Prediction of the translocon-mediated membrane insertion free energies of protein sequences.

PubMed

Park, Yungki; Helms, Volkhard

2008-05-15

Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins

Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

PubMed

Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

2016-01-01

Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

PubMed Central

Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

2015-01-01

PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Germline transformation of the western corn rootworm, Diabrotica virgifera virgifera.

PubMed

Chu, F; Klobasa, W; Wu, P; Pinzi, S; Grubbs, N; Gorski, S; Cardoza, Y; Lorenzen, M D

2017-08-01

The western corn rootworm (WCR), a major pest of maize, is notorious for rapidly adapting biochemically, behaviourally and developmentally to a variety of control methods. Despite much effort, the genetic basis of WCR adaptation remains a mystery. Since transformation-based applications such as transposon tagging and enhancer trapping have facilitated genetic dissection of model species such as Drosophila melanogaster, we developed a germline-transformation system for WCR in an effort to gain a greater understanding of the basic biology of this economically important insect. Here we report the use of a fluorescent-marked Minos element to create transgenic WCR. We demonstrate that the transgenic strains express both an eye-specific fluorescent marker and piggyBac transposase. We identified insertion-site junction sequences via inverse PCR and assessed insertion copy number using digital droplet PCR (ddPCR). Interestingly, most WCR identified as transgenic via visual screening for DsRed fluorescence proved to carry multiple Minos insertions when tested via ddPCR. A total of eight unique insertion strains were created by outcrossing the initial transgenic strains to nontransgenic WCR mates. Establishing transgenic technologies for this beetle is the first step towards bringing a wide range