including selective degradation of translationally competent messenger RNAs. Besides mRNAs, host cells also express a variety of noncoding RNAs, including small RNAs, that may also be subject to inhibition upon viral infection. In this review we focused on different ways viruses antagonize coding and noncoding RNAs in the host cell to its advantage. PMID:27271653
-
Molecular characterization of Banana streak virus isolate from Musa Acuminata in China.
Zhuang, Jun; Wang, Jian-Hua; Zhang, Xin; Liu, Zhi-Xin
2011-12-01
Banana streak virus (BSV), a member of genus Badnavirus, is a causal agent of banana streak disease throughout the world. The genetic diversity of BSVs from different regions of banana plantations has previously been investigated, but there are relatively few reports of the genetic characteristic of episomal (non-integrated) BSV genomes isolated from China. Here, the complete genome, a total of 7722bp (GenBank accession number DQ092436), of an isolate of Banana streak virus (BSV) on cultivar Cavendish (BSAcYNV) in Yunnan, China was determined. The genome organises in the typical manner of badnaviruses. The intergenic region of genomic DNA contains a large stem-loop, which may contribute to the ribosome shift into the following open reading frames (ORFs). The coding region of BSAcYNV consists of three overlapping ORFs, ORF1 with a non-AUG start codon and ORF2 encoding two small proteins are individually involved in viral movement and ORF3 encodes a polyprotein. Besides the complete genome, a defective genome lacking the whole RNA leader region and a majority of ORF1 and which encompasses 6525bp was also isolated and sequenced from this BSV DNA reservoir in infected banana plants. Sequence analyses showed that BSAcYNV has closest similarity in terms of genome organization and the coding assignments with an BSV isolate from Vietnam (BSAcVNV). The corresponding coding regions shared identities of 88% and -95% at nucleotide and amino acid levels, respectively. Phylogenetic analysis also indicated BSAcYNV shared the closest geographical evolutionary relationship to BSAcVNV among sequenced banana streak badnaviruses.
-
Immunity: Insect Immune Memory Goes Viral.
Ligoxygakis, Petros
2017-11-20
Adaptive memory in insect immunity has been controversial. In this issue, Andino and co-workers propose that acquisition of viral sequences in the host genome gives rise to anti-sense, anti-viral piRNAs. Such sequences can be regarded as both a genomic archive of past infections and as an armour of potential heritable memory. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Viral dark matter and virus–host interactions resolved from publicly available microbial genomes
Roux, Simon; Hallam, Steven J; Woyke, Tanja; Sullivan, Matthew B
2015-01-01
The ecological importance of viruses is now widely recognized, yet our limited knowledge of viral sequence space and virus–host interactions precludes accurate prediction of their roles and impacts. In this study, we mined publicly available bacterial and archaeal genomic data sets to identify 12,498 high-confidence viral genomes linked to their microbial hosts. These data augment public data sets 10-fold, provide first viral sequences for 13 new bacterial phyla including ecologically abundant phyla, and help taxonomically identify 7–38% of ‘unknown’ sequence space in viromes. Genome- and network-based classification was largely consistent with accepted viral taxonomy and suggested that (i) 264 new viral genera were identified (doubling known genera) and (ii) cross-taxon genomic recombination is limited. Further analyses provided empirical data on extrachromosomal prophages and coinfection prevalences, as well as evaluation of in silico virus–host linkage predictions. Together these findings illustrate the value of mining viral signal from microbial genomes. DOI: http://dx.doi.org/10.7554/eLife.08490.001 PMID:26200428
-
The web server of IBM's Bioinformatics and Pattern Discovery group: 2004 update
Huynh, Tien; Rigoutsos, Isidore
2004-01-01
In this report, we provide an update on the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server, which is operational around the clock, provides access to a large number of methods that have been developed and published by the group's members. There is an increasing number of problems that these tools can help tackle; these problems range from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences, the identification—directly from sequence—of structural deviations from α-helicity and the annotation of amino acid sequences for antimicrobial activity. Additionally, annotations for more than 130 archaeal, bacterial, eukaryotic and viral genomes are now available on-line and can be searched interactively. The tools and code bundles continue to be accessible from http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:15215340
-
Information Entropy Analysis of the H1N1 Genetic Code
NASA Astrophysics Data System (ADS)
Martwick, Andy
2010-03-01
During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.
-
A +1 ribosomal frameshifting motif prevalent among plant amalgaviruses.
Nibert, Max L; Pyle, Jesse D; Firth, Andrew E
2016-11-01
Sequence accessions attributable to novel plant amalgaviruses have been found in the Transcriptome Shotgun Assembly database. Sixteen accessions, derived from 12 different plant species, appear to encompass the complete protein-coding regions of the proposed amalgaviruses, which would substantially expand the size of genus Amalgavirus from 4 current species. Other findings include evidence for UUU_CGN as a +1 ribosomal frameshifting motif prevalent among plant amalgaviruses; for a variant version of this motif found thus far in only two amalgaviruses from solanaceous plants; for a region of α-helical coiled coil propensity conserved in a central region of the ORF1 translation product of plant amalgaviruses; and for conserved sequences in a C-terminal region of the ORF2 translation product (RNA-dependent RNA polymerase) of plant amalgaviruses, seemingly beyond the region of conserved polymerase motifs. These results additionally illustrate the value of mining the TSA database and others for novel viral sequences for comparative analyses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
-
Ho, Daniel W H; Sze, Karen M F; Ng, Irene O L
2015-08-28
Viral integration into the human genome upon infection is an important risk factor for various human malignancies. We developed viral integration site detection tool called Virus-Clip, which makes use of information extracted from soft-clipped sequencing reads to identify exact positions of human and virus breakpoints of integration events. With initial read alignment to virus reference genome and streamlined procedures, Virus-Clip delivers a simple, fast and memory-efficient solution to viral integration site detection. Moreover, it can also automatically annotate the integration events with the corresponding affected human genes. Virus-Clip has been verified using whole-transcriptome sequencing data and its detection was validated to have satisfactory sensitivity and specificity. Marked advancement in performance was detected, compared to existing tools. It is applicable to versatile types of data including whole-genome sequencing, whole-transcriptome sequencing, and targeted sequencing. Virus-Clip is available at http://web.hku.hk/~dwhho/Virus-Clip.zip.
-
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
-
Sasaya, Takahide; Kusaba, Shinnosuke; Ishikawa, Koichi; Koganezawa, Hiroki
2004-09-01
Lettuce big-vein virus (LBVV) is the type species of the genus Varicosavirus and is a two-segmented negative-sense single-stranded RNA virus. The larger LBVV genome segment (RNA1) consists of 6797 nt and encodes an L polymerase that resembles that of rhabdoviruses. Here, the nucleotide sequence of the second LBVV genome segment (RNA2) is reported. LBVV RNA2 consisted of 6081 nt and contained antisense information for five major ORFs: ORF1 (nt 210-1403 on the viral RNA), ORF2 (nt 1493-2494), ORF3 (nt 2617-3489), ORF4 (nt 3843-4337) and ORF5 (nt 4530-5636), which had coding capacities of 44, 36, 32, 19 and 41 kDa, respectively. The gene at the 3' end of the viral RNA encoded a coat protein, while the other four genes encoded proteins of unknown functions. The 3'-terminal 11 nt of LBVV RNA2 were identical to those of LBVV RNA1, and the 5'-terminal regions of LBVV RNA1 and RNA2 contained a long common nucleotide stretch of about 100 nt. Northern blot analysis using probes specific to the individual ORFs revealed that LBVV transcribes monocistronic RNAs. Analysis of the terminal sequences, and primer extension and RNase H digestion analysis of LBVV mRNAs, suggested that LBVV utilizes a transcription termination/initiation strategy comparable with that of rhabdoviruses.
-
Metagenomic Analysis of Viral Communities in (Hado)Pelagic Sediments
Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken
2013-01-01
In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 106 to 1011 viruses/cm3 of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24−30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10−3 in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95−99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses. PMID:23468952
-
Metagenomic analysis of viral communities in (hado)pelagic sediments.
Yoshida, Mitsuhiro; Takaki, Yoshihiro; Eitoku, Masamitsu; Nunoura, Takuro; Takai, Ken
2013-01-01
In this study, we analyzed viral metagenomes (viromes) in the sedimentary habitats of three geographically and geologically distinct (hado)pelagic environments in the northwest Pacific; the Izu-Ogasawara Trench (water depth = 9,760 m) (OG), the Challenger Deep in the Mariana Trench (10,325 m) (MA), and the forearc basin off the Shimokita Peninsula (1,181 m) (SH). Virus abundance ranged from 10(6) to 10(11) viruses/cm(3) of sediments (down to 30 cm below the seafloor [cmbsf]). We recovered viral DNA assemblages (viromes) from the (hado)pelagic sediment samples and obtained a total of 37,458, 39,882, and 70,882 sequence reads by 454 GS FLX Titanium pyrosequencing from the virome libraries of the OG, MA, and SH (hado)pelagic sediments, respectively. Only 24-30% of the sequence reads from each virome library exhibited significant similarities to the sequences deposited in the public nr protein database (E-value <10(-3) in BLAST). Among the sequences identified as potential viral genes based on the BLAST search, 95-99% of the sequence reads in each library were related to genes from single-stranded DNA (ssDNA) viral families, including Microviridae, Circoviridae, and Geminiviridae. A relatively high abundance of sequences related to the genetic markers (major capsid protein [VP1] and replication protein [Rep]) of two ssDNA viral groups were also detected in these libraries, thereby revealing a high genotypic diversity of their viruses (833 genotypes for VP1 and 2,551 genotypes for Rep). A majority of the viral genes predicted from each library were classified into three ssDNA viral protein categories: Rep, VP1, and minor capsid protein. The deep-sea sedimentary viromes were distinct from the viromes obtained from the oceanic and fresh waters and marine eukaryotes, and thus, deep-sea sediments harbor novel viromes, including previously unidentified ssDNA viruses.
-
Setiawan, Laurentia C; Gijsbers, Esther F; van Nuenen, Adrianus C; Kootstra, Neeltje A
2015-08-01
The HLA-B27 allele is over-represented among human immunodeficiency virus type 1-infected long-term non-progressors. In these patients, strong CTL responses targeting HLA-B27-restricted viral epitopes have been associated with long-term asymptomatic survival. Indeed, loss of control of viraemia in HLA-B27 patients has been associated with CTL escape at position 264 in the immunodominant KK10 epitope. This CTL escape mutation in the viral Gag protein has been associated with severe viral attenuation and may require the presence of compensatory mutations before emerging. Here, we studied sequence evolution within HLA-B27-restricted CTL epitopes in the viral Gag protein during the course of infection of seven HLA-B27-positive patients. Longitudinal gag sequences obtained at different time points around the time of AIDS diagnosis were obtained and analysed for the presence of mutations in epitopes restricted by HLA-B27, and for potential compensatory mutations. Sequence variations were observed in the HLA-B27-restricted CTL epitopes IK9 and DR11, and the immunodominant KK10 epitope. However, the presence of sequence variations in the HLA-B27-restricted CTL epitopes could not be associated with an increase in viraemia in the majority of the patients studied. Furthermore, we observed low genetic diversity in the gag region of the viral variants throughout the course of infection, which is indicative of low viral replication and corresponds to the low viral load observed in the HLA-B27-positive patients. These data indicated that control of viral replication can be maintained in HLA-B27-positive patients despite the emergence of viral mutations in HLA-B27-restricted epitopes.
-
Viral quasispecies inference from 454 pyrosequencing
2013-01-01
Background Many potentially life-threatening infectious viruses are highly mutable in nature. Characterizing the fittest variants within a quasispecies from infected patients is expected to allow unprecedented opportunities to investigate the relationship between quasispecies diversity and disease epidemiology. The advent of next-generation sequencing technologies has allowed the study of virus diversity with high-throughput sequencing, although these methods come with higher rates of errors which can artificially increase diversity. Results Here we introduce a novel computational approach that incorporates base quality scores from next-generation sequencers for reconstructing viral genome sequences that simultaneously infers the number of variants within a quasispecies that are present. Comparisons on simulated and clinical data on dengue virus suggest that the novel approach provides a more accurate inference of the underlying number of variants within the quasispecies, which is vital for clinical efforts in mapping the within-host viral diversity. Sequence alignments generated by our approach are also found to exhibit lower rates of error. Conclusions The ability to infer the viral quasispecies colony that is present within a human host provides the potential for a more accurate classification of the viral phenotype. Understanding the genomics of viruses will be relevant not just to studying how to control or even eradicate these viral infectious diseases, but also in learning about the innate protection in the human host against the viruses. PMID:24308284
-
The Spleen Is an HIV-1 Sanctuary During Combined Antiretroviral Therapy.
Nolan, David J; Rose, Rebecca; Rodriguez, Patricia H; Salemi, Marco; Singer, Elyse J; Lamers, Susanna L; McGrath, Michael S
2018-01-01
Combined antiretroviral therapy (cART) does not eradicate HIV, which persists for years and can re-establish replication if treatment is stopped. The current challenge is identifying those tissues harboring virus through cART. Here, we used HIV env-nef single genome sequencing and HIV gag droplet digital PCR (ddPCR) to survey 50 tissues from five subjects on cART with no detectable plasma viral load at death. The spleen most consistently contained multiple proviral and expressed sequences (4/5 participants). Spleen-derived HIV demonstrated two distinct phylogenetic patterns: multiple identical sequences, often from different tissues, as well as diverse viral sequences on long terminal branches. Our results suggested that ddPCR may overestimate the size of the tissue-based viral reservoir. The spleen, a lymphatic organ at the intersection of the immune and circulatory systems, may play a key role in viral persistence.
-
Kawasaki, Junna; Kawamura, Maki; Ohsato, Yoshiharu; Ito, Jumpei; Nishigaki, Kazuo
2017-10-15
Recombination events induce significant genetic changes, and this process can result in virus genetic diversity or in the generation of novel pathogenicity. We discovered a new recombinant feline leukemia virus (FeLV) gag gene harboring an unrelated insertion, termed the X region, which was derived from Felis catus endogenous gammaretrovirus 4 (FcERV-gamma4). The identified FcERV-gamma4 proviruses have lost their coding capabilities, but some can express their viral RNA in feline tissues. Although the X-region-carrying recombinant FeLVs appeared to be replication-defective viruses, they were detected in 6.4% of tested FeLV-infected cats. All isolated recombinant FeLV clones commonly incorporated a middle part of the FcERV-gamma4 5'-leader region as an X region. Surprisingly, a sequence corresponding to the portion contained in all X regions is also present in at least 13 endogenous retroviruses (ERVs) observed in the cat, human, primate, and pig genomes. We termed this shared genetic feature the commonly shared (CS) sequence. Despite our phylogenetic analysis indicating that all CS-sequence-carrying ERVs are classified as gammaretroviruses, no obvious closeness was revealed among these ERVs. However, the Shannon entropy in the CS sequence was lower than that in other parts of the provirus genome. Notably, the CS sequence of human endogenous retrovirus T had 73.8% similarity with that of FcERV-gamma4, and specific signals were detected in the human genome by Southern blot analysis using a probe for the FcERV-gamma4 CS sequence. Our results provide an interesting evolutionary history for CS-sequence circulation among several distinct ancestral viruses and a novel recombined virus over a prolonged period. IMPORTANCE Recombination among ERVs or modern viral genomes causes a rapid evolution of retroviruses, and this phenomenon can result in the serious situation of viral disease reemergence. We identified a novel recombinant FeLV gag gene that contains an unrelated sequence, termed the X region. This region originated from the 5' leader of FcERV-gamma4, a replication-incompetent feline ERV. Surprisingly, a sequence corresponding to the X region is also present in the 5' portion of other ERVs, including human endogenous retroviruses. Scattered copies of the ERVs carrying the unique genetic feature, here named the commonly shared (CS) sequence, were found in each host genome, suggesting that ancestral viruses may have captured and maintained the CS sequence. More recently, a novel recombinant FeLV hijacked the CS sequence from inactivated FcERV-gamma4 as the X region. Therefore, tracing the CS sequences can provide unique models for not only the modern reservoir of new recombinant viruses but also the genetic features shared among ancient retroviruses. Copyright © 2017 American Society for Microbiology.
-
Human La binds mRNAs through contacts to the poly(A) tail.
Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A
2018-05-04
In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3'OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3'OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail.
-
Murphy, B; Hillman, C; McDonnel, S
2014-01-22
Feline immunodeficiency virus (FIV)-infected cats enter a clinically asymptomatic phase during chronic infection. Despite the lack of overt clinical disease, the asymptomatic phase is characterized by persistent immunologic impairment. In the peripheral blood obtained from cats experimentally infected with FIV-C for approximately 5 years, we identified a persistent inversion of the CD4/CD8 ratio. We cloned and sequenced the FIV-C long terminal repeat containing the viral promoter from cells infected with the inoculating virus and from in vivo-derived peripheral blood mononuclear cells and CD4 T cells isolated at multiple time points throughout the asymptomatic phase. Relative to the inoculating virus, viral sequences amplified from cells isolated from all of the infected animals demonstrated multiple single nucleotide mutations and a short deletion within the viral U3, R and U5 regions. A transcriptionally inactivating proviral mutation in the U3 promoter AP-1 site was identified at multiple time points from all of the infected animals but not within cell-associated viral RNA. In contrast, no mutations were identified within the sequence of the viral dUTPase gene amplified from PBMC isolated at approximately 5 years post-infection relative to the inoculating sequence. The possible implications of these mutations to viral pathogenesis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Palma, Paolo; Zangari, Paola; Alteri, Claudia; Tchidjou, Hyppolite K; Manno, Emma Concetta; Liuzzi, Giuseppina; Perno, Carlo Federico; Rossi, Paolo; Bertoli, Ada; Bernardi, Stefania
2016-12-09
HIV genetic diversity implicates major challenges for the control of viral infection by the immune system and for the identification of an effective immunotherapeutic strategy. With the present case report we underline as HIV evolution could be effectively halted by early antiretroviral treatment (eART). Few cases supported this evidence due to the difficulty of performing amplification and sequencing analysis in long-term viral suppressed patients. Here, we reported the case of limited HIV-1 viral evolution over time in a successful early treated child. A perinatally HIV-1 infected infant was treated within 7 weeks of age with zidovudine, lamivudine, nevirapine and lopinavir/ritonavir. At antiretroviral treatment (ART) initiation HIV-1 viral load (VL) and CD4 percentage were >500,000 copies/ml and 35%, respectively. Plasma genotypic resistance test showed a wild-type virus. The child reached VL undetectability after 33 weeks of combination antiretroviral therapy (cART) since he maintained a stable VL <40copies/ml. After 116 weeks on ART we were able to perform amplification and sequencing assay on the plasma virus. At this time VL was <40 copies/ml and CD4 percentage was 40%. Again the genotypic resistance test revealed a wild-type virus. The phylogenetic analysis performed on the HIV-1 pol sequences of the mother and the child revealed that sequences clustered with C subtype reference strains and formed a monophyletic cluster distinct from the other C sequences included in the analysis (bootstrap value >90%). Any major evolutionary divergence was detected. eART limits the viral evolution avoiding the emergence of new viral variants. This result may have important implications in host immune control and may sustain the challenge search of new personalized immunotherapeutic approaches to achieve a prolonged viral remission.
-
SARS-CoV-Encoded Small RNAs Contribute to Infection-Associated Lung Pathology.
Morales, Lucía; Oliveros, Juan Carlos; Fernandez-Delgado, Raúl; tenOever, Benjamin Robert; Enjuanes, Luis; Sola, Isabel
2017-03-08
Severe acute respiratory syndrome coronavirus (SARS-CoV) causes lethal disease in humans, which is characterized by exacerbated inflammatory response and extensive lung pathology. To address the relevance of small non-coding RNAs in SARS-CoV pathology, we deep sequenced RNAs from the lungs of infected mice and discovered three 18-22 nt small viral RNAs (svRNAs). The three svRNAs were derived from the nsp3 (svRNA-nsp3.1 and -nsp3.2) and N (svRNA-N) genomic regions of SARS-CoV. Biogenesis of CoV svRNAs was RNase III, cell type, and host species independent, but it was dependent on the extent of viral replication. Antagomir-mediated inhibition of svRNA-N significantly reduced in vivo lung pathology and pro-inflammatory cytokine expression. Taken together, these data indicate that svRNAs contribute to SARS-CoV pathogenesis and highlight the potential of svRNA-N antagomirs as antivirals. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Carter-Timofte, Madalina E; Hansen, Anders F; Christiansen, Mette; Paludan, Søren R; Mogensen, Trine H
2018-05-01
Recently, deficiency in the cytosolic DNA sensor RNA Polymerase III was described in children with severe primary varicella-zoster virus (VZV) infection in the CNS and lungs. In the present study we examined adult patients with VZV CNS infection caused by viral reactivation. By whole exome sequencing we identified mutations in POL III genes in two of eight patients. These mutations were located in the coding regions of the subunits POLR3A and POLR3E. In functional assays, we found impaired expression of antiviral and inflammatory cytokines in response to the POL III agonist Poly(dA:dT) as well as increased viral replication in patient cells compared to controls. Altogether, this study provides significant extension on the current knowledge on susceptibility to VZV infection by demonstrating mutations in POL III genes associated with impaired immunological sensing of AT-rich DNA in adult patients with VZV CNS infection.
-
Shayakhmetov, D; Kovalenko, D; Yurov, G; Borisenko, A; Tikchonenko, T
1997-08-01
Use of viral inducible promoters which can be activated by virus-specific transactivator proteins to drive expression of antisense (as)RNA genes appears to be an attractive approach to inhibit virus infections in vivo. To this end, we have constructed an asRNA gene expressed from the bovine leukaemia virus (BLV) U3 promoter that is complementary to the R-U5 region of the BLV genome. This is the region that is most susceptible to inhibition by asRNA. With plasmid pLU, which expresses the asRNA gene under the control of the BLV U3 promoter, 75% inhibition of virus replication was attained in CC81 cells (the molar ratio of pLU DNA over BLV proviral DNA in the transfection mixture was 5:1). Plasmid pLT, which contains only the BLV U3 promoter without any asRNA-coding region, also efficiently (up to 60%) inhibited virus replication when cotransfected with BLV proviral DNA at a ratio of 20:1. It was suggested that competition between functional and 'empty' viral promoters for the viral transactivator protein p38tax could account for this inhibition. An immunoblotting assay showed that in the presence of nuclear extracts from CC81 cells exogenous BLV p38tax specifically associates with its responsive sequence located in the BLV U3 promoter. Moreover, the additional expression of p38tax in CC81 cells abolishes the inhibitory effect of the empty viral promoter. These observations suggest a new mechanism of BLV inhibition caused, most probably, by sequestering of the viral transactivator protein.
-
Amexis, Georgios; Oeth, Paul; Abel, Kenneth; Ivshina, Anna; Pelloquin, Francois; Cantor, Charles R.; Braun, Andreas; Chumakov, Konstantin
2001-01-01
RNA viruses exist as quasispecies, heterogeneous and dynamic mixtures of mutants having one or more consensus sequences. An adequate description of the genomic structure of such viral populations must include the consensus sequence(s) plus a quantitative assessment of sequence heterogeneities. For example, in quality control of live attenuated viral vaccines, the presence of even small quantities of mutants or revertants may indicate incomplete or unstable attenuation that may influence vaccine safety. Previously, we demonstrated the monitoring of oral poliovirus vaccine with the use of mutant analysis by PCR and restriction enzyme cleavage (MAPREC). In this report, we investigate genetic variation in live attenuated mumps virus vaccine by using both MAPREC and a platform (DNA MassArray) based on matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Mumps vaccines prepared from the Jeryl Lynn strain typically contain at least two distinct viral substrains, JL1 and JL2, which have been characterized by full length sequencing. We report the development of assays for characterizing sequence variants in these substrains and demonstrate their use in quantitative analysis of substrains and sequence variations in mixed virus cultures and mumps vaccines. The results obtained from both the MAPREC and MALDI-TOF methods showed excellent correlation. This suggests the potential utility of MALDI-TOF for routine quality control of live viral vaccines and for assessment of genetic stability and quantitative monitoring of genetic changes in other RNA viruses of clinical interest. PMID:11593021
-
Eltahir, Yassir M.; Al Hammadi, Zulaikha M.; Tao, Ying; Queen, Krista; Hosani, Farida Al; Gerber, Susan I.; Hall, Aron J.; Al Muhairi, Salama
2017-01-01
Camels are known carriers for many viral pathogens, including Middle East respiratory syndrome coronavirus (MERS-CoV). It is likely that there are additional, as yet unidentified viruses in camels with the potential to cause disease in humans. In this study, we performed metagenomic sequencing analysis on nasopharyngeal swab samples from 108 MERS-CoV-positive dromedary camels from a live animal market in Abu Dhabi, United Arab Emirates. We obtained a total of 846.72 million high-quality reads from these nasopharyngeal swab samples, of which 2.88 million (0.34%) were related to viral sequences while 512.63 million (60.5%) and 50.87 million (6%) matched bacterial and eukaryotic sequences, respectively. Among the viral reads, sequences related to mammalian viruses from 13 genera in 10 viral families were identified, including Coronaviridae, Nairoviridae, Paramyxoviridae, Parvoviridae, Polyomaviridae, Papillomaviridae, Astroviridae, Picornaviridae, Poxviridae, and Genomoviridae. Some viral sequences belong to known camel or human viruses and others are from potentially novel camel viruses with only limited sequence similarity to virus sequences in GenBank. A total of five potentially novel virus species or strains were identified. Co-infection of at least two recently identified camel coronaviruses was detected in 92.6% of the camels in the study. This study provides a comprehensive survey of viruses in the virome of upper respiratory samples in camels that have extensive contact with the human population. PMID:28902913
-
Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.
Hiscock, D; Upton, C
2000-05-01
The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .
-
A wide extent of inter-strain diversity in virulent and vaccine strains of alphaherpesviruses.
Szpara, Moriah L; Tafuri, Yolanda R; Parsons, Lance; Shamim, S Rafi; Verstrepen, Kevin J; Legendre, Matthieu; Enquist, L W
2011-10-01
Alphaherpesviruses are widespread in the human population, and include herpes simplex virus 1 (HSV-1) and 2, and varicella zoster virus (VZV). These viral pathogens cause epithelial lesions, and then infect the nervous system to cause lifelong latency, reactivation, and spread. A related veterinary herpesvirus, pseudorabies (PRV), causes similar disease in livestock that result in significant economic losses. Vaccines developed for VZV and PRV serve as useful models for the development of an HSV-1 vaccine. We present full genome sequence comparisons of the PRV vaccine strain Bartha, and two virulent PRV isolates, Kaplan and Becker. These genome sequences were determined by high-throughput sequencing and assembly, and present new insights into the attenuation of a mammalian alphaherpesvirus vaccine strain. We find many previously unknown coding differences between PRV Bartha and the virulent strains, including changes to the fusion proteins gH and gB, and over forty other viral proteins. Inter-strain variation in PRV protein sequences is much closer to levels previously observed for HSV-1 than for the highly stable VZV proteome. Almost 20% of the PRV genome contains tandem short sequence repeats (SSRs), a class of nucleic acids motifs whose length-variation has been associated with changes in DNA binding site efficiency, transcriptional regulation, and protein interactions. We find SSRs throughout the herpesvirus family, and provide the first global characterization of SSRs in viruses, both within and between strains. We find SSR length variation between different isolates of PRV and HSV-1, which may provide a new mechanism for phenotypic variation between strains. Finally, we detected a small number of polymorphic bases within each plaque-purified PRV strain, and we characterize the effect of passage and plaque-purification on these polymorphisms. These data add to growing evidence that even plaque-purified stocks of stable DNA viruses exhibit limited sequence heterogeneity, which likely seeds future strain evolution.
-
Standing your Ground to Exoribonucleases: Function of Flavivirus Long Non-coding RNAs
Charley, Phillida A.; Wilusz, Jeffrey
2015-01-01
Members of the Flaviviridae (e.g. Dengue virus, West Nile virus, and Hepatitis C virus) contain a positive-sense RNA genome that encodes a large polyprotein. It is now also clear most if not all of these viruses also produce an abundant subgenomic long non-coding RNA. These non-coding RNAs, which are called subgenomicflavivirus RNAs (sfRNAs) or Xrn1-resistant RNAs (xrRNAs), are stable decay intermediates generated from the viral genomic RNA through the stalling of the cellular exoribonuclease Xrn1 at highly structured regions. Several functions of these flavivirus long non-coding RNAs have been revealed in recent years. The generation of these sfRNAs/xrRNAs from viral transcripts results in the repression of Xrn1 and the dysregulation of cellular mRNA stability. The abundant sfRNAs also serve directly as a decoy for important cellular protein regulators of the interferon and RNA interference antiviral pathways. Thus the generation of long non-coding RNAs from flaviviruses, hepaciviruses and pestiviruses likely disrupts aspects of innate immunity and may directly contribute to viral replication, cytopathology and pathogenesis. PMID:26368052
-
Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise
2000-01-01
We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121
-
Filichkin, S A; Bransom, K L; Goodwin, J B; Dreher, T W
2000-09-01
Five highly infectious turnip yellow mosaic virus (TYMV) genomes with sequence changes in their 3'-terminal regions that result in altered aminoacylation and eEF1A binding have been studied. These genomes were derived from cloned parental RNAs of low infectivity by sequential passaging in plants. Three of these genomes that are incapable of aminoacylation have been reported previously (J. B. Goodwin, J. M. Skuzeski, and T. W. Dreher, Virology 230:113-124, 1997). We now demonstrate by subcloning the 3' untranslated regions into wild-type TYMV RNA that the high infectivities and replication rates of these genomes compared to their progenitors are mostly due to a small number of mutations acquired in the 3' tRNA-like structure during passaging. Mutations in other parts of the genome, including the replication protein coding region, are not required for high infectivity but probably do play a role in optimizing viral amplification and spread in plants. Two other TYMV RNA variants of suboptimal infectivities, one that accepts methionine instead of the usual valine and one that interacts less tightly with eEF1A, were sequentially passaged to produce highly infectious genomes. The improved infectivities of these RNAs were not associated with increased replication in protoplasts, and no mutations were acquired in their 3' tRNA-like structures. Complete sequencing of one genome identified two mutations that result in amino acid changes in the movement protein gene, suggesting that improved infectivity may be a function of improved viral dissemination in plants. Our results show that the wild-type TYMV replication proteins are able to amplify genomes with 3' termini of variable sequence and tRNA mimicry. These and previous results have led to a model in which the binding of eEF1A to the 3' end to antagonize minus-strand initiation is a major role of the tRNA-like structure.
-
Hou, Weiguo; Wang, Shang; Briggs, Brandon R; Li, Gaoyuan; Xie, Wei; Dong, Hailiang
2018-01-01
Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
-
Hou, Weiguo; Wang, Shang; Briggs, Brandon R.; Li, Gaoyuan; Xie, Wei; Dong, Hailiang
2018-01-01
Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities) from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length) encoding the cyanophage gp23 major capsid protein (MCP). Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92%) belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
-
Smith, Richard H; Hallwirth, Claus V; Westerman, Michael; Hetherington, Nicola A; Tseng, Yu-Shan; Cecchini, Sylvain; Virag, Tamas; Ziegler, Mona-Larissa; Rogozin, Igor B; Koonin, Eugene V; Agbandje-McKenna, Mavis; Kotin, Robert M; Alexander, Ian E
2016-07-05
Germline endogenous viral elements (EVEs) genetically preserve viral nucleotide sequences useful to the study of viral evolution, gene mutation, and the phylogenetic relationships among host organisms. Here, we describe a lineage-specific, adeno-associated virus (AAV)-derived endogenous viral element (mAAV-EVE1) found within the germline of numerous closely related marsupial species. Molecular screening of a marsupial DNA panel indicated that mAAV-EVE1 occurs specifically within the marsupial suborder Macropodiformes (present-day kangaroos, wallabies, and related macropodoids), to the exclusion of other Diprotodontian lineages. Orthologous mAAV-EVE1 locus sequences from sixteen macropodoid species, representing a speciation history spanning an estimated 30 million years, facilitated compilation of an inferred ancestral sequence that recapitulates the genome of an ancient marsupial AAV that circulated among Australian metatherian fauna sometime during the late Eocene to early Oligocene. In silico gene reconstruction and molecular modelling indicate remarkable conservation of viral structure over a geologic timescale. Characterisation of AAV-EVE loci among disparate species affords insight into AAV evolution and, in the case of macropodoid species, may offer an additional genetic basis for assignment of phylogenetic relationships among the Macropodoidea. From an applied perspective, the identified AAV "fossils" provide novel capsid sequences for use in translational research and clinical applications.
-
Broad Surveys of DNA Viral Diversity Obtained through Viral Metagenomics of Mosquitoes
Ng, Terry Fei Fan; Willner, Dana L.; Lim, Yan Wei; Schmieder, Robert; Chau, Betty; Nilsson, Christina; Anthony, Simon; Ruan, Yijun; Rohwer, Forest; Breitbart, Mya
2011-01-01
Viruses are the most abundant and diverse genetic entities on Earth; however, broad surveys of viral diversity are hindered by the lack of a universal assay for viruses and the inability to sample a sufficient number of individual hosts. This study utilized vector-enabled metagenomics (VEM) to provide a snapshot of the diversity of DNA viruses present in three mosquito samples from San Diego, California. The majority of the sequences were novel, suggesting that the viral community in mosquitoes, as well as the animal and plant hosts they feed on, is highly diverse and largely uncharacterized. Each mosquito sample contained a distinct viral community. The mosquito viromes contained sequences related to a broad range of animal, plant, insect and bacterial viruses. Animal viruses identified included anelloviruses, circoviruses, herpesviruses, poxviruses, and papillomaviruses, which mosquitoes may have obtained from vertebrate hosts during blood feeding. Notably, sequences related to human papillomaviruses were identified in one of the mosquito samples. Sequences similar to plant viruses were identified in all mosquito viromes, which were potentially acquired through feeding on plant nectar. Numerous bacteriophages and insect viruses were also detected, including a novel densovirus likely infecting Culex erythrothorax. Through sampling insect vectors, VEM enables broad survey of viral diversity and has significantly increased our knowledge of the DNA viruses present in mosquitoes. PMID:21674005
-
Fernandez-Cassi, X; Timoneda, N; Gonzales-Gustavson, E; Abril, J F; Bofill-Mas, S; Girones, R
2017-09-18
Microbial food-borne diseases are still frequently reported despite the implementation of microbial quality legislation to improve food safety. Among all the microbial agents, viruses are the most important causative agents of food-borne outbreaks. The development and application of a new generation of sequencing techniques to test for viral contaminants in fresh produce is an unexplored field that allows for the study of the viral populations that might be transmitted by the fecal-oral route through the consumption of contaminated food. To advance this promising field, parsley was planted and grown under controlled conditions and irrigated using contaminated river water. Viruses polluting the irrigation water and the parsley leaves were studied by using metagenomics. To address possible contamination due to sample manipulation, library preparation, and other sources, parsley plants irrigated with nutritive solution were used as a negative control. In parallel, viruses present in the river water used for plant irrigation were analyzed using the same methodology. It was possible to assign viral taxons from 2.4 to 74.88% of the total reads sequenced depending on the sample. Most of the viral reads detected in the river water were related to the plant viral families Tymoviridae (66.13%) and Virgaviridae (14.45%) and the phage viral families Myoviridae (5.70%), Siphoviridae (5.06%), and Microviridae (2.89%). Less than 1% of the viral reads were related to viral families that infect humans, including members of the Adenoviridae, Reoviridae, Picornaviridae and Astroviridae families. On the surface of the parsley plants, most of the viral reads that were detected were assigned to the Dicistroviridae family (41.52%). Sequences related to important viral pathogens, such as the hepatitis E virus, several picornaviruses from species A and B as well as human sapoviruses and GIV noroviruses were detected. The high diversity of viral sequences found in the parsley plants suggests that irrigation on fecally-tainted food may have a role in the transmission of a wide diversity of viral families. This finding reinforces the idea that the best way to avoid food-borne viral diseases is to introduce good field irrigation and production practices. New strains have been identified that are related to the Picornaviridae and distantly related to the Hepeviridae family. However, the detection of a viral genome alone does not necessarily indicate there is a risk of infection or disease development. Thus, further investigation is crucial for correlating the detection of viral metagenomes in samples with the risk of infection. There is also an urgent need to develop new methods to improve the sensitivity of current Next Generation Sequencing (NGS) techniques in the food safety area. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Computational clustering for viral reference proteomes
Chen, Chuming; Huang, Hongzhan; Mazumder, Raja; Natale, Darren A.; McGarvey, Peter B.; Zhang, Jian; Polson, Shawn W.; Wang, Yuqi; Wu, Cathy H.
2016-01-01
Motivation: The enormous number of redundant sequenced genomes has hindered efforts to analyze and functionally annotate proteins. As the taxonomy of viruses is not uniformly defined, viral proteomes pose special challenges in this regard. Grouping viruses based on the similarity of their proteins at proteome scale can normalize against potential taxonomic nomenclature anomalies. Results: We present Viral Reference Proteomes (Viral RPs), which are computed from complete virus proteomes within UniProtKB. Viral RPs based on 95, 75, 55, 35 and 15% co-membership in proteome similarity based clusters are provided. Comparison of our computational Viral RPs with UniProt’s curator-selected Reference Proteomes indicates that the two sets are consistent and complementary. Furthermore, each Viral RP represents a cluster of virus proteomes that was consistent with virus or host taxonomy. We provide BLASTP search and FTP download of Viral RP protein sequences, and a browser to facilitate the visualization of Viral RPs. Availability and implementation: http://proteininformationresource.org/rps/viruses/ Contact: chenc@udel.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153712
-
Genome sequence diversity and clues to the evolution of variola (smallpox) virus.
Esposito, Joseph J; Sammons, Scott A; Frace, A Michael; Osborne, John D; Olsen-Rasmussen, Melissa; Zhang, Ming; Govil, Dhwani; Damon, Inger K; Kline, Richard; Laker, Miriam; Li, Yu; Smith, Geoffrey L; Meyer, Hermann; Leduc, James W; Wohlhueter, Robert M
2006-08-11
Comparative genomics of 45 epidemiologically varied variola virus isolates from the past 30 years of the smallpox era indicate low sequence diversity, suggesting that there is probably little difference in the isolates' functional gene content. Phylogenetic clustering inferred three clades coincident with their geographical origin and case-fatality rate; the latter implicated putative proteins that mediate viral virulence differences. Analysis of the viral linear DNA genome suggests that its evolution involved direct descent and DNA end-region recombination events. Knowing the sequences will help understand the viral proteome and improve diagnostic test precision, therapeutics, and systems for their assessment.
-
Sarmady, Mahdi; Dampier, William; Tozeren, Aydin
2011-01-01
Virus proteins alter protein pathways of the host toward the synthesis of viral particles by breaking and making edges via binding to host proteins. In this study, we developed a computational approach to predict viral sequence hotspots for binding to host proteins based on sequences of viral and host proteins and literature-curated virus-host protein interactome data. We use a motif discovery algorithm repeatedly on collections of sequences of viral proteins and immediate binding partners of their host targets and choose only those motifs that are conserved on viral sequences and highly statistically enriched among binding partners of virus protein targeted host proteins. Our results match experimental data on binding sites of Nef to host proteins such as MAPK1, VAV1, LCK, HCK, HLA-A, CD4, FYN, and GNB2L1 with high statistical significance but is a poor predictor of Nef binding sites on highly flexible, hoop-like regions. Predicted hotspots recapture CD8 cell epitopes of HIV Nef highlighting their importance in modulating virus-host interactions. Host proteins potentially targeted or outcompeted by Nef appear crowding the T cell receptor, natural killer cell mediated cytotoxicity, and neurotrophin signaling pathways. Scanning of HIV Nef motifs on multiple alignments of hepatitis C protein NS5A produces results consistent with literature, indicating the potential value of the hotspot discovery in advancing our understanding of virus-host crosstalk. PMID:21738584
-
Huang, Zhihong; Pan, Mengjia; Zhu, Silei; Zhang, Hao; Wu, Wenbi; Yuan, Meijin; Yang, Kai
2017-03-01
Baculoviridae is a family of insect-specific viruses that have a circular double-stranded DNA genome packaged within a rod-shaped capsid. The mechanism of baculovirus nucleocapsid assembly remains unclear. Previous studies have shown that deletion of the ac83 gene of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) blocks viral nucleocapsid assembly. Interestingly, the ac83 -encoded protein Ac83 is not a component of the nucleocapsid, implying a particular role for ac83 in nucleocapsid assembly that may be independent of its protein product. To examine this possibility, Ac83 synthesis was disrupted by insertion of a chloramphenicol resistance gene into its coding sequence or by deleting its promoter and translation start codon. Both mutants produced progeny viruses normally, indicating that the Ac83 protein is not required for nucleocapsid assembly. Subsequently, complementation assays showed that the production of progeny viruses required the presence of ac83 in the AcMNPV genome instead of its presence in trans Therefore, we reasoned that ac83 is involved in nucleocapsid assembly via an internal cis -acting element, which we named the nucleocapsid assembly-essential element (NAE). The NAE was identified to lie within nucleotides 1651 to 1850 of ac83 and had 8 conserved A/T-rich regions. Sequences homologous to the NAE were found only in alphabaculoviruses and have a conserved positional relationship with another essential cis -acting element that was recently identified. The identification of the NAE may help to connect the data of viral cis -acting elements and related proteins in the baculovirus nucleocapsid assembly, which is important for elucidating DNA-protein interaction events during this process. IMPORTANCE Virus nucleocapsid assembly usually requires specific cis -acting elements in the viral genome for various processes, such as the selection of the viral genome from the cellular nucleic acids, the cleavage of concatemeric viral genome replication intermediates, and the encapsidation of the viral genome into procapsids. In linear DNA viruses, such elements generally locate at the ends of the viral genome; however, most of these elements remain unidentified in circular DNA viruses (including baculovirus) due to their circular genomic conformation. Here, we identified a nucleocapsid assembly-essential element in the AcMNPV (the archetype of baculovirus) genome. This finding provides an important reference for studies of nucleocapsid assembly-related elements in baculoviruses and other circular DNA viruses. Moreover, as most of the previous studies of baculovirus nucleocapsid assembly have been focused on viral proteins, our study provides a novel entry point to investigate this mechanism via cis -acting elements in the viral genome. Copyright © 2017 American Society for Microbiology.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aw, Tiong Gim; Howe, Adina; Rose, Joan B.
2014-12-01
Genomic-based molecular techniques are emerging as powerful tools that allow a comprehensive characterization of water and wastewater microbiomes. Most recently, next generation sequencing (NGS) technologies which produce large amounts of sequence data are beginning to impact the field of environmental virology. In this study, NGS and bioinformatics have been employed for the direct detection and characterization of viruses in wastewater and of viruses isolated after cell culture. Viral particles were concentrated and purified from sewage samples by polyethylene glycol precipitation. Viral nucleic acid was extracted and randomly amplified prior to sequencing using Illumina technology, yielding a total of 18 millionmore » sequence reads. Most of the viral sequences detected could not be characterized, indicating the great viral diversity that is yet to be discovered. This sewage virome was dominated by bacteriophages and contained sequences related to known human pathogenic viruses such as adenoviruses (species B, C and F), polyomaviruses JC and BK and enteroviruses (type B). An array of other animal viruses was also found, suggesting unknown zoonotic viruses. This study demonstrated the feasibility of metagenomic approaches to characterize viruses in complex environmental water samples.« less
-
Cas9 specifies functional viral targets during CRISPR-Cas adaptation.
Heler, Robert; Samai, Poulami; Modell, Joshua W; Weiner, Catherine; Goldberg, Gregory W; Bikard, David; Marraffini, Luciano A
2015-03-12
Clustered regularly interspaced short palindromic repeat (CRISPR) loci and their associated (Cas) proteins provide adaptive immunity against viral infection in prokaryotes. Upon infection, short phage sequences known as spacers integrate between CRISPR repeats and are transcribed into small RNA molecules that guide the Cas9 nuclease to the viral targets (protospacers). Streptococcus pyogenes Cas9 cleavage of the viral genome requires the presence of a 5'-NGG-3' protospacer adjacent motif (PAM) sequence immediately downstream of the viral target. It is not known whether and how viral sequences flanked by the correct PAM are chosen as new spacers. Here we show that Cas9 selects functional spacers by recognizing their PAM during spacer acquisition. The replacement of cas9 with alleles that lack the PAM recognition motif or recognize an NGGNG PAM eliminated or changed PAM specificity during spacer acquisition, respectively. Cas9 associates with other proteins of the acquisition machinery (Cas1, Cas2 and Csn2), presumably to provide PAM-specificity to this process. These results establish a new function for Cas9 in the genesis of prokaryotic immunological memory.
-
Dorsch-Häsler, Karoline; Fisher, Paul B.; Weinstein, I. Bernard; Ginsberg, Harold S.
1980-01-01
The integration pattern of viral DNA was studied in a number of cell lines transformed by wild-type adenovirus type 5 (Ad5 WT) and two mutants of the DNA-binding protein gene, H5ts125 and H5ts107. The effect of chemical carcinogens on the integration of viral DNA was also investigated. Liquid hybridization (C0t) analyses showed that rat embryo cells transformed by Ad5 WT usually contained only the left-hand end of the viral genome, whereas cell lines transformed by H5ts125 or H5ts107 at either the semipermissive (36°C) or nonpermissive (39.5°C) temperature often contained one to five copies of all or most of the entire adenovirus genome. The arrangement of the integrated adenovirus DNA sequences was determined by cleavage of transformed cell DNA with restriction endonucleases XbaI, EcoRI, or HindIII followed by transfer of separated fragments to nitrocellulose paper and hybridization according to the technique of E. M. Southern (J. Mol. Biol. 98: 503-517, 1975). It was found that the adenovirus genome is integrated as a linear sequence covalently linked to host cell DNA; that the viral DNA is integrated into different host DNA sequences in each cell line studied; that in cell lines that contain multiple copies of the Ad5 genome the viral DNA sequences can be integrated in a single set of host cell DNA sequences and not as concatemers; and that chemical carcinogens do not alter the extent or pattern of viral DNA integration. Images PMID:6246266
-
de Andrade, Roberto R S; Vaslin, Maite F S
2014-03-07
Next-generation parallel sequencing (NGS) allows the identification of viral pathogens by sequencing the small RNAs of infected hosts. Thus, viral genomes may be assembled from host immune response products without prior virus enrichment, amplification or purification. However, mapping of the vast information obtained presents a bioinformatics challenge. In order to by pass the need of line command and basic bioinformatics knowledge, we develop a mapping software with a graphical interface to the assemblage of viral genomes from small RNA dataset obtained by NGS. SearchSmallRNA was developed in JAVA language version 7 using NetBeans IDE 7.1 software. The program also allows the analysis of the viral small interfering RNAs (vsRNAs) profile; providing an overview of the size distribution and other features of the vsRNAs produced in infected cells. The program performs comparisons between each read sequenced present in a library and a chosen reference genome. Reads showing Hamming distances smaller or equal to an allowed mismatched will be selected as positives and used to the assemblage of a long nucleotide genome sequence. In order to validate the software, distinct analysis using NGS dataset obtained from HIV and two plant viruses were used to reconstruct viral whole genomes. SearchSmallRNA program was able to reconstructed viral genomes using NGS of small RNA dataset with high degree of reliability so it will be a valuable tool for viruses sequencing and discovery. It is accessible and free to all research communities and has the advantage to have an easy-to-use graphical interface. SearchSmallRNA was written in Java and is freely available at http://www.microbiologia.ufrj.br/ssrna/.
-
2014-01-01
Background Next-generation parallel sequencing (NGS) allows the identification of viral pathogens by sequencing the small RNAs of infected hosts. Thus, viral genomes may be assembled from host immune response products without prior virus enrichment, amplification or purification. However, mapping of the vast information obtained presents a bioinformatics challenge. Methods In order to by pass the need of line command and basic bioinformatics knowledge, we develop a mapping software with a graphical interface to the assemblage of viral genomes from small RNA dataset obtained by NGS. SearchSmallRNA was developed in JAVA language version 7 using NetBeans IDE 7.1 software. The program also allows the analysis of the viral small interfering RNAs (vsRNAs) profile; providing an overview of the size distribution and other features of the vsRNAs produced in infected cells. Results The program performs comparisons between each read sequenced present in a library and a chosen reference genome. Reads showing Hamming distances smaller or equal to an allowed mismatched will be selected as positives and used to the assemblage of a long nucleotide genome sequence. In order to validate the software, distinct analysis using NGS dataset obtained from HIV and two plant viruses were used to reconstruct viral whole genomes. Conclusions SearchSmallRNA program was able to reconstructed viral genomes using NGS of small RNA dataset with high degree of reliability so it will be a valuable tool for viruses sequencing and discovery. It is accessible and free to all research communities and has the advantage to have an easy-to-use graphical interface. Availability and implementation SearchSmallRNA was written in Java and is freely available at http://www.microbiologia.ufrj.br/ssrna/. PMID:24607237
-
Reuther, Peter; Göpfert, Kristina; Dudek, Alexandra H.; Heiner, Monika; Herold, Susanne; Schwemmle, Martin
2015-01-01
Influenza A viruses (IAV) pose a constant threat to the human population and therefore a better understanding of their fundamental biology and identification of novel therapeutics is of upmost importance. Various reporter-encoding IAV were generated to achieve these goals, however, one recurring difficulty was the genetic instability especially of larger reporter genes. We employed the viral NS segment coding for the non-structural protein 1 (NS1) and nuclear export protein (NEP) for stable expression of diverse reporter proteins. This was achieved by converting the NS segment into a single open reading frame (ORF) coding for NS1, the respective reporter and NEP. To allow expression of individual proteins, the reporter genes were flanked by two porcine Teschovirus-1 2A peptide (PTV-1 2A)-coding sequences. The resulting viruses encoding luciferases, fluorescent proteins or a Cre recombinase are characterized by a high genetic stability in vitro and in mice and can be readily employed for antiviral compound screenings, visualization of infected cells or cells that survived acute infection. PMID:26068081
-
A Pan-HIV Strategy for Complete Genome Sequencing
Yamaguchi, Julie; Alessandri-Gradt, Elodie; Tell, Robert W.; Brennan, Catherine A.
2015-01-01
Molecular surveillance is essential to monitor HIV diversity and track emerging strains. We have developed a universal library preparation method (HIV-SMART [i.e., switching mechanism at 5′ end of RNA transcript]) for next-generation sequencing that harnesses the specificity of HIV-directed priming to enable full genome characterization of all HIV-1 groups (M, N, O, and P) and HIV-2. Broad application of the HIV-SMART approach was demonstrated using a panel of diverse cell-cultured virus isolates. HIV-1 non-subtype B-infected clinical specimens from Cameroon were then used to optimize the protocol to sequence directly from plasma. When multiplexing 8 or more libraries per MiSeq run, full genome coverage at a median ∼2,000× depth was routinely obtained for either sample type. The method reproducibly generated the same consensus sequence, consistently identified viral sequence heterogeneity present in specimens, and at viral loads of ≤4.5 log copies/ml yielded sufficient coverage to permit strain classification. HIV-SMART provides an unparalleled opportunity to identify diverse HIV strains in patient specimens and to determine phylogenetic classification based on the entire viral genome. Easily adapted to sequence any RNA virus, this technology illustrates the utility of next-generation sequencing (NGS) for viral characterization and surveillance. PMID:26699702
-
Sethuraman, Sunantha; Thomas, Merin; Gay, Lauren A; Renne, Rolf
2018-05-29
Ribonomics experiments involving crosslinking and immuno-precipitation (CLIP) of Ago proteins have expanded the understanding of the miRNA targetome of several organisms. These techniques, collectively referred to as CLIP-seq, have been applied to identifying the mRNA targets of miRNAs expressed by Kaposi's Sarcoma-associated herpes virus (KSHV) and Epstein-Barr virus (EBV). However, these studies focused on identifying only those RNA targets of KSHV and EBV miRNAs that are known to encode proteins. Recent studies have demonstrated that long non-coding RNAs (lncRNAs) are also targeted by miRNAs. In this study, we performed a systematic re-analysis of published datasets from KSHV- and EBV-driven cancers. We used CLIP-seq data from lymphoma cells or EBV-transformed B cells, and a crosslinking, ligation and sequencing of hybrids dataset from KSHV-infected endothelial cells, to identify novel lncRNA targets of viral miRNAs. Here, we catalog the lncRNA targetome of KSHV and EBV miRNAs, and provide a detailed in silico analysis of lncRNA-miRNA binding interactions. Viral miRNAs target several hundred lncRNAs, including a subset previously shown to be aberrantly expressed in human malignancies. In addition, we identified thousands of lncRNAs to be putative targets of human miRNAs, suggesting that miRNA-lncRNA interactions broadly contribute to the regulation of gene expression.
-
Martino, Luigi; Pennell, Simon; Kelly, Geoff; Bui, Tam T T; Kotik-Kogan, Olga; Smerdon, Stephen J; Drake, Alex F; Curry, Stephen; Conte, Maria R
2012-02-01
Human La protein is an essential factor in the biology of both coding and non-coding RNAs. In the nucleus, La binds primarily to 3' oligoU containing RNAs, while in the cytoplasm La interacts with an array of different mRNAs lacking a 3' UUU(OH) trailer. An example of the latter is the binding of La to the IRES domain IV of the hepatitis C virus (HCV) RNA, which is associated with viral translation stimulation. By systematic biophysical investigations, we have found that La binds to domain IV using an RNA recognition that is quite distinct from its mode of binding to RNAs with a 3' UUU(OH) trailer: although the La motif and first RNA recognition motif (RRM1) are sufficient for high-affinity binding to 3' oligoU, recognition of HCV domain IV requires the La motif and RRM1 to work in concert with the atypical RRM2 which has not previously been shown to have a significant role in RNA binding. This new mode of binding does not appear sequence specific, but recognizes structural features of the RNA, in particular a double-stranded stem flanked by single-stranded extensions. These findings pave the way for a better understanding of the role of La in viral translation initiation.
-
Rapid Sequencing of Complete env Genes from Primary HIV-1 Samples.
Laird Smith, Melissa; Murrell, Ben; Eren, Kemal; Ignacio, Caroline; Landais, Elise; Weaver, Steven; Phung, Pham; Ludka, Colleen; Hepler, Lance; Caballero, Gemma; Pollner, Tristan; Guo, Yan; Richman, Douglas; Poignard, Pascal; Paxinos, Ellen E; Kosakovsky Pond, Sergei L; Smith, Davey M
2016-07-01
The ability to study rapidly evolving viral populations has been constrained by the read length of next-generation sequencing approaches and the sampling depth of single-genome amplification methods. Here, we develop and characterize a method using Pacific Biosciences' Single Molecule, Real-Time (SMRT®) sequencing technology to sequence multiple, intact full-length human immunodeficiency virus-1 env genes amplified from viral RNA populations circulating in blood, and provide computational tools for analyzing and visualizing these data.
-
Goya, Stephanie; Valinotto, Laura E; Tittarelli, Estefania; Rojo, Gabriel L; Nabaes Jodar, Mercedes S; Greninger, Alexander L; Zaiat, Jonathan J; Marti, Marcelo A; Mistchenko, Alicia S; Viegas, Mariana
2018-01-01
Over the last decade, the number of viral genome sequences deposited in available databases has grown exponentially. However, sequencing methodology vary widely and many published works have relied on viral enrichment by viral culture or nucleic acid amplification with specific primers rather than through unbiased techniques such as metagenomics. The genome of RNA viruses is highly variable and these enrichment methodologies may be difficult to achieve or may bias the results. In order to obtain genomic sequences of human respiratory syncytial virus (HRSV) from positive nasopharyngeal aspirates diverse methodologies were evaluated and compared. A total of 29 nearly complete and complete viral genomes were obtained. The best performance was achieved with a DNase I treatment to the RNA directly extracted from the nasopharyngeal aspirate (NPA), sequence-independent single-primer amplification (SISPA) and library preparation performed with Nextera XT DNA Library Prep Kit with manual normalization. An average of 633,789 and 1,674,845 filtered reads per library were obtained with MiSeq and NextSeq 500 platforms, respectively. The higher output of NextSeq 500 was accompanied by the increasing of duplicated reads percentage generated during SISPA (from an average of 1.5% duplicated viral reads in MiSeq to an average of 74% in NextSeq 500). HRSV genome recovery was not affected by the presence or absence of duplicated reads but the computational demand during the analysis was increased. Considering that only samples with viral load ≥ E+06 copies/ml NPA were tested, no correlation between sample viral loads and number of total filtered reads was observed, nor with the mapped viral reads. The HRSV genomes showed a mean coverage of 98.46% with the best methodology. In addition, genomes of human metapneumovirus (HMPV), human rhinovirus (HRV) and human parainfluenza virus types 1-3 (HPIV1-3) were also obtained with the selected optimal methodology.
-
Marine, Rachel L; Nasko, Daniel J; Wray, Jeffrey; Polson, Shawn W; Wommack, K Eric
2017-01-01
Chaperonins are protein-folding machinery found in all cellular life. Chaperonin genes have been documented within a few viruses, yet, surprisingly, analysis of metagenome sequence data indicated that chaperonin-carrying viruses are common and geographically widespread in marine ecosystems. Also unexpected was the discovery of viral chaperonin sequences related to thermosome proteins of archaea, indicating the presence of virioplankton populations infecting marine archaeal hosts. Virioplankton large subunit chaperonin sequences (GroELs) were divergent from bacterial sequences, indicating that viruses have carried this gene over long evolutionary time. Analysis of viral metagenome contigs indicated that: the order of large and small subunit genes was linked to the phylogeny of GroEL; both lytic and temperate phages may carry group I chaperonin genes; and viruses carrying a GroEL gene likely have large double-stranded DNA (dsDNA) genomes (>70 kb). Given these connections, it is likely that chaperonins are critical to the biology and ecology of virioplankton populations that carry these genes. Moreover, these discoveries raise the intriguing possibility that viral chaperonins may more broadly alter the structure and function of viral and cellular proteins in infected host cells. PMID:28731469
-
Marine, Rachel L; Nasko, Daniel J; Wray, Jeffrey; Polson, Shawn W; Wommack, K Eric
2017-11-01
Chaperonins are protein-folding machinery found in all cellular life. Chaperonin genes have been documented within a few viruses, yet, surprisingly, analysis of metagenome sequence data indicated that chaperonin-carrying viruses are common and geographically widespread in marine ecosystems. Also unexpected was the discovery of viral chaperonin sequences related to thermosome proteins of archaea, indicating the presence of virioplankton populations infecting marine archaeal hosts. Virioplankton large subunit chaperonin sequences (GroELs) were divergent from bacterial sequences, indicating that viruses have carried this gene over long evolutionary time. Analysis of viral metagenome contigs indicated that: the order of large and small subunit genes was linked to the phylogeny of GroEL; both lytic and temperate phages may carry group I chaperonin genes; and viruses carrying a GroEL gene likely have large double-stranded DNA (dsDNA) genomes (>70 kb). Given these connections, it is likely that chaperonins are critical to the biology and ecology of virioplankton populations that carry these genes. Moreover, these discoveries raise the intriguing possibility that viral chaperonins may more broadly alter the structure and function of viral and cellular proteins in infected host cells.
-
Vinner, Lasse; Mourier, Tobias; Friis-Nielsen, Jens; Gniadecki, Robert; Dybkaer, Karen; Rosenberg, Jacob; Langhoff, Jill Levin; Cruz, David Flores Santa; Fonager, Jannik; Izarzugaza, Jose M G; Gupta, Ramneek; Sicheritz-Ponten, Thomas; Brunak, Søren; Willerslev, Eske; Nielsen, Lars Peter; Hansen, Anders Johannes
2015-08-19
Although nearly one fifth of all human cancers have an infectious aetiology, the causes for the majority of cancers remain unexplained. Despite the enormous data output from high-throughput shotgun sequencing, viral DNA in a clinical sample typically constitutes a proportion of host DNA that is too small to be detected. Sequence variation among virus genomes complicates application of sequence-specific, and highly sensitive, PCR methods. Therefore, we aimed to develop and characterize a method that permits sensitive detection of sequences despite considerable variation. We demonstrate that our low-stringency in-solution hybridization method enables detection of <100 viral copies. Furthermore, distantly related proviral sequences may be enriched by orders of magnitude, enabling discovery of hitherto unknown viral sequences by high-throughput sequencing. The sensitivity was sufficient to detect retroviral sequences in clinical samples. We used this method to conduct an investigation for novel retrovirus in samples from three cancer types. In accordance with recent studies our investigation revealed no retroviral infections in human B-cell lymphoma cells, cutaneous T-cell lymphoma or colorectal cancer biopsies. Nonetheless, our generally applicable method makes sensitive detection possible and permits sequencing of distantly related sequences from complex material.
-
A comprehensive and quantitative exploration of thousands of viral genomes
Mahmoudabadi, Gita
2018-01-01
The complete assembly of viral genomes from metagenomic datasets (short genomic sequences gathered from environmental samples) has proven to be challenging, so there are significant blind spots when we view viral genomes through the lens of metagenomics. One approach to overcoming this problem is to leverage the thousands of complete viral genomes that are publicly available. Here we describe our efforts to assemble a comprehensive resource that provides a quantitative snapshot of viral genomic trends – such as gene density, noncoding percentage, and abundances of functional gene categories – across thousands of viral genomes. We have also developed a coarse-grained method for visualizing viral genome organization for hundreds of genomes at once, and have explored the extent of the overlap between bacterial and bacteriophage gene pools. Existing viral classification systems were developed prior to the sequencing era, so we present our analysis in a way that allows us to assess the utility of the different classification systems for capturing genomic trends. PMID:29624169
-
A comprehensive and quantitative exploration of thousands of viral genomes.
Mahmoudabadi, Gita; Phillips, Rob
2018-04-19
The complete assembly of viral genomes from metagenomic datasets (short genomic sequences gathered from environmental samples) has proven to be challenging, so there are significant blind spots when we view viral genomes through the lens of metagenomics. One approach to overcoming this problem is to leverage the thousands of complete viral genomes that are publicly available. Here we describe our efforts to assemble a comprehensive resource that provides a quantitative snapshot of viral genomic trends - such as gene density, noncoding percentage, and abundances of functional gene categories - across thousands of viral genomes. We have also developed a coarse-grained method for visualizing viral genome organization for hundreds of genomes at once, and have explored the extent of the overlap between bacterial and bacteriophage gene pools. Existing viral classification systems were developed prior to the sequencing era, so we present our analysis in a way that allows us to assess the utility of the different classification systems for capturing genomic trends. © 2018, Mahmoudabadi et al.
-
Li, Hui; Stoddard, Mark B; Wang, Shuyi; Giorgi, Elena E; Blair, Lily M; Learn, Gerald H; Hahn, Beatrice H; Alter, Harvey J; Busch, Michael P; Fierer, Daniel S; Ribeiro, Ruy M; Perelson, Alan S; Bhattacharya, Tanmoy; Shaw, George M
2016-01-01
Despite the recent development of highly effective anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and development of an effective vaccine. A precise molecular identification of transmitted/founder (T/F) HCV genomes that lead to productive clinical infection could play a critical role in vaccine research, as it has for HIV-1. However, the replication schema of these two RNA viruses differ substantially, as do viral responses to innate and adaptive host defenses. These differences raise questions as to the certainty of T/F HCV genome inferences, particularly in cases where multiple closely related sequence lineages have been observed. To clarify these issues and distinguish between competing models of early HCV diversification, we examined seven cases of acute HCV infection in humans and chimpanzees, including three examples of virus transmission between linked donors and recipients. Using single-genome sequencing (SGS) of plasma vRNA, we found that inferred T/F sequences in recipients were identical to viral sequences in their respective donors. Early in infection, HCV genomes generally evolved according to a simple model of random evolution where the coalescent corresponded to the T/F sequence. Closely related sequence lineages could be explained by high multiplicity infection from a donor whose viral sequences had undergone a pretransmission bottleneck due to treatment, immune selection, or recent infection. These findings validate SGS, together with mathematical modeling and phylogenetic analysis, as a novel strategy to infer T/F HCV genome sequences. Despite the recent development of highly effective, interferon-sparing anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and the development of an effective vaccine, which could be facilitated by a precise molecular identification of transmitted/founder (T/F) viral genomes and their progeny. We used single-genome sequencing to show that inferred HCV T/F sequences in recipients were identical to viral sequences in their respective donors and that viral genomes generally evolved early in infection according to a simple model of random sequence evolution. Altogether, the findings validate T/F genome inferences and illustrate how T/F sequence identification can illuminate studies of HCV transmission, immunopathogenesis, drug resistance development, and vaccine protection, including sieving effects on breakthrough virus strains. Copyright © 2015 Li et al.
-
Ancient papillomavirus-host co-speciation in Felidae
Rector, Annabel; Lemey, Philippe; Tachezy, Ruth; Mostmans, Sara; Ghim, Shin-Je; Van Doorslaer, Koenraad; Roelke, Melody; Bush, Mitchell; Montali, Richard J; Joslin, Janis; Burk, Robert D; Jenson, Alfred B; Sundberg, John P; Shapiro, Beth; Van Ranst, Marc
2007-01-01
Background Estimating evolutionary rates for slowly evolving viruses such as papillomaviruses (PVs) is not possible using fossil calibrations directly or sequences sampled over a time-scale of decades. An ability to correlate their divergence with a host species, however, can provide a means to estimate evolutionary rates for these viruses accurately. To determine whether such an approach is feasible, we sequenced complete feline PV genomes, previously available only for the domestic cat (Felis domesticus, FdPV1), from four additional, globally distributed feline species: Lynx rufus PV type 1, Puma concolor PV type 1, Panthera leo persica PV type 1, and Uncia uncia PV type 1. Results The feline PVs all belong to the Lambdapapillomavirus genus, and contain an unusual second noncoding region between the early and late protein region, which is only present in members of this genus. Our maximum likelihood and Bayesian phylogenetic analyses demonstrate that the evolutionary relationships between feline PVs perfectly mirror those of their feline hosts, despite a complex and dynamic phylogeographic history. By applying host species divergence times, we provide the first precise estimates for the rate of evolution for each PV gene, with an overall evolutionary rate of 1.95 × 10-8 (95% confidence interval 1.32 × 10-8 to 2.47 × 10-8) nucleotide substitutions per site per year for the viral coding genome. Conclusion Our work provides evidence for long-term virus-host co-speciation of feline PVs, indicating that viral diversity in slowly evolving viruses can be used to investigate host species evolution. These findings, however, should not be extrapolated to other viral lineages without prior confirmation of virus-host co-divergence. PMID:17430578
-
Godoy, Bibiane A; Gomes-Gouvêa, Michele S; Zagonel-Oliveira, Marcelo; Alvarado-Mora, Mónica V; Salzano, Francisco M; Pinho, João R R; Fagundes, Nelson J R
2016-09-01
Native American populations present the highest prevalence of Hepatitis B Virus (HBV) infection in the Americas, which may be associated to severe disease outcomes. Ten HBV genotypes (A–J) have been described, displaying a remarkable geographic structure, which most likely reflects historic patterns of human migrations. In this study, we characterize the HBV strains circulating in a historical sample of Native South Americans to characterize the historical viral dynamics in this population. The sample consisted of 1070 individuals belonging to 38 populations collected between 1965 and 1997. Presence of HBV DNA was checked by quantitative real-time PCR, and determination of HBV genotypes and subgenotypes was performed through sequencing and phylogenetic analysis of a fragment including part of HBsAg and Pol coding regions (S/Pol). A Bayesian Skyline Plot analysis was performed to compare the viral population dynamics of HBV/A1 strains found in Native Americans and in the general Brazilian population. A total of 109 individuals were positive for HBV DNA (~ 10%), and 70 samples were successfully sequenced and genotyped. Subgenotype A1 (HBV/A1), related to African populations and the African slave trade, was the most prevalent (66–94%). The Skyline Plot analysis showed a marked population expansion of HBV/A1 in Native Americans occurring more recently (1945–1965) than in the general Brazilian population. Our results suggest that historic processes that contributed to formation of HBV/A1 circulating in Native American are related with more recent migratory waves towards the Amazon basin, which generated a different viral dynamics in this region.
-
Modeling Host Genetic Regulation of Influenza Pathogenesis in the Collaborative Cross
Ferris, Martin T.; Aylor, David L.; Bottomly, Daniel; Whitmore, Alan C.; Aicher, Lauri D.; Bell, Timothy A.; Bradel-Tretheway, Birgit; Bryan, Janine T.; Buus, Ryan J.; Gralinski, Lisa E.; Haagmans, Bart L.; McMillan, Leonard; Miller, Darla R.; Rosenzweig, Elizabeth; Valdar, William; Wang, Jeremy; Churchill, Gary A.; Threadgill, David W.; McWeeney, Shannon K.; Katze, Michael G.; Pardo-Manuel de Villena, Fernando; Baric, Ralph S.; Heise, Mark T.
2013-01-01
Genetic variation contributes to host responses and outcomes following infection by influenza A virus or other viral infections. Yet narrow windows of disease symptoms and confounding environmental factors have made it difficult to identify polymorphic genes that contribute to differential disease outcomes in human populations. Therefore, to control for these confounding environmental variables in a system that models the levels of genetic diversity found in outbred populations such as humans, we used incipient lines of the highly genetically diverse Collaborative Cross (CC) recombinant inbred (RI) panel (the pre-CC population) to study how genetic variation impacts influenza associated disease across a genetically diverse population. A wide range of variation in influenza disease related phenotypes including virus replication, virus-induced inflammation, and weight loss was observed. Many of the disease associated phenotypes were correlated, with viral replication and virus-induced inflammation being predictors of virus-induced weight loss. Despite these correlations, pre-CC mice with unique and novel disease phenotype combinations were observed. We also identified sets of transcripts (modules) that were correlated with aspects of disease. In order to identify how host genetic polymorphisms contribute to the observed variation in disease, we conducted quantitative trait loci (QTL) mapping. We identified several QTL contributing to specific aspects of the host response including virus-induced weight loss, titer, pulmonary edema, neutrophil recruitment to the airways, and transcriptional expression. Existing whole-genome sequence data was applied to identify high priority candidate genes within QTL regions. A key host response QTL was located at the site of the known anti-influenza Mx1 gene. We sequenced the coding regions of Mx1 in the eight CC founder strains, and identified a novel Mx1 allele that showed reduced ability to inhibit viral replication, while maintaining protection from weight loss. PMID:23468633
-
A gyrovirus infecting a sea bird
Li, Linlin; Pesavento, Patricia A.; Gaynor, Anne M.; Duerr, Rebecca S.; Phan, Tung Gia; Zhang, Wen; Deng, Xutao
2015-01-01
We characterized the genome of a highly divergent gyrovirus (GyV8) in the spleen and uropygial gland tissues of a diseased northern fulmar (Fulmarus glacialis), a pelagic bird beached in San Francisco, California. No other exogenous viral sequences could be identified using viral metagenomics. The small circular DNA genome shared no significant nucleotide sequence identity, and only 38–42 % amino acid sequence identity in VP1, with any of the previously identified gyroviruses. GyV8 is the first member of the third major phylogenetic clade of this viral genus and the first gyrovirus detected in an avian species other than chicken. PMID:26036564
-
Mx1 and Mx2 key antiviral proteins are surprisingly lost in toothed whales
Braun, Benjamin A.; Marcovitz, Amir; Camp, J. Gray; Jia, Robin; Bejerano, Gill
2015-01-01
Viral outbreaks in dolphins and other Delphinoidea family members warrant investigation into the integrity of the cetacean immune system. The dynamin-like GTPase genes Myxovirus 1 (Mx1) and Mx2 defend mammals against a broad range of viral infections. Loss of Mx1 function in human and mice enhances infectivity by multiple RNA and DNA viruses, including orthomyxoviruses (influenza A), paramyxoviruses (measles), and hepadnaviruses (hepatitis B), whereas loss of Mx2 function leads to decreased resistance to HIV-1 and other viruses. Here we show that both Mx1 and Mx2 have been rendered nonfunctional in Odontoceti cetaceans (toothed whales, including dolphins and orcas). We discovered multiple exon deletions, frameshift mutations, premature stop codons, and transcriptional evidence of decay in the coding sequence of both Mx1 and Mx2 in four species of Odontocetes. We trace the likely loss event for both proteins to soon after the divergence of Odontocetes and Mystocetes (baleen whales) ∼33–37 Mya. Our data raise intriguing questions as to what drove the loss of both Mx1 and Mx2 genes in the Odontoceti lineage, a double loss seen in none of 56 other mammalian genomes, and suggests a hitherto unappreciated fundamental genetic difference in the way these magnificent mammals respond to viral infections. PMID:26080416
-
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
-
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
-
Mx1 and Mx2 key antiviral proteins are surprisingly lost in toothed whales.
Braun, Benjamin A; Marcovitz, Amir; Camp, J Gray; Jia, Robin; Bejerano, Gill
2015-06-30
Viral outbreaks in dolphins and other Delphinoidea family members warrant investigation into the integrity of the cetacean immune system. The dynamin-like GTPase genes Myxovirus 1 (Mx1) and Mx2 defend mammals against a broad range of viral infections. Loss of Mx1 function in human and mice enhances infectivity by multiple RNA and DNA viruses, including orthomyxoviruses (influenza A), paramyxoviruses (measles), and hepadnaviruses (hepatitis B), whereas loss of Mx2 function leads to decreased resistance to HIV-1 and other viruses. Here we show that both Mx1 and Mx2 have been rendered nonfunctional in Odontoceti cetaceans (toothed whales, including dolphins and orcas). We discovered multiple exon deletions, frameshift mutations, premature stop codons, and transcriptional evidence of decay in the coding sequence of both Mx1 and Mx2 in four species of Odontocetes. We trace the likely loss event for both proteins to soon after the divergence of Odontocetes and Mystocetes (baleen whales) ∼33-37 Mya. Our data raise intriguing questions as to what drove the loss of both Mx1 and Mx2 genes in the Odontoceti lineage, a double loss seen in none of 56 other mammalian genomes, and suggests a hitherto unappreciated fundamental genetic difference in the way these magnificent mammals respond to viral infections.
-
Genetic heterogeneity of the hepatitis C virus.
Bukh, J; Miller, R H; Purcell, R H
1995-01-01
Hepatitis C virus (HCV) is an important etiological agent in the development of chronic liver diseases such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). The virus, identified only recently, contains a single-stranded RNA genome of positive polarity, is distantly related to pestiviruses and flaviviruses, and has been classified as the first member of a third genus within the family Flaviviridae. Extensive analysis of HCV genomic sequences demonstrated that this virus possesses significant genetic heterogeneity. Different regions of the viral genome demonstrate a varying degree of heterogeneity; the regions coding for the putative envelope proteins are the most variable sites between different isolates. Furthermore, HCV circulates as a quasispecies in the host. During the course of acute and chronic infection, the sequence composition of the HCV population in one patient has been found to change sequentially with an extremely high rate of nonconserved nucleotide changes in the hypervariable region I (HVR1) of HCV. Such sequence changes alter the antigenicity of the epitopes coded within HVR1 so that these are not always recognized by preexisting antibodies. It has been suggested that this could represent one mechanism by which HCV evades host immune surveillance and may account for the high rate of chronicity observed in such infections. Continuous viral replication may, in turn, lead to the development of chronic liver disease, including HCC, in infected individuals. To date, at least nine major genetic groups (genotypes 1-9) and more than 30 subgroups of HCV have been recognized based on genetic differences. A distinct difference has been observed in the genotype distribution in Africa compared with other continents. Recent data have suggested a difference in pathogenesis and in the outcome of interferon therapy in individuals infected with HCV of certain genotypes. For example, genotype 1b (II) seems to be associated with more severe liver disease, including HCC, and with a poorer response to interferon therapy. The extensive genetic heterogeneity of HCV may have serious implications for the diagnosis, treatment and prevention of hepatitis C as well as in understanding the biology of infection by this important human pathogen.
-
Koppstein, David; Ashour, Joseph; Bartel, David P.
2015-01-01
The influenza polymerase cleaves host RNAs ∼10–13 nucleotides downstream of their 5′ ends and uses this capped fragment to prime viral mRNA synthesis. To better understand this process of cap snatching, we used high-throughput sequencing to determine the 5′ ends of A/WSN/33 (H1N1) influenza mRNAs. The sequences provided clear evidence for nascent-chain realignment during transcription initiation and revealed a strong influence of the viral template on the frequency of realignment. After accounting for the extra nucleotides inserted through realignment, analysis of the capped fragments indicated that the different viral mRNAs were each prepended with a common set of sequences and that the polymerase often cleaved host RNAs after a purine and often primed transcription on a single base pair to either the terminal or penultimate residue of the viral template. We also developed a bioinformatic approach to identify the targeted host transcripts despite limited information content within snatched fragments and found that small nuclear RNAs and small nucleolar RNAs contributed the most abundant capped leaders. These results provide insight into the mechanism of viral transcription initiation and reveal the diversity of the cap-snatched repertoire, showing that noncoding transcripts as well as mRNAs are used to make influenza mRNAs. PMID:25901029
-
Host-Associated Metagenomics: A Guide to Generating Infectious RNA Viromes
Robert, Catherine; Pascalis, Hervé; Michelle, Caroline; Jardot, Priscilla; Charrel, Rémi; Raoult, Didier; Desnues, Christelle
2015-01-01
Background Metagenomic analyses have been widely used in the last decade to describe viral communities in various environments or to identify the etiology of human, animal, and plant pathologies. Here, we present a simple and standardized protocol that allows for the purification and sequencing of RNA viromes from complex biological samples with an important reduction of host DNA and RNA contaminants, while preserving the infectivity of viral particles. Principal Findings We evaluated different viral purification steps, random reverse transcriptions and sequence-independent amplifications of a pool of representative RNA viruses. Viruses remained infectious after the purification process. We then validated the protocol by sequencing the RNA virome of human body lice engorged in vitro with artificially contaminated human blood. The full genomes of the most abundant viruses absorbed by the lice during the blood meal were successfully sequenced. Interestingly, random amplifications differed in the genome coverage of segmented RNA viruses. Moreover, the majority of reads were taxonomically identified, and only 7–15% of all reads were classified as “unknown”, depending on the random amplification method. Conclusion The protocol reported here could easily be applied to generate RNA viral metagenomes from complex biological samples of different origins. Our protocol allows further virological characterizations of the described viral communities because it preserves the infectivity of viral particles and allows for the isolation of viruses. PMID:26431175
-
Moser, Lindsey A.; Ramirez-Carvajal, Lisbeth; Puri, Vinita; Pauszek, Steven J.; Matthews, Krystal; Dilley, Kari A.; Mullan, Clancy; McGraw, Jennifer; Khayat, Michael; Beeri, Karen; Yee, Anthony; Dugan, Vivien; Heise, Mark T.; Frieman, Matthew B.; Rodriguez, Luis L.; Bernard, Kristen A.; Wentworth, David E.
2016-01-01
ABSTRACT Several biosafety level 3 and/or 4 (BSL-3/4) pathogens are high-consequence, single-stranded RNA viruses, and their genomes, when introduced into permissive cells, are infectious. Moreover, many of these viruses are select agents (SAs), and their genomes are also considered SAs. For this reason, cDNAs and/or their derivatives must be tested to ensure the absence of infectious virus and/or viral RNA before transfer out of the BSL-3/4 and/or SA laboratory. This tremendously limits the capacity to conduct viral genomic research, particularly the application of next-generation sequencing (NGS). Here, we present a sequence-independent method to rapidly amplify viral genomic RNA while simultaneously abolishing both viral and genomic RNA infectivity across multiple single-stranded positive-sense RNA (ssRNA+) virus families. The process generates barcoded DNA amplicons that range in length from 300 to 1,000 bp, which cannot be used to rescue a virus and are stable to transport at room temperature. Our barcoding approach allows for up to 288 barcoded samples to be pooled into a single library and run across various NGS platforms without potential reconstitution of the viral genome. Our data demonstrate that this approach provides full-length genomic sequence information not only from high-titer virion preparations but it can also recover specific viral sequence from samples with limited starting material in the background of cellular RNA, and it can be used to identify pathogens from unknown samples. In summary, we describe a rapid, universal standard operating procedure that generates high-quality NGS libraries free of infectious virus and infectious viral RNA. IMPORTANCE This report establishes and validates a standard operating procedure (SOP) for select agents (SAs) and other biosafety level 3 and/or 4 (BSL-3/4) RNA viruses to rapidly generate noninfectious, barcoded cDNA amenable for next-generation sequencing (NGS). This eliminates the burden of testing all processed samples derived from high-consequence pathogens prior to transfer from high-containment laboratories to lower-containment facilities for sequencing. Our established protocol can be scaled up for high-throughput sequencing of hundreds of samples simultaneously, which can dramatically reduce the cost and effort required for NGS library construction. NGS data from this SOP can provide complete genome coverage from viral stocks and can also detect virus-specific reads from limited starting material. Our data suggest that the procedure can be implemented and easily validated by institutional biosafety committees across research laboratories. PMID:27822536
-
A phylogenetic approach to following West Nile virus in Connecticut
Anderson, John F.; Vossbrinck, Charles R.; Andreadis, Theodore G.; Iton, Anthony; Beckwith, William H.; Mayo, Donald R.
2001-01-01
The 1999 outbreak of West Nile (WN) virus in the northeastern United States was the first known natural occurrence of this flavivirus in the Western Hemisphere. In 1999 and 2000, 82 independent Connecticut WN virus isolates were cultured from nine species of birds, five species of mosquitoes, and one striped skunk. Nucleotide sequences obtained from these isolates identified 30 genetic changes, compared with WN-NY99, in a 921-nt region of the viral genome beginning at nucleotide position 205 and ending at 1125. This region encodes portions of the nucleocapsid and envelope proteins and includes the entire coding regions for the premembrane and membrane proteins. Amino acid changes occurred at seven loci in six isolates relative to the WN-NY99 strain. Although 34 of the isolates showed sequences identical to the WN-NY99 isolate, we were able to show geographical-based clusters of mutations. In particular, 26 isolates were characterized by mutation of C to T at position 858. This group apparently originated in Stamford, CT and disseminated to sites located as far as 54 miles from Stamford. Sequences of WN virus isolated from both brain and heart tissues from the same avian host were identical in all 14 tested individual birds, suggesting that the mutations we have documented are real and not caused by culture, RNA extraction, or PCR procedures. We conclude that this portion of the viral genome will enable us to follow the geographical and temporal movement of variant WN virus strains as they adapt to North America. PMID:11606791
-
Functional Role of Infective Viral Particles on Metal Reduction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Coates, John D.
2014-04-01
A proposed strategy for the remediation of uranium (U) contaminated sites was based on the immobilization of U by reducing the oxidized soluble U, U(VI), to form a reduced insoluble end product, U(IV). Previous studies identified Geobacter sp., including G. sulfurreducens and G. metallireducens, as predominant U(VI)-reducing bacteria under acetate-oxidizing and U(VI)-reducing conditions. Examination of the finished genome sequence annotation of the canonical metal reducing species Geobacter sulfurreducens strain PCA and G. metallireduceans strain GS-15 as well as the draft genome sequence of G. uraniumreducens strain Rf4 identified phage related proteins. In addition, the completed genome for Anaeromyxobacter dehalogenans andmore » the draft genome sequence of Desulfovibrio desulfuricans strain G20, two more model metal-reducing bacteria, also revealed phage related sequences. The presence of these gene sequences indicated that Geobacter spp., Anaeromyxobacter spp., and Desulfovibrio spp. are susceptible to viral infection. Furthermore, viral populations in soils and sedimentary environments in the order of 6.4×10{sup 6}–2.7×10{sup 10} VLP’s cm{sup -3} have been observed. In some cases, viral populations exceed bacterial populations in these environments suggesting that a relationship may exist between viruses and bacteria. Our preliminary screens of samples collected from the ESR FRC indicated that viral like particles were observed in significant numbers. The objective of this study was to investigate the potential functional role viruses play in metal reduction specifically Fe(III) and U(VI) reduction, the environmental parameters affecting viral infection of metal reducing bacteria, and the subsequent effects on U transport.« less
-
Kim, Kiyeon; Omori, Ryosuke; Ueno, Keisuke; Iida, Sayaka; Ito, Kimihito
2016-01-01
Understanding the evolutionary dynamics of influenza viruses is essential to control both avian and human influenza. Here, we analyze host-specific and segment-specific Tajima's D trends of influenza A virus through a systematic review using viral sequences registered in the National Center for Biotechnology Information. To avoid bias from viral population subdivision, viral sequences were stratified according to their sampling locations and sampling years. As a result, we obtained a total of 580 datasets each of which consists of nucleotide sequences of influenza A viruses isolated from a single population of hosts at a single sampling site within a single year. By analyzing nucleotide sequences in the datasets, we found that Tajima's D values of viral sequences were different depending on hosts and gene segments. Tajima's D values of viruses isolated from chicken and human samples showed negative, suggesting purifying selection or a rapid population growth of the viruses. The negative Tajima's D values in rapidly growing viral population were also observed in computer simulations. Tajima's D values of PB2, PB1, PA, NP, and M genes of the viruses circulating in wild mallards were close to zero, suggesting that these genes have undergone neutral selection in constant-sized population. On the other hand, Tajima's D values of HA and NA genes of these viruses were positive, indicating HA and NA have undergone balancing selection in wild mallards. Taken together, these results indicated the existence of unknown factors that maintain viral subtypes in wild mallards.
-
Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures
Pride, David T; Schoenfeld, Thomas
2008-01-01
Background Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. Results From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs are predicted to belong to viruses rather than to any Bacteria or Archaea, consistent with the apparent viral origin of both metagenomes. Conclusion That BLAST searches identify no significant homologs for most metagenome contigs, while GSPC suggests their origin as archaeal viruses or bacteriophages, indicates GSPC provides a complementary approach in viral metagenomic analysis. PMID:18798991
-
Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures.
Pride, David T; Schoenfeld, Thomas
2008-09-17
Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs are predicted to belong to viruses rather than to any Bacteria or Archaea, consistent with the apparent viral origin of both metagenomes. That BLAST searches identify no significant homologs for most metagenome contigs, while GSPC suggests their origin as archaeal viruses or bacteriophages, indicates GSPC provides a complementary approach in viral metagenomic analysis.
-
Mendez, Ernesto; Ruggli, Nicolas; Collett, Marc S.; Rice, Charles M.
1998-01-01
Bovine viral diarrhea virus (BVDV), strain NADL, was originally isolated from an animal with fatal mucosal disease. This isolate is cytopathic in cell culture and produces two forms of NS3-containing proteins: uncleaved NS2-3 and mature NS3. For BVDV NADL, the production of NS3, a characteristic of cytopathic BVDV strains, is believed to be a consequence of an in-frame insertion of a 270-nucleotide cellular mRNA sequence (called cIns) in the NS2 coding region. In this study, we constructed a stable full-length cDNA copy of BVDV NADL in a low-copy-number plasmid vector. As assayed by transfection of MDBK cells, uncapped RNAs transcribed from this template were highly infectious (>105 PFU/μg). The recovered virus was similar in plaque morphology, growth properties, polyprotein processing, and cytopathogenicity to the BVDV NADL parent. Deletion of cIns abolished processing at the NS2/NS3 site and produced a virus that was no longer cytopathic for MDBK cells. This deletion did not affect the efficiency of infectious virus production or viral protein production, but it reduced the level of virus-specific RNA synthesis and accumulation. Thus, cIns not only modulates NS3 production but also upregulates RNA replication relative to an isogenic noncytopathic derivative lacking the insert. These results raise the possibility of a linkage between enhanced BVDV NADL RNA replication and virus-induced cytopathogenicity. PMID:9573238
-
Construction and characterization of poliovirus subgenomic replicons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaplan, G.; Racaniello, V.R.
1988-05-01
Poliovirus RNAs containing in-frame deletions within the capsid-coding region were produced by in vitro transcription of altered poliovirus type 1 cDNA by using bacteriophage T7 RNA polymerase. Three RNAs were transcribed that contained deletions of 2,317 nucleotides (bases 747 to 3,064), 1,781 nucleotides (bases 1,175 to 2,956), and 1,295 nucleotides (bases 1,175 to 2,470). All three subgenomic RNAs replicated after transfection into HeLa cells, demonstrating that sequences encoding the capsid polypeptides are not essential for viral RNA replication in vivo. Viral RNA containing the largest deletion (R1) replicated approximately three times better than full-length RNA produced in vitro. Northern blotmore » (RNA blot) hybridization analysis of total cellular RNA from HeLa cells at different times after transfection with R1 demonstrated the presence of increasing amounts of the expected 5.1-kilobase subgenomic RNA. Analysis by immunoprecipitation of ({sup 35}S-labeled) viral proteins induced after transfection of R1 RNA into HeLa cells revealed the presence of proteins 2A{sup pro}, 2C, and 3D{sup pol} and its precursors, suggesting that the polyprotein cleavages are similar to those occurring in virus-infected cells. These internally and terminally deleted RNAs inhibited the replication of subgenomic replicons R1, R2, and R3 and caused a reduction in plaque size when cotransfected with P1/Mahoney or P2/Lansing viral RNA, suggesting that individual cells had received both RNAs.« less
-
Rapid Sequencing of Complete env Genes from Primary HIV-1 Samples
Eren, Kemal; Ignacio, Caroline; Landais, Elise; Weaver, Steven; Phung, Pham; Ludka, Colleen; Hepler, Lance; Caballero, Gemma; Pollner, Tristan; Guo, Yan; Richman, Douglas; Poignard, Pascal; Paxinos, Ellen E.; Kosakovsky Pond, Sergei L.
2016-01-01
Abstract The ability to study rapidly evolving viral populations has been constrained by the read length of next-generation sequencing approaches and the sampling depth of single-genome amplification methods. Here, we develop and characterize a method using Pacific Biosciences’ Single Molecule, Real-Time (SMRT®) sequencing technology to sequence multiple, intact full-length human immunodeficiency virus-1 env genes amplified from viral RNA populations circulating in blood, and provide computational tools for analyzing and visualizing these data. PMID:29492273
-
Sobel Leonard, Ashley; McClain, Micah T; Smith, Gavin J D; Wentworth, David E; Halpin, Rebecca A; Lin, Xudong; Ransier, Amy; Stockwell, Timothy B; Das, Suman R; Gilbert, Anthony S; Lambkin-Williams, Robert; Ginsburg, Geoffrey S; Woods, Christopher W; Koelle, Katia
2016-12-15
Knowledge of influenza virus evolution at the point of transmission and at the intrahost level remains limited, particularly for human hosts. Here, we analyze a unique viral data set of next-generation sequencing (NGS) samples generated from a human influenza challenge study wherein 17 healthy subjects were inoculated with cell- and egg-passaged virus. Nasal wash samples collected from 7 of these subjects were successfully deep sequenced. From these, we characterized changes in the subjects' viral populations during infection and identified differences between the virus in these samples and the viral stock used to inoculate the subjects. We first calculated pairwise genetic distances between the subjects' nasal wash samples, the viral stock, and the influenza virus A/Wisconsin/67/2005 (H3N2) reference strain used to generate the stock virus. These distances revealed that considerable viral evolution occurred at various points in the human challenge study. Further quantitative analyses indicated that (i) the viral stock contained genetic variants that originated and likely were selected for during the passaging process, (ii) direct intranasal inoculation with the viral stock resulted in a selective bottleneck that reduced nonsynonymous genetic diversity in the viral hemagglutinin and nucleoprotein, and (iii) intrahost viral evolution continued over the course of infection. These intrahost evolutionary dynamics were dominated by purifying selection. Our findings indicate that rapid viral evolution can occur during acute influenza infection in otherwise healthy human hosts when the founding population size of the virus is large, as is the case with direct intranasal inoculation. Influenza viruses circulating among humans are known to rapidly evolve over time. However, little is known about how influenza virus evolves across single transmission events and over the course of a single infection. To address these issues, we analyze influenza virus sequences from a human challenge experiment that initiated infection with a cell- and egg-passaged viral stock, which appeared to have adapted during its preparation. We find that the subjects' viral populations differ genetically from the viral stock, with subjects' viral populations having lower representation of the amino-acid-changing variants that arose during viral preparation. We also find that most of the viral evolution occurring over single infections is characterized by further decreases in the frequencies of these amino-acid-changing variants and that only limited intrahost genetic diversification through new mutations is apparent. Our findings indicate that influenza virus populations can undergo rapid genetic changes during acute human infections. Copyright © 2016 Sobel Leonard et al.
-
Shah, Jigna D; Baller, Joshua; Zhang, Ying; Silverstein, Kevin; Xing, Zheng; Cardona, Carol J
2014-12-01
RNA viruses have been associated with enteritis in poultry and have been isolated from diseased birds. The same viral agents have also been detected in healthy flocks bringing into question their role in health and disease. In order to understand better eukaryotic viruses in the gut, this project focused on evaluating alternative methods to purify and concentrate viral particles, which do not involve the use of density gradients, for generating viral metagenome data. In this study, the sequence outcomes of three tissue processing methods have been evaluated and a data analysis pipeline has been established for RNA viruses from the gastrointestinal tract. In addition, with the use of the best method and increased sequencing depth, a glimpse of the RNA viral community in the gastrointestinal tract of a clinically normal 5-week old turkey is presented. The viruses from the Reoviridae and Astroviridae families together accounted for 76.3% of total viruses identified. The rarefaction curve at the species level further indicated that majority of the species diversity was included with the increased sequencing depth, implying that viruses from other viral families were present in very low abundance. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
-
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
-
Ramesh, S V
2013-09-01
Of late non-coding RNAs (ncRNAs)-mediated gene silencing is an influential tool deliberately deployed to negatively regulate the expression of targeted genes. In addition to the widely employed small interfering RNA (siRNA)-mediated gene silencing approach, other variants like artificial miRNA (amiRNA), miRNA mimics, and artificial transacting siRNAs (tasiRNAs) are being explored and successfully deployed in developing non-coding RNA-based genetically modified plants. The ncRNA-based gene manipulations are typified with mobile nature of silencing signals, interference from viral genome-derived suppressor proteins, and an obligation for meticulous computational analysis to prevaricate any inadvertent effects. In a broad sense, risk assessment inquiries for genetically modified plants based on the expression of ncRNAs are competently addressed by the environmental risk assessment (ERA) models, currently in vogue, designed for the first generation transgenic plants which are based on the expression of heterologous proteins. Nevertheless, transgenic plants functioning on the foundation of ncRNAs warrant due attention with respect to their unique attributes like off-target or non-target gene silencing effects, small RNAs (sRNAs) persistence, food and feed safety assessments, problems in detection and tracking of sRNAs in food, impact of ncRNAs in plant protection measures, effect of mutations etc. The role of recent developments in sequencing techniques like next generation sequencing (NGS) and the ERA paradigm of the different countries in vogue are also discussed in the context of ncRNA-based gene manipulations.
-
Tirera, Sourakhata; Ginouves, Marine; Donato, Damien; Caballero, Ignacio S; Bouchier, Christiane; Lavergne, Anne; Bourreau, Eliane; Mosnier, Emilie; Vantilcke, Vincent; Couppié, Pierre; Prevot, Ghislaine; Lacoste, Vincent
2017-07-01
Leishmania RNA virus type 1 (LRV1) is an endosymbiont of some Leishmania (Vianna) species in South America. Presence of LRV1 in parasites exacerbates disease severity in animal models and humans, related to a disproportioned innate immune response, and is correlated with drug treatment failures in humans. Although the virus was identified decades ago, its genomic diversity has been overlooked until now. We subjected LRV1 strains from 19 L. (V.) guyanensis and one L. (V.) braziliensis isolates obtained from cutaneous leishmaniasis samples identified throughout French Guiana with next-generation sequencing and de novo sequence assembly. We generated and analyzed 24 unique LRV1 sequences over their full-length coding regions. Multiple alignment of these new sequences revealed variability (0.5%-23.5%) across the entire sequence except for highly conserved motifs within the 5' untranslated region. Phylogenetic analyses showed that viral genomes of L. (V.) guyanensis grouped into five distinct clusters. They further showed a species-dependent clustering between viral genomes of L. (V.) guyanensis and L. (V.) braziliensis, confirming a long-term co-evolutionary history. Noteworthy, we identified cases of multiple LRV1 infections in three of the 20 Leishmania isolates. Here, we present the first-ever estimate of LRV1 genomic diversity that exists in Leishmania (V.) guyanensis parasites. Genetic characterization and phylogenetic analyses of these viruses has shed light on their evolutionary relationships. To our knowledge, this study is also the first to report cases of multiple LRV1 infections in some parasites. Finally, this work has made it possible to develop molecular tools for adequate identification and genotyping of LRV1 strains for diagnostic purposes. Given the suspected worsening role of LRV1 infection in the pathogenesis of human leishmaniasis, these data have a major impact from a clinical viewpoint and for the management of Leishmania-infected patients.
-
Caballero, Ignacio S.; Bouchier, Christiane; Lavergne, Anne; Bourreau, Eliane; Mosnier, Emilie; Vantilcke, Vincent; Couppié, Pierre; Prevot, Ghislaine
2017-01-01
Introduction Leishmania RNA virus type 1 (LRV1) is an endosymbiont of some Leishmania (Vianna) species in South America. Presence of LRV1 in parasites exacerbates disease severity in animal models and humans, related to a disproportioned innate immune response, and is correlated with drug treatment failures in humans. Although the virus was identified decades ago, its genomic diversity has been overlooked until now. Methodology/Principles findings We subjected LRV1 strains from 19 L. (V.) guyanensis and one L. (V.) braziliensis isolates obtained from cutaneous leishmaniasis samples identified throughout French Guiana with next-generation sequencing and de novo sequence assembly. We generated and analyzed 24 unique LRV1 sequences over their full-length coding regions. Multiple alignment of these new sequences revealed variability (0.5%–23.5%) across the entire sequence except for highly conserved motifs within the 5’ untranslated region. Phylogenetic analyses showed that viral genomes of L. (V.) guyanensis grouped into five distinct clusters. They further showed a species-dependent clustering between viral genomes of L. (V.) guyanensis and L. (V.) braziliensis, confirming a long-term co-evolutionary history. Noteworthy, we identified cases of multiple LRV1 infections in three of the 20 Leishmania isolates. Conclusions/Significance Here, we present the first-ever estimate of LRV1 genomic diversity that exists in Leishmania (V.) guyanensis parasites. Genetic characterization and phylogenetic analyses of these viruses has shed light on their evolutionary relationships. To our knowledge, this study is also the first to report cases of multiple LRV1 infections in some parasites. Finally, this work has made it possible to develop molecular tools for adequate identification and genotyping of LRV1 strains for diagnostic purposes. Given the suspected worsening role of LRV1 infection in the pathogenesis of human leishmaniasis, these data have a major impact from a clinical viewpoint and for the management of Leishmania-infected patients. PMID:28715422
-
Molecular typing of enteroviruses associated with viral meningitis in Cyprus, 2000-2002.
Richter, Jan; Koptides, Dana; Tryfonos, Christina; Christodoulou, Christina
2006-08-01
Human enteroviruses are responsible for a wide spectrum of clinical diseases affecting many different organ systems. Although infection is usually asymptomatic, infections of the central nervous system manifested as meningitis or encephalitis can pose a serious public health problem, especially during outbreaks. In this study, samples from 218 patients diagnosed with enteroviral meningitis between January 2000 and December 2002 were analysed in order to assess the epidemiology of human enteroviruses as a cause of viral meningitis in Cyprus. A new typing strategy, based on partial sequencing of the 5' non-coding region (5'NCR), prediction of type, and selection of type-specific primers for sensitive VP1 PCR amplification, was developed. As clustering in the 5'NCR was concordant with clustering in the VP1 region, quick and reliable typing by VP1 sequencing was achieved without virus isolation in cell culture. The most frequent enterovirus serotypes identified were Human echovirus 30 (55.5%), Human echovirus 13 (15.1%), Human echovirus 6 (13.8%) and Human echovirus 9 (8.3%). Human coxsackieviruses B2, B1 and B5, Human echovirus 4, Human enterovirus 71 and Human coxsackievirus A6 represented rather rare serotypes. This is the first molecular epidemiological study of enterovirus meningitis in Cyprus. Serotype distribution corresponded basically with observations in other European countries, suggesting the spread of enteroviruses by tourism.
-
Bass, David; Moureau, Gregory; Tang, Shuoya; McAlister, Erica; Culverwell, C. Lorna; Glücksman, Edvard; Wang, Hui; Brown, T. David K.; Gould, Ernest A.; Harbach, Ralph E.; de Lamballerie, Xavier; Firth, Andrew E.
2013-01-01
We investigated whether small RNA (sRNA) sequenced from field-collected mosquitoes and chironomids (Diptera) can be used as a proxy signature of viral prevalence within a range of species and viral groups, using sRNAs sequenced from wild-caught specimens, to inform total RNA deep sequencing of samples of particular interest. Using this strategy, we sequenced from adult Anopheles maculipennis s.l. mosquitoes the apparently nearly complete genome of one previously undescribed virus related to chronic bee paralysis virus, and, from a pool of Ochlerotatus caspius and Oc. detritus mosquitoes, a nearly complete entomobirnavirus genome. We also reconstructed long sequences (1503-6557 nt) related to at least nine other viruses. Crucially, several of the sequences detected were reconstructed from host organisms highly divergent from those in which related viruses have been previously isolated or discovered. It is clear that viral transmission and maintenance cycles in nature are likely to be significantly more complex and taxonomically diverse than previously expected. PMID:24260463
-
Dacheux, Laurent; Cervantes-Gonzalez, Minerva; Guigon, Ghislaine; Thiberge, Jean-Michel; Vandenbogaert, Mathias; Maufrais, Corinne
2014-01-01
The prediction of viral zoonosis epidemics has become a major public health issue. A profound understanding of the viral population in key animal species acting as reservoirs represents an important step towards this goal. Bats harbor diverse viruses, some of which are of particular interest because they cause severe human diseases. However, little is known about the diversity of the global population of viruses found in bats (virome). We determined the viral diversity of five different French insectivorous bat species (nine specimens in total) in close contact with humans. Sequence-independent amplification, high-throughput sequencing with Illumina technology and a dedicated bioinformatics analysis pipeline were used on pooled tissues (brain, liver and lungs). Comparisons of the sequences of contigs and unassembled reads provided a global taxonomic distribution of virus-related sequences for each sample, highlighting differences both within and between bat species. Many viral families were present in these viromes, including viruses known to infect bacteria, plants/fungi, insects or vertebrates, the most relevant being those infecting mammals (Retroviridae, Herpesviridae, Bunyaviridae, Poxviridae, Flaviviridae, Reoviridae, Bornaviridae, Picobirnaviridae). In particular, we detected several new mammalian viruses, including rotaviruses, gammaretroviruses, bornaviruses and bunyaviruses with the identification of the first bat nairovirus. These observations demonstrate that bats naturally harbor viruses from many different families, most of which infect mammals. They may therefore constitute a major reservoir of viral diversity that should be analyzed carefully, to determine the role played by bats in the spread of zoonotic viral infections. PMID:24489870
-
The Fecal Viral Flora of Wild Rodents
Phan, Tung G.; Kapusinszky, Beatrix; Wang, Chunlin; Rose, Robert K.; Lipton, Howard L.; Delwart, Eric L.
2011-01-01
The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat) collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in mammals. PMID:21909269
-
Sequencing artifacts in the type A influenza databases and attempts to correct them.
Suarez, David L; Chester, Nikki; Hatfield, Jason
2014-07-01
There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.
-
Viral taxonomy needs a spring clean; its exploration era is over.
Gibbs, Adrian J
2013-08-09
The International Committee on Taxonomy of Viruses has recently changed its approved definition of a viral species, and also discontinued work on its database of virus descriptions. These events indicate that the exploration era of viral taxonomy has ended; over the past century the principles of viral taxonomy have been established, the tools for phylogenetic inference invented, and the ultimate discriminatory data required for taxonomy, namely gene sequences, are now readily available. Further changes would make viral taxonomy more informative. First, the status of a 'taxonomic species' with an italicized name should only be given to viruses that are specifically linked with a single 'type genomic sequence' like those in the NCBI Reference Sequence Database. Secondly all approved taxa should be predominately monophyletic, and uninformative higher taxa disendorsed. These are 'quality assurance' measures and would improve the value of viral nomenclature to its users. The ICTV should also promote the use of a public database, such as Wikipedia, to replace the ICTV database as a store of the primary metadata of individual viruses, and should publish abstracts of the ICTV Reports in that database, so that they are 'Open Access'.
-
Luft, F; Klaes, R; Nees, M; Dürst, M; Heilmann, V; Melsheimer, P; von Knebel Doeberitz, M
2001-04-01
Human papillomavirus (HPV) genomes usually persist as episomal molecules in HPV associated preneoplastic lesions whereas they are frequently integrated into the host cell genome in HPV-related cancers cells. This suggests that malignant conversion of HPV-infected epithelia is linked to recombination of cellular and viral sequences. Due to technical limitations, precise sequence information on viral-cellular junctions were obtained only for few cell lines and primary lesions. In order to facilitate the molecular analysis of genomic HPV integration, we established a ligation-mediated PCR assay for the detection of integrated papillomavirus sequences (DIPS-PCR). DIPS-PCR was initially used to amplify genomic viral-cellular junctions from HPV-associated cervical cancer cell lines (C4-I, C4-II, SW756, and HeLa) and HPV-immortalized keratinocyte lines (HPKIA, HPKII). In addition to junctions already reported in public data bases, various new fusion fragments were identified. Subsequently, 22 different viral-cellular junctions were amplified from 17 cervical carcinomas and 1 vulval intraepithelial neoplasia (VIN III). Sequence analysis of each junction revealed that the viral E1 open reading frame (ORF) was fused to cellular sequences in 20 of 22 (91%) cases. Chromosomal integration loci mapped to chromosomes 1 (2n), 2 (3n), 7 (2n), 8 (3n), 10 (1n), 14 (5n), 16 (1n), 17 (2n), and mitochondrial DNA (1n), suggesting random distribution of chromosomal integration sites. Precise sequence information obtained by DIPS-PCR was further used to monitor the monoclonal origin of 4 cervical cancers, 1 case of recurrent premalignant lesions and 1 lymph node metastasis. Therefore, DIPS-PCR might allow efficient therapy control and prediction of relapse in patients with HPV-associated anogenital cancers. Copyright 2001 Wiley-Liss, Inc.
-
Haseloff, J; Goelet, P; Zimmern, D; Ahlquist, P; Dasgupta, R; Kaesberg, P
1984-01-01
The plant viruses alfalfa mosaic virus (AMV) and brome mosaic virus (BMV) each divide their genetic information among three RNAs while tobacco mosaic virus (TMV) contains a single genomic RNA. Amino acid sequence comparisons suggest that the single proteins encoded by AMV RNA 1 and BMV RNA 1 and by AMV RNA 2 and BMV RNA 2 are related to the NH2-terminal two-thirds and the COOH-terminal one-third, respectively, of the largest protein encoded by TMV. Separating these two domains in the TMV RNA sequence is an amber termination codon, whose partial suppression allows translation of the downstream domain. Many of the residues that the TMV read-through domain and the segmented plant viruses have in common are also conserved in a read-through domain found in the nonstructural polyprotein of the animal alphaviruses Sindbis and Middelburg. We suggest that, despite substantial differences in gene organization and expression, all of these viruses use related proteins for common functions in RNA replication. Reassortment of functional modules of coding and regulatory sequence from preexisting viral or cellular sources, perhaps via RNA recombination, may be an important mechanism in RNA virus evolution. PMID:6611550
-
Rotavirus I in feces of a cat with diarrhea.
Phan, Tung G; Leutenegger, Christian M; Chan, Roxanne; Delwart, Eric
2017-06-01
A divergent rotavirus I was detected using viral metagenomics in the feces of a cat with diarrhea. The eleven segments of rotavirus I strain Felis catus encoded non-structural and structural proteins with amino acid identities ranging from 25 to 79% to the only two currently sequenced members of that viral species both derived from canine feces. No other eukaryotic viral sequences nor bacterial and protozoan pathogens were detected in this fecal sample suggesting the involvement of rotavirus I in feline diarrhea.
-
Bull, Marta; Learn, Gerald; Genowati, Indira; McKernan, Jennifer; Hitti, Jane; Lockhart, David; Tapia, Kenneth; Holte, Sarah; Dragavon, Joan; Coombs, Robert; Mullins, James; Frenkel, Lisa
2009-09-22
Compartmentalization of HIV-1 between the genital tract and blood was noted in half of 57 women included in 12 studies primarily using cell-free virus. To further understand differences between genital tract and blood viruses of women with chronic HIV-1 infection cell-free and cell-associated virus populations were sequenced from these tissues, reasoning that integrated viral DNA includes variants archived from earlier in infection, and provides a greater array of genotypes for comparisons. Multiple sequences from single-genome-amplification of HIV-1 RNA and DNA from the genital tract and blood of each woman were compared in a cross-sectional study. Maximum likelihood phylogenies were evaluated for evidence of compartmentalization using four statistical tests. Genital tract and blood HIV-1 appears compartmentalized in 7/13 women by >/=2 statistical analyses. These subjects' phylograms were characterized by low diversity genital-specific viral clades interspersed between clades containing both genital and blood sequences. Many of the genital-specific clades contained monotypic HIV-1 sequences. In 2/7 women, HIV-1 populations were significantly compartmentalized across all four statistical tests; both had low diversity genital tract-only clades. Collapsing monotypic variants into a single sequence diminished the prevalence and extent of compartmentalization. Viral sequences did not demonstrate tissue-specific signature amino acid residues, differential immune selection, or co-receptor usage. In women with chronic HIV-1 infection multiple identical sequences suggest proliferation of HIV-1-infected cells, and low diversity tissue-specific phylogenetic clades are consistent with bursts of viral replication. These monotypic and tissue-specific viruses provide statistical support for compartmentalization of HIV-1 between the female genital tract and blood. However, the intermingling of these clades with clades comprised of both genital and blood sequences and the absence of tissue-specific genetic features suggests compartmentalization between blood and genital tract may be due to viral replication and proliferation of infected cells, and questions whether HIV-1 in the female genital tract is distinct from blood.
-
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)
Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.
1996-01-01
The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146
-
Generation and Characterization of a Defective HIV-1 Virus as an Immunogen for a Therapeutic Vaccine
García-Pérez, Javier; García, Felipe; Blanco, Julia; Escribà-García, Laura; Gatell, Jose Maria; Alcamí, Jose; Plana, Montserrat; Sánchez-Palomino, Sonsoles
2012-01-01
Background The generation of new immunogens able to elicit strong specific immune responses remains a major challenge in the attempts to obtain a prophylactic or therapeutic vaccine against HIV/AIDS. We designed and constructed a defective recombinant virus based on the HIV-1 genome generating infective but non-replicative virions able to elicit broad and strong cellular immune responses in HIV-1 seropositive individuals. Results Viral particles were generated through transient transfection in producer cells (293-T) of a full length HIV-1 DNA carrying a deletion of 892 base pairs (bp) in the pol gene encompassing the sequence that codes for the reverse transcriptase (NL4-3/ΔRT clone). The viral particles generated were able to enter target cells, but due to the absence of reverse transcriptase no replication was detected. The immunogenic capacity of these particles was assessed by ELISPOT to determine γ-interferon production in a cohort of 69 chronic asymptomatic HIV-1 seropositive individuals. Surprisingly, defective particles produced from NL4-3/ΔRT triggered stronger cellular responses than wild-type HIV-1 viruses inactivated with Aldrithiol-2 (AT-2) and in a larger proportion of individuals (55% versus 23% seropositive individuals tested). Electron microscopy showed that NL4-3/ΔRT virions display immature morphology. Interestingly, wild-type viruses treated with Amprenavir (APV) to induce defective core maturation also induced stronger responses than the same viral particles generated in the absence of protease inhibitors. Conclusions We propose that immature HIV-1 virions generated from NL4-3/ΔRT viral clones may represent new prototypes of immunogens with a safer profile and stronger capacity to induce cellular immune responses than wild-type inactivated viral particles. PMID:23144996
-
Wild-Type Measles Viruses with Non-Standard Genome Lengths
Bankamp, Bettina; Liu, Chunyu; Rivailler, Pierre; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen F.; Bellini, William J.; Rota, Paul A.
2014-01-01
The length of the single stranded, negative sense RNA genome of measles virus (MeV) is highly conserved at 15,894 nucleotides (nt). MeVs can be grouped into 24 genotypes based on the highly variable 450 nucleotides coding for the carboxyl-terminus of the nucleocapsid protein (N-450). Here, we report the genomic sequences of 2 wild-type viral isolates of genotype D4 with genome lengths of 15,900 nt. Both genomes had a 7 nt insertion in the 3′ untranslated region (UTR) of the matrix (M) gene and a 1 nt deletion in the 5′ UTR of the fusion (F) gene. The net gain of 6 nt complies with the rule-of-six required for replication competency of the genomes of morbilliviruses. The insertions and deletion (indels) were confirmed in a patient sample that was the source of one of the viral isolates. The positions of the indels were identical in both viral isolates, even though epidemiological data and the 3 nt differences in N-450 between the two genomes suggested that the viruses represented separate chains of transmission. Identical indels were found in the M-F intergenic regions of 14 additional genotype D4 viral isolates that were imported into the US during 2007–2010. Viral isolates with and without indels produced plaques of similar size and replicated efficiently in A549/hSLAM and Vero/hSLAM cells. This is the first report of wild-type MeVs with genome lengths other than 15,894 nt and demonstrates that the length of the M-F UTR of wild-type MeVs is flexible. PMID:24748123
-
Tannir, Nizar M.; Williams, Michelle D.; Chen, Yunxin; Yao, Hui; Zhang, Jianping; Thompson, Erika J.; Meric-Bernstam, Funda; Medeiros, L. Jeffrey; Weinstein, John N.
2013-01-01
Elucidation of tumor-DNA virus associations in many cancer types has enhanced our knowledge of fundamental oncogenesis mechanisms and provided a basis for cancer prevention initiatives. RNA-Seq is a novel tool to comprehensively assess such associations. We interrogated RNA-Seq data from 3,775 malignant neoplasms in The Cancer Genome Atlas database for the presence of viral sequences. Viral integration sites were also detected in expressed transcripts using a novel approach. The detection capacity of RNA-Seq was compared to available clinical laboratory data. Human papillomavirus (HPV) transcripts were detected using RNA-Seq analysis in head-and-neck squamous cell carcinoma, uterine endometrioid carcinoma, and squamous cell carcinoma of the lung. Detection of HPV by RNA-Seq correlated with detection by in situ hybridization and immunohistochemistry in squamous cell carcinoma tumors of the head and neck. Hepatitis B virus and Epstein-Barr virus (EBV) were detected using RNA-Seq in hepatocellular carcinoma and gastric carcinoma tumors, respectively. Integration sites of viral genes and oncogenes were detected in cancers harboring HPV or hepatitis B virus but not in EBV-positive gastric carcinoma. Integration sites of expressed viral transcripts frequently involved known coding areas of the host genome. No DNA virus transcripts were detected in acute myeloid leukemia, cutaneous melanoma, low- and high-grade gliomas of the brain, and adenocarcinomas of the breast, colon and rectum, lung, prostate, ovary, kidney, and thyroid. In conclusion, this study provides a large-scale overview of the landscape of DNA viruses in human malignant cancers. While further validation is necessary for specific cancer types, our findings highlight the utility of RNA-Seq in detecting tumor-associated DNA viruses and identifying viral integration sites that may unravel novel mechanisms of cancer pathogenesis. PMID:23740984
-
Human La binds mRNAs through contacts to the poly(A) tail
Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A
2018-01-01
Abstract In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3’OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3’OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail. PMID:29447394
-
Evidence of translation efficiency adaptation of the coding regions of the bacteriophage lambda.
Goz, Eli; Mioduser, Oriah; Diament, Alon; Tuller, Tamir
2017-08-01
Deciphering the way gene expression regulatory aspects are encoded in viral genomes is a challenging mission with ramifications related to all biomedical disciplines. Here, we aimed to understand how the evolution shapes the bacteriophage lambda genes by performing a high resolution analysis of ribosomal profiling data and gene expression related synonymous/silent information encoded in bacteriophage coding regions.We demonstrated evidence of selection for distinct compositions of synonymous codons in early and late viral genes related to the adaptation of translation efficiency to different bacteriophage developmental stages. Specifically, we showed that evolution of viral coding regions is driven, among others, by selection for codons with higher decoding rates; during the initial/progressive stages of infection the decoding rates in early/late genes were found to be superior to those in late/early genes, respectively. Moreover, we argued that selection for translation efficiency could be partially explained by adaptation to Escherichia coli tRNA pool and the fact that it can change during the bacteriophage life cycle.An analysis of additional aspects related to the expression of viral genes, such as mRNA folding and more complex/longer regulatory signals in the coding regions, is also reported. The reported conclusions are likely to be relevant also to additional viruses. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
-
Ab initio gene identification in metagenomic sequences
Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark
2010-01-01
We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810
-
Weiss, Eric R; Lamers, Susanna L; Henderson, Jennifer L; Melnikov, Alexandre; Somasundaran, Mohan; Garber, Manuel; Selin, Liisa; Nusbaum, Chad; Luzuriaga, Katherine
2018-01-15
Over 90% of the world's population is persistently infected with Epstein-Barr virus. While EBV does not cause disease in most individuals, it is the common cause of acute infectious mononucleosis (AIM) and has been associated with several cancers and autoimmune diseases, highlighting a need for a preventive vaccine. At present, very few primary, circulating EBV genomes have been sequenced directly from infected individuals. While low levels of diversity and low viral evolution rates have been predicted for double-stranded DNA (dsDNA) viruses, recent studies have demonstrated appreciable diversity in common dsDNA pathogens (e.g., cytomegalovirus). Here, we report 40 full-length EBV genome sequences obtained from matched oral wash and B cell fractions from a cohort of 10 AIM patients. Both intra- and interpatient diversity were observed across the length of the entire viral genome. Diversity was most pronounced in viral genes required for establishing latent infection and persistence, with appreciable levels of diversity also detected in structural genes, including envelope glycoproteins. Interestingly, intrapatient diversity declined significantly over time ( P < 0.01), and this was particularly evident on comparison of viral genomes sequenced from B cell fractions in early primary infection and convalescence ( P < 0.001). B cell-associated viral genomes were observed to converge, becoming nearly identical to the B95.8 reference genome over time (Spearman rank-order correlation test; r = -0.5589, P = 0.0264). The reduction in diversity was most marked in the EBV latency genes. In summary, our data suggest independent convergence of diverse viral genome sequences toward a reference-like strain within a relatively short period following primary EBV infection. IMPORTANCE Identification of viral proteins with low variability and high immunogenicity is important for the development of a protective vaccine. Knowledge of genome diversity within circulating viral populations is a key step in this process, as is the expansion of intrahost genomic variation during infection. We report full-length EBV genomes sequenced from the blood and oral wash of 10 individuals early in primary infection and during convalescence. Our data demonstrate considerable diversity within the pool of circulating EBV strains, as well as within individual patients. Overall viral diversity decreased from early to persistent infection, particularly in latently infected B cells, which serve as the viral reservoir. Reduction in B cell-associated viral genome diversity coincided with a convergence toward a reference-like EBV genotype. Greater convergence positively correlated with time after infection, suggesting that the reference-like genome is the result of selection. Copyright © 2018 American Society for Microbiology.
-
PCR Amplification Strategies towards full-length HIV-1 Genome sequencing.
Liu, Chao Chun; Ji, Hezhao
2018-06-26
The advent of next generation sequencing has enabled greater resolution of viral diversity and improved feasibility of full viral genome sequencing allowing routine HIV-1 full genome sequencing in both research and diagnostic settings. Regardless of the sequencing platform selected, successful PCR amplification of the HIV-1 genome is essential for sequencing template preparation. As such, full HIV-1 genome amplification is a crucial step in dictating the successful and reliable sequencing downstream. Here we reviewed existing PCR protocols leading to HIV-1 full genome sequencing. In addition to the discussion on basic considerations on relevant PCR design, the advantages as well as the pitfalls of published protocols were reviewed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
-
Steel, Olivia; Kraberger, Simona; Sikorski, Alyssa; Young, Laura M; Catchpole, Ryan J; Stevens, Aaron J; Ladley, Jenny J; Coray, Dorien S; Stainton, Daisy; Dayaram, Anisha; Julian, Laurel; van Bysterveldt, Katherine; Varsani, Arvind
2016-09-01
In recent years, innovations in molecular techniques and sequencing technologies have resulted in a rapid expansion in the number of known viral sequences, in particular those with circular replication-associated protein (Rep)-encoding single-stranded (CRESS) DNA genomes. CRESS DNA viruses are present in the virome of many ecosystems and are known to infect a wide range of organisms. A large number of the recently identified CRESS DNA viruses cannot be classified into any known viral families, indicating that the current view of CRESS DNA viral sequence space is greatly underestimated. Animal faecal matter has proven to be a particularly useful source for sampling CRESS DNA viruses in an ecosystem, as it is cost-effective and non-invasive. In this study a viral metagenomic approach was used to explore the diversity of CRESS DNA viruses present in the faeces of domesticated and wild animals in New Zealand. Thirty-eight complete CRESS DNA viral genomes and two circular molecules (that may be defective molecules or single components of multicomponent genomes) were identified from forty-nine individual animal faecal samples. Based on shared genome organisations and sequence similarities, eighteen of the isolates were classified as gemycircularviruses and twelve isolates were classified as smacoviruses. The remaining eight isolates lack significant sequence similarity with any members of known CRESS DNA virus groups. This research adds significantly to our knowledge of CRESS DNA viral diversity in New Zealand, emphasising the prevalence of CRESS DNA viruses in nature, and reinforcing the suggestion that a large proportion of CRESS DNA viruses are yet to be identified. Copyright © 2016 Elsevier B.V. All rights reserved.
-
A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province.
Shi, Chenyan; Liu, Yi; Hu, Xiaomin; Xiong, Jinfeng; Zhang, Bo; Yuan, Zhiming
2015-01-01
Mosquitoes as one of the most common but important vectors have the potential to transmit or acquire a lot of viruses through biting, however viral flora in mosquitoes and its impact on mosquito-borne disease transmission has not been well investigated and evaluated. In this study, the metagenomic techniquehas been successfully employed in analyzing the abundance and diversity of viral community in three mosquito samples from Hubei, China. Among 92,304 reads produced through a run with 454 GS FLX system, 39% have high similarities with viral sequences belonging to identified bacterial, fungal, animal, plant and insect viruses, and 0.02% were classed into unidentified viral sequences, demonstrating high abundance and diversity of viruses in mosquitoes. Furthermore, two novel viruses in subfamily Densovirinae and family Dicistroviridae were identified, and six torque tenosus virus1 in family Anelloviridae, three porcine parvoviruses in subfamily Parvovirinae and a Culex tritaeniorhynchus rhabdovirus in Family Rhabdoviridae were preliminarily characterized. The viral metagenomic analysis offered us a deep insight into the viral population of mosquito which played an important role in viral initiative or passive transmission and evolution during the process.
-
Ancient DNA sequence revealed by error-correcting codes.
Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo
2015-07-10
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.
-
Ancient DNA sequence revealed by error-correcting codes
Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo
2015-01-01
A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228
-
Kanda, Teru; Furuse, Yuki; Oshitani, Hitoshi; Kiyono, Tohru
2016-05-01
The Epstein-Barr virus (EBV) is etiologically linked to approximately 10% of gastric cancers, in which viral genomes are maintained as multicopy episomes. EBV-positive gastric cancer cells are incompetent for progeny virus production, making viral DNA cloning extremely difficult. Here we describe a highly efficient strategy for obtaining bacterial artificial chromosome (BAC) clones of EBV episomes by utilizing a CRISPR/Cas9-mediated strand break of the viral genome and subsequent homology-directed repair. EBV strains maintained in two gastric cancer cell lines (SNU719 and YCCEL1) were cloned, and their complete viral genome sequences were determined. Infectious viruses of gastric cancer cell-derived EBVs were reconstituted, and the viruses established stable latent infections in immortalized keratinocytes. While Ras oncoprotein overexpression caused massive vacuolar degeneration and cell death in control keratinocytes, EBV-infected keratinocytes survived in the presence of Ras expression. These results implicate EBV infection in predisposing epithelial cells to malignant transformation by inducing resistance to oncogene-induced cell death. Recent progress in DNA-sequencing technology has accelerated EBV whole-genome sequencing, and the repertoire of sequenced EBV genomes is increasing progressively. Accordingly, the presence of EBV variant strains that may be relevant to EBV-associated diseases has begun to attract interest. Clearly, the determination of additional disease-associated viral genome sequences will facilitate the identification of any disease-specific EBV variants. We found that CRISPR/Cas9-mediated cleavage of EBV episomal DNA enabled the cloning of disease-associated viral strains with unprecedented efficiency. As a proof of concept, two gastric cancer cell-derived EBV strains were cloned, and the infection of epithelial cells with reconstituted viruses provided important clues about the mechanism of EBV-mediated epithelial carcinogenesis. This experimental system should contribute to establishing the relationship between viral genome variation and EBV-associated diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
-
Death of a dogma: eukaryotic mRNAs can code for more than one protein
Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier
2016-01-01
mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5′ UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3′ UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573
-
Metavir 2: new tools for viral metagenome comparison and assembled virome analysis
2014-01-01
Background Metagenomics, based on culture-independent sequencing, is a well-fitted approach to provide insights into the composition, structure and dynamics of environmental viral communities. Following recent advances in sequencing technologies, new challenges arise for existing bioinformatic tools dedicated to viral metagenome (i.e. virome) analysis as (i) the number of viromes is rapidly growing and (ii) large genomic fragments can now be obtained by assembling the huge amount of sequence data generated for each metagenome. Results To face these challenges, a new version of Metavir was developed. First, all Metavir tools have been adapted to support comparative analysis of viromes in order to improve the analysis of multiple datasets. In addition to the sequence comparison previously provided, viromes can now be compared through their k-mer frequencies, their taxonomic compositions, recruitment plots and phylogenetic trees containing sequences from different datasets. Second, a new section has been specifically designed to handle assembled viromes made of thousands of large genomic fragments (i.e. contigs). This section includes an annotation pipeline for uploaded viral contigs (gene prediction, similarity search against reference viral genomes and protein domains) and an extensive comparison between contigs and reference genomes. Contigs and their annotations can be explored on the website through specifically developed dynamic genomic maps and interactive networks. Conclusions The new features of Metavir 2 allow users to explore and analyze viromes composed of raw reads or assembled fragments through a set of adapted tools and a user-friendly interface. PMID:24646187
-
Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei
2009-03-01
Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.
-
Germer, Jeffrey J; Ankoudinova, Irina; Belousov, Yevgeniy S; Mahoney, Walt; Dong, Chen; Meng, Jihong; Mandrekar, Jayawant N; Yao, Joseph D
2017-05-01
Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A chimeric bovine viral diarrhea virus construct containing an HEV RNA insert (SynTura HEV) was developed, value assigned with the first World Health Organization (WHO) international standard for HEV RNA (code 6329/10), and used to prepare working assay calibrators and controls, which supported an assay quantification range of 100 to 5,000,000 IU/ml. The analytical sensitivity (95% detection rate) of this assay was 25.2 IU/ml (95% confidence interval [CI], 19.2 to 44.1 IU/ml). The assay successfully amplified 16 different HEV sequences with significant nucleotide mismatching in primer/probe binding regions, while evaluation of a WHO international reference panel for HEV genotypes (code 8578/13) showed viral load results falling within the result ranges generated by WHO collaborative study participants for all panel members (genotypes 1 to 4). Broadly reactive RT-qPCR primers targeting HEV ORF2/3 were successfully adapted for use in an assay based on Pleiades probe chemistry. The availability of secondary standards calibrated to the WHO HEV international standard can improve the standardization and performance of assays for the detection and quantification of HEV RNA. Copyright © 2017 American Society for Microbiology.
-
Evolution of the viral hemorrhagic septicemia virus: divergence, selection and origin.
He, Mei; Yan, Xue-Chun; Liang, Yang; Sun, Xiao-Wen; Teng, Chun-Bo
2014-08-01
Viral hemorrhagic septicemia virus (VHSV) is an economically significant rhabdovirus that affects an increasing number of freshwater and marine fish species. Extensive studies have been conducted on the molecular epizootiology, genetic diversity, and phylogeny of VHSV. However, there are discrepancies between the reported estimates of the nucleotide substitution rate for the G gene and the divergence times for the genotypes. Herein, Bayesian coalescent analyses were conducted to the time-stamped entire coding sequences of the six VHSV genes. Rate estimates based on the G gene indicated that the marine genotypes/subtypes might not all evolve slower than their major European freshwater counterpart. Age calculations on the six genes revealed that the first bifurcation event of the analyzed isolates might have taken place within the last 300 years, which was much younger than previously thought. Selection analyses suggested that two codons of the G gene might be positively selected. Surveys of codon usage bias showed that the P, M and NV genes exhibited genotype-specific variations. Furthermore, we proposed that VHSV originated from the Pacific Northwest of North America. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Mutation of HIV-1 genomes in a clinical population treated with the mutagenic nucleoside KP1461.
Mullins, James I; Heath, Laura; Hughes, James P; Kicha, Jessica; Styrchak, Sheila; Wong, Kim G; Rao, Ushnal; Hansen, Alexis; Harris, Kevin S; Laurent, Jean-Pierre; Li, Deyu; Simpson, Jeffrey H; Essigmann, John M; Loeb, Lawrence A; Parkins, Jeffrey
2011-01-14
The deoxycytidine analog KP1212, and its prodrug KP1461, are prototypes of a new class of antiretroviral drugs designed to increase viral mutation rates, with the goal of eventually causing the collapse of the viral population. Here we present an extensive analysis of viral sequences from HIV-1 infected volunteers from the first "mechanism validation" phase II clinical trial of a mutagenic base analog in which individuals previously treated with antiviral drugs received 1600 mg of KP1461 twice per day for 124 days. Plasma viral loads were not reduced, and overall levels of viral mutation were not increased during this short-term study, however, the mutation spectrum of HIV was altered. A large number (N = 105 per sample) of sequences were analyzed, each derived from individual HIV-1 RNA templates, after 0, 56 and 124 days of therapy from 10 treated and 10 untreated control individuals (>7.1 million base pairs of unique viral templates were sequenced). We found that private mutations, those not found in more than one viral sequence and likely to have occurred in the most recent rounds of replication, increased in treated individuals relative to controls after 56 (p = 0.038) and 124 (p = 0.002) days of drug treatment. The spectrum of mutations observed in the treated group showed an excess of A to G and G to A mutations (p = 0.01), and to a lesser extent T to C and C to T mutations (p = 0.09), as predicted by the mechanism of action of the drug. These results validate the proposed mechanism of action in humans and should spur development of this novel antiretroviral approach.
-
Mutation of HIV-1 Genomes in a Clinical Population Treated with the Mutagenic Nucleoside KP1461
Mullins, James I.; Heath, Laura; Hughes, James P.; Kicha, Jessica; Styrchak, Sheila; Wong, Kim G.; Rao, Ushnal; Hansen, Alexis; Harris, Kevin S.; Laurent, Jean-Pierre; Li, Deyu; Simpson, Jeffrey H.; Essigmann, John M.; Loeb, Lawrence A.; Parkins, Jeffrey
2011-01-01
The deoxycytidine analog KP1212, and its prodrug KP1461, are prototypes of a new class of antiretroviral drugs designed to increase viral mutation rates, with the goal of eventually causing the collapse of the viral population. Here we present an extensive analysis of viral sequences from HIV-1 infected volunteers from the first “mechanism validation” phase II clinical trial of a mutagenic base analog in which individuals previously treated with antiviral drugs received 1600 mg of KP1461 twice per day for 124 days. Plasma viral loads were not reduced, and overall levels of viral mutation were not increased during this short-term study, however, the mutation spectrum of HIV was altered. A large number (N = 105 per sample) of sequences were analyzed, each derived from individual HIV-1 RNA templates, after 0, 56 and 124 days of therapy from 10 treated and 10 untreated control individuals (>7.1 million base pairs of unique viral templates were sequenced). We found that private mutations, those not found in more than one viral sequence and likely to have occurred in the most recent rounds of replication, increased in treated individuals relative to controls after 56 (p = 0.038) and 124 (p = 0.002) days of drug treatment. The spectrum of mutations observed in the treated group showed an excess of A to G and G to A mutations (p = 0.01), and to a lesser extent T to C and C to T mutations (p = 0.09), as predicted by the mechanism of action of the drug. These results validate the proposed mechanism of action in humans and should spur development of this novel antiretroviral approach. PMID:21264288
-
Anderson, Tavis K; Laegreid, William W; Cerutti, Francesco; Osorio, Fernando A; Nelson, Eric A; Christopher-Hennings, Jane; Goldberg, Tony L
2012-06-15
The extraordinary genetic and antigenic variability of RNA viruses is arguably the greatest challenge to the development of broadly effective vaccines. No single viral variant can induce sufficiently broad immunity, and incorporating all known naturally circulating variants into one multivalent vaccine is not feasible. Furthermore, no objective strategies currently exist to select actual viral variants that should be included or excluded in polyvalent vaccines. To address this problem, we demonstrate a method based on graph theory that quantifies the relative importance of viral variants. We demonstrate our method through application to the envelope glycoprotein gene of a particularly diverse RNA virus of pigs: porcine reproductive and respiratory syndrome virus (PRRSV). Using distance matrices derived from sequence nucleotide difference, amino acid difference and evolutionary distance, we constructed viral networks and used common network statistics to assign each sequence an objective ranking of relative 'importance'. To validate our approach, we use an independent published algorithm to score our top-ranked wild-type variants for coverage of putative T-cell epitopes across the 9383 sequences in our dataset. Top-ranked viruses achieve significantly higher coverage than low-ranked viruses, and top-ranked viruses achieve nearly equal coverage as a synthetic mosaic protein constructed in silico from the same set of 9383 sequences. Our approach relies on the network structure of PRRSV but applies to any diverse RNA virus because it identifies subsets of viral variants that are most important to overall viral diversity. We suggest that this method, through the objective quantification of variant importance, provides criteria for choosing viral variants for further characterization, diagnostics, surveillance and ultimately polyvalent vaccine development.
-
Riley, Matthew C; Wilkes, Rebecca P
2015-12-18
Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine escape.
-
[Vaccine application of recombinant herpesviruses].
Yokoyama, N; Xuan, X; Mikami, T
2000-04-01
Recently, genetic engineering using recombinant DNA techniques has been applied to design new viral vaccines in order to reduce some problems which the present viral vaccines have. Up to now, many viruses have been investigated for development of recombinant attenuated vaccines or live viral vectors for delivery of foreign genes coding immunogenic antigens. In this article, we introduced the new vaccine strategy using genetically engineered herpesviruses.
-
Wymant, Chris; Colijn, Caroline; Danaviah, Siva; Essex, Max; Frost, Simon; Gall, Astrid; Gaseitsiwe, Simani; Grabowski, Mary K.; Gray, Ronald; Guindon, Stephane; von Haeseler, Arndt; Kaleebu, Pontiano; Kendall, Michelle; Kozlov, Alexey; Manasa, Justen; Minh, Bui Quang; Moyo, Sikhulile; Novitsky, Vlad; Nsubuga, Rebecca; Pillay, Sureshnee; Quinn, Thomas C.; Serwadda, David; Ssemwanga, Deogratius; Stamatakis, Alexandros; Trifinopoulos, Jana; Wawer, Maria; Brown, Andy Leigh; de Oliveira, Tulio; Kellam, Paul; Pillay, Deenan; Fraser, Christophe
2017-01-01
Abstract To characterize HIV-1 transmission dynamics in regions where the burden of HIV-1 is greatest, the “Phylogenetics and Networks for Generalised HIV Epidemics in Africa” consortium (PANGEA-HIV) is sequencing full-genome viral isolates from across sub-Saharan Africa. We report the first 3,985 PANGEA-HIV consensus sequences from four cohort sites (Rakai Community Cohort Study, n = 2,833; MRC/UVRI Uganda, n = 701; Mochudi Prevention Project, n = 359; Africa Health Research Institute Resistance Cohort, n = 92). Next-generation sequencing success rates varied: more than 80% of the viral genome from the gag to the nef genes could be determined for all sequences from South Africa, 75% of sequences from Mochudi, 60% of sequences from MRC/UVRI Uganda, and 22% of sequences from Rakai. Partial sequencing failure was primarily associated with low viral load, increased for amplicons closer to the 3′ end of the genome, was not associated with subtype diversity except HIV-1 subtype D, and remained significantly associated with sampling location after controlling for other factors. We assessed the impact of the missing data patterns in PANGEA-HIV sequences on phylogeny reconstruction in simulations. We found a threshold in terms of taxon sampling below which the patchy distribution of missing characters in next-generation sequences (NGS) has an excess negative impact on the accuracy of HIV-1 phylogeny reconstruction, which is attributable to tree reconstruction artifacts that accumulate when branches in viral trees are long. The large number of PANGEA-HIV sequences provides unprecedented opportunities for evaluating HIV-1 transmission dynamics across sub-Saharan Africa and identifying prevention opportunities. Molecular epidemiological analyses of these data must proceed cautiously because sequence sampling remains below the identified threshold and a considerable negative impact of missing characters on phylogeny reconstruction is expected. PMID:28540766
-
Ratmann, Oliver; Wymant, Chris; Colijn, Caroline; Danaviah, Siva; Essex, M; Frost, Simon D W; Gall, Astrid; Gaiseitsiwe, Simani; Grabowski, Mary; Gray, Ronald; Guindon, Stephane; von Haeseler, Arndt; Kaleebu, Pontiano; Kendall, Michelle; Kozlov, Alexey; Manasa, Justen; Minh, Bui Quang; Moyo, Sikhulile; Novitsky, Vladimir; Nsubuga, Rebecca; Pillay, Sureshnee; Quinn, Thomas C; Serwadda, David; Ssemwanga, Deogratius; Stamatakis, Alexandros; Trifinopoulos, Jana; Wawer, Maria; Leigh Brown, Andrew; de Oliveira, Tulio; Kellam, Paul; Pillay, Deenan; Fraser, Christophe
2017-05-25
To characterize HIV-1 transmission dynamics in regions where the burden of HIV-1 is greatest, the 'Phylogenetics and Networks for Generalised HIV Epidemics in Africa' consortium (PANGEA-HIV) is sequencing full-genome viral isolates from across sub-Saharan Africa. We report the first 3,985 PANGEA-HIV consensus sequences from four cohort sites (Rakai Community Cohort Study, n=2,833; MRC/UVRI Uganda, n=701; Mochudi Prevention Project, n=359; Africa Health Research Institute Resistance Cohort, n=92). Next-generation sequencing success rates varied: more than 80% of the viral genome from the gag to the nef genes could be determined for all sequences from South Africa, 75% of sequences from Mochudi, 60% of sequences from MRC/UVRI Uganda, and 22% of sequences from Rakai. Partial sequencing failure was primarily associated with low viral load, increased for amplicons closer to the 3' end of the genome, was not associated with subtype diversity except HIV-1 subtype D, and remained significantly associated with sampling location after controlling for other factors. We assessed the impact of the missing data patterns in PANGEA-HIV sequences on phylogeny reconstruction in simulations. We found a threshold in terms of taxon sampling below which the patchy distribution of missing characters in next-generation sequences has an excess negative impact on the accuracy of HIV-1 phylogeny reconstruction, which is attributable to tree reconstruction artifacts that accumulate when branches in viral trees are long. The large number of PANGEA-HIV sequences provides unprecedented opportunities for evaluating HIV-1 transmission dynamics across sub-Saharan Africa and identifying prevention opportunities. Molecular epidemiological analyses of these data must proceed cautiously because sequence sampling remains below the identified threshold and a considerable negative impact of missing characters on phylogeny reconstruction is expected.
-
Madi, Nada; Al-Nakib, Widad; Mustafa, Abu Salim; Habibi, Nazima
2018-03-01
A metagenomic approach based on target independent next-generation sequencing has become a known method for the detection of both known and novel viruses in clinical samples. This study aimed to use the metagenomic sequencing approach to characterize the viral diversity in respiratory samples from patients with respiratory tract infections. We have investigated 86 respiratory samples received from various hospitals in Kuwait between 2015 and 2016 for the diagnosis of respiratory tract infections. A metagenomic approach using the next-generation sequencer to characterize viruses was used. According to the metagenomic analysis, an average of 145, 019 reads were identified, and 2% of these reads were of viral origin. Also, metagenomic analysis of the viral sequences revealed many known respiratory viruses, which were detected in 30.2% of the clinical samples. Also, sequences of non-respiratory viruses were detected in 14% of the clinical samples, while sequences of non-human viruses were detected in 55.8% of the clinical samples. The average genome coverage of the viruses was 12% with the highest genome coverage of 99.2% for respiratory syncytial virus, and the lowest was 1% for torque teno midi virus 2. Our results showed 47.7% agreement between multiplex Real-Time PCR and metagenomics sequencing in the detection of respiratory viruses in the clinical samples. Though there are some difficulties in using this method to clinical samples such as specimen quality, these observations are indicative of the promising utility of the metagenomic sequencing approach for the identification of respiratory viruses in patients with respiratory tract infections. © 2017 Wiley Periodicals, Inc.
-
Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T
2005-04-01
ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.
-
Hirose, Yusuke; Onuki, Mamiko; Tenjimbayashi, Yuri; Mori, Seiichiro; Ishii, Yoshiyuki; Takeuchi, Takamasa; Tasaka, Nobutaka; Satoh, Toyomi; Morisada, Tohru; Iwata, Takashi; Miyamoto, Shingo; Matsumoto, Koji; Sekizawa, Akihiko; Kukimoto, Iwao
2018-06-15
Persistent infection with oncogenic human papillomaviruses (HPVs) causes cervical cancer, accompanied by the accumulation of somatic mutations into the host genome. There are concomitant genetic changes in the HPV genome during viral infection; however, their relevance to cervical carcinogenesis is poorly understood. Here, we explored within-host genetic diversity of HPV by performing deep-sequencing analyses of viral whole-genome sequences in clinical specimens. The whole genomes of HPV types 16, 52, and 58 were amplified by type-specific PCR from total cellular DNA of cervical exfoliated cells collected from patients with cervical intraepithelial neoplasia (CIN) and invasive cervical cancer (ICC) and were deep sequenced. After constructing a reference viral genome sequence for each specimen, nucleotide positions showing changes with >0.5% frequencies compared to the reference sequence were determined for individual samples. In total, 1,052 positions of nucleotide variations were detected in HPV genomes from 151 samples (CIN1, n = 56; CIN2/3, n = 68; ICC, n = 27), with various numbers per sample. Overall, C-to-T and C-to-A substitutions were the dominant changes observed across all histological grades. While C-to-T transitions were predominantly detected in CIN1, their prevalence was decreased in CIN2/3 and fell below that of C-to-A transversions in ICC. Analysis of the trinucleotide context encompassing substituted bases revealed that TpCpN, a preferred target sequence for cellular APOBEC cytosine deaminases, was a primary site for C-to-T substitutions in the HPV genome. These results strongly imply that the APOBEC proteins are drivers of HPV genome mutation, particularly in CIN1 lesions. IMPORTANCE HPVs exhibit surprisingly high levels of genetic diversity, including a large repertoire of minor genomic variants in each viral genotype. Here, by conducting deep-sequencing analyses, we show for the first time a comprehensive snapshot of the within-host genetic diversity of high-risk HPVs during cervical carcinogenesis. Quasispecies harboring minor nucleotide variations in viral whole-genome sequences were extensively observed across different grades of CIN and cervical cancer. Among the within-host variations, C-to-T transitions, a characteristic change mediated by cellular APOBEC cytosine deaminases, were predominantly detected throughout the whole viral genome, most strikingly in low-grade CIN lesions. The results strongly suggest that within-host variations of the HPV genome are primarily generated through the interaction with host cell DNA-editing enzymes and that such within-host variability is an evolutionary source of the genetic diversity of HPVs. Copyright © 2018 American Society for Microbiology.
-
Error catastrophe and phase transition in the empirical fitness landscape of HIV
NASA Astrophysics Data System (ADS)
Hart, Gregory R.; Ferguson, Andrew L.
2015-03-01
We have translated clinical sequence databases of the p6 HIV protein into an empirical fitness landscape quantifying viral replicative capacity as a function of the amino acid sequence. We show that the viral population resides close to a phase transition in sequence space corresponding to an "error catastrophe" beyond which there is lethal accumulation of mutations. Our model predicts that the phase transition may be induced by drug therapies that elevate the mutation rate, or by forcing mutations at particular amino acids. Applying immune pressure to any combination of killer T-cell targets cannot induce the transition, providing a rationale for why the viral protein can exist close to the error catastrophe without sustaining fatal fitness penalties due to adaptive immunity.
-
Duda, Anja; Stange, Annett; Lüftenegger, Daniel; Stanke, Nicole; Westphal, Dana; Pietschmann, Thomas; Eastman, Scott W; Linial, Maxine L; Rethwilm, Axel; Lindemann, Dirk
2004-12-01
Analogous to cellular glycoproteins, viral envelope proteins contain N-terminal signal sequences responsible for targeting them to the secretory pathway. The prototype foamy virus (PFV) envelope (Env) shows a highly unusual biosynthesis. Its precursor protein has a type III membrane topology with both the N and C terminus located in the cytoplasm. Coexpression of FV glycoprotein and interaction of its leader peptide (LP) with the viral capsid is essential for viral particle budding and egress. Processing of PFV Env into the particle-associated LP, surface (SU), and transmembrane (TM) subunits occur posttranslationally during transport to the cell surface by yet-unidentified cellular proteases. Here we provide strong evidence that furin itself or a furin-like protease and not the signal peptidase complex is responsible for both processing events. N-terminal protein sequencing of the SU and TM subunits of purified PFV Env-immunoglobulin G immunoadhesin identified furin consensus sequences upstream of both cleavage sites. Mutagenesis analysis of two overlapping furin consensus sequences at the PFV LP/SU cleavage site in the wild-type protein confirmed the sequencing data and demonstrated utilization of only the first site. Fully processed SU was almost completely absent in viral particles of mutants having conserved arginine residues replaced by alanines in the first furin consensus sequence, but normal processing was observed upon mutation of the second motif. Although these mutants displayed a significant loss in infectivity as a result of reduced particle release, no correlation to processing inhibition was observed, since another mutant having normal LP/SU processing had a similar defect.
-
Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M
2016-03-01
Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.
-
Short reads from honey bee (Apis sp.) sequencing projects reflect microbial associate diversity
Hurst, Gregory D.D.
2017-01-01
High throughput (or ‘next generation’) sequencing has transformed most areas of biological research and is now a standard method that underpins empirical study of organismal biology, and (through comparison of genomes), reveals patterns of evolution. For projects focused on animals, these sequencing methods do not discriminate between the primary target of sequencing (the animal genome) and ‘contaminating’ material, such as associated microbes. A common first step is to filter out these contaminants to allow better assembly of the animal genome or transcriptome. Here, we aimed to assess if these ‘contaminations’ provide information with regard to biologically important microorganisms associated with the individual. To achieve this, we examined whether the short read data from Apis retrieved elements of its well established microbiome. To this end, we screened almost 1,000 short read libraries of honey bee (Apis sp.) DNA sequencing project for the presence of microbial sequences, and find sequences from known honey bee microbial associates in at least 11% of them. Further to this, we screened ∼500 Apis RNA sequencing libraries for evidence of viral infections, which were found to be present in about half of them. We then used the data to reconstruct draft genomes of three Apis associated bacteria, as well as several viral strains de novo. We conclude that ‘contamination’ in short read sequencing libraries can provide useful genomic information on microbial taxa known to be associated with the target organisms, and may even lead to the discovery of novel associations. Finally, we demonstrate that RNAseq samples from experiments commonly carry uneven viral loads across libraries. We note variation in viral presence and load may be a confounding feature of differential gene expression analyses, and as such it should be incorporated as a random factor in analyses. PMID:28717593
-
Short reads from honey bee (Apis sp.) sequencing projects reflect microbial associate diversity.
Gerth, Michael; Hurst, Gregory D D
2017-01-01
High throughput (or 'next generation') sequencing has transformed most areas of biological research and is now a standard method that underpins empirical study of organismal biology, and (through comparison of genomes), reveals patterns of evolution. For projects focused on animals, these sequencing methods do not discriminate between the primary target of sequencing (the animal genome) and 'contaminating' material, such as associated microbes. A common first step is to filter out these contaminants to allow better assembly of the animal genome or transcriptome. Here, we aimed to assess if these 'contaminations' provide information with regard to biologically important microorganisms associated with the individual. To achieve this, we examined whether the short read data from Apis retrieved elements of its well established microbiome. To this end, we screened almost 1,000 short read libraries of honey bee ( Apis sp.) DNA sequencing project for the presence of microbial sequences, and find sequences from known honey bee microbial associates in at least 11% of them. Further to this, we screened ∼500 Apis RNA sequencing libraries for evidence of viral infections, which were found to be present in about half of them. We then used the data to reconstruct draft genomes of three Apis associated bacteria, as well as several viral strains de novo . We conclude that 'contamination' in short read sequencing libraries can provide useful genomic information on microbial taxa known to be associated with the target organisms, and may even lead to the discovery of novel associations. Finally, we demonstrate that RNAseq samples from experiments commonly carry uneven viral loads across libraries. We note variation in viral presence and load may be a confounding feature of differential gene expression analyses, and as such it should be incorporated as a random factor in analyses.
-
Construction and characterization of poliovirus subgenomic replicons.
Kaplan, G; Racaniello, V R
1988-05-01
Poliovirus RNAs containing in-frame deletions within the capsid-coding region were produced by in vitro transcription of altered poliovirus type 1 cDNA by using bacteriophage T7 RNA polymerase. Three RNAs were transcribed that contained deletions of 2,317 nucleotides (bases 747 to 3064), 1,781 nucleotides (bases 1,175 to 2,956), and 1,295 nucleotides (bases 1,175 to 2,470). All three subgenomic RNAs replicated after transfection into HeLa cells, demonstrating that sequences encoding the capsid polypeptides are not essential for viral RNA replication in vivo. Viral RNA containing the largest deletion (R1) replicated approximately three times better than full-length RNA produced in vitro. Northern blot (RNA blot) hybridization analysis of total cellular RNA from HeLa cells at different times after transfection with R1 demonstrated the presence of increasing amounts of the expected 5.1-kilobase subgenomic RNA. Analysis by immunoprecipitation of viral proteins induced after transfection of R1 RNA into HeLa cells revealed the presence of proteins 2Apro, 2C, and 3Dpol and its precursors, suggesting that the polyprotein cleavages are similar to those occurring in virus-infected cells. Replication of P2/Lansing virion RNA was inhibited by cotransfection with the R1 replicon, as demonstrated by hybridization analysis with a serotype-specific oligonucleotide probe. A higher level of inhibition of RNA replication was observed when P2/Lansing RNA was cotransfected into HeLa cells with truncated R1 transcripts (R1-PvuII) that were missing 395 3' nucleotides and a poly(A) tail. These internally and terminally deleted RNAs inhibited the replication of subgenomic replicons R1, R2, and R3 and caused a reduction in plaque size when cotransfected with P1/Mahoney or P2/Lansing viral RNA, suggesting that individual cells had received both RNAs. No inhibition of plaque size was observed when replicon RNAs were used that were missing 1,384 or 1,839 3' nucleotides or contained plasmid-derived sequences downstream of the 3' poly(A). The trans-acting inhibitory effect of R1-PvuII on the replication of poliovirus P2/Lansing RNA did not involve entry of RNA into cells and appeared to reduce viral translation and RNA synthesis late in the infection cycle.
-
Development of a Model System for Tick-Borne Flavivirus Persistence in HEK 293T Cells
Mlera, Luwanika; Offerdahl, Danielle K.; Martens, Craig; Porcella, Stephen F.; Melik, Wessam
2015-01-01
ABSTRACT We devised a model system to study persistent infection by the tick-borne flavivirus Langat virus (LGTV) in 293T cells. Infection with a molecularly cloned LGTV strain produced an acute lytic crisis that left few surviving cells. The culture was repopulated by cells that were ~90% positive for LGTV E protein, thus initiating a persistent infection that was maintained for at least 35 weeks without additional lytic crises. Staining of cells for viral proteins and ultrastructural analysis revealed only minor differences from the acute phase of infection. Infectious LGTV decreased markedly over the study period, but the number of viral genomes remained relatively constant, suggesting the development of defective interfering particles (DIPs). Viral genome changes were investigated by RNA deep sequencing. At the initiation of persistent infection, levels of DIPs were below the limit of detection at a coverage depth of 11,288-fold, implying that DIPs are not required for initiation of persistence. However, after 15 passages, DIPs constituted approximately 34% of the total LGTV population (coverage of 1,293-fold). Furthermore, at this point, one specific DIP population predominated in which nucleotides 1058 to 2881 had been deleted. This defective genome specified an intact polyprotein that coded for a truncated fusion protein containing 28 N-terminal residues of E and 134 C-terminal residues of NS1. Such a fusion protein has not previously been described, and a possible function in persistent infection is uncertain. DIPs are not required for the initiation of persistent LGTV infection but may play a role in the maintenance of viral persistence. PMID:26045539
-
Moustakas, A; Sonstegard, T S; Hackett, P B
1993-01-01
The Rous sarcoma virus (RSV) leader RNA has three short open reading frames (ORF1 to ORF3) which are conserved in all avian sarcoma-leukosis retroviruses. Effects on virus propagation were determined following three types of alterations in the ORFs: (i) replacement of AUG initiation codons in order to prohibit ORF translation, (ii) alterations of the codon context around the AUG initiation codon to enhance translation of the normally silent ORF3, and (iii) elongation of the ORF coding sequences. Mutagenesis of the AUG codons for ORF1 and ORF2 (AUG1 and AUG2) singly or together delayed the onset of viral replication and cell transformation. In contrast, mutagenesis of AUG3 almost completely suppressed these viral activities. Mutagenesis of ORF3 to enhance its translation inhibited viral propagation. When the mutant ORF3 included an additional frameshift mutation which extended the ORF beyond the initiation site for the gag, gag-pol, and env proteins, host cells were initially transformed but died soon thereafter. Elongation of ORF1 from 7 to 62 codons led to the accumulation of transformation-defective virus with a delayed onset of replication. In contrast, viruses with elongation of ORF1 from 7 to 30 codons, ORF2 from 16 to 48 codons, or ORF3 from 9 to 64 codons, without any alterations in the AUG context, exhibited wild-type phenotypes. These results are consistent with a model that translation of the ORFs is necessary to facilitate virus production. Images PMID:7685415
-
Filichkin, Sergei A.; Bransom, Kay L.; Goodwin, Joel B.; Dreher, Theo W.
2000-01-01
Five highly infectious turnip yellow mosaic virus (TYMV) genomes with sequence changes in their 3′-terminal regions that result in altered aminoacylation and eEF1A binding have been studied. These genomes were derived from cloned parental RNAs of low infectivity by sequential passaging in plants. Three of these genomes that are incapable of aminoacylation have been reported previously (J. B. Goodwin, J. M. Skuzeski, and T. W. Dreher, Virology 230:113–124, 1997). We now demonstrate by subcloning the 3′ untranslated regions into wild-type TYMV RNA that the high infectivities and replication rates of these genomes compared to their progenitors are mostly due to a small number of mutations acquired in the 3′ tRNA-like structure during passaging. Mutations in other parts of the genome, including the replication protein coding region, are not required for high infectivity but probably do play a role in optimizing viral amplification and spread in plants. Two other TYMV RNA variants of suboptimal infectivities, one that accepts methionine instead of the usual valine and one that interacts less tightly with eEF1A, were sequentially passaged to produce highly infectious genomes. The improved infectivities of these RNAs were not associated with increased replication in protoplasts, and no mutations were acquired in their 3′ tRNA-like structures. Complete sequencing of one genome identified two mutations that result in amino acid changes in the movement protein gene, suggesting that improved infectivity may be a function of improved viral dissemination in plants. Our results show that the wild-type TYMV replication proteins are able to amplify genomes with 3′ termini of variable sequence and tRNA mimicry. These and previous results have led to a model in which the binding of eEF1A to the 3′ end to antagonize minus-strand initiation is a major role of the tRNA-like structure. PMID:10954536
-
1987-10-13
after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell
-
Redmond, Catherine J.; Dooley, Katharine E.; Fu, Haiqing; Gillison, Maura L.; Akagi, Keiko; Symer, David E.; Aladjem, Mirit I.
2018-01-01
Integration of human papillomavirus (HPV) genomes into cellular chromatin is common in HPV-associated cancers. Integration is random, and each site is unique depending on how and where the virus integrates. We recently showed that tandemly integrated HPV16 could result in the formation of a super-enhancer-like element that drives transcription of the viral oncogenes. Here, we characterize the chromatin landscape and genomic architecture of this integration locus to elucidate the mechanisms that promoted de novo super-enhancer formation. Using next-generation sequencing and molecular combing/fiber-FISH, we show that ~26 copies of HPV16 are integrated into an intergenic region of chromosome 2p23.2, interspersed with 25 kb of amplified, flanking cellular DNA. This interspersed, co-amplified viral-host pattern is frequent in HPV-associated cancers and here we designate it as Type III integration. An abundant viral-cellular fusion transcript encoding the viral E6/E7 oncogenes is expressed from the integration locus and the chromatin encompassing both the viral enhancer and a region in the adjacent amplified cellular sequences is strongly enriched in the super-enhancer markers H3K27ac and Brd4. Notably, the peak in the amplified cellular sequence corresponds to an epithelial-cell-type specific enhancer. Thus, HPV16 integration generated a super-enhancer-like element composed of tandem interspersed copies of the viral upstream regulatory region and a cellular enhancer, to drive high levels of oncogene expression. PMID:29364907
-
Cotten, Matthew; Oude Munnink, Bas; Canuti, Marta; Deijs, Martin; Watson, Simon J; Kellam, Paul; van der Hoek, Lia
2014-01-01
We have developed a full genome virus detection process that combines sensitive nucleic acid preparation optimised for virus identification in fecal material with Illumina MiSeq sequencing and a novel post-sequencing virus identification algorithm. Enriched viral nucleic acid was converted to double-stranded DNA and subjected to Illumina MiSeq sequencing. The resulting short reads were processed with a novel iterative Python algorithm SLIM for the identification of sequences with homology to known viruses. De novo assembly was then used to generate full viral genomes. The sensitivity of this process was demonstrated with a set of fecal samples from HIV-1 infected patients. A quantitative assessment of the mammalian, plant, and bacterial virus content of this compartment was generated and the deep sequencing data were sufficient to assembly 12 complete viral genomes from 6 virus families. The method detected high levels of enteropathic viruses that are normally controlled in healthy adults, but may be involved in the pathogenesis of HIV-1 infection and will provide a powerful tool for virus detection and for analyzing changes in the fecal virome associated with HIV-1 progression and pathogenesis.
-
Cotten, Matthew; Oude Munnink, Bas; Canuti, Marta; Deijs, Martin; Watson, Simon J.; Kellam, Paul; van der Hoek, Lia
2014-01-01
We have developed a full genome virus detection process that combines sensitive nucleic acid preparation optimised for virus identification in fecal material with Illumina MiSeq sequencing and a novel post-sequencing virus identification algorithm. Enriched viral nucleic acid was converted to double-stranded DNA and subjected to Illumina MiSeq sequencing. The resulting short reads were processed with a novel iterative Python algorithm SLIM for the identification of sequences with homology to known viruses. De novo assembly was then used to generate full viral genomes. The sensitivity of this process was demonstrated with a set of fecal samples from HIV-1 infected patients. A quantitative assessment of the mammalian, plant, and bacterial virus content of this compartment was generated and the deep sequencing data were sufficient to assembly 12 complete viral genomes from 6 virus families. The method detected high levels of enteropathic viruses that are normally controlled in healthy adults, but may be involved in the pathogenesis of HIV-1 infection and will provide a powerful tool for virus detection and for analyzing changes in the fecal virome associated with HIV-1 progression and pathogenesis. PMID:24695106
-
Landès-Devauchelle, C; Bras, F; Dezélée, S; Teninges, D
1995-11-10
The nucleotide sequence of the genes 2 and 3 of the Drosophila rhabdovirus sigma was determined from cDNAs to viral genome and poly(A)+ mRNAs. Gene 2 comprises 1032 nucleotides and contains a long ORF encoding a molecular weight 35,208 polypeptide present in infected cells and in virions which migrates in SDS-PAGE as a doublet of M(r) about 60 kDa. The distribution of acidic charges as well as the electrophoretic properties of the protein are characteristic of the rhabdovirus P proteins. Gene 3 comprises 923 nucleotides and contains a long ORF capable of coding a polypeptide of 298 amino acids of MW 33,790. The putative protein (PP3) is similar in size to a minor component of the virions. Computer analysis shows that the sequence of PP3 contains three motifs related to the conserved motifs of reverse transcriptases.
-
Gao, Bo; Zhang, Jianming; Wang, Yuping; Chen, Fan; Zheng, Chaohui; Xie, Lianhui
2017-09-25
Over the past decade, indigenous dengue outbreaks have occurred occasionally in Fujian province in southeastern China because of sporadic imported dengue viruses (DENV). In this study, 3 DENV-2 and 2 DENV-4 strains were isolated from suspected febrile travelers at 2 ports of entry in Fujian between 2013-2015. Complete viral genome sequences of these new isolates were obtained with Sanger chemistry. Genomic sequence analyses revealed that these strains belonged to genotypes of 2-Cosmopolitan and 4-II. Consistent with the patients' travel information, phylogenetic analyses of the complete coding regions also indicated that most of the new isolates were genetically similar to the circulating strains in Southeast Asia rather than previous Chinese strains that were available. Therefore, phylogenetic analyses of the imported DENV demonstrated that multiple introductions of DENV emerged continuously in Fujian, and highlighted the importance of dengue surveillance at entry-exit ports in the subtropical regions of southern China.
-
Studies with infections fragments of phage DNA. Final report, January 1, 1970--June 30, 1976
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schachtele, C. F.
The minute, virulent and structurally intricate Bacillus subtilis bacteriophage phi 29 was utilized to study in vivo viral development. Purified strands of phi 29 DNA were used to analyze transcription of the viral genome. Early mRNA hybridizes to the light DNA strand which controls DNA replication and other early functions. Late mRNA hybridizes to the heavy DNA strand which codes for phage structural proteins. The temporal sequence of specific viral protein synthesis was analyzed by gel electrophoresis and was shown to directly correlate with the RNA transcription pattern. The genes carried by phi 29 have been marked with ts andmore » sus mutations and mapped by appropriate crosses yielding a linear map of 17 cistrons. Fragments of the phi 29 DNA were shown to retain their biological activity and marker rescue studies indicated that gene transfer could be performed with pieces having a molecular weight of less than 1 million daltons. Mutant infection under nonpermissive conditions and the analysis of precursor structures has allowed the formation of a tentative morphogenetic pathway leading to the formation of infectious particles. Work with phi 29 has established this virus as an advantageous model system for studying a variety of problems in molecular biology and approximately a dozen laboratories in the country and abroad are working with this phage.« less
-
Protease inhibitors as potential therapeutic agents for AIDS.
Jamjoom, G A
1991-09-01
A decade since the epidemic of the acquired immunodeficiency syndrome (AIDS) was first recognized, a wealth of information has accumulated on the molecular biology of the causative agents, the human immunodeficiency viruses (HIV). Of particular interest is knowledge of the viral enzymes involved in the formation of new virus particles. Such enzymes constitute attractive targets for efforts aimed at selecting agents that interfere with virus multiplication and subsequent spread and pathogenesis. Already, several agents that inhibit the viral reverse transcriptase (e.g., nucleoside analogs such as Zidovudine) have proved to have a beneficial effect on the course off the disease, but their prolonged use has been associated with significant toxicity and the emergence of resistant mutants. A second enzyme that has recently attracted attention is the virus-coded protease. This enzyme is involved in the cleavage of viral precursor polyproteins into the final products that constitute the mature virus particle. Protease inhibitors interfere with the process of virus maturation which is required for the formation of infective virus particles. Several custom-made inhibitors with a high selective action against HIV protease have been produced recently. They are nonhydrolyzable peptide analogs that mimic the cleavage sequences of the natural substrate of the enzyme during the transition state of the cleavage reaction. It is hoped that a similar selectivity in vivo may make protease inhibitors a promising new category of AIDS therapeutics.
-
Viruses and miRNAs: More Friends than Foes.
Bruscella, Patrice; Bottini, Silvia; Baudesson, Camille; Pawlotsky, Jean-Michel; Feray, Cyrille; Trabucchi, Michele
2017-01-01
There is evidence that eukaryotic miRNAs (hereafter called host miRNAs) play a role in the replication and propagation of viruses. Expression or targeting of host miRNAs can be involved in cellular antiviral responses. Most times host miRNAs play a role in viral life-cycles and promote infection through complex regulatory pathways. miRNAs can also be encoded by a viral genome and be expressed in the host cell. Viral miRNAs can share common sequences with host miRNAs or have totally different sequences. They can regulate a variety of biological processes involved in viral infection, including apoptosis, evasion of the immune response, or modulation of viral life-cycle phases. Overall, virus/miRNA pathway interaction is defined by a plethora of complex mechanisms, though not yet fully understood. This article review summarizes recent advances and novel biological concepts related to the understanding of miRNA expression, control and function during viral infections. The article also discusses potential therapeutic applications of this particular host-pathogen interaction.
-
Viruses and miRNAs: More Friends than Foes
Bruscella, Patrice; Bottini, Silvia; Baudesson, Camille; Pawlotsky, Jean-Michel; Feray, Cyrille; Trabucchi, Michele
2017-01-01
There is evidence that eukaryotic miRNAs (hereafter called host miRNAs) play a role in the replication and propagation of viruses. Expression or targeting of host miRNAs can be involved in cellular antiviral responses. Most times host miRNAs play a role in viral life-cycles and promote infection through complex regulatory pathways. miRNAs can also be encoded by a viral genome and be expressed in the host cell. Viral miRNAs can share common sequences with host miRNAs or have totally different sequences. They can regulate a variety of biological processes involved in viral infection, including apoptosis, evasion of the immune response, or modulation of viral life-cycle phases. Overall, virus/miRNA pathway interaction is defined by a plethora of complex mechanisms, though not yet fully understood. This article review summarizes recent advances and novel biological concepts related to the understanding of miRNA expression, control and function during viral infections. The article also discusses potential therapeutic applications of this particular host–pathogen interaction. PMID:28555130
-
Ferns, R Bridget; Tarr, Alexander W; Hue, Stephane; Urbanowicz, Richard A; McClure, C Patrick; Gilson, Richard; Ball, Jonathan K; Nastouli, Eleni; Garson, Jeremy A; Pillay, Deenan
2016-05-01
HIV-1 infected patients who acquire HCV infection have higher rates of chronicity and liver disease progression than patients with HCV mono-infection. Understanding early events in this pathogenic process is important. We applied single genome sequencing of the E1 to NS3 regions and viral pseudotype neutralization assays to explore the consequences of viral quasispecies evolution from pre-seroconversion to chronicity in four co-infected individuals (mean follow up 566 days). We observed that one to three founder viruses were transmitted. Relatively low viral sequence diversity, possibly related to an impaired immune response, due to HIV infection was observed in three patients. However, the fourth patient, after an early purifying selection displayed increasing E2 sequence evolution, possibly related to being on suppressive antiretroviral therapy. Viral pseudotypes generated from HCV variants showed relative resistance to neutralization by autologous plasma but not to plasma collected from later time points, confirming ongoing virus escape from antibody neutralization. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda
2017-06-17
The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .
-
Chen, Sunlu; Zheng, Huizhen; Kishima, Yuji
2017-06-01
The interplay of different virus species in a host cell after infection can affect the adaptation of each virus. Endogenous viral elements, such as endogenous pararetroviruses (PRVs), have arisen from vertical inheritance of viral sequences integrated into host germline genomes. As viral genomic fossils, these sequences can thus serve as valuable paleogenomic data to study the long-term evolutionary dynamics of virus-virus interactions, but they have rarely been applied for this purpose. All extant PRVs have been considered autonomous species in their parasitic life cycle in host cells. Here, we provide evidence for multiple non-autonomous PRV species with structural defects in viral activity that have frequently infected ancient grass hosts and adapted through interplay between viruses. Our paleogenomic analyses using endogenous PRVs in grass genomes revealed that these non-autonomous PRV species have participated in interplay with autonomous PRVs in a possible commensal partnership, or, alternatively, with one another in a possible mutualistic partnership. These partnerships, which have been established by the sharing of noncoding regulatory sequences (NRSs) in intergenic regions between two partner viruses, have been further maintained and altered by the sequence homogenization of NRSs between partners. Strikingly, we found that frequent region-specific recombination, rather than mutation selection, is the main causative mechanism of NRS homogenization. Our results, obtained from ancient DNA records of viruses, suggest that adaptation of PRVs has occurred by concerted evolution of NRSs between different virus species in the same host. Our findings further imply that evaluation of within-host NRS interactions within and between populations of viral pathogens may be important.
-
Bröer, Sonja; Hage, Elias; Käufer, Christopher; Gerhauser, Ingo; Anjum, Muneeb; Li, Lin; Baumgärtner, Wolfgang; Schulz, Thomas F; Löscher, Wolfgang
2017-03-01
Following intracerebral inoculation, the BeAn 8386 strain of Theiler's virus causes persistent infection and inflammatory demyelinating encephalomyelitis in the spinal cord of T-cell defective SJL/J mice, which is widely used as a model of multiple sclerosis. In contrast, C57BL/6 (B6) mice clear the virus and develop inflammation and lesions in the hippocampus, associated with acute and chronic seizures, representing a novel model of viral encephalitis-induced epilepsy. Here we characterize the geno- and phenotype of two naturally occurring variants of BeAn (BeAn-1 and BeAn-2) that can be used to further understand the viral and host factors involved in the neuropathogenesis in B6 and SJL/J mice. Next generation sequencing disclosed 15 single nucleotide differences between BeAn-1 and BeAn-2, of which 4 are coding changes and 3 are in the 5'-UTR (5'-untranslated region). The relatively minor variations in the nucleotide sequence of the two BeAn substrains led to marked differences in neurovirulence. In SJL/J mice, inflammatory demyelination in the spinal cord and its clinical consequences were significantly more marked following infection with BeAn-1 than with BeAn-2. Both BeAn substrains caused lymphocyte infiltration and increase of MAC3-positive cells in the hippocampus, but hippocampal damage and seizures were only observed in B6 mice. Seizures occurred in one third of BeAn-2 infected B6 mice, but not in BeAn-1 infected B6 mice. By comparing individual mice by receiver operating characteristic (ROC) curve analysis, the severity of hippocampal neurodegeneration and amount of MAC3-positive microglia/macrophages discriminated seizing from non-seizing B6 mice, whereas T-lymphocyte brain infiltration was not found to be a crucial factor. These data add novel evidence to the view that differential outcome of infection may be not invariably linked to a distinct viral burden but to a finely tuned balance between antiviral immune responses that although essential for host resistance can also contribute to immunopathology. Copyright © 2016. Published by Elsevier Inc.
-
Late Ebola virus relapse causing meningoencephalitis: a case report.
Jacobs, Michael; Rodger, Alison; Bell, David J; Bhagani, Sanjay; Cropley, Ian; Filipe, Ana; Gifford, Robert J; Hopkins, Susan; Hughes, Joseph; Jabeen, Farrah; Johannessen, Ingolfur; Karageorgopoulos, Drosos; Lackenby, Angie; Lester, Rebecca; Liu, Rebecca S N; MacConnachie, Alisdair; Mahungu, Tabitha; Martin, Daniel; Marshall, Neal; Mepham, Stephen; Orton, Richard; Palmarini, Massimo; Patel, Monika; Perry, Colin; Peters, S Erica; Porter, Duncan; Ritchie, David; Ritchie, Neil D; Seaton, R Andrew; Sreenu, Vattipally B; Templeton, Kate; Warren, Simon; Wilkie, Gavin S; Zambon, Maria; Gopal, Robin; Thomson, Emma C
2016-07-30
There are thousands of survivors of the 2014 Ebola outbreak in west Africa. Ebola virus can persist in survivors for months in immune-privileged sites; however, viral relapse causing life-threatening and potentially transmissible disease has not been described. We report a case of late relapse in a patient who had been treated for severe Ebola virus disease with high viral load (peak cycle threshold value 13.2). A 39-year-old female nurse from Scotland, who had assisted the humanitarian effort in Sierra Leone, had received intensive supportive treatment and experimental antiviral therapies, and had been discharged with undetectable Ebola virus RNA in peripheral blood. The patient was readmitted to hospital 9 months after discharge with symptoms of acute meningitis, and was found to have Ebola virus in cerebrospinal fluid (CSF). She was treated with supportive therapy and experimental antiviral drug GS-5734 (Gilead Sciences, San Francisco, Foster City, CA, USA). We monitored Ebola virus RNA in CSF and plasma, and sequenced the viral genome using an unbiased metagenomic approach. On admission, reverse transcriptase PCR identified Ebola virus RNA at a higher level in CSF (cycle threshold value 23.7) than plasma (31.3); infectious virus was only recovered from CSF. The patient developed progressive meningoencephalitis with cranial neuropathies and radiculopathy. Clinical recovery was associated with addition of high-dose corticosteroids during GS-5734 treatment. CSF Ebola virus RNA slowly declined and was undetectable following 14 days of treatment with GS-5734. Sequencing of plasma and CSF viral genome revealed only two non-coding changes compared with the original infecting virus. Our report shows that previously unanticipated, late, severe relapses of Ebola virus can occur, in this case in the CNS. This finding fundamentally redefines what is known about the natural history of Ebola virus infection. Vigilance should be maintained in the thousands of Ebola survivors for cases of relapsed infection. The potential for these cases to initiate new transmission chains is a serious public health concern. Royal Free London NHS Foundation Trust. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
A Metagenomic Survey of Viral Abundance and Diversity in Mosquitoes from Hubei Province
Shi, Chenyan; Liu, Yi; Hu, Xiaomin; Xiong, Jinfeng; Zhang, Bo; Yuan, Zhiming
2015-01-01
Mosquitoes as one of the most common but important vectors have the potential to transmit or acquire a lot of viruses through biting, however viral flora in mosquitoes and its impact on mosquito-borne disease transmission has not been well investigated and evaluated. In this study, the metagenomic techniquehas been successfully employed in analyzing the abundance and diversity of viral community in three mosquito samples from Hubei, China. Among 92,304 reads produced through a run with 454 GS FLX system, 39% have high similarities with viral sequences belonging to identified bacterial, fungal, animal, plant and insect viruses, and 0.02% were classed into unidentified viral sequences, demonstrating high abundance and diversity of viruses in mosquitoes. Furthermore, two novel viruses in subfamily Densovirinae and family Dicistroviridae were identified, and six torque tenosus virus1 in family Anelloviridae, three porcine parvoviruses in subfamily Parvovirinae and a Culex tritaeniorhynchus rhabdovirus in Family Rhabdoviridae were preliminarily characterized. The viral metagenomic analysis offered us a deep insight into the viral population of mosquito which played an important role in viral initiative or passive transmission and evolution during the process. PMID:26030271
-
O'Flaherty, Brigid M; Li, Yan; Tao, Ying; Paden, Clinton R; Queen, Krista; Zhang, Jing; Dinwiddie, Darrell L; Gross, Stephen M; Schroth, Gary P; Tong, Suxiang
2018-06-01
Next generation sequencing (NGS) technologies have revolutionized the genomics field and are becoming more commonplace for identification of human infectious diseases. However, due to the low abundance of viral nucleic acids (NAs) in relation to host, viral identification using direct NGS technologies often lacks sufficient sensitivity. Here, we describe an approach based on two complementary enrichment strategies that significantly improves the sensitivity of NGS-based virus identification. To start, we developed two sets of DNA probes to enrich virus NAs associated with respiratory diseases. The first set of probes spans the genomes, allowing for identification of known viruses and full genome sequencing, while the second set targets regions conserved among viral families or genera, providing the ability to detect both known and potentially novel members of those virus groups. Efficiency of enrichment was assessed by NGS testing reference virus and clinical samples with known infection. We show significant improvement in viral identification using enriched NGS compared to unenriched NGS. Without enrichment, we observed an average of 0.3% targeted viral reads per sample. However, after enrichment, 50%-99% of the reads per sample were the targeted viral reads for both the reference isolates and clinical specimens using both probe sets. Importantly, dramatic improvements on genome coverage were also observed following virus-specific probe enrichment. The methods described here provide improved sensitivity for virus identification by NGS, allowing for a more comprehensive analysis of disease etiology. © 2018 O'Flaherty et al.; Published by Cold Spring Harbor Laboratory Press.
-
Deep Sequencing to Identify the Causes of Viral Encephalitis
Chan, Benjamin K.; Wilson, Theodore; Fischer, Kael F.; Kriesel, John D.
2014-01-01
Deep sequencing allows for a rapid, accurate characterization of microbial DNA and RNA sequences in many types of samples. Deep sequencing (also called next generation sequencing or NGS) is being developed to assist with the diagnosis of a wide variety of infectious diseases. In this study, seven frozen brain samples from deceased subjects with recent encephalitis were investigated. RNA from each sample was extracted, randomly reverse transcribed and sequenced. The sequence analysis was performed in a blinded fashion and confirmed with pathogen-specific PCR. This analysis successfully identified measles virus sequences in two brain samples and herpes simplex virus type-1 sequences in three brain samples. No pathogen was identified in the other two brain specimens. These results were concordant with pathogen-specific PCR and partially concordant with prior neuropathological examinations, demonstrating that deep sequencing can accurately identify viral infections in frozen brain tissue. PMID:24699691
-
Leda, Ana Rachel; Hunter, James; Oliveira, Ursula Castro; Azevedo, Inacio Junqueira; Sucupira, Maria Cecilia Araripe; Diaz, Ricardo Sobhie
2018-04-19
The presence of minority transmitted drug resistance mutations was assessed using ultra-deep sequencing and correlated with disease progression among recently HIV-1-infected individuals from Brazil. Samples at baseline during recent infection and 1 year after the establishment of the infection were analysed. Viral RNA and proviral DNA from 25 individuals were subjected to ultra-deep sequencing of the reverse transcriptase and protease regions of HIV-1. Viral strains carrying transmitted drug resistance mutations were detected in 9 out of the 25 patients, for all major antiretroviral classes, ranging from one to five mutations per patient. Ultra-deep sequencing detected strains with frequencies as low as 1.6% and only strains with frequencies >20% were detected by population plasma sequencing (three patients). Transmitted drug resistance strains with frequencies <14.8% did not persist upon established infection. The presence of transmitted drug resistance mutations was negatively correlated with the viral load and with CD4+ T cell count decay. Transmitted drug resistance mutations representing small percentages of the viral population do not persist during infection because they are negatively selected in the first year after HIV-1 seroconversion.
-
An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1
2010-01-01
Background HIV-1 can be inhibited by RNA interference in vitro through the expression of short hairpin RNAs (shRNAs) that target conserved genome sequences. In silico shRNA design for HIV has lacked a detailed study of virus variability constituting a possible breaking point in a clinical setting. We designed shRNAs against HIV-1 considering the variability observed in naïve and drug-resistant isolates available at public databases. Methods A Bioperl-based algorithm was developed to automatically scan multiple sequence alignments of HIV, while evaluating the possibility of identifying dominant and subdominant viral variants that could be used as efficient silencing molecules. Student t-test and Bonferroni Dunn correction test were used to assess statistical significance of our findings. Results Our in silico approach identified the most common viral variants within highly conserved genome regions, with a calculated free energy of ≥ -6.6 kcal/mol. This is crucial for strand loading to RISC complex and for a predicted silencing efficiency score, which could be used in combination for achieving over 90% silencing. Resistant and naïve isolate variability revealed that the most frequent shRNA per region targets a maximum of 85% of viral sequences. Adding more divergent sequences maintained this percentage. Specific sequence features that have been found to be related with higher silencing efficiency were hardly accomplished in conserved regions, even when lower entropy values correlated with better scores. We identified a conserved region among most HIV-1 genomes, which meets as many sequence features for efficient silencing. Conclusions HIV-1 variability is an obstacle to achieving absolute silencing using shRNAs designed against a consensus sequence, mainly because there are many functional viral variants. Our shRNA cocktail could be truly effective at silencing dominant and subdominant naïve viral variants. Additionally, resistant isolates might be targeted under specific antiretroviral selective pressure, but in both cases these should be tested exhaustively prior to clinical use. PMID:21172023
-
Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences
Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.
2012-01-01
ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136
-
Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M
1994-01-01
A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide sequences in the TRL and IRL, respectively. Additional homologous aa sequences are the hydrophobic aa domain in the middle of both proteins. The functions of ORF-2, ORF-3, and additional ORFs are under study.
-
Paul, Sinu; Piontkivska, Helen
2009-01-01
Background Studies have shown that in the genome of human immunodeficiency virus (HIV-1) regions responsible for interactions with the host's immune system, namely, cytotoxic T-lymphocyte (CTL) epitopes tend to cluster together in relatively conserved regions. On the other hand, "epitope-less" regions or regions with relatively low density of epitopes tend to be more variable. However, very little is known about relationships among epitopes from different genes, in other words, whether particular epitopes from different genes would occur together in the same viral genome. To identify CTL epitopes in different genes that co-occur in HIV genomes, association rule mining was used. Results Using a set of 189 best-defined HIV-1 CTL/CD8+ epitopes from 9 different protein-coding genes, as described by Frahm, Linde & Brander (2007), we examined the complete genomic sequences of 62 reference HIV sequences (including 13 subtypes and sub-subtypes with approximately 4 representative sequences for each subtype or sub-subtype, and 18 circulating recombinant forms). The results showed that despite inclusion of recombinant sequences that would be expected to break-up associations of epitopes in different genes when two different genomes are recombined, there exist particular combinations of epitopes (epitope associations) that occur repeatedly across the world-wide population of HIV-1. For example, Pol epitope LFLDGIDKA is found to be significantly associated with epitopes GHQAAMQML and FLKEKGGL from Gag and Nef, respectively, and this association rule is observed even among circulating recombinant forms. Conclusion We have identified CTL epitope combinations co-occurring in HIV-1 genomes including different subtypes and recombinant forms. Such co-occurrence has important implications for design of complex vaccines (multi-epitope vaccines) and/or drugs that would target multiple HIV-1 regions at once and, thus, may be expected to overcome challenges associated with viral escape. PMID:19580659
-
Miller, Eric S.; Heidelberg, John F.; Eisen, Jonathan A.; Nelson, William C.; Durkin, A. Scott; Ciecko, Ann; Feldblyum, Tamara V.; White, Owen; Paulsen, Ian T.; Nierman, William C.; Lee, Jong; Szczypinski, Bridget; Fraser, Claire M.
2003-01-01
The complete genome sequence of the T4-like, broad-host-range vibriophage KVP40 has been determined. The genome sequence is 244,835 bp, with an overall G+C content of 42.6%. It encodes 386 putative protein-encoding open reading frames (CDSs), 30 tRNAs, 33 T4-like late promoters, and 57 potential rho-independent terminators. Overall, 92.1% of the KVP40 genome is coding, with an average CDS size of 587 bp. While 65% of the CDSs were unique to KVP40 and had no known function, the genome sequence and organization show specific regions of extensive conservation with phage T4. At least 99 KVP40 CDSs have homologs in the T4 genome (Blast alignments of 45 to 68% amino acid similarity). The shared CDSs represent 36% of all T4 CDSs but only 26% of those from KVP40. There is extensive representation of the DNA replication, recombination, and repair enzymes as well as the viral capsid and tail structural genes. KVP40 lacks several T4 enzymes involved in host DNA degradation, appears not to synthesize the modified cytosine (hydroxymethyl glucose) present in T-even phages, and lacks group I introns. KVP40 likely utilizes the T4-type sigma-55 late transcription apparatus, but features of early- or middle-mode transcription were not identified. There are 26 CDSs that have no viral homolog, and many did not necessarily originate from Vibrio spp., suggesting an even broader host range for KVP40. From these latter CDSs, an NAD salvage pathway was inferred that appears to be unique among bacteriophages. Features of the KVP40 genome that distinguish it from T4 are presented, as well as those, such as the replication and virion gene clusters, that are substantially conserved. PMID:12923095
-
BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.
Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F
2014-01-01
We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.
-
Expression of Functional Influenza Virus RNA Polymerase in the Methylotrophic Yeast Pichia pastoris
Hwang, Jung-Shan; Yamada, Kazunori; Honda, Ayae; Nakade, Kohji; Ishihama, Akira
2000-01-01
Influenza virus RNA polymerase with the subunit composition PB1-PB2-PA is a multifunctional enzyme with the activities of both synthesis and cleavage of RNA and is involved in both transcription and replication of the viral genome. In order to produce large amounts of the functional viral RNA polymerase sufficient for analysis of its structure-function relationships, the cDNAs for RNA segments 1, 2, and 3 of influenza virus A/PR/8, each under independent control of the alcohol oxidase gene promoter, were integrated into the chromosome of the methylotrophic yeast Pichia pastoris. Simultaneous expression of all three P proteins in the yeast P. pastoris was achieved by the addition of methanol. To purify the P protein complexes, a sequence coding for a histidine tag was added to the PB2 protein gene at its N terminus. Starting from the induced P. pastoris cell lysate, we partially purified a 3P complex by Ni2+-agarose affinity column chromatography. The 3P complex showed influenza virus model RNA-directed and ApG-primed RNA synthesis in vitro but was virtually inactive without addition of template or primer. The kinetic properties of model template-directed RNA synthesis and the requirements for template sequence were analyzed using the 3P complex. Furthermore, the 3P complex showed capped RNA-primed RNA synthesis. Thus, we conclude that functional influenza virus RNA polymerase with the catalytic properties of a transcriptase is formed in the methylotrophic yeast P. pastoris. PMID:10756019
-
NASA Astrophysics Data System (ADS)
Champeimont, Raphaël; Laine, Elodie; Hu, Shuang-Wei; Penin, Francois; Carbone, Alessandra
2016-05-01
A novel computational approach of coevolution analysis allowed us to reconstruct the protein-protein interaction network of the Hepatitis C Virus (HCV) at the residue resolution. For the first time, coevolution analysis of an entire viral genome was realized, based on a limited set of protein sequences with high sequence identity within genotypes. The identified coevolving residues constitute highly relevant predictions of protein-protein interactions for further experimental identification of HCV protein complexes. The method can be used to analyse other viral genomes and to predict the associated protein interaction networks.
-
Weiss, Eric R.; Alter, Galit; Ogembo, Javier Gordon; Henderson, Jennifer L.; Tabak, Barbara; Bakiş, Yasin; Somasundaran, Mohan; Garber, Manuel; Selin, Liisa
2016-01-01
ABSTRACT The Epstein-Barr virus (EBV) gp350 glycoprotein interacts with the cellular receptor to mediate viral entry and is thought to be the major target for neutralizing antibodies. To better understand the role of EBV-specific antibodies in the control of viral replication and the evolution of sequence diversity, we measured EBV gp350-specific antibody responses and sequenced the gp350 gene in samples obtained from individuals experiencing primary EBV infection (acute infectious mononucleosis [AIM]) and again 6 months later (during convalescence [CONV]). EBV gp350-specific IgG was detected in the sera of 17 (71%) of 24 individuals at the time of AIM and all 24 (100%) individuals during CONV; binding antibody titers increased from AIM through CONV, reaching levels equivalent to those in age-matched, chronically infected individuals. Antibody-dependent cell-mediated phagocytosis (ADCP) was rarely detected during AIM (4 of 24 individuals; 17%) but was commonly detected during CONV (19 of 24 individuals; 79%). The majority (83%) of samples taken during AIM neutralized infection of primary B cells; all samples obtained at 6 months postdiagnosis neutralized EBV infection of cultured and primary target cells. Deep sequencing revealed interpatient gp350 sequence variation but conservation of the CR2-binding site. The levels of gp350-specific neutralizing activity directly correlated with higher peripheral blood EBV DNA levels during AIM and a greater evolution of diversity in gp350 nucleotide sequences from AIM to CONV. In summary, we conclude that the viral load and EBV gp350 diversity during early infection are associated with the development of neutralizing antibody responses following AIM. IMPORTANCE Antibodies against viral surface proteins can blunt the spread of viral infection by coating viral particles, mediating uptake by immune cells, or blocking interaction with host cell receptors, making them a desirable component of a sterilizing vaccine. The EBV surface protein gp350 is a major target for antibodies. We report the detection of EBV gp350-specific antibodies capable of neutralizing EBV infection in vitro. The majority of gp350-directed vaccines focus on glycoproteins from lab-adapted strains, which may poorly reflect primary viral envelope diversity. We report some of the first primary gp350 sequences, noting that the gp350 host receptor binding site is remarkably stable across patients and time. However, changes in overall gene diversity were detectable during infection. Patients with higher peripheral blood viral loads in primary infection and greater changes in viral diversity generated more efficient antibodies. Our findings provide insight into the generation of functional antibodies, necessary for vaccine development. PMID:27733645
-
Weiss, Eric R; Alter, Galit; Ogembo, Javier Gordon; Henderson, Jennifer L; Tabak, Barbara; Bakiş, Yasin; Somasundaran, Mohan; Garber, Manuel; Selin, Liisa; Luzuriaga, Katherine
2017-01-01
The Epstein-Barr virus (EBV) gp350 glycoprotein interacts with the cellular receptor to mediate viral entry and is thought to be the major target for neutralizing antibodies. To better understand the role of EBV-specific antibodies in the control of viral replication and the evolution of sequence diversity, we measured EBV gp350-specific antibody responses and sequenced the gp350 gene in samples obtained from individuals experiencing primary EBV infection (acute infectious mononucleosis [AIM]) and again 6 months later (during convalescence [CONV]). EBV gp350-specific IgG was detected in the sera of 17 (71%) of 24 individuals at the time of AIM and all 24 (100%) individuals during CONV; binding antibody titers increased from AIM through CONV, reaching levels equivalent to those in age-matched, chronically infected individuals. Antibody-dependent cell-mediated phagocytosis (ADCP) was rarely detected during AIM (4 of 24 individuals; 17%) but was commonly detected during CONV (19 of 24 individuals; 79%). The majority (83%) of samples taken during AIM neutralized infection of primary B cells; all samples obtained at 6 months postdiagnosis neutralized EBV infection of cultured and primary target cells. Deep sequencing revealed interpatient gp350 sequence variation but conservation of the CR2-binding site. The levels of gp350-specific neutralizing activity directly correlated with higher peripheral blood EBV DNA levels during AIM and a greater evolution of diversity in gp350 nucleotide sequences from AIM to CONV. In summary, we conclude that the viral load and EBV gp350 diversity during early infection are associated with the development of neutralizing antibody responses following AIM. Antibodies against viral surface proteins can blunt the spread of viral infection by coating viral particles, mediating uptake by immune cells, or blocking interaction with host cell receptors, making them a desirable component of a sterilizing vaccine. The EBV surface protein gp350 is a major target for antibodies. We report the detection of EBV gp350-specific antibodies capable of neutralizing EBV infection in vitro The majority of gp350-directed vaccines focus on glycoproteins from lab-adapted strains, which may poorly reflect primary viral envelope diversity. We report some of the first primary gp350 sequences, noting that the gp350 host receptor binding site is remarkably stable across patients and time. However, changes in overall gene diversity were detectable during infection. Patients with higher peripheral blood viral loads in primary infection and greater changes in viral diversity generated more efficient antibodies. Our findings provide insight into the generation of functional antibodies, necessary for vaccine development. Copyright © 2016 American Society for Microbiology.
-
Schyth, Brian Dall; Bela-ong, Dennis Berbulla; Jalali, Seyed Amir Hossein; Kristensen, Lasse Bøgelund Juel; Einer-Jensen, Katja; Pedersen, Finn Skou; Lorenzen, Niels
2015-01-01
MicroRNAs (miRNAs) are ~22 base pair-long non-coding RNAs which regulate gene expression in the cytoplasm of eukaryotic cells by binding to specific target regions in mRNAs to mediate transcriptional blocking or mRNA cleavage. Through their fundamental roles in cellular pathways, gene regulation mediated by miRNAs has been shown to be involved in almost all biological phenomena, including development, metabolism, cell cycle, tumor formation, and host-pathogen interactions. To address the latter in a primitive vertebrate host, we here used an array platform to analyze the miRNA response in rainbow trout (Oncorhynchus mykiss) following inoculation with the virulent fish rhabdovirus Viral hemorrhagic septicaemia virus. Two clustered miRNAs, miR-462 and miR-731 (herein referred to as miR-462 cluster), described only in teleost fishes, were found to be strongly upregulated, indicating their involvement in fish-virus interactions. We searched for homologues of the two teleost miRNAs in other vertebrate species and investigated whether findings related to ours have been reported for these homologues. Gene synteny analysis along with gene sequence conservation suggested that the teleost fish miR-462 and miR-731 had evolved from the ancestral miR-191 and miR-425 (herein called miR-191 cluster), respectively. Whereas the miR-462 cluster locus is found between two protein-coding genes (intergenic) in teleost fish genomes, the miR-191 cluster locus is found within an intron of a protein-coding gene (intragenic) in the human genome. Interferon (IFN)-inducible and immune-related promoter elements found upstream of the teleost miR-462 cluster locus suggested roles in immune responses to viral pathogens in fish, while in humans, the miR-191 cluster functionally associated with cell cycle regulation. Stimulation of fish cell cultures with the IFN inducer poly I:C accordingly upregulated the expression of miR-462 and miR-731, while no stimulatory effect on miR-191 and miR-425 expression was observed in human cell lines. Despite high sequence conservation, evolution has thus resulted in different regulation and presumably also different functional roles of these orthologous miRNA clusters in different vertebrate lineages. PMID:26207374
-
Viral genetic variation accounts for a third of variability in HIV-1 set-point viral load in Europe.
Blanquart, François; Wymant, Chris; Cornelissen, Marion; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Hall, Matthew; Hillebregt, Mariska; Ong, Swee Hoe; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle J; Grabowski, M Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Vanham, Guido; Berkhout, Ben; Kellam, Paul; Reiss, Peter; Fraser, Christophe
2017-06-01
HIV-1 set-point viral load-the approximately stable value of viraemia in the first years of chronic infection-is a strong predictor of clinical outcome and is highly variable across infected individuals. To better understand HIV-1 pathogenesis and the evolution of the viral population, we must quantify the heritability of set-point viral load, which is the fraction of variation in this phenotype attributable to viral genetic variation. However, current estimates of heritability vary widely, from 6% to 59%. Here we used a dataset of 2,028 seroconverters infected between 1985 and 2013 from 5 European countries (Belgium, Switzerland, France, the Netherlands and the United Kingdom) and estimated the heritability of set-point viral load at 31% (CI 15%-43%). Specifically, heritability was measured using models of character evolution describing how viral load evolves on the phylogeny of whole-genome viral sequences. In contrast to previous studies, (i) we measured viral loads using standardized assays on a sample collected in a strict time window of 6 to 24 months after infection, from which the viral genome was also sequenced; (ii) we compared 2 models of character evolution, the classical "Brownian motion" model and another model ("Ornstein-Uhlenbeck") that includes stabilising selection on viral load; (iii) we controlled for covariates, including age and sex, which may inflate estimates of heritability; and (iv) we developed a goodness of fit test based on the correlation of viral loads in cherries of the phylogenetic tree, showing that both models of character evolution fit the data well. An overall heritability of 31% (CI 15%-43%) is consistent with other studies based on regression of viral load in donor-recipient pairs. Thus, about a third of variation in HIV-1 virulence is attributable to viral genetic variation.
-
Russo, Alice G; Eden, John-Sebastian; Enosi Tuipulotu, Daniel; Shi, Mang; Selechnik, Daniel; Shine, Richard; Rollins, Lee Ann; Holmes, Edward C; White, Peter A
2018-06-13
Cane toads are a notorious invasive species, inhabiting over 1.2 million km 2 of Australia and threatening native biodiversity. Release of pathogenic cane toad viruses is one possible biocontrol strategy yet is currently hindered by the poorly-described cane toad virome. Metatranscriptomic analysis of 16 cane toad livers revealed the presence of a novel and full-length picornavirus, Rhimavirus A (RhiV-A), a member of a reptile and amphibian specific-cluster of the Picornaviridae basal to the Kobuvirus -like group. In the combined liver transcriptome, we also identified a complete genome sequence of a distinct epsilonretrovirus, R. marina endogenous retrovirus (RMERV). The recently sequenced cane toad genome contains eight complete RMERV proviruses, as well as 21 additional truncated insertions. The oldest full length RMERV provirus was estimated to have inserted 1.9 MYA. To screen for these viral sequences in additional toads, we analysed publicly available transcriptomes from six diverse Australian locations. RhiV-A transcripts were identified in toads sampled from three locations across 1,000 km of Australia, stretching to the current Western Australia (WA) invasion front, whilst RMERV transcripts were observed at all six sites. Lastly, we scanned the cane toad genome for non-retroviral endogenous viral elements, finding three sequences related to small DNA viruses in the family Circoviridae This shows ancestral circoviral infection with subsequent genomic integration. The identification of these current and past viral infections enriches our knowledge of the cane toad virome, an understanding of which will facilitate future work on infection and disease in this important invasive species. Importance Cane toads are poisonous amphibians which were introduced to Australia in 1935 for insect control. Since then, their population has increased dramatically, and they now threat many native Australian species. One potential method to control the population is to release a cane toad virus with high mortality, yet few cane toad viruses have been characterised. This study samples cane toads from different Australian locations and uses an RNA sequencing and computational approach to find new viruses. We report novel complete picornavirus and retrovirus sequences which were genetically similar to viruses infecting frogs, reptiles and fish. Using data generated in other studies, we show that these viral sequences are present in cane toads from distinct Australian locations. Three sequences related to circoviruses were also found in the toad genome. The identification of new viral sequences will aid future studies which investigate their prevalence and potential as agents for biocontrol. Copyright © 2018 American Society for Microbiology.
-
Yang, Teng-Chieh; Maluf, Nasib Karl
2012-02-21
Human adenovirus (Ad) is an icosahedral, double-stranded DNA virus. Viral DNA packaging refers to the process whereby the viral genome becomes encapsulated by the viral particle. In Ad, activation of the DNA packaging reaction requires at least three viral components: the IVa2 and L4-22K proteins and a section of DNA within the viral genome, called the packaging sequence. Previous studies have shown that the IVa2 and L4-22K proteins specifically bind to conserved elements within the packaging sequence and that these interactions are absolutely required for the observation of DNA packaging. However, the equilibrium mechanism for assembly of IVa2 and L4-22K onto the packaging sequence has not been determined. Here we characterize the assembly of the IVa2 and L4-22K proteins onto truncated packaging sequence DNA by analytical sedimentation velocity and equilibrium methods. At limiting concentrations of L4-22K, we observe a species with two IVa2 monomers and one L4-22K monomer bound to the DNA. In this species, the L4-22K monomer is promoting positive cooperative interactions between the two bound IVa2 monomers. As L4-22K levels are increased, we observe a species with one IVa2 monomer and three L4-22K monomers bound to the DNA. To explain this result, we propose a model in which L4-22K self-assembly on the DNA competes with IVa2 for positive heterocooperative interactions, destabilizing binding of the second IVa2 monomer. Thus, we propose that L4-22K levels control the extent of cooperativity observed between adjacently bound IVa2 monomers. We have also determined the hydrodynamic properties of all observed stoichiometric species; we observe that species with three L4-22K monomers bound have more extended conformations than species with a single L4-22K bound. We suggest this might reflect a molecular switch that controls insertion of the viral DNA into the capsid.
-
Rennick, Linda J; Duprex, W Paul; Rima, Bert K
2007-10-01
Transcription from morbillivirus genomes commences at a single promoter in the 3' non-coding terminus, with the six genes being transcribed sequentially. The 3' and 5' untranslated regions (UTRs) of the genes (mRNA sense), together with the intergenic trinucleotide spacer, comprise the non-coding sequences (NCS) of the virus and contain the conserved gene end and gene start signals, respectively. Bicistronic minigenomes containing transcription units (TUs) encoding autofluorescent reporter proteins separated by measles virus (MV) NCS were used to give a direct estimation of gene expression in single, living cells by assessing the relative amounts of each fluorescent protein in each cell. Initially, five minigenomes containing each of the MV NCS were generated. Assays were developed to determine the amount of each fluorescent protein in cells at both cell population and single-cell levels. This revealed significant variations in gene expression between cells expressing the same NCS-containing minigenome. The minigenome containing the M/F NCS produced significantly lower amounts of fluorescent protein from the second TU (TU2), compared with the other minigenomes. A minigenome with a truncated F 5' UTR had increased expression from TU2. This UTR is 524 nt longer than the other MV 5' UTRs. Insertions into the 5' UTR of the enhanced green fluorescent protein gene in the minigenome containing the N/P NCS showed that specific sequences, rather than just the additional length of F 5' UTR, govern this decreased expression from TU2.
-
CRISPR-Cas systems exploit viral DNA injection to establish and maintain adaptive immunity.
Modell, Joshua W; Jiang, Wenyan; Marraffini, Luciano A
2017-04-06
Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems provide protection against viral and plasmid infection by capturing short DNA sequences from these invaders and integrating them into the CRISPR locus of the prokaryotic host. These sequences, known as spacers, are transcribed into short CRISPR RNA guides that specify the cleavage site of Cas nucleases in the genome of the invader. It is not known when spacer sequences are acquired during viral infection. Here, to investigate this, we tracked spacer acquisition in Staphylococcus aureus cells harbouring a type II CRISPR-Cas9 system after infection with the staphylococcal bacteriophage ϕ12. We found that new spacers were acquired immediately after infection preferentially from the cos site, the viral free DNA end that is first injected into the cell. Analysis of spacer acquisition after infection with mutant phages demonstrated that most spacers are acquired during DNA injection, but not during other stages of the viral cycle that produce free DNA ends, such as DNA replication or packaging. Finally, we showed that spacers acquired from early-injected genomic regions, which direct Cas9 cleavage of the viral DNA immediately after infection, provide better immunity than spacers acquired from late-injected regions. Our results reveal that CRISPR-Cas systems exploit the phage life cycle to generate a pattern of spacer acquisition that ensures a successful CRISPR immune response.
-
The Vaginal Eukaryotic DNA Virome and Preterm Birth.
Wylie, Kristine M; Wylie, Todd N; Cahill, Alison G; Macones, George A; Tuuli, Methodius G; Stout, Molly J
2018-05-05
Despite decades of attempts to link infectious agents to preterm birth, an exact causative microbe or community of microbes remains elusive. Culture-independent sequencing of vaginal bacterial communities demonstrates community characteristics are associated with preterm birth, although none are specific enough to apply clinically. Viruses are important components of the vaginal microbiome and have dynamic relationships with vaginal bacterial communities. We hypothesized that vaginal eukaryotic DNA viral communities (the "vaginal virome") either alone or in the context of bacterial communities are associated with preterm birth. The objective of this study was to use high-throughput sequencing to examine the vaginal eukaryotic DNA virome in a cohort of pregnant women and examine associations between vaginal community characteristics and preterm birth. This is a nested case-control study within a prospective cohort study of women with singleton pregnancies, not on supplemental progesterone, and without cervical cerclage in situ. Serial mid-vaginal swabs were obtained at routine prenatal visits. DNA was extracted, bacterial communities were characterized by 16S rRNA gene sequencing, and eukaryotic viral communities were characterized by enrichment of viral nucleic acid with the ViroCap targeted sequence capture panel followed by nucleic acid sequencing. Viral communities were analyzed according to presence/absence of viruses, diversity, dynamics over time, and association with bacterial community data obtained from the same specimens. Sixty subjects contributed 128 vaginal swabs longitudinally across pregnancy. Twenty-four patients delivered preterm. Participants were predominantly African-American (65%). Six families of eukaryotic DNA viruses were detected in the vaginal samples. At least 1 virus was detected in 80% of women. No specific virus or group of viruses was associated with preterm delivery. Higher viral richness was significantly associated with preterm delivery in the full group and in the African American subgroup (P=0.0005 and P=0.0003, respectively). Having both high bacterial diversity and high viral diversity in the first trimester was associated with the highest risk for preterm birth. Higher vaginal viral diversity is associated with preterm birth. Changes in vaginal virome diversity appear similar to changes in the vaginal bacterial microbiome over pregnancy, suggesting that underlying physiology of pregnancy may regulate both bacterial and viral communities. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Virus versus Host Plant MicroRNAs: Who Determines the Outcome of the Interaction?
Maghuly, Fatemeh; Ramkat, Rose C.; Laimer, Margit
2014-01-01
Considering the importance of microRNAs (miRNAs) in the regulation of essential processes in plant pathogen interactions, it is not surprising that, while plant miRNA sequences counteract viral attack via antiviral RNA silencing, viruses in turn have developed antihost defense mechanisms blocking these RNA silencing pathways and establish a counter-defense. In the current study, computational and stem-loop Reverse Transcription – Polymerase Chain Reaction (RT-PCR) approaches were employed to a) predict and validate virus encoded mature miRNAs (miRs) in 39 DNA-A sequences of the bipartite genomes of African cassava mosaic virus (ACMV) and East African cassava mosaic virus-Uganda (EACMV-UG) isolates, b) determine whether virus encoded miRs/miRs* generated from the 5′/3′ harpin arms have the capacity to bind to genomic sequences of the host plants Jatropha or cassava and c) investigate whether plant encoded miR/miR* sequences have the potential to bind to the viral genomes. Different viral pre-miRNA hairpin sequences and viral miR/miR* length variants occurring as isomiRs were predicted in both viruses. These miRNAs were located in three Open Reading Frames (ORFs) and in the Intergenic Region (IR). Moreover, various target genes for miRNAs from both viruses were predicted and annotated in the host plant genomes indicating that they are involved in biotic response, metabolic pathways and transcription factors. Plant miRs/miRs* from conserved and highly expressed families were identified, which were shown to have potential targets in the genome of both begomoviruses, representing potential plant miRNAs mediating antiviral defense. This is the first assessment of predicted viral miRs/miRs* of ACMV and EACMV-UG and host plant miRNAs, providing a reference point for miRNA identification in pathogens and their hosts. These findings will improve the understanding of host- pathogen interaction pathways and the function of viral miRNAs in Euphorbiaceous crop plants. PMID:24896088
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, S.B.
Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less
-
MicroRNAs and non-coding RNAs in virus-infected cells
Ouellet, Dominique L.; Provost, Patrick
2010-01-01
Within the past few years, microRNAs (miRNAs) and other non-coding RNAs (ncRNAs) have emerged as elements with critically high importance in post-transcriptional control of cellular and, more recently, viral processes. Endogenously produced by a component of the miRNA-guided RNA silencing machinery known as Dicer, miRNAs are known to control messenger RNA (mRNA) translation through recognition of specific binding sites usually located in their 3′ untranslated region. Recent evidences indicate that the host miRNA pathway may represent an adapted antiviral defense mechanism that can act either by direct miRNA-mediated modulation of viral gene expression or through recognition and inactivation of structured viral RNA species by the protein components of the RNA silencing machinery, such as Dicer. This latter process, however, is a double-edge sword, as it may yield viral miRNAs exerting gene regulatory properties on both host and viral mRNAs. Our knowledge of the interaction between viruses and host RNA silencing machineries, and how this influences the course of infection, is becoming increasingly complex. This review article aims to summarize our current knowledge about viral miRNAs/ncRNAs and their targets, as well as cellular miRNAs that are modulated by viruses upon infection. PMID:20217543
-
Ip, Hon S.; Wiley, Michael R.; Long, Renee; Gustavo, Palacios; Shearn-Bochsler, Valerie; Whitehouse, Chris A.
2014-01-01
Advances in massively parallel DNA sequencing platforms, commonly termed next-generation sequencing (NGS) technologies, have greatly reduced time, labor, and cost associated with DNA sequencing. Thus, NGS has become a routine tool for new viral pathogen discovery and will likely become the standard for routine laboratory diagnostics of infectious diseases in the near future. This study demonstrated the application of NGS for the rapid identification and characterization of a virus isolated from the brain of an endangered Mississippi sandhill crane. This bird was part of a population restoration effort and was found in an emaciated state several days after Hurricane Isaac passed over the refuge in Mississippi in 2012. Post-mortem examination had identified trichostrongyliasis as the possible cause of death, but because a virus with morphology consistent with a togavirus was isolated from the brain of the bird, an arboviral etiology was strongly suspected. Because individual molecular assays for several known arboviruses were negative, unbiased NGS by Illumina MiSeq was used to definitively identify and characterize the causative viral agent. Whole genome sequencing and phylogenetic analysis revealed the viral isolate to be the Highlands J virus, a known avian pathogen. This study demonstrates the use of unbiased NGS for the rapid detection and characterization of an unidentified viral pathogen and the application of this technology to wildlife disease diagnostics and conservation medicine.
-
Current Advances on Virus Discovery and Diagnostic Role of Viral Metagenomics in Aquatic Organisms
Munang'andu, Hetron M.; Mugimba, Kizito K.; Byarugaba, Denis K.; Mutoloki, Stephen; Evensen, Øystein
2017-01-01
The global expansion of the aquaculture industry has brought with it a corresponding increase of novel viruses infecting different aquatic organisms. These emerging viral pathogens have proved to be a challenge to the use of traditional cell-cultures and immunoassays for identification of new viruses especially in situations where the novel viruses are unculturable and no antibodies exist for their identification. Viral metagenomics has the potential to identify novel viruses without prior knowledge of their genomic sequence data and may provide a solution for the study of unculturable viruses. This review provides a synopsis on the contribution of viral metagenomics to the discovery of viruses infecting different aquatic organisms as well as its potential role in viral diagnostics. High throughput Next Generation sequencing (NGS) and library construction used in metagenomic projects have simplified the task of generating complete viral genomes unlike the challenge faced in traditional methods that use multiple primers targeted at different segments and VPs to generate the entire genome of a novel virus. In terms of diagnostics, studies carried out this far show that viral metagenomics has the potential to serve as a multifaceted tool able to study and identify etiological agents of single infections, co-infections, tissue tropism, profiling viral infections of different aquatic organisms, epidemiological monitoring of disease prevalence, evolutionary phylogenetic analyses, and the study of genomic diversity in quasispecies viruses. With sequencing technologies and bioinformatics analytical tools becoming cheaper and easier, we anticipate that metagenomics will soon become a routine tool for the discovery, study, and identification of novel pathogens including viruses to enable timely disease control for emerging diseases in aquaculture. PMID:28382024
-
Maruyama, Sandra Regina; Castro-Jorge, Luiza Antunes; Ribeiro, José Marcos Chaves; Gardinassi, Luiz Gustavo; Garcia, Gustavo Rocha; Brandão, Lucinda Giampietro; Rodrigues, Aline Rezende; Okada, Marcos Ituo; Abrão, Emiliana Pereira; Ferreira, Beatriz Rossetti; da Fonseca, Benedito Antonio Lopes; de Miranda-Santos, Isabel Kinney Ferreira
2013-01-01
Transcripts similar to those that encode the nonstructural (NS) proteins NS3 and NS5 from flaviviruses were found in a salivary gland (SG) complementary DNA (cDNA) library from the cattle tick Rhipicephalus microplus. Tick extracts were cultured with cells to enable the isolation of viruses capable of replicating in cultured invertebrate and vertebrate cells. Deep sequencing of the viral RNA isolated from culture supernatants provided the complete coding sequences for the NS3 and NS5 proteins and their molecular characterisation confirmed similarity with the NS3 and NS5 sequences from other flaviviruses. Despite this similarity, phylogenetic analyses revealed that this potentially novel virus may be a highly divergent member of the genus Flavivirus. Interestingly, we detected the divergent NS3 and NS5 sequences in ticks collected from several dairy farms widely distributed throughout three regions of Brazil. This is the first report of flavivirus-like transcripts in R. microplus ticks. This novel virus is a potential arbovirus because it replicated in arthropod and mammalian cells; furthermore, it was detected in a cDNA library from tick SGs and therefore may be present in tick saliva. It is important to determine whether and by what means this potential virus is transmissible and to monitor the virus as a potential emerging tick-borne zoonotic pathogen. PMID:24626302
-
Cao, Guangli; Meng, Xiangkun; Xue, Renyu; Zhu, Yuexiong; Zhang, Xiaorong; Pan, Zhonghua; Zheng, Xiaojian; Gong, Chengliang
2012-07-01
A novel Bombyx mori cypovirus 1 isolated from infected silkworm larvae and tentatively assigned as Bombyx mori cypovirus 1 isolate Suzhou (BmCPV-SZ). The complete nucleotide sequences of genomic segments S1-S10 from BmCPV-SZ were determined. All segments possessed a single open reading frame; however, bioinformatic evidence suggested a short overlapping coding sequence in S1. Each BmCPV-SZ segment possessed the conserved terminal sequences AGUAA and GUUAGCC at the 5' and 3' ends, respectively. The conserved A/G at the -3 position in relation to the AUG codon could be found in the BmCPV-SZ genome, and it was postulated that this conserved A/G may be the most important nucleotide for efficient translation initiation in cypoviruses (CPVs). Examination of the putative amino acid sequences encoded by BmCPV-SZ revealed some characteristic motifs. Homology searches showed that viral structural proteins VP1, VP3, and VP4 had localized homologies with proteins of Rice ragged stunt virus , a member of the genus Oryzavirus within the family Reoviridae. A phylogenetic tree based on RNA-dependent RNA polymerase sequences demonstrated that CPV is more closely related to Rice ragged stunt virus and Aedes pseudoscutellaris reovirus than to other members of Reoviridae, suggesting that they may have originated from common ancestors.
-
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
-
NASA Astrophysics Data System (ADS)
Daly, R. A.; Mouser, P. J.; Trexler, R.; Wrighton, K. C.
2014-12-01
Despite a growing appreciation for the ecological role of viruses in marine and gut systems, little is known about their role in the terrestrial deep (> 2000 m) subsurface. We used assembly-based metagenomics to examine the viral component in fluids from hydraulically fractured Marcellus shale gas wells. Here we reconstructed microbial and viral genomes from samples collected 7, 82, and 328 days post fracturing. Viruses accounted for 4.14%, 0.92% and 0.59% of the sample reads that mapped to the assembly. We identified 6 complete, circularized viral genomes and an additional 92 viral contigs > 5 kb with a maximum contig size of 73.6 kb. A BLAST comparison to NCBI viral genomes revealed that 85% of viral contigs had significant hits to the viral order Caudovirales, with 43% of sequences belonging to the family Siphoviridae, 38% to Myoviridae, and 12% to Podoviridae. Enrichment of Caudovirales viruses was supported by a large number of predicted proteins characteristic of tailed viruses including terminases (TerL), tape measure, tail formation, and baseplate related proteins. The viral contigs included evidence of lytic and temperate lifestyles, with the 7 day sample having the greatest number of detected lytic viruses. Notably in this sample, the most abundant virus was lytic and its inferred host, a member of the Vibrionaceae, was not detected at later time points. Analyses of CRISPR sequences (a viral and foreign DNA immune system in bacteria and archaea), linked 18 viral contigs to hosts. CRISPR linkages increased through time and all bacterial and archaeal genomes recovered in the final time point had genes for CRISPR-mediated viral defense. The majority of CRISPR sequences linked phage genomes to several Halanaerobium strains, which are the dominant and persisting members of the community inferred to be responsible for carbon and sulfur cycling in these shales. Network analysis revealed that several viruses were present in the 82 and 328 day samples; this viral persistence is consistent with concomitant temporal stability in geochemistry and microbial community composition. Our findings suggest that after a disturbance (hydraulic fracturing) viral predation and host immunity is an important controller of microbial community structure, metabolism, and thus biogeochemical cycling in the deep subsurface.
-
2011-01-01
Background Human Rhinoviruses (HRVs) are well recognized viral pathogens associated with acute respiratory tract illnesses (RTIs) abundant worldwide. Although recent studies have phylogenetically identified the new HRV species (HRV-C), data on molecular epidemiology, genetic diversity, and clinical manifestation have been limited. Result To gain new insight into HRV genetic diversity, we determined the complete coding sequences of putative new members of HRV species C (HRV-CU072 with 1% prevalence) and HRV-B (HRV-CU211) identified from clinical specimens collected from pediatric patients diagnosed with a symptom of acute lower RTI. Complete coding sequence and phylogenetic analysis revealed that the HRV-CU072 strain shared a recent common ancestor with most closely related Chinese strain (N4). Comparative analysis at the protein level showed that HRV-CU072 might accumulate substitutional mutations in structural proteins, as well as nonstructural proteins 3C and 3 D. Comparative analysis of all available HRVs and HEVs indicated that HRV-C contains a relatively high G+C content and is more closely related to HEV-D. This might be correlated to their replication and capability to adapt to the high temperature environment of the human lower respiratory tract. We herein report an infrequently occurring intra-species recombination event in HRV-B species (HRV-CU211) with a crossing over having taken place at the boundary of VP2 and VP3 genes. Moreover, we observed phylogenetic compatibility in all HRV species and suggest that dynamic mechanisms for HRV evolution seem to be related to recombination events. These findings indicated that the elementary units shaping the genetic diversity of HRV-C could be found in the nonstructural 2A and 3D genes. Conclusion This study provides information for understanding HRV genetic diversity and insight into the role of selection pressure and recombination mechanisms influencing HRV evolution. PMID:21214911
-
Linsuwanon, Piyada; Payungporn, Sunchai; Suwannakarn, Kamol; Chieochansin, Thaweesak; Theamboonlers, Apiradee; Poovorawan, Yong
2011-01-07
Human Rhinoviruses (HRVs) are well recognized viral pathogens associated with acute respiratory tract illnesses (RTIs) abundant worldwide. Although recent studies have phylogenetically identified the new HRV species (HRV-C), data on molecular epidemiology, genetic diversity, and clinical manifestation have been limited. To gain new insight into HRV genetic diversity, we determined the complete coding sequences of putative new members of HRV species C (HRV-CU072 with 1% prevalence) and HRV-B (HRV-CU211) identified from clinical specimens collected from pediatric patients diagnosed with a symptom of acute lower RTI. Complete coding sequence and phylogenetic analysis revealed that the HRV-CU072 strain shared a recent common ancestor with most closely related Chinese strain (N4). Comparative analysis at the protein level showed that HRV-CU072 might accumulate substitutional mutations in structural proteins, as well as nonstructural proteins 3C and 3 D. Comparative analysis of all available HRVs and HEVs indicated that HRV-C contains a relatively high G+C content and is more closely related to HEV-D. This might be correlated to their replication and capability to adapt to the high temperature environment of the human lower respiratory tract. We herein report an infrequently occurring intra-species recombination event in HRV-B species (HRV-CU211) with a crossing over having taken place at the boundary of VP2 and VP3 genes. Moreover, we observed phylogenetic compatibility in all HRV species and suggest that dynamic mechanisms for HRV evolution seem to be related to recombination events. These findings indicated that the elementary units shaping the genetic diversity of HRV-C could be found in the nonstructural 2A and 3D genes. This study provides information for understanding HRV genetic diversity and insight into the role of selection pressure and recombination mechanisms influencing HRV evolution.
-
Viral Diversity Threshold for Adaptive Immunity in Prokaryotes
Weinberger, Ariel D.; Wolf, Yuri I.; Lobkovsky, Alexander E.; Gilmore, Michael S.; Koonin, Eugene V.
2012-01-01
ABSTRACT Bacteria and archaea face continual onslaughts of rapidly diversifying viruses and plasmids. Many prokaryotes maintain adaptive immune systems known as clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (Cas). CRISPR-Cas systems are genomic sensors that serially acquire viral and plasmid DNA fragments (spacers) that are utilized to target and cleave matching viral and plasmid DNA in subsequent genomic invasions, offering critical immunological memory. Only 50% of sequenced bacteria possess CRISPR-Cas immunity, in contrast to over 90% of sequenced archaea. To probe why half of bacteria lack CRISPR-Cas immunity, we combined comparative genomics and mathematical modeling. Analysis of hundreds of diverse prokaryotic genomes shows that CRISPR-Cas systems are substantially more prevalent in thermophiles than in mesophiles. With sequenced bacteria disproportionately mesophilic and sequenced archaea mostly thermophilic, the presence of CRISPR-Cas appears to depend more on environmental temperature than on bacterial-archaeal taxonomy. Mutation rates are typically severalfold higher in mesophilic prokaryotes than in thermophilic prokaryotes. To quantitatively test whether accelerated viral mutation leads microbes to lose CRISPR-Cas systems, we developed a stochastic model of virus-CRISPR coevolution. The model competes CRISPR-Cas-positive (CRISPR-Cas+) prokaryotes against CRISPR-Cas-negative (CRISPR-Cas−) prokaryotes, continually weighing the antiviral benefits conferred by CRISPR-Cas immunity against its fitness costs. Tracking this cost-benefit analysis across parameter space reveals viral mutation rate thresholds beyond which CRISPR-Cas cannot provide sufficient immunity and is purged from host populations. These results offer a simple, testable viral diversity hypothesis to explain why mesophilic bacteria disproportionately lack CRISPR-Cas immunity. More generally, fundamental limits on the adaptability of biological sensors (Lamarckian evolution) are predicted. PMID:23221803
-
Death of a dogma: eukaryotic mRNAs can code for more than one protein.
Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier
2016-01-08
mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Gambley, C F; Geering, A D W; Steele, V; Thomas, J E
2008-01-01
A previously published partial sequence of pineapple bacilliform virus was shown to be from a retrotransposon (family Metaviridae) and not from a badnavirus as previously thought. Two newly discovered sequence groups isolated from pineapple were associated with bacilliform virions and were transmitted by mealybugs. Phylogenetic analyses indicated that they were members of new badnavirus species. A third caulimovirid sequence was also amplified from pineapple, but available evidence suggests that this DNA is not encapsidated, but more likely derived from an endogenous virus.
-
Piantadosi, Anne; Mukerji, Shibani S; Chitneni, Pooja; Cho, Tracey A; Cosimi, Lisa A; Hung, Deborah T; Goldberg, Marcia B; Sabeti, Pardis C; Kuritzkes, Daniel R; Grad, Yonatan H
2017-01-01
Enteroviruses cause a wide spectrum of clinical disease. In this study, we describe the case of a young man with orchitis and aseptic meningitis who was diagnosed with enterovirus infection. Using unbiased "metagenomic" massively parallel sequencing, we assembled a near-complete viral genome, the first use of this method for full-genome viral sequencing from cerebrospinal fluid. We found that the genome belonged to the subgroup echovirus 30, which is a common cause of aseptic meningitis but has not been previously reported to cause orchitis.
-
In Silico Pattern-Based Analysis of the Human Cytomegalovirus Genome
Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T.; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas
2003-01-01
More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/). PMID:12634390
-
In silico pattern-based analysis of the human cytomegalovirus genome.
Rigoutsos, Isidore; Novotny, Jiri; Huynh, Tien; Chin-Bow, Stephen T; Parida, Laxmi; Platt, Daniel; Coleman, David; Shenk, Thomas
2003-04-01
More than 200 open reading frames (ORFs) from the human cytomegalovirus genome have been reported as potentially coding for proteins. We have used two pattern-based in silico approaches to analyze this set of putative viral genes. With the help of an objective annotation method that is based on the Bio-Dictionary, a comprehensive collection of amino acid patterns that describes the currently known natural sequence space of proteins, we have reannotated all of the previously reported putative genes of the human cytomegalovirus. Also, with the help of MUSCA, a pattern-based multiple sequence alignment algorithm, we have reexamined the original human cytomegalovirus gene family definitions. Our analysis of the genome shows that many of the coded proteins comprise amino acid combinations that are unique to either the human cytomegalovirus or the larger group of herpesviruses. We have confirmed that a surprisingly large portion of the analyzed ORFs encode membrane proteins, and we have discovered a significant number of previously uncharacterized proteins that are predicted to be G-protein-coupled receptor homologues. The analysis also indicates that many of the encoded proteins undergo posttranslational modifications such as hydroxylation, phosphorylation, and glycosylation. ORFs encoding proteins with similar functional behavior appear in neighboring regions of the human cytomegalovirus genome. All of the results of the present study can be found and interactively explored online (http://cbcsrv.watson.ibm.com/virus/).
-
Discovery of Novel Viruses in Mosquitoes from the Zambezi Valley of Mozambique
Hayer, Juliette; Abilio, Ana Paula; Mulandane, Fernando Chanisso; Verner-Carlsson, Jenny; Falk, Kerstin I.; Fafetine, Jose M.; Berg, Mikael; Blomström, Anne-Lie
2016-01-01
Mosquitoes carry a wide variety of viruses that can cause vector-borne infectious diseases and affect both human and veterinary public health. Although Mozambique can be considered a hot spot for emerging infectious diseases due to factors such as a rich vector population and a close vector/human/wildlife interface, the viral flora in mosquitoes have not previously been investigated. In this study, viral metagenomics was employed to analyze the viral communities in Culex and Mansonia mosquitoes in the Zambezia province of Mozambique. Among the 1.7 and 2.6 million sequences produced from the Culex and Mansonia samples, respectively, 3269 and 983 reads were classified as viral sequences. Viruses belonging to the Flaviviridae, Rhabdoviridae and Iflaviridae families were detected, and different unclassified single- and double-stranded RNA viruses were also identified. A near complete genome of a flavivirus, tentatively named Cuacua virus, was obtained from the Mansonia mosquitoes. Phylogenetic analysis of this flavivirus, using the NS5 amino acid sequence, showed that it grouped with ‘insect-specific’ viruses and was most closely related to Nakiwogo virus previously identified in Uganda. Both mosquito genera had viral sequences related to Rhabdoviruses, and these were most closely related to Culex tritaeniorhynchus rhabdovirus (CTRV). The results from this study suggest that several viruses specific for insects belonging to, for example, the Flaviviridae and Rhabdoviridae families, as well as a number of unclassified RNA viruses, are present in mosquitoes in Mozambique. PMID:27682810
-
Ma, Xueqing; Li, Pinghua; Sun, Pu; Lu, Zengjun; Bao, Huifang; Bai, Xingwen; Fu, Yuanfang; Cao, Yimei; Li, Dong; Chen, Yingli; Qiao, Zilin; Liu, Zaixin
2016-07-15
The deletion of residues 93-102 in non-structure protein 3A of foot-and-mouth disease virus (FMDV) is associated with the inability of FMDV to grow in bovine cells and attenuated virulence in cattle.Whereas, a previously reported FMDV strain O/HKN/21/70 harboring 93-102 deletion in 3A protein grew equally well in bovine and swine cells. This suggests that changes inFMDV genome sequence, in addition to 93-102 deletion in 3A, may also affectthe viral growth phenotype in bovine cellsduring infection and replication.However, it is nuclear that changes in which region (inside or outside of 3A region) influences FMDV growth phenotype in bovine cells.In this study, to determine the region in FMDV genomeaffecting viral growth phenotype in bovine cells, we constructed chimeric FMDVs, rvGZSB-HKN3A and rvHN-HKN3A, by introducing the 3A coding region of O/HKN/21/70 into the context of O/SEA/Mya-98 strain O/GZSB/2011 and O Cathay topotype strain O/HN/CHA/93, respectively, since O/GZSB/2011 containing full-length 3A protein replicated well in bovine and swine cells, and O/HN/CHA/93 harboring 93-102 deletion in 3A protein grew poorly in bovine cells.The chimeric virusesrvGZSB-HKN3A and rvHN-HKN3A displayed growth properties and plaque phenotypes similar to those of the parental virus rvGZSB and rv-HN in BHK-21 and primary fetal porcine kidney (FPK) cells. However, rvHN-HKN3A and rv-HN replicated poorly in primary fetal bovine kidney (FBK) cells with no visible plaques, and rvGZSB-HKN3A exhibited lower growth rate and smaller plaque size phenotypes than those of the parental virus in FBK cells, but similar growth properties and plaque phenotypes to those of the recombinant viruses harboring 93-102 deletion in 3A. These results demonstrate that the difference present in FMDV genome sequence outside the 3A coding region also have influence on FMDV replication ability in bovine cells. Copyright © 2016 Elsevier B.V. All rights reserved.
-
SieveSifter: a web-based tool for visualizing the sieve analyses of HIV-1 vaccine efficacy trials.
Fiore-Gartland, Andrew; Kullman, Nicholas; deCamp, Allan C; Clenaghan, Graham; Yang, Wayne; Magaret, Craig A; Edlefsen, Paul T; Gilbert, Peter B
2017-08-01
Analysis of HIV-1 virions from participants infected in a randomized controlled preventive HIV-1 vaccine efficacy trial can help elucidate mechanisms of partial protection. By comparing the genetic sequence of viruses from vaccine and placebo recipients to the sequence of the vaccine itself, a technique called 'sieve analysis', one can identify functional specificities of vaccine-induced immune responses. We have created an interactive web-based visualization and data access tool for exploring the results of sieve analyses performed on four major preventive HIV-1 vaccine efficacy trials: (i) the HIV Vaccine Trial Network (HVTN) 502/Step trial, (ii) the RV144/Thai trial, (iii) the HVTN 503/Phambili trial and (iv) the HVTN 505 trial. The tool acts simultaneously as a platform for rapid reinterpretation of sieve effects and as a portal for organizing and sharing the viral sequence data. Access to these valuable datasets also enables the development of novel methodology for future sieve analyses. Visualization: http://sieve.fredhutch.org/viz . Source code: https://github.com/nkullman/SIEVE . Data API: http://sieve.fredhutch.org/data . agartlan@fredhutch.org. © The Author(s) 2017. Published by Oxford University Press.
-
What can we learn about lyssavirus genomes using 454 sequencing?
Höper, Dirk; Finke, Stefan; Freuling, Conrad M; Hoffmann, Bernd; Beer, Martin
2012-01-01
The main task of the individual project number four"Whole genome sequencing, virus-host adaptation, and molecular epidemiological analyses of lyssaviruses "within the network" Lyssaviruses--a potential re-emerging public health threat" is to provide high quality complete genome sequences from lyssaviruses. These sequences are analysed in-depth with regard to the diversity of the viral populations as to both quasi-species and so-called defective interfering RNAs. Moreover, the sequence data will facilitate further epidemiological analyses, will provide insight into the evolution of lyssaviruses and will be the basis for the design of novel nucleic acid based diagnostics. The first results presented here indicate that not only high quality full-length lyssavirus genome sequences can be generated, but indeed efficient analysis of the viral population gets feasible.
-
Dahl, Viktor; Gisslen, Magnus; Hagberg, Lars; Peterson, Julia; Shao, Wei; Spudich, Serena; Price, Richard W.; Palmer, Sarah
2014-01-01
We sequenced the genome of human immunodeficiency virus type 1 (HIV-1) recovered from 70 cerebrospinal fluid (CSF) specimens and 29 plasma samples and corresponding samples obtained before treatment initiation from 17 subjects receiving suppressive therapy. More CSF sequences than plasma sequences were hypermutants. We determined CSF sequences and plasma sequences in specimens obtained from 2 subjects after treatment initiation. In one subject, we found genetically distinct CSF and plasma sequences, indicating that they came from HIV-1 from 2 different compartments, one potentially the central nervous system, during suppressive therapy. In addition, there was little evidence of viral evolution in the CSF during therapy, suggesting that continuous virus replication is not the major cause of viral persistence in the central nervous system. PMID:24338353
-
Dahl, Viktor; Gisslen, Magnus; Hagberg, Lars; Peterson, Julia; Shao, Wei; Spudich, Serena; Price, Richard W; Palmer, Sarah
2014-05-15
We sequenced the genome of human immunodeficiency virus type 1 (HIV-1) recovered from 70 cerebrospinal fluid (CSF) specimens and 29 plasma samples and corresponding samples obtained before treatment initiation from 17 subjects receiving suppressive therapy. More CSF sequences than plasma sequences were hypermutants. We determined CSF sequences and plasma sequences in specimens obtained from 2 subjects after treatment initiation. In one subject, we found genetically distinct CSF and plasma sequences, indicating that they came from HIV-1 from 2 different compartments, one potentially the central nervous system, during suppressive therapy. In addition, there was little evidence of viral evolution in the CSF during therapy, suggesting that continuous virus replication is not the major cause of viral persistence in the central nervous system.
-
Wang, Nidan; Li, Yijia; Han, Yang; Xie, Jing; Li, Taisheng
2017-06-01
The association between baseline human immunodeficiency virus (HIV) sequence diversity and HIV DNA decay after the initiation of antiretroviral therapy (ART) remains uncharacterized during the early stages of HIV infection. Samples were obtained from a cohort of 17 patients with early HIV infection (<6 months after infection) who initiated ART, and the C2V5 region of the HIV-1 envelope (env) gene was amplified via single genome amplification (SGA) to determine the peripheral plasma HIV quasispecies. We categorized HIV quasispecies into two groups according to baseline viral sequence genetic distance, which was determined by the Poisson-Fitter tool. Total HIV DNA in peripheral blood mononuclear cells (PBMCs), viral load, and T cell subsets were measured prior to and after the initiation of ART. The median SGA sequence number was 17 (range 6-28). At baseline, we identified 7 patients with homogeneous viral populations (designated the Homogeneous group) and 10 patients with heterogeneous viral populations (designated the Heterogeneous group) based on SGA sequences. Both groups exhibited similar HIV DNA decay rates during the first 6 months of ART (P > 0.99), but the Homogenous group experienced more prominent decay than the Heterogeneous group after 6 months (P = 0.037). The Heterogeneous group had higher CD4 cell counts after ART initiation; however, both groups had comparable recovery in terms of CD4/CD8 ratios and CD8 T cell activation levels. Viral population homogeneity upon the initiation of ART is associated with a decrease in HIV DNA levels during ART. J. Med. Virol. 89:982-988, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
-
Metzgar, David; Myers, Christopher A.; Russell, Kevin L.; Faix, Dennis; Blair, Patrick J.; Brown, Jason; Vo, Scott; Swayne, David E.; Thomas, Colleen; Stenger, David A.; Lin, Baochuan; Malanoski, Anthony P.; Wang, Zheng; Blaney, Kate M.; Long, Nina C.; Schnur, Joel M.; Saad, Magdi D.; Borsuk, Lisa A.; Lichanska, Agnieszka M.; Lorence, Matthew C.; Weslowski, Brian; Schafer, Klaus O.; Tibbetts, Clark
2010-01-01
For more than four decades the cause of most type A influenza virus infections of humans has been attributed to only two viral subtypes, A/H1N1 or A/H3N2. In contrast, avian and other vertebrate species are a reservoir of type A influenza virus genome diversity, hosting strains representing at least 120 of 144 combinations of 16 viral hemagglutinin and 9 viral neuraminidase subtypes. Viral genome segment reassortments and mutations emerging within this reservoir may spawn new influenza virus strains as imminent epidemic or pandemic threats to human health and poultry production. Traditional methods to detect and differentiate influenza virus subtypes are either time-consuming and labor-intensive (culture-based) or remarkably insensitive (antibody-based). Molecular diagnostic assays based upon reverse transcriptase-polymerase chain reaction (RT-PCR) have short assay cycle time, and high analytical sensitivity and specificity. However, none of these diagnostic tests determine viral gene nucleotide sequences to distinguish strains and variants of a detected pathogen from one specimen to the next. Decision-quality, strain- and variant-specific pathogen gene sequence information may be critical for public health, infection control, surveillance, epidemiology, or medical/veterinary treatment planning. The Resequencing Pathogen Microarray (RPM-Flu) is a robust, highly multiplexed and target gene sequencing-based alternative to both traditional culture- or biomarker-based diagnostic tests. RPM-Flu is a single, simultaneous differential diagnostic assay for all subtype combinations of type A influenza viruses and for 30 other viral and bacterial pathogens that may cause influenza-like illness. These other pathogen targets of RPM-Flu may co-infect and compound the morbidity and/or mortality of patients with influenza. The informative specificity of a single RPM-Flu test represents specimen-specific viral gene sequences as determinants of virus type, A/HN subtype, virulence, host-range, and resistance to antiviral agents. PMID:20140251
-
Metzgar, David; Myers, Christopher A; Russell, Kevin L; Faix, Dennis; Blair, Patrick J; Brown, Jason; Vo, Scott; Swayne, David E; Thomas, Colleen; Stenger, David A; Lin, Baochuan; Malanoski, Anthony P; Wang, Zheng; Blaney, Kate M; Long, Nina C; Schnur, Joel M; Saad, Magdi D; Borsuk, Lisa A; Lichanska, Agnieszka M; Lorence, Matthew C; Weslowski, Brian; Schafer, Klaus O; Tibbetts, Clark
2010-02-03
For more than four decades the cause of most type A influenza virus infections of humans has been attributed to only two viral subtypes, A/H1N1 or A/H3N2. In contrast, avian and other vertebrate species are a reservoir of type A influenza virus genome diversity, hosting strains representing at least 120 of 144 combinations of 16 viral hemagglutinin and 9 viral neuraminidase subtypes. Viral genome segment reassortments and mutations emerging within this reservoir may spawn new influenza virus strains as imminent epidemic or pandemic threats to human health and poultry production. Traditional methods to detect and differentiate influenza virus subtypes are either time-consuming and labor-intensive (culture-based) or remarkably insensitive (antibody-based). Molecular diagnostic assays based upon reverse transcriptase-polymerase chain reaction (RT-PCR) have short assay cycle time, and high analytical sensitivity and specificity. However, none of these diagnostic tests determine viral gene nucleotide sequences to distinguish strains and variants of a detected pathogen from one specimen to the next. Decision-quality, strain- and variant-specific pathogen gene sequence information may be critical for public health, infection control, surveillance, epidemiology, or medical/veterinary treatment planning. The Resequencing Pathogen Microarray (RPM-Flu) is a robust, highly multiplexed and target gene sequencing-based alternative to both traditional culture- or biomarker-based diagnostic tests. RPM-Flu is a single, simultaneous differential diagnostic assay for all subtype combinations of type A influenza viruses and for 30 other viral and bacterial pathogens that may cause influenza-like illness. These other pathogen targets of RPM-Flu may co-infect and compound the morbidity and/or mortality of patients with influenza. The informative specificity of a single RPM-Flu test represents specimen-specific viral gene sequences as determinants of virus type, A/HN subtype, virulence, host-range, and resistance to antiviral agents.
-
Stoppani, Elena; Bassi, Ivan; Dotti, Silvia; Lizier, Michela; Ferrari, Maura; Lucchini, Franco
2015-08-01
Influenza A virus is the principal agent responsible of the respiratory tract's infections in humans. Every year, highly pathogenic and infectious strains with new antigenic assets appear, making ineffective vaccines so far developed. The discovery of RNA interference (RNAi) opened the way to the progress of new promising drugs against Influenza A virus and also to the introduction of disease resistance traits in genetically modified animals. In this paper, we show that Madin-Darby Canine Kidney (MDCK) cell line expressing short hairpin RNAs (shRNAs) cassette, designed on a specific conserved region of the nucleoprotein (NP) viral genome, can strongly inhibit the viral replication of four viral strains sharing the target sequence, reducing the viral mRNA respectively to 2.5×10(-4), 7.5×10(-5), 1.7×10(-3), 1.9×10(-4) compared to the control, as assessed by real-time PCR. Moreover, we demonstrate that during the challenge with a viral strain bearing a single mismatch on the target sequence, although a weaker inhibition is observed, viral mRNA is still lowered down to 1.2×10(-3) folds in the shRNA-expressing clone compared to the control, indicating a broad potential use of this approach. In addition, we developed a highly predictive and fast screening test of siRNA sequences based on dual-luciferase assay, useful for the in vitro prediction of the potential effect of viral inhibition. In conclusion, these findings reveal new siRNA sequences able to inhibit Influenza A virus replication and provide a basis for the development of siRNAs as prophylaxis and therapy for influenza infection both in humans and animals. Copyright © 2015 Elsevier B.V. All rights reserved.
-
HIV-1 low copy viral sequencing-A prototype assay.
Mellberg, Tomas; Krabbe, Jon; Gisslén, Magnus; Svennerholm, Bo
2016-01-01
In HIV-1 patients with low viral burden, sequencing is often problematic, yet important. This study presents a sensitive, sub-type independent system for sequencing of low level viremia. Sequencing data from 32 HIV-1 infected patients with low level viremia were collected longitudinally. A combination of ViroSeq® HIV-1 Genotyping System and an in-house nesting protocol was used. Eight sub-types were represented. The success-rate of amplification of both PR and RT in the same sample was 100% in samples with viral loads above 100 copies/ml. Below 100 copies/ml, this study managed to amplify both regions in 7/13 (54%) samples. The assays were able to amplify either PR or RT in all sub-types included but one sub-type A specimen. In conclusion, this study presents a promising, simple assay to increase the ability to perform HIV-1 resistance testing at low level viremia. This is a prototype assay and the method needs further testing to evaluate clinical performance.
-
Hang, Jun; Vento, Todd J; Norby, Erica A; Jarman, Richard G; Keiser, Paul B; Kuschner, Robert A; Binn, Leonard N
2017-08-01
Human adenoviruses (HAdV), in particular types 4 and 7, frequently cause acute respiratory disease (ARD) during basic military training. HAdV4 and HAdV7 vaccines reduced the ARD risk in U.S. military. It is important to identify other respiratory pathogens and assess their potential impact on military readiness. In 2002, during a period when the HAdV vaccines were not available, throat swabs were taken from trainees (n = 184) with respiratory infections at Fort Jackson, South Carolina. Viral etiology was investigated initially with viral culture and neutralization assay and recently in this study by sequencing the viral isolates. Viral culture and neutralization assays identified 90 HAdV4 isolates and 27 additional cultures that showed viral cytopathic effects (CPE), including some with picornavirus-like CPE. Next-generation sequencing confirmed these results and determined viral genotypes, including 77 HAdV4, 4 HAdV3, 1 HAdV2, 17 coxsackievirus A21 (CAV21), and 1 enterovirus D68. Two samples were positive for both HAdV4 and CAV21. The identified genotypes are phylogenetically close to but distinct from those found during other years or in other military/non-military sites. HAdV4 is the predominant respiratory pathogen in unvaccinated military trainee. HAdV4 has temporal and demographic variability. CAV21 is a significant respiratory pathogen and needs to be evaluated for its current significance in military basic trainees. © 2017 Wiley Periodicals, Inc.
-
Diversity of DNA and RNA Viruses in Indoor Air As Assessed via Metagenomic Sequencing.
Rosario, Karyna; Fierer, Noah; Miller, Shelly; Luongo, Julia; Breitbart, Mya
2018-02-06
Diverse bacterial and fungal communities inhabit human-occupied buildings and circulate in indoor air; however, viral diversity in these man-made environments remains largely unknown. Here we investigated DNA and RNA viruses circulating in the air of 12 university dormitory rooms by analyzing dust accumulated over a one-year period on heating, ventilation, and air conditioning (HVAC) filters. A metagenomic sequencing approach was used to determine the identity and diversity of viral particles extracted from the HVAC filters. We detected a broad diversity of viruses associated with a range of hosts, including animals, arthropods, bacteria, fungi, humans, plants, and protists, suggesting that disparate organisms can contribute to indoor airborne viral communities. Viral community composition and the distribution of human-infecting papillomaviruses and polyomaviruses were distinct in the different dormitory rooms, indicating that airborne viral communities are variable in human-occupied spaces and appear to reflect differential rates of viral shedding from room occupants. This work significantly expands the known airborne viral diversity found indoors, enabling the design of sensitive and quantitative assays to further investigate specific viruses of interest and providing new insight into the likely sources of viruses found in indoor air.
-
Gu, Z; Gao, Q; Li, X; Parniak, M A; Wainberg, M A
1992-01-01
We have used the technique of in vitro selection to generate variants of human immunodeficiency virus type 1 (HIV-1) that are resistant to 2',3'-dideoxyinosine (ddI) and cross-resistant to 2',3'-dideoxycytidine (ddC). The complete reverse transcriptase (RT)-coding regions, plus portions of flanking sequences, of viruses possessing a ddI-resistant phenotype were cloned and sequenced by polymerase chain reaction (PCR)-based methods. We observed that several of these viruses possessed mutations at amino acid sites 184 (Met-->Val; ATG-->GTG) and 294 (Pro-->Ser; CCA-->TCA). These mutations were introduced in the pol gene of infectious, cloned HXB2-D DNA by site-directed mutagenesis. Viral replication assays confirmed the importance of site 184 with regard to resistance to ddI. The recombinant viruses thus generated displayed more than fivefold-greater resistance to ddI than parental HXB2-D did. Moreover, more than fivefold-greater resistance to ddC was also documented; however, the recombinant viruses continued to be inhibited by zidovudine (AZT). No resistance to ddI, ddC, or AZT was introduced by inclusion of mutation site 294 in the pol gene of HXB2-D. PCR analysis performed on viral samples obtained from patients receiving long-term ddI therapy confirmed the presence of mutation site 184 in five of seven cases tested. In three of these five positive cases, the wild-type codon was also detected, indicating that mixtures of viral quasispecies were apparently present. Viruses possessing a ddI resistance phenotype were isolated from both subjects whose viruses contained only the mutated rather than wild-type codon at position 184 as well as from a third individual, whose viruses appeared to be mostly of the mutated variety. Images PMID:1279198
-
Kim, John E; Beckthold, Brenda; Chen, Zhaoxia; Mihowich, Jennifer; Malloch, Laurie; Gill, Michael John
2007-11-01
The presence of HIV-1 non-B subtypes is increasing worldwide. This poses challenges to commercial diagnostic and viral load (RNA) monitoring tests that are predominantly based on HIV-1 subtype B strains. Based on phylogenetic analysis of the gag, pol, and env gene regions, we describe the first HIV-1 H/J recombinant in Canada that presented divergent viral load values. DNA sequence analysis of the gag gene region further revealed that genetic diversity between this H/J recombinant and the primers and probes used in the bio-Merieux Nuclisens HIV-1 QT (Nuclisens) and Roche Amplicor Monitor HIV-1, v1.5 (Monitor) viral RNA assays can erroneously lead to undetectable viral load values. This observation appears to be more problematic in the Nuclisens assay. In light of increasing genetic diversity in HIV worldwide we recommend that DNA sequencing of HIV, especially in the gag gene region targeted by primers and probes used in molecular diagnostic and viral load tests, be incorporated into clinical monitoring practices.
-
Phage and Nucleocytoplasmic Large Viral Sequences Dominate Coral Viromes from the Arabian Gulf.
Mahmoud, Huda; Jose, Liny
2017-01-01
Corals that naturally thrive under extreme conditions are gaining increasing attention due to their importance as living models to understand the impact of global warming on world corals. Here, we present the first metagenomic study of viral communities in corals thriving in a thermally variable water body in which the temperature fluctuates between 11 and 39°C in different seasons. The viral assemblages of two of the most abundant massive ( Porites harrisoni ) and branching ( Acropora downingi ) corals in offshore and inshore reef systems in the northern Arabian Gulf were investigated. Samples were collected from five reef systems during summer, autumn and winter of 2011/2012. The two coral viromes contain 12 viral families, including 10 dsDNA viral families [Siphoviridae, Podoviridae, Myoviridae, Phycodnaviridae, Baculoviridae, Herpesviridae, Adenoviridae, Alloherpesviridae, Mimiviridae and one unclassified family], one-ssDNA viral family (Microviridae) and one RNA viral family (Retroviridae). Overall, sequences significantly similar to Podoviridae were the most abundant in the P. harrisoni and A. downingi viromes. Various morphological types of virus-like particles (VLPs) were confirmed in the healthy coral tissue by transmission electron microscopy, including large tailless VLPs and electron-dense core VLPs. Tailed bacteriophages were isolated from coral tissue using a plaque assay. Higher functional gene diversity was recorded in A. downingi than in P. harrisoni , and comparative metagenomics revealed that the Gulf viral assemblages are functionally distinct from Pacific Ocean coral viral communities.
-
Efficient error correction for next-generation sequencing of viral amplicons
2012-01-01
Background Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. Results In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Conclusions Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses. The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm PMID:22759430
-
Efficient error correction for next-generation sequencing of viral amplicons.
Skums, Pavel; Dimitrova, Zoya; Campo, David S; Vaughan, Gilberto; Rossi, Livia; Forbi, Joseph C; Yokosawa, Jonny; Zelikovsky, Alex; Khudyakov, Yury
2012-06-25
Next-generation sequencing allows the analysis of an unprecedented number of viral sequence variants from infected patients, presenting a novel opportunity for understanding virus evolution, drug resistance and immune escape. However, sequencing in bulk is error prone. Thus, the generated data require error identification and correction. Most error-correction methods to date are not optimized for amplicon analysis and assume that the error rate is randomly distributed. Recent quality assessment of amplicon sequences obtained using 454-sequencing showed that the error rate is strongly linked to the presence and size of homopolymers, position in the sequence and length of the amplicon. All these parameters are strongly sequence specific and should be incorporated into the calibration of error-correction algorithms designed for amplicon sequencing. In this paper, we present two new efficient error correction algorithms optimized for viral amplicons: (i) k-mer-based error correction (KEC) and (ii) empirical frequency threshold (ET). Both were compared to a previously published clustering algorithm (SHORAH), in order to evaluate their relative performance on 24 experimental datasets obtained by 454-sequencing of amplicons with known sequences. All three algorithms show similar accuracy in finding true haplotypes. However, KEC and ET were significantly more efficient than SHORAH in removing false haplotypes and estimating the frequency of true ones. Both algorithms, KEC and ET, are highly suitable for rapid recovery of error-free haplotypes obtained by 454-sequencing of amplicons from heterogeneous viruses.The implementations of the algorithms and data sets used for their testing are available at: http://alan.cs.gsu.edu/NGS/?q=content/pyrosequencing-error-correction-algorithm.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roux, Simon; Emerson, Joanne B.; Eloe-Fadrosh, Emiley A.
BackgroundViral metagenomics (viromics) is increasingly used to obtain uncultivated viral genomes, evaluate community diversity, and assess ecological hypotheses. While viromic experimental methods are relatively mature and widely accepted by the research community, robust bioinformatics standards remain to be established. Here we usedin silicomock viral communities to evaluate the viromic sequence-to-ecological-inference pipeline, including (i) read pre-processing and metagenome assembly, (ii) thresholds applied to estimate viral relative abundances based on read mapping to assembled contigs, and (iii) normalization methods applied to the matrix of viral relative abundances for alpha and beta diversity estimates. ResultsTools specifically designed for metagenomes, specifically metaSPAdes, MEGAHIT, andmore » IDBA-UD, were the most effective at assembling viromes. Read pre-processing, such as partitioning, had virtually no impact on assembly output, but may be useful when hardware is limited. Viral populations with 2–5 × coverage typically assembled well, whereas lesser coverage led to fragmented assembly. Strain heterogeneity within populations hampered assembly, especially when strains were closely related (average nucleotide identity, or ANI ≥97%) and when the most abundant strain represented <50% of the population. Viral community composition assessments based on read recruitment were generally accurate when the following thresholds for detection were applied: (i) ≥10 kb contig lengths to define populations, (ii) coverage defined from reads mapping at ≥90% identity, and (iii) ≥75% of contig length with ≥1 × coverage. Finally, although data are limited to the most abundant viruses in a community, alpha and beta diversity patterns were robustly estimated (±10%) when comparing samples of similar sequencing depth, but more divergent (up to 80%) when sequencing depth was uneven across the dataset. In the latter cases, the use of normalization methods specifically developed for metagenomes provided the best estimates. ConclusionsThese simulations provide benchmarks for selecting analysis cut-offs and establish that an optimized sample-to-ecological-inference viromics pipeline is robust for making ecological inferences from natural viral communities. Continued development to better accessing RNA, rare, and/or diverse viral populations and improved reference viral genome availability will alleviate many of viromics remaining limitations.« less
-
Roux, Simon; Emerson, Joanne B.; Eloe-Fadrosh, Emiley A.; ...
2017-09-21
BackgroundViral metagenomics (viromics) is increasingly used to obtain uncultivated viral genomes, evaluate community diversity, and assess ecological hypotheses. While viromic experimental methods are relatively mature and widely accepted by the research community, robust bioinformatics standards remain to be established. Here we usedin silicomock viral communities to evaluate the viromic sequence-to-ecological-inference pipeline, including (i) read pre-processing and metagenome assembly, (ii) thresholds applied to estimate viral relative abundances based on read mapping to assembled contigs, and (iii) normalization methods applied to the matrix of viral relative abundances for alpha and beta diversity estimates. ResultsTools specifically designed for metagenomes, specifically metaSPAdes, MEGAHIT, andmore » IDBA-UD, were the most effective at assembling viromes. Read pre-processing, such as partitioning, had virtually no impact on assembly output, but may be useful when hardware is limited. Viral populations with 2–5 × coverage typically assembled well, whereas lesser coverage led to fragmented assembly. Strain heterogeneity within populations hampered assembly, especially when strains were closely related (average nucleotide identity, or ANI ≥97%) and when the most abundant strain represented <50% of the population. Viral community composition assessments based on read recruitment were generally accurate when the following thresholds for detection were applied: (i) ≥10 kb contig lengths to define populations, (ii) coverage defined from reads mapping at ≥90% identity, and (iii) ≥75% of contig length with ≥1 × coverage. Finally, although data are limited to the most abundant viruses in a community, alpha and beta diversity patterns were robustly estimated (±10%) when comparing samples of similar sequencing depth, but more divergent (up to 80%) when sequencing depth was uneven across the dataset. In the latter cases, the use of normalization methods specifically developed for metagenomes provided the best estimates. ConclusionsThese simulations provide benchmarks for selecting analysis cut-offs and establish that an optimized sample-to-ecological-inference viromics pipeline is robust for making ecological inferences from natural viral communities. Continued development to better accessing RNA, rare, and/or diverse viral populations and improved reference viral genome availability will alleviate many of viromics remaining limitations.« less
-
Classification of viral zoonosis through receptor pattern analysis.
Bae, Se-Eun; Son, Hyeon Seok
2011-04-13
Viral zoonosis, the transmission of a virus from its primary vertebrate reservoir species to humans, requires ubiquitous cellular proteins known as receptor proteins. Zoonosis can occur not only through direct transmission from vertebrates to humans, but also through intermediate reservoirs or other environmental factors. Viruses can be categorized according to genotype (ssDNA, dsDNA, ssRNA and dsRNA viruses). Among them, the RNA viruses exhibit particularly high mutation rates and are especially problematic for this reason. Most zoonotic viruses are RNA viruses that change their envelope proteins to facilitate binding to various receptors of host species. In this study, we sought to predict zoonotic propensity through the analysis of receptor characteristics. We hypothesized that the major barrier to interspecies virus transmission is that receptor sequences vary among species--in other words, that the specific amino acid sequence of the receptor determines the ability of the viral envelope protein to attach to the cell. We analysed host-cell receptor sequences for their hydrophobicity/hydrophilicity characteristics. We then analysed these properties for similarities among receptors of different species and used a statistical discriminant analysis to predict the likelihood of transmission among species. This study is an attempt to predict zoonosis through simple computational analysis of receptor sequence differences. Our method may be useful in predicting the zoonotic potential of newly discovered viral strains.
-
Hoffman, Brett; Li, Zhubing; Liu, Qiang
2015-08-01
Hepatitis C virus (HCV) non-structural protein 5A (NS5A) is essential for viral replication; however, its effect on HCV RNA translation remains controversial partially due to the use of reporters lacking the 3' UTR, where NS5A binds to the poly(U/UC) sequence. We investigated the role of NS5A in HCV translation using a monocistronic RNA containing a Renilla luciferase gene flanked by the HCV UTRs. We found that NS5A downregulated viral RNA translation in a dose-dependent manner. This downregulation required both the 5' and 3' UTRs of HCV because substitution of either sequence with the 5' and 3' UTRs of enterovirus 71 or a cap structure at the 5' end eliminated the effects of NS5A on translation. Translation of the HCV genomic RNA was also downregulated by NS5A. The inhibition of HCV translation by NS5A required the poly(U/UC) sequence in the 3' UTR as NS5A did not affect translation when it was deleted. In addition, we showed that, whilst the amphipathic α-helix of NS5A has no effect on viral translation, the three domains of NS5A can inhibit translation independently, also dependent on the presence of the poly(U/UC) sequence in the 3' UTR. These results suggested that NS5A downregulated HCV RNA translation through a mechanism involving the poly(U/UC) sequence in the 3' UTR.
-
Xia, Xia-Yu; Ge, Meng; Hsi, Jenny H; He, Xiang; Ruan, Yu-Hua; Wang, Zhi-Xin; Shao, Yi-Ming; Pan, Xian-Ming
2014-01-01
Accurate estimates of HIV-1 incidence are essential for monitoring epidemic trends and evaluating intervention efforts. However, the long asymptomatic stage of HIV-1 infection makes it difficult to effectively distinguish incident infections from chronic ones. Current incidence assays based on serology or viral sequence diversity are both still lacking in accuracy. In the present work, a sequence clustering based diversity (SCBD) assay was devised by utilizing the fact that viral sequences derived from each transmitted/founder (T/F) strain tend to cluster together at early stage, and that only the intra-cluster diversity is correlated with the time since HIV-1 infection. The dot-matrix pairwise alignment was used to eliminate the disproportional impact of insertion/deletions (indels) and recombination events, and so was the proportion of clusterable sequences (Pc) as an index to identify late chronic infections with declined viral genetic diversity. Tested on a dataset containing 398 incident and 163 chronic infection cases collected from the Los Alamos HIV database (last modified 2/8/2012), our SCBD method achieved 99.5% sensitivity and 98.8% specificity, with an overall accuracy of 99.3%. Further analysis and evaluation also suggested its performance was not affected by host factors such as the viral subtypes and transmission routes. The SCBD method demonstrated the potential of sequencing based techniques to become useful for identifying incident infections. Its use may be most advantageous for settings with low to moderate incidence relative to available resources. The online service is available at http://www.bioinfo.tsinghua.edu.cn:8080/SCBD/index.jsp.
-
Chauhan, Sushma; Rahman, Hifzur; Mastan, Shaik G; Pamidimarri, D V N Sudheer; Reddy, Muppala P
2018-07-20
Begomoviruses belong to the family Geminiviridae are associated with several disease symptoms, such as mosaic and leaf curling in Jatropha curcas. The molecular characterization of these viral strains will help in developing management strategies to control the disease. In this study, J. curcas that was infected with begomovirus and showed acute leaf curling symptoms were identified. DNA-A segment from pathogenic viral strain was isolated and sequenced. The sequenced genome was assembled and characterized in detail. The full-length DNA-A sequence was covered by primer walking. The genome sequence showed the general organization of DNA-A from begomovirus by the distribution of ORFs in both viral and anti-viral strands. The genome size ranged from 2844 bp-2852 bp. Three strains with minor nucleotide variations were identified, and a phylogenetic analysis was performed by comparing the DNA-A segments from other reported begomovirus isolates. The maximum sequence similarity was observed with Euphorbia yellow mosaic virus (FN435995). In the phylogenetic tree, no clustering was observed with previously reported begomovirus strains isolated from J. curcas host. The strains isolated in this study belong to new begomoviral strain that elicits symptoms of leaf curling in J. curcas. The results indicate that the probable origin of the strains is from Jatropha mosaic virus infecting J. gassypifolia. The strains isolated in this study are referred as Jatropha curcas leaf curl India virus (JCLCIV) based on the major symptoms exhibited by host J. curcas. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes
NASA Astrophysics Data System (ADS)
Farzan Sabahi, Mohammad; Dehghanfard, Ali
2014-12-01
The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.
-
Seligmann, Hervé
2013-03-01
Usual DNA→RNA transcription exchanges T→U. Assuming different systematic symmetric nucleotide exchanges during translation, some GenBank RNAs match exactly human mitochondrial sequences (exchange rules listed in decreasing transcript frequencies): C↔U, A↔U, A↔U+C↔G (two nucleotide pairs exchanged), G↔U, A↔G, C↔G, none for A↔C, A↔G+C↔U, and A↔C+G↔U. Most unusual transcripts involve exchanging uracil. Independent measures of rates of rare replicational enzymatic DNA nucleotide misinsertions predict frequencies of RNA transcripts systematically exchanging the corresponding misinserted nucleotides. Exchange transcripts self-hybridize less than other gene regions, self-hybridization increases with length, suggesting endoribonuclease-limited elongation. Blast detects stop codon depleted putative protein coding overlapping genes within exchange-transcribed mitochondrial genes. These align with existing GenBank proteins (mainly metazoan origins, prokaryotic and viral origins underrepresented). These GenBank proteins frequently interact with RNA/DNA, are membrane transporters, or are typical of mitochondrial metabolism. Nucleotide exchange transcript frequencies increase with overlapping gene densities and stop densities, indicating finely tuned counterbalancing regulation of expression of systematic symmetric nucleotide exchange-encrypted proteins. Such expression necessitates combined activities of suppressor tRNAs matching stops, and nucleotide exchange transcription. Two independent properties confirm predicted exchanged overlap coding genes: discrepancy of third codon nucleotide contents from replicational deamination gradients, and codon usage according to circular code predictions. Predictions from both properties converge, especially for frequent nucleotide exchange types. Nucleotide exchanging transcription apparently increases coding densities of protein coding genes without lengthening genomes, revealing unsuspected functional DNA coding potential. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
-
Previsani, N; Fontana, S; Hirt, B; Beard, P
1997-10-01
Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Qingzhan; Shi, Kaichuang; Yoo, Dongwan, E-mail: dyoo@illinois.edu
Type I interferons (IFN-α/β) are the major components of the innate immune response of hosts, and in turn many viruses have evolved to modulate the host response during infection. We found that the IFN-β production was significantly suppressed during PEDV infection in cells. To identify viral IFN antagonists and to study their suppressive function, viral coding sequences for the entire structural and nonstructural proteins were cloned and expressed. Of 16 PEDV nonstructural proteins (nsps), nsp1, nsp3, nsp7, nsp14, nsp15 and nsp16 were found to inhibit the IFN-β and IRF3 promoter activities. The sole accessory protein ORF3, structure protein envelope (E),more » membrane (M), and nucleocapsid (N) protein were also shown to inhibit such activities. PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP) by degrading CBP. A further study showed that the CBP degradation by nsp1 was proteasome-dependent. Our data demonstrate that PEDV modulates the host innate immune responses by degrading CBP and suppressing ISGs expression. - Highlights: • PEDV modulates the host innate immune system by suppressing the type I interferon production and ISGs expression. • Ten viral proteins were identified as IFN antagonists, and nsp1 was the most potent viral IFN antagonist. • PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP). • PEDV nsp1 caused the CBP degradation in the nucleus, which may be the key mechanism for PEDV-mediated IFN downregulation.« less
-
Cloned Viral Protein Vaccine for Foot-and-Mouth Disease: Responses in Cattle and Swine
NASA Astrophysics Data System (ADS)
Kleid, Dennis G.; Yansura, Daniel; Small, Barbara; Dowbenko, Donald; Moore, Douglas M.; Grubman, Marvin J.; McKercher, Peter D.; Morgan, Donald O.; Robertson, Betty H.; Bachrach, Howard L.
1981-12-01
A DNA sequence coding for the immunogenic capsid protein VP3 of foot-and-mouth disease virus A12, prepared from the virion RNA, was ligated to a plasmid designed to express a chimeric protein from the Escherichia coli tryptophan promoter-operator system. When Escherichia coli transformed with this plasmid was grown in tryptophan-depleted media, approximately 17 percent of the total cellular protein was found to be an insoluble and stable chimeric protein. The purified chimeric protein competed equally on a molar basis with VP3 for specific antibodies to foot-and-mouth disease virus. When inoculated into six cattle and two swine, this protein elicited high levels of neutralizing antibody and protection against challenge with foot-and-mouth disease virus.
-
Influenza A virus hemagglutinin glycosylation compensates for antibody escape fitness costs.
Kosik, Ivan; Ince, William L; Gentles, Lauren E; Oler, Andrew J; Kosikova, Martina; Angel, Matthew; Magadán, Javier G; Xie, Hang; Brooke, Christopher B; Yewdell, Jonathan W
2018-01-01
Rapid antigenic evolution enables the persistence of seasonal influenza A and B viruses in human populations despite widespread herd immunity. Understanding viral mechanisms that enable antigenic evolution is critical for designing durable vaccines and therapeutics. Here, we utilize the primerID method of error-correcting viral population sequencing to reveal an unexpected role for hemagglutinin (HA) glycosylation in compensating for fitness defects resulting from escape from anti-HA neutralizing antibodies. Antibody-free propagation following antigenic escape rapidly selected viruses with mutations that modulated receptor binding avidity through the addition of N-linked glycans to the HA globular domain. These findings expand our understanding of the viral mechanisms that maintain fitness during antigenic evolution to include glycan addition, and highlight the immense power of high-definition virus population sequencing to reveal novel viral adaptive mechanisms.
-
Finding and identifying the viral needle in the metagenomic haystack: trends and challenges
Soueidan, Hayssam; Schmitt, Louise-Amélie; Candresse, Thierry; Nikolski, Macha
2015-01-01
Collectively, viruses have the greatest genetic diversity on Earth, occupy extremely varied niches and are likely able to infect all living organisms. Viral infections are an important issue for human health and cause considerable economic losses when agriculturally important crops or husbandry animals are infected. The advent of metagenomics has provided a precious tool to study viruses by sampling them in natural environments and identifying the genomic composition of a sample. However, reaching a clear recognition and taxonomic assignment of the identified viruses has been hampered by the computational difficulty of these problems. In this perspective paper we examine the trends in current research for the identification of viral sequences in a metagenomic sample, pinpoint the intrinsic computational difficulties for the identification of novel viral sequences within metagenomic samples, and suggest possible avenues to overcome them. PMID:25610431
-
Shedding new light on viral photosynthesis.
Puxty, Richard J; Millard, Andrew D; Evans, David J; Scanlan, David J
2015-10-01
Viruses infecting the environmentally important marine cyanobacteria Prochlorococcus and Synechococcus encode 'auxiliary metabolic genes' (AMGs) involved in the light and dark reactions of photosynthesis. Here, we discuss progress on the inventory of such AMGs in the ever-increasing number of viral genome sequences as well as in metagenomic datasets. We contextualise these gene acquisitions with reference to a hypothesised fitness gain to the phage. We also report new evidence with regard to the sequence and predicted structural properties of viral petE genes encoding the soluble electron carrier plastocyanin. Viral copies of PetE exhibit extensive modifications to the N-terminal signal peptide and possess several novel residues in a region responsible for interaction with redox partners. We also highlight potential knowledge gaps in this field and discuss future opportunities to discover novel phage-host interactions involved in the photosynthetic process.
-
Can the HIV-1 splicing machinery be targeted for drug discovery?
Dlamini, Zodwa; Hull, Rodney
2017-01-01
HIV-1 is able to express multiple protein types and isoforms from a single 9 kb mRNA transcript. These proteins are also expressed at particular stages of viral development, and this is achieved through the control of alternative splicing and the export of these transcripts from the nucleus. The nuclear export is controlled by the HIV protein Rev being required to transport incompletely spliced and partially spliced mRNA from the nucleus where they are normally retained. This implies a close relationship between the control of alternate splicing and the nuclear export of mRNA in the control of HIV-1 viral proliferation. This review discusses both the processes. The specificity and regulation of splicing in HIV-1 is controlled by the use of specific splice sites as well as exonic splicing enhancer and exonic splicing silencer sequences. The use of these silencer and enhancer sequences is dependent on the serine arginine family of proteins as well as the heterogeneous nuclear ribonucleoprotein family of proteins that bind to these sequences and increase or decrease splicing. Since alternative splicing is such a critical factor in viral development, it presents itself as a promising drug target. This review aims to discuss the inhibition of splicing, which would stall viral development, as an anti-HIV therapeutic strategy. In this review, the most recent knowledge of splicing in human immunodeficiency viral development and the latest therapeutic strategies targeting human immunodeficiency viral splicing are discussed. PMID:28331370
-
Substitution rate and natural selection in parvovirus B19
Stamenković, Gorana G.; Ćirković, Valentina S.; Šiljić, Marina M.; Blagojević, Jelena V.; Knežević, Aleksandra M.; Joksić, Ivana D.; Stanojević, Maja P.
2016-01-01
The aim of this study was to estimate substitution rate and imprints of natural selection on parvovirus B19 genotype 1. Studied datasets included 137 near complete coding B19 genomes (positions 665 to 4851) for phylogenetic and substitution rate analysis and 146 and 214 partial genomes for selection analyses in open reading frames ORF1 and ORF2, respectively, collected 1973–2012 and including 9 newly sequenced isolates from Serbia. Phylogenetic clustering assigned majority of studied isolates to G1A. Nucleotide substitution rate for total coding DNA was 1.03 (0.6–1.27) x 10−4 substitutions/site/year, with higher values for analyzed genome partitions. In spite of the highest evolutionary rate, VP2 codons were found to be under purifying selection with rare episodic positive selection, whereas codons under diversifying selection were found in the unique part of VP1, known to contain B19 immune epitopes important in persistent infection. Analyses of overlapping gene regions identified nucleotide positions under opposite selective pressure in different ORFs, suggesting complex evolutionary mechanisms of nucleotide changes in B19 viral genomes. PMID:27775080
-
Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio
2015-01-01
Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310
-
A robust and cost-effective approach to sequence and analyze complete genomes of small RNA viruses
USDA-ARS?s Scientific Manuscript database
Background: Next-generation sequencing (NGS) allows ultra-deep sequencing of nucleic acids. The use of sequence-independent amplification of viral nucleic acids without utilization of target-specific primers provides advantages over traditional sequencing methods and allows detection of unsuspected ...
-
Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N
2012-01-01
Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.
-
Informational structure of genetic sequences and nature of gene splicing
NASA Astrophysics Data System (ADS)
Trifonov, E. N.
1991-10-01
Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.
-
New parvovirus in child with unexplained diarrhea, Tunisia.
Phan, Tung G; Sdiri-Loulizi, Khira; Aouni, Mahjoub; Ambert-Balay, Katia; Pothier, Pierre; Deng, Xutao; Delwart, Eric
2014-11-01
A divergent parvovirus genome was the only eukaryotic viral sequence detected in feces of a Tunisian child with unexplained diarrhea. Tusavirus 1 shared 44% and 39% identity with the nonstructural protein 1 and viral protein 1, respectively, of the closest genome, Kilham rat parvovirus, indicating presence of a new human viral species in the Protoparvovirus genus.
-
New Parvovirus in Child with Unexplained Diarrhea, Tunisia
Phan, Tung G.; Sdiri-Loulizi, Khira; Aouni, Mahjoub; Ambert-Balay, Katia; Pothier, Pierre; Deng, Xutao
2014-01-01
A divergent parvovirus genome was the only eukaryotic viral sequence detected in feces of a Tunisian child with unexplained diarrhea. Tusavirus 1 shared 44% and 39% identity with the nonstructural protein 1 and viral protein 1, respectively, of the closest genome, Kilham rat parvovirus, indicating presence of a new human viral species in the Protoparvovirus genus. PMID:25340816
-
Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.
Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J
2012-05-24
The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.
-
NASA Astrophysics Data System (ADS)
Emerson, J. B.; Brum, J. R.; Roux, S.; Bolduc, B.; Woodcroft, B. J.; Singleton, C. M.; Boyd, J. A.; Hodgkins, S. B.; Wilson, R.; Trubl, G. G.; Jang, H. B.; Crill, P. M.; Chanton, J.; Saleska, S. R.; Rich, V. I.; Tyson, G. W.; Sullivan, M. B.
2016-12-01
Methane and carbon dioxide emissions, which are under significant microbial control, provide positive feedbacks to climate change in thawing permafrost peatlands. Although viruses in marine systems have been shown to impact microbial ecology and biogeochemical cycling through host cell lysis, horizontal gene transfer, and auxiliary metabolic gene expression, viral ecology in permafrost and other soils remains virtually unstudied due to methodological challenges. Here, we identified viral sequences in 208 assembled bulk soil metagenomes derived from a permafrost thaw gradient in Stordalen Mire, northern Sweden, from 2010-2012. 2,048 viral populations were recovered, which genome- and network-based classification revealed to be largely novel, increasing known viral genera globally by 40%. Ecologically, viral communities differed significantly across the thaw gradient and by soil depth. Co-occurring microbial community composition, soil moisture, and pH were predictors of viral community composition, indicative of biological and biogeochemical feedbacks as permafrost thaws. Host prediction—achieved through clustered regularly interspaced short palindromic repeats (CRISPRs), tetranucleotide frequency patterns, and other sequence similarities to binned microbial population genomes—was able to link 38% of the viral populations to a microbial host. 5% of the implicated hosts were archaea, predominantly methanogens and ammonia-oxidizing Nitrososphaera, 45% were Acidobacteria or Verrucomicrobia (mostly predicted heterotrophic complex carbon degraders), and 21% were Proteobacteria, including methane oxidizers. Recovered viral genome fragments also contained auxiliary metabolic genes involved in carbon and nitrogen cycling. Together, these data reveal multiple levels of previously unknown viral contributions to biogeochemical cycling, including to carbon gas emissions, in peatland soils undergoing and contributing to climate change. This work represents a significant step towards understanding viral roles in microbially-mediated biogeochemical cycling in soil.
-
Yoshida, Mitsuhiro; Mochizuki, Tomohiro; Urayama, Syun-Ichi; Yoshida-Takashima, Yukari; Nishi, Shinro; Hirai, Miho; Nomaki, Hidetaka; Takaki, Yoshihiro; Nunoura, Takuro; Takai, Ken
2018-01-01
Previous studies on marine environmental virology have primarily focused on double-stranded DNA (dsDNA) viruses; however, it has recently been suggested that single-stranded DNA (ssDNA) viruses are more abundant in marine ecosystems. In this study, we performed a quantitative viral community DNA analysis to estimate the relative abundance and composition of both ssDNA and dsDNA viruses in offshore upper bathyal sediment from Tohoku, Japan (water depth = 500 m). The estimated dsDNA viral abundance ranged from 3 × 106 to 5 × 106 genome copies per cm3 sediment, showing values similar to the range of fluorescence-based direct virus counts. In contrast, the estimated ssDNA viral abundance ranged from 1 × 108 to 3 × 109 genome copies per cm3 sediment, thus providing an estimation that the ssDNA viral populations represent 96.3–99.8% of the benthic total DNA viral assemblages. In the ssDNA viral metagenome, most of the identified viral sequences were associated with ssDNA viral families such as Circoviridae and Microviridae. The principle components analysis of the ssDNA viral sequence components from the sedimentary ssDNA viral metagenomic libraries found that the different depth viral communities at the study site all exhibited similar profiles compared with deep-sea sediment ones at other reference sites. Our results suggested that deep-sea benthic ssDNA viruses have been significantly underestimated by conventional direct virus counts and that their contributions to deep-sea benthic microbial mortality and geochemical cycles should be further addressed by such a new quantitative approach. PMID:29467725
-
Dal Bosco, Daniela; Sinski, Iraci; Ritschel, Patrícia S; Camargo, Umberto A; Fajardo, Thor V M; Harakava, Ricardo; Quecini, Vera
2018-06-06
Increased tolerance to pathogens is an important goal in conventional and biotechnology-assisted grapevine breeding programs worldwide. Fungal and viral pathogens cause direct losses in berry production, but also affect the quality of the final products. Precision breeding strategies allow the introduction of resistance characters in elite cultivars, although the factors determining the plant's overall performance are not fully characterized. Grapevine plants expressing defense proteins, from fungal or plant origins, or of the coat protein gene of grapevine leafroll-associated virus 3 (GLRaV-3) were generated by Agrobacterium-mediated transformation of somatic embryos and shoot apical meristems. The responses of the transformed lines to pathogen challenges were investigated by biochemical, phytopathological and molecular methods. The expression of a Metarhizium anisopliae chitinase gene delayed pathogenesis and disease progression against the necrotrophic pathogen Botrytis cinerea. Modified lines expressing a Solanum nigrum osmotin-like protein also exhibited slower disease progression, but to a smaller extent. Grapevine lines carrying two hairpin-inducing constructs had lower GLRaV-3 titers when challenged by grafting, although disease symptoms and viral multiplication were detected. The levels of global genome methylation were determined for the genetically engineered lines, and correlation analyses demonstrated the association between higher levels of methylated DNA and larger portions of virus-derived sequences. Resistance expression was also negatively correlated with the contents of introduced viral sequences and genome methylation, indicating that the effectiveness of resistance strategies employing sequences of viral origin is subject to epigenetic regulation in grapevine.
-
Metagenomics of rumen bacteriophage from thirteen lactating dairy cattle
2013-01-01
Background The bovine rumen hosts a diverse and complex community of Eukarya, Bacteria, Archea and viruses (including bacteriophage). The rumen viral population (the rumen virome) has received little attention compared to the rumen microbial population (the rumen microbiome). We used massively parallel sequencing of virus like particles to investigate the diversity of the rumen virome in thirteen lactating Australian Holstein dairy cattle all housed in the same location, 12 of which were sampled on the same day. Results Fourteen putative viral sequence fragments over 30 Kbp in length were assembled and annotated. Many of the putative genes in the assembled contigs showed no homology to previously annotated genes, highlighting the large amount of work still required to fully annotate the functions encoded in viral genomes. The abundance of the contig sequences varied widely between animals, even though the cattle were of the same age, stage of lactation and fed the same diets. Additionally the twelve animals which were co-habited shared a number of their dominant viral contigs. We compared the functional characteristics of our bovine viromes with that of other viromes, as well as rumen microbiomes. At the functional level, we found strong similarities between all of the viral samples, which were highly distinct from the rumen microbiome samples. Conclusions Our findings suggest a large amount of between animal variation in the bovine rumen virome and that co-habiting animals may have more similar viromes than non co-habited animals. We report the deepest sequencing to date of the rumen virome. This work highlights the enormous amount of novelty and variation present in the rumen virome. PMID:24180266
-
NASA Astrophysics Data System (ADS)
Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.
2018-01-01
The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/
-
Sequence features of viral and human Internal Ribosome Entry Sites predictive of their activity
Elias-Kirma, Shani; Nir, Ronit; Segal, Eran
2017-01-01
Translation of mRNAs through Internal Ribosome Entry Sites (IRESs) has emerged as a prominent mechanism of cellular and viral initiation. It supports cap-independent translation of select cellular genes under normal conditions, and in conditions when cap-dependent translation is inhibited. IRES structure and sequence are believed to be involved in this process. However due to the small number of IRESs known, there have been no systematic investigations of the determinants of IRES activity. With the recent discovery of thousands of novel IRESs in human and viruses, the next challenge is to decipher the sequence determinants of IRES activity. We present the first in-depth computational analysis of a large body of IRESs, exploring RNA sequence features predictive of IRES activity. We identified predictive k-mer features resembling IRES trans-acting factor (ITAF) binding motifs across human and viral IRESs, and found that their effect on expression depends on their sequence, number and position. Our results also suggest that the architecture of retroviral IRESs differs from that of other viruses, presumably due to their exposure to the nuclear environment. Finally, we measured IRES activity of synthetically designed sequences to confirm our prediction of increasing activity as a function of the number of short IRES elements. PMID:28922394
-
Kravatsky, Yuri; Chechetkin, Vladimir; Fedoseeva, Daria; Gorbacheva, Maria; Kravatskaya, Galina; Kretova, Olga; Tchurikov, Nickolai
2017-11-23
The efficient development of antiviral drugs, including efficient antiviral small interfering RNAs (siRNAs), requires continuous monitoring of the strict correspondence between a drug and the related highly variable viral DNA/RNA target(s). Deep sequencing is able to provide an assessment of both the general target conservation and the frequency of particular mutations in the different target sites. The aim of this study was to develop a reliable bioinformatic pipeline for the analysis of millions of short, deep sequencing reads corresponding to selected highly variable viral sequences that are drug target(s). The suggested bioinformatic pipeline combines the available programs and the ad hoc scripts based on an original algorithm of the search for the conserved targets in the deep sequencing data. We also present the statistical criteria for the threshold of reliable mutation detection and for the assessment of variations between corresponding data sets. These criteria are robust against the possible sequencing errors in the reads. As an example, the bioinformatic pipeline is applied to the study of the conservation of RNA interference (RNAi) targets in human immunodeficiency virus 1 (HIV-1) subtype A. The developed pipeline is freely available to download at the website http://virmut.eimb.ru/. Brief comments and comparisons between VirMut and other pipelines are also presented.
-
Oka, Tomoichiro; Doan, Yen Hai; Shimoike, Takashi; Haga, Kei; Takizawa, Takenori
2017-12-01
Sapoviruses (SaVs) are enteric viruses and have been detected in various mammals. They are divided into multiple genogroups and genotypes based on the entire major capsid protein (VP1) encoding region sequences. In this study, we determined the first complete genome sequences of two genogroup V, genotype 3 (GV.3) SaV strains detected from swine fecal samples, in combination with Illumina MiSeq sequencing of the libraries prepared from viral RNA and PCR products. The lengths of the viral genome (7494 nucleotides [nt] excluding polyA tail) and short 5'-untranslated region (14 nt) as well as two predicted open reading frames are similar to those of other SaVs. The amino acid differences between the two porcine SaVs are most frequent in the central region of the VP1-encoding region. A stem-loop structure which was predicted in the first 41 nt of the 5'-terminal region of GV.3 SaVs and the other available complete genome sequences of SaVs may have a critical role in viral genome replication. Our study provides complete genome sequences of rarely reported GV.3 SaV strains and highlights the common 5'-terminal genomic feature of SaVs detected from different mammalian species.
-
Ndunguru, Joseph; Taylor, Nigel J; Yadav, Jitender; Aly, Haytham; Legg, James P; Aveling, Terry; Thompson, Graham; Fauquet, Claude M
2005-05-18
Plant viral diseases present major constraints to crop production. Effective sampling of the viruses infecting plants is required to facilitate their molecular study and is essential for the development of crop protection and improvement programs. Retaining integrity of viral pathogens within sampled plant tissues is often a limiting factor in this process, most especially when sample sizes are large and when operating in developing counties and regions remote from laboratory facilities. FTA is a paper-based system designed to fix and store nucleic acids directly from fresh tissues pressed into the treated paper. We report here the use of FTA as an effective technology for sampling and retrieval of DNA and RNA viruses from plant tissues and their subsequent molecular analysis. DNA and RNA viruses were successfully recovered from leaf tissues of maize, cassava, tomato and tobacco pressed into FTA Classic Cards. Viral nucleic acids eluted from FTA cards were found to be suitable for diagnostic molecular analysis by PCR-based techniques and restriction analysis, and for cloning and nucleotide sequencing in a manner equivalent to that offered by tradition isolation methods. Efficacy of the technology was demonstrated both from sampled greenhouse-grown plants and from leaf presses taken from crop plants growing in farmer's fields in East Africa. In addition, FTA technology was shown to be suitable for recovery of viral-derived transgene sequences integrated into the plant genome. Results demonstrate that FTA is a practical, economical and sensitive method for sampling, storage and retrieval of viral pathogens and plant genomic sequences, when working under controlled conditions and in the field. Application of this technology has the potential to significantly increase ability to bring modern analytical techniques to bear on the viral pathogens infecting crop plants.
-
Viral genetic variation accounts for a third of variability in HIV-1 set-point viral load in Europe
Wymant, Chris; Cornelissen, Marion; Gall, Astrid; Bakker, Margreet; Bezemer, Daniela; Hall, Matthew; Hillebregt, Mariska; Ong, Swee Hoe; Albert, Jan; Bannert, Norbert; Fellay, Jacques; Fransen, Katrien; Gourlay, Annabelle J.; Grabowski, M. Kate; Gunsenheimer-Bartmeyer, Barbara; Günthard, Huldrych F.; Kivelä, Pia; Kouyos, Roger; Laeyendecker, Oliver; Liitsola, Kirsi; Meyer, Laurence; Porter, Kholoud; Ristola, Matti; van Sighem, Ard; Vanham, Guido; Berkhout, Ben; Kellam, Paul; Reiss, Peter; Fraser, Christophe
2017-01-01
HIV-1 set-point viral load—the approximately stable value of viraemia in the first years of chronic infection—is a strong predictor of clinical outcome and is highly variable across infected individuals. To better understand HIV-1 pathogenesis and the evolution of the viral population, we must quantify the heritability of set-point viral load, which is the fraction of variation in this phenotype attributable to viral genetic variation. However, current estimates of heritability vary widely, from 6% to 59%. Here we used a dataset of 2,028 seroconverters infected between 1985 and 2013 from 5 European countries (Belgium, Switzerland, France, the Netherlands and the United Kingdom) and estimated the heritability of set-point viral load at 31% (CI 15%–43%). Specifically, heritability was measured using models of character evolution describing how viral load evolves on the phylogeny of whole-genome viral sequences. In contrast to previous studies, (i) we measured viral loads using standardized assays on a sample collected in a strict time window of 6 to 24 months after infection, from which the viral genome was also sequenced; (ii) we compared 2 models of character evolution, the classical “Brownian motion” model and another model (“Ornstein–Uhlenbeck”) that includes stabilising selection on viral load; (iii) we controlled for covariates, including age and sex, which may inflate estimates of heritability; and (iv) we developed a goodness of fit test based on the correlation of viral loads in cherries of the phylogenetic tree, showing that both models of character evolution fit the data well. An overall heritability of 31% (CI 15%–43%) is consistent with other studies based on regression of viral load in donor–recipient pairs. Thus, about a third of variation in HIV-1 virulence is attributable to viral genetic variation. PMID:28604782
-
SEQassembly: A Practical Tools Program for Coding Sequences Splicing
NASA Astrophysics Data System (ADS)
Lee, Hongbin; Yang, Hang; Fu, Lei; Qin, Long; Li, Huili; He, Feng; Wang, Bo; Wu, Xiaoming
CDS (Coding Sequences) is a portion of mRNA sequences, which are composed by a number of exon sequence segments. The construction of CDS sequence is important for profound genetic analysis such as genotyping. A program in MATLAB environment is presented, which can process batch of samples sequences into code segments under the guide of reference exon models, and splice these code segments of same sample source into CDS according to the exon order in queue file. This program is useful in transcriptional polymorphism detection and gene function study.
-
Correlation approach to identify coding regions in DNA sequences
NASA Technical Reports Server (NTRS)
Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.
1994-01-01
Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.
-
Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles
Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.
1998-01-01
Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.
-
Complete genome sequence of lymphocystis disease virus isolated from China.
Zhang, Qi-Ya; Xiao, Feng; Xie, Jian; Li, Zheng-Qiu; Gui, Jian-Fang
2004-07-01
Lymphocystis diseases in fish throughout the world have been extensively described. Here we report the complete genome sequence of lymphocystis disease virus isolated in China (LCDV-C), an LCDV isolated from cultured flounder (Paralichthys olivaceus) with lymphocystis disease in China. The LCDV-C genome is 186,250 bp, with a base composition of 27.25% G+C. Computer-assisted analysis revealed 240 potential open reading frames (ORFs) and 176 nonoverlapping putative viral genes, which encode polypeptides ranging from 40 to 1,193 amino acids. The percent coding density is 67%, and the average length of each ORF is 702 bp. A search of the GenBank database using the 176 individual putative genes revealed 103 homologues to the corresponding ORFs of LCDV-1 and 73 potential genes that were not found in LCDV-1 and other iridoviruses. Among the 73 genes, there are 8 genes that contain conserved domains of cellular genes and 65 novel genes that do not show any significant homology with the sequences in public databases. Although a certain extent of similarity between putative gene products of LCDV-C and corresponding proteins of LCDV-1 was revealed, no colinearity was detected when their ORF arrangements and coding strategies were compared to each other, suggesting that a high degree of genetic rearrangements between them has occurred. And a large number of tandem and overlapping repeated sequences were observed in the LCDV-C genome. The deduced amino acid sequence of the major capsid protein (MCP) presents the highest identity to those of LCDV-1 and other iridoviruses among the LCDV-C gene products. Furthermore, a phylogenetic tree was constructed based on the multiple alignments of nine MCP amino acid sequences. Interestingly, LCDV-C and LCDV-1 were clustered together, but their amino acid identity is much less than that in other clusters. The unexpected levels of divergence between their genomes in size, gene organization, and gene product identity suggest that LCDV-C and LCDV-1 shouldn't belong to a same species and that LCDV-C should be considered a species different from LCDV-1.
-
Complete Genome Sequence of Lymphocystis Disease Virus Isolated from China
Zhang, Qi-Ya; Xiao, Feng; Xie, Jian; Li, Zheng-Qiu; Gui, Jian-Fang
2004-01-01
Lymphocystis diseases in fish throughout the world have been extensively described. Here we report the complete genome sequence of lymphocystis disease virus isolated in China (LCDV-C), an LCDV isolated from cultured flounder (Paralichthys olivaceus) with lymphocystis disease in China. The LCDV-C genome is 186,250 bp, with a base composition of 27.25% G+C. Computer-assisted analysis revealed 240 potential open reading frames (ORFs) and 176 nonoverlapping putative viral genes, which encode polypeptides ranging from 40 to 1,193 amino acids. The percent coding density is 67%, and the average length of each ORF is 702 bp. A search of the GenBank database using the 176 individual putative genes revealed 103 homologues to the corresponding ORFs of LCDV-1 and 73 potential genes that were not found in LCDV-1 and other iridoviruses. Among the 73 genes, there are 8 genes that contain conserved domains of cellular genes and 65 novel genes that do not show any significant homology with the sequences in public databases. Although a certain extent of similarity between putative gene products of LCDV-C and corresponding proteins of LCDV-1 was revealed, no colinearity was detected when their ORF arrangements and coding strategies were compared to each other, suggesting that a high degree of genetic rearrangements between them has occurred. And a large number of tandem and overlapping repeated sequences were observed in the LCDV-C genome. The deduced amino acid sequence of the major capsid protein (MCP) presents the highest identity to those of LCDV-1 and other iridoviruses among the LCDV-C gene products. Furthermore, a phylogenetic tree was constructed based on the multiple alignments of nine MCP amino acid sequences. Interestingly, LCDV-C and LCDV-1 were clustered together, but their amino acid identity is much less than that in other clusters. The unexpected levels of divergence between their genomes in size, gene organization, and gene product identity suggest that LCDV-C and LCDV-1 shouldn't belong to a same species and that LCDV-C should be considered a species different from LCDV-1. PMID:15194775
-
Statistical properties of DNA sequences
NASA Technical Reports Server (NTRS)
Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.
1995-01-01
We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.
-
Recently Patented Viral Nucleotide Sequences and Generation of Virus-Derived Vaccines.
Venkataraman, Srividhya; Ahmad, Tauqeer; Haidar, Mounir A; Hefferon, Kathleen L
2017-01-01
With an increase in comprehension of the molecular biology of viruses, there has been a recent surge in the application of virus sequences and viral gene expression strategies towards the diagnosis and treatment of diseases. The scope of the patenting landscape has widened as a result and the current review discusses patents pertaining to live / attenuated viral vaccines. The vaccines addressed here have been developed by both conventional means as well as by the state-of-the-art genetic engineering techniques. This review also addresses the applications of these patents for clinical and biotechnological purposes. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
-
Cellulases and coding sequences
Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong
2001-02-20
The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.
-
Cellulases and coding sequences
Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong
2001-01-01
The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.
-
Sequential Bottlenecks Drive Viral Evolution in Early Acute Hepatitis C Virus Infection
McElroy, Kerensa; Gaudieri, Silvana; Pham, Son T.; Chopra, Abha; Cameron, Barbara; Maher, Lisa; Dore, Gregory J.; White, Peter A.; Lloyd, Andrew R.
2011-01-01
Hepatitis C is a pandemic human RNA virus, which commonly causes chronic infection and liver disease. The characterization of viral populations that successfully initiate infection, and also those that drive progression to chronicity is instrumental for understanding pathogenesis and vaccine design. A comprehensive and longitudinal analysis of the viral population was conducted in four subjects followed from very early acute infection to resolution of disease outcome. By means of next generation sequencing (NGS) and standard cloning/Sanger sequencing, genetic diversity and viral variants were quantified over the course of the infection at frequencies as low as 0.1%. Phylogenetic analysis of reassembled viral variants revealed acute infection was dominated by two sequential bottleneck events, irrespective of subsequent chronicity or clearance. The first bottleneck was associated with transmission, with one to two viral variants successfully establishing infection. The second occurred approximately 100 days post-infection, and was characterized by a decline in viral diversity. In the two subjects who developed chronic infection, this second bottleneck was followed by the emergence of a new viral population, which evolved from the founder variants via a selective sweep with fixation in a small number of mutated sites. The diversity at sites with non-synonymous mutation was higher in predicted cytotoxic T cell epitopes, suggesting immune-driven evolution. These results provide the first detailed analysis of early within-host evolution of HCV, indicating strong selective forces limit viral evolution in the acute phase of infection. PMID:21912520
-
Replication of a chronic hepatitis B virus genotype F1b construct.
Hernández, Sergio; Jiménez, Gustavo; Alarcón, Valentina; Prieto, Cristian; Muñoz, Francisca; Riquelme, Constanza; Venegas, Mauricio; Brahm, Javier; Loyola, Alejandra; Villanueva, Rodrigo A
2016-03-01
Genotype F is one of the less-studied genotypes of human hepatitis B virus, although it is widely distributed in regions of Central and South American. Our previous studies have shown that HBV genotype F is prevalent in Chile, and phylogenetic analysis of its full-length sequence amplified from the sera of chronically infected patients identified it as HBV subgenotype F1b. We have previously reported the full-length sequence of a HBV molecular clone obtained from a patient chronically infected with genotype F1b. In this report, we established a system to study HBV replication based on hepatoma cell lines transfected with full-length monomers of the HBV genome. Culture supernatants were analyzed after transfection and found to contain both HBsAg and HBeAg viral antigens. Consistently, fractionated cell extracts revealed the presence of viral replication, with both cytoplasmic and nuclear DNA intermediates. Analysis of HBV-transfected cells by indirect immunofluorescence or immunoelectron microscopy revealed the expression of viral antigens and cytoplasmic viral particles, respectively. To test the functionality of the ongoing viral replication further at the level of chromatinized cccDNA, transfected cells were treated with a histone deacetylase inhibitor, and this resulted in increased viral replication. This correlated with changes posttranslational modifications of histones at viral promoters. Thus, the development of this viral replication system for HBV genotype F will facilitate studies on the regulation of viral replication and the identification of new antiviral drugs.
-
Capul, Althea A; de la Torre, Juan Carlos; Buchmeier, Michael J
2011-04-01
Arenaviruses are negative-strand RNA viruses that cause human diseases such as lymphocytic choriomeningitis, Bolivian hemorrhagic fever, and Lassa hemorrhagic fever. No licensed vaccines exist, and current treatment is limited to ribavirin. The prototypic arenavirus, lymphocytic choriomeningitis virus (LCMV), is a model for dissecting virus-host interactions in persistent and acute disease. The RING finger protein Z has been identified as the driving force of arenaviral budding and acts as the viral matrix protein. While residues in Z required for viral budding have been described, residues that govern the Z matrix function(s) have yet to be fully elucidated. Because this matrix function is integral to viral assembly, we reasoned that this would be reflected in sequence conservation. Using sequence alignment, we identified several conserved residues in Z outside the RING and late domains. Nine residues were each mutated to alanine in Lassa fever virus Z. All of the mutations affected the expression of an LCMV minigenome and the infectivity of virus-like particles, but to greatly varying degrees. Interestingly, no mutations appeared to affect Z-mediated budding or association with viral GP. Our findings provide direct experimental evidence supporting a role for Z in the modulation of the activity of the viral ribonucleoprotein (RNP) complex and its packaging into mature infectious viral particles.
-
Vega Thurber, Rebecca L.; Barott, Katie L.; Hall, Dana; Liu, Hong; Rodriguez-Mueller, Beltran; Desnues, Christelle; Edwards, Robert A.; Haynes, Matthew; Angly, Florent E.; Wegley, Linda; Rohwer, Forest L.
2008-01-01
During the last several decades corals have been in decline and at least one-third of all coral species are now threatened with extinction. Coral disease has been a major contributor to this threat, but little is known about the responsible pathogens. To date most research has focused on bacterial and fungal diseases; however, viruses may also be important for coral health. Using a combination of empirical viral metagenomics and real-time PCR, we show that Porites compressa corals contain a suite of eukaryotic viruses, many related to the Herpesviridae. This coral-associated viral consortium was found to shift in response to abiotic stressors. In particular, when exposed to reduced pH, elevated nutrients, and thermal stress, the abundance of herpes-like viral sequences rapidly increased in 2 separate experiments. Herpes-like viral sequences were rarely detected in apparently healthy corals, but were abundant in a majority of stressed samples. In addition, surveys of the Nematostella and Hydra genomic projects demonstrate that even distantly related Cnidarians contain numerous herpes-like viral genes, likely as a result of latent or endogenous viral infection. These data support the hypotheses that corals experience viral infections, which are exacerbated by stress, and that herpes-like viruses are common in Cnidarians. PMID:19017800
-
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and most similar to the genus Mardivirus. The UL15 and/or UL15.5 accumulate(s) in the cytoplasm during early times post-infection and then are translocated to the nucleus at late times.
-
Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.
Nikolaitchik, Olga A; Hu, Wei-Shau
2014-04-01
A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1 regulates its genome packaging and generate infectious viruses necessary for transmission to new hosts.
-
Deciphering the Role of the Gag-Pol Ribosomal Frameshift Signal in HIV-1 RNA Genome Packaging
Nikolaitchik, Olga A.
2014-01-01
ABSTRACT A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5′ untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. IMPORTANCE To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5′ end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1 regulates its genome packaging and generate infectious viruses necessary for transmission to new hosts. PMID:24453371
-
Dinu, Sorin; Calistru, Petre-Iacob; Ceauşu, Emanoil; Târdeil, Graţiela; Oprişan, Gabriela
2015-01-01
Although the European recommendations include the use of new antiviral drugs for the treatment of hepatitis C, in Romania the current treatment remains interferon plus ribavirin. First generation viral protease inhibitors (i.e. boceprevir, telaprevir), which have raised the chances of obtaining viral clearance in up to 70% of infection cases produced by genotype 1 isolates, have not been introduced yet as standard treatment in our country. The success of these new antivirals is limited by the occurrence and selection of resistance mutations during therapy. We set-up a molecular study aiming to detect any resistance mutations to boceprevir and telaprevir harbored by hepatitis C isolates infecting Romanian patients naïve to viral protease inhibitors. Since these new antivirals are efficient and approved for genotype 1 infection, viral samples were genotyped following a protocol previously developed by our research group. We analyzed by both population sequencing and molecular cloning and sequencing the NS3 protease region of hepatitis C virus isolates infecting patients which were not previously exposed to boceprevir and telaprevir. All the analyzed samples were subtype 1b and resembled the samples collected in recent years from Romanian patients. Molecular cloning followed by sequencing showed great intra-host diversity, which is known to represent the source of isolates with different resistance phenotypes. Both population sequencing and molecular cloning followed by clone sequencing revealed two boceprevir resistance mutations (T54S and V55A), respectively, a telaprevir resistance mutation (T54S) in the sequences obtained from a patient with chronic hepatitis C. To our knowledge, this is the first study indicating the existence of pre-treatment resistance mutations to boceprevir and telaprevir in hepatitis C virus isolates infecting Romanian patients.
-
The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1
Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.
1986-01-01
The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668
-
Weber, Jan; Vazquez, Ana C; Winner, Dane; Gibson, Richard M; Rhea, Ariel M; Rose, Justine D; Wylie, Doug; Henry, Kenneth; Wright, Alison; King, Kevin; Archer, John; Poveda, Eva; Soriano, Vicente; Robertson, David L; Olivo, Paul D; Arts, Eric J; Quiñones-Mateu, Miguel E
2013-05-01
CCR5 antagonists are a powerful new class of antiretroviral drugs that require a companion assay to evaluate the presence of CXCR4-tropic (non-R5) viruses prior to use in human immunodeficiency virus (HIV)-infected individuals. In this study, we have developed, characterized, verified, and prevalidated a novel phenotypic test to determine HIV-1 coreceptor tropism (VERITROP) based on a sensitive cell-to-cell fusion assay. A proprietary vector was constructed containing a near-full-length HIV-1 genome with the yeast uracil biosynthesis (URA3) gene replacing the HIV-1 env coding sequence. Patient-derived HIV-1 PCR products were introduced by homologous recombination using an innovative yeast-based cloning strategy. The env-expressing vectors were then used in a cell-to-cell fusion assay to determine the presence of R5 and/or non-R5 HIV-1 variants within the viral population. Results were compared with (i) the original version of Trofile (Monogram Biosciences, San Francisco, CA), (ii) population sequencing, and (iii) 454 pyrosequencing, with the genotypic data analyzed using several bioinformatics tools, i.e., the 11/24/25 rule, Geno2Pheno (2% to 5.75%, 3.5%, or 10% false-positive rate [FPR]), and webPSSM. VERITROP consistently detected minority non-R5 variants from clinical specimens, with an analytical sensitivity of 0.3%, with viral loads of ≥1,000 copies/ml, and from B and non-B subtypes. In a pilot study, a 73.7% (56/76) concordance was observed with the original Trofile assay, with 19 of the 20 discordant results corresponding to non-R5 variants detected using VERITROP and not by the original Trofile assay. The degree of concordance of VERITROP and Trofile with population and deep sequencing results depended on the algorithm used to determine HIV-1 coreceptor tropism. Overall, VERITROP showed better concordance with deep sequencing/Geno2Pheno at a 0.3% detection threshold (67%), whereas Trofile matched better with population sequencing (79%). However, 454 sequencing using Geno2Pheno at a 10% FPR and 0.3% threshold and VERITROP more accurately predicted the success of a maraviroc-based regimen. In conclusion, VERITROP may promote the development of new HIV coreceptor antagonists and aid in the treatment and management of HIV-infected individuals prior to and/or during treatment with this class of drugs.
-
Defining Differential Genetic Signatures in CXCR4- and the CCR5-Utilizing HIV-1 Co-Linear Sequences
Aiamkitsumrit, Benjamas; Dampier, Will; Martin-Garcia, Julio; Nonnemacher, Michael R.; Pirrone, Vanessa; Ivanova, Tatyana; Zhong, Wen; Kilareski, Evelyn; Aldigun, Hazeez; Frantz, Brian; Rimbey, Matthew; Wojno, Adam; Passic, Shendra; Williams, Jean W.; Shah, Sonia; Blakey, Brandon; Parikh, Nirzari; Jacobson, Jeffrey M.; Moldover, Brian; Wigdahl, Brian
2014-01-01
The adaptation of human immunodeficiency virus type-1 (HIV-1) to an array of physiologic niches is advantaged by the plasticity of the viral genome, encoded proteins, and promoter. CXCR4-utilizing (X4) viruses preferentially, but not universally, infect CD4+ T cells, generating high levels of virus within activated HIV-1-infected T cells that can be detected in regional lymph nodes and peripheral blood. By comparison, the CCR5-utilizing (R5) viruses have a greater preference for cells of the monocyte-macrophage lineage; however, while R5 viruses also display a propensity to enter and replicate in T cells, they infect a smaller percentage of CD4+ T cells in comparison to X4 viruses. Additionally, R5 viruses have been associated with viral transmission and CNS disease and are also more prevalent during HIV-1 disease. Specific adaptive changes associated with X4 and R5 viruses were identified in co-linear viral sequences beyond the Env-V3. The in silico position-specific scoring matrix (PSSM) algorithm was used to define distinct groups of X4 and R5 sequences based solely on sequences in Env-V3. Bioinformatic tools were used to identify genetic signatures involving specific protein domains or long terminal repeat (LTR) transcription factor sites within co-linear viral protein R (Vpr), trans-activator of transcription (Tat), or LTR sequences that were preferentially associated with X4 or R5 Env-V3 sequences. A number of differential amino acid and nucleotide changes were identified across the co-linear Vpr, Tat, and LTR sequences, suggesting the presence of specific genetic signatures that preferentially associate with X4 or R5 viruses. Investigation of the genetic relatedness between X4 and R5 viruses utilizing phylogenetic analyses of complete sequences could not be used to definitively and uniquely identify groups of R5 or X4 sequences; in contrast, differences in the genetic diversities between X4 and R5 were readily identified within these co-linear sequences in HIV-1-infected patients. PMID:25265194
-
Bioinformatics prediction of siRNAs as potential antiviral agents against dengue viruses
Villegas-Rosales, Paula M; Méndez-Tenorio, Alfonso; Ortega-Soto, Elizabeth; Barrón, Blanca L
2012-01-01
Dengue virus (DENV 1-4) represents the major emerging arthropod-borne viral infection in the world. Currently, there is neither an available vaccine nor a specific treatment. Hence, there is a need of antiviral drugs for these viral infections; we describe the prediction of short interfering RNA (siRNA) as potential therapeutic agents against the four DENV serotypes. Our strategy was to carry out a series of multiple alignments using ClustalX program to find conserved sequences among the four DENV serotype genomes to obtain a consensus sequence for siRNAs design. A highly conserved sequence among the four DENV serotypes, located in the encoding sequence for NS4B and NS5 proteins was found. A total of 2,893 complete DENV genomes were downloaded from the NCBI, and after a depuration procedure to identify identical sequences, 220 complete DENV genomes were left. They were edited to select the NS4B and NS5 sequences, which were aligned to obtain a consensus sequence. Three different servers were used for siRNA design, and the resulting siRNAs were aligned to identify the most prevalent sequences. Three siRNAs were chosen, one targeted the genome region that codifies for NS4B protein and the other two; the region for NS5 protein. Predicted secondary structure for DENV genomes was used to demonstrate that the siRNAs were able to target the viral genome forming double stranded structures, necessary to activate the RNA silencing machinery. PMID:22829722
-
Sequence variation of the feline immunodeficiency virus genome and its clinical relevance.
Stickney, A L; Dunowska, M; Cave, N J
2013-06-08
The ongoing evolution of feline immunodeficiency virus (FIV) has resulted in the existence of a diverse continuum of viruses. FIV isolates differ with regards to their mutation and replication rates, plasma viral loads, cell tropism and the ability to induce apoptosis. Clinical disease in FIV-infected cats is also inconsistent. Genomic sequence variation of FIV is likely to be responsible for some of the variation in viral behaviour. The specific genetic sequences that influence these key viral properties remain to be determined. With knowledge of the specific key determinants of pathogenicity, there is the potential for veterinarians in the future to apply this information for prognostic purposes. Genomic sequence variation of FIV also presents an obstacle to effective vaccine development. Most challenge studies demonstrate acceptable efficacy of a dual-subtype FIV vaccine (Fel-O-Vax FIV) against FIV infection under experimental settings; however, vaccine efficacy in the field still remains to be proven. It is important that we discover the key determinants of immunity induced by this vaccine; such data would compliment vaccine field efficacy studies and provide the basis to make informed recommendations on its use.
-
Evolutionary and biophysical relationships among the papillomavirus E2 proteins.
Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael
2009-01-01
Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.
-
Mechanisms of inhibition of viral replication in plants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1990-01-01
We have made a number of interesting observations of importance to the fields of virology and plant molecular biology. Topics include the genome of cucumber mosaic virus (CMV), recombination of the CMV genome, transgenic plants and viral movement genes, mapping resistance breakage sequences in the tomato mosaic virus (TMV) genome, and mapping pathogeneticity domains and viral RNA heterogeneity. 1 fig., 1 tab.
-
Human viral pathogens are pervasive in wastewater treatment center aerosols.
Brisebois, Evelyne; Veillette, Marc; Dion-Dupont, Vanessa; Lavoie, Jacques; Corbeil, Jacques; Culley, Alexander; Duchaine, Caroline
2018-05-01
Wastewater treatment center (WTC) workers may be vulnerable to diseases caused by viruses, such as the common cold, influenza and gastro-intestinal infections. Although there is a substantial body of literature characterizing the microbial community found in wastewater, only a few studies have characterized the viral component of WTC aerosols, despite the fact that most diseases affecting WTC workers are of viral origin and that some of these viruses are transmitted through the air. In this study, we evaluated in four WTCs the presence of 11 viral pathogens of particular concern in this milieu and used a metagenomic approach to characterize the total viral community in the air of one of those WTCs. The presence of viruses in aerosols in different locations of individual WTCs was evaluated and the results obtained with four commonly used air samplers were compared. We detected four of the eleven viruses tested, including human adenovirus (hAdV), rotavirus, hepatitis A virus (HAV) and Herpes Simplex virus type 1 (HSV1). The results of the metagenomic assay uncovered very few viral RNA sequences in WTC aerosols, however sequences from human DNA viruses were in much greater relative abundance. Copyright © 2017. Published by Elsevier B.V.
-
Liu, Jin; Shao, Luyao; Trang, Phong; Yang, Zhu; Reeves, Michael; Sun, Xu; Vu, Gia-Phong; Wang, Yu; Li, Hongjian; Zheng, Congyi; Lu, Sangwei; Liu, Fenyong
2016-06-09
An external guide sequence (EGS) is a RNA sequence which can interact with a target mRNA to form a tertiary structure like a pre-tRNA and recruit intracellular ribonuclease P (RNase P), a tRNA processing enzyme, to degrade target mRNA. Previously, an in vitro selection procedure has been used by us to engineer new EGSs that are more robust in inducing human RNase P to cleave their targeted mRNAs. In this study, we constructed EGSs from a variant to target the mRNA encoding herpes simplex virus 1 (HSV-1) major transcription regulator ICP4, which is essential for the expression of viral early and late genes and viral growth. The EGS variant induced human RNase P cleavage of ICP4 mRNA sequence 60 times better than the EGS generated from a natural pre-tRNA. A decrease of about 97% and 75% in the level of ICP4 gene expression and an inhibition of about 7,000- and 500-fold in viral growth were observed in HSV infected cells expressing the variant and the pre-tRNA-derived EGS, respectively. This study shows that engineered EGSs can inhibit HSV-1 gene expression and viral growth. Furthermore, these results demonstrate the potential for engineered EGS RNAs to be developed and used as anti-HSV therapeutics.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banfield, Jillian; Breitbart, Mya; VerBerkmoes, Nathan
CRISPRs (clustered regularly interspaced short palindromic repeats) are adaptive immune systems in Bacteria and Archaea. Transcripts of the spacers that separate the repeats confer immunity through sequence identity with a targeted region (proto-spacer) in phage/viral, plasmid, or other foreign DNA. Short sequences immediately flanking the proto-spacer (proto-spacer adjacent motifs—PAMs) are important in both procuring spacers from and providing immunity to targeted sequences. New spacers are incorporated unidirectionally at the leader end of the CRISPR loci, thus recording a timeline of recent viral exposure. In the early phase of our research, we documented extremely rapid diversification of the CRISPR loci inmore » natural populations [Tyson and Banfield, 2008] matched by high levels of sequence variation in natural viral populations [Andersson and Banfield, 2008]. Since then, in a genetically tractable model laboratory system, we have 1) tracked phage mutation and CRISPR diversification, and in a natural model system, we have 2) examined population history via over time, 3) investigated the timescale over which spacers become ineffective and the process by which ineffective spacers are removed, and 4) analyzed viral diversity. In addition to research activities, our group has organized five international CRISPR meetings, the fifth to be held at University of California, Berkeley in June 2012. Most importantly, the project provided the majority of funding support for Christine Sun (Ph.D. 2012).« less
-
Viral Communities Associated with Human Pericardial Fluids in Idiopathic Pericarditis
Fancello, Laura; Monteil, Sonia; Popgeorgiev, Nikolay; Rivet, Romain; Gouriet, Frédérique; Fournier, Pierre-Edouard; Raoult, Didier; Desnues, Christelle
2014-01-01
Pericarditis is a common human disease defined by inflammation of the pericardium. Currently, 40% to 85% of pericarditis cases have no identified etiology. Most of these cases are thought to be caused by an infection of undetected, unsuspected or unknown viruses. In this work, we used a culture- and sequence-independent approach to investigate the viral DNA communities present in human pericardial fluids. Seven viral metagenomes were generated from the pericardial fluid of patients affected by pericarditis of unknown etiology and one metagenome was generated from the pericardial fluid of a sudden infant death case. As a positive control we generated one metagenome from the pericardial fluid of a patient affected by pericarditis caused by herpesvirus type 3. Furthermore, we used as negative controls a total of 6 pericardial fluids from 6 different individuals affected by pericarditis of non-infectious origin: 5 of them were sequenced as a unique pool and the remaining one was sequenced separately. The results showed a significant presence of torque teno viruses especially in one patient, while herpesviruses and papillomaviruses were present in the positive control. Co-infections by different genotypes of the same viral type (torque teno viruses) or different viruses (herpesviruses and papillomaviruses) were observed. Sequences related to bacteriophages infecting Staphylococcus, Enterobacteria, Streptococcus, Burkholderia and Pseudomonas were also detected in three patients. This study detected torque teno viruses and papillomaviruses, for the first time, in human pericardial fluids. PMID:24690743
-
Liu, Jin; Shao, Luyao; Trang, Phong; Yang, Zhu; Reeves, Michael; Sun, Xu; Vu, Gia-Phong; Wang, Yu; Li, Hongjian; Zheng, Congyi; Lu, Sangwei; Liu, Fenyong
2016-01-01
An external guide sequence (EGS) is a RNA sequence which can interact with a target mRNA to form a tertiary structure like a pre-tRNA and recruit intracellular ribonuclease P (RNase P), a tRNA processing enzyme, to degrade target mRNA. Previously, an in vitro selection procedure has been used by us to engineer new EGSs that are more robust in inducing human RNase P to cleave their targeted mRNAs. In this study, we constructed EGSs from a variant to target the mRNA encoding herpes simplex virus 1 (HSV-1) major transcription regulator ICP4, which is essential for the expression of viral early and late genes and viral growth. The EGS variant induced human RNase P cleavage of ICP4 mRNA sequence 60 times better than the EGS generated from a natural pre-tRNA. A decrease of about 97% and 75% in the level of ICP4 gene expression and an inhibition of about 7,000- and 500-fold in viral growth were observed in HSV infected cells expressing the variant and the pre-tRNA-derived EGS, respectively. This study shows that engineered EGSs can inhibit HSV-1 gene expression and viral growth. Furthermore, these results demonstrate the potential for engineered EGS RNAs to be developed and used as anti-HSV therapeutics. PMID:27279482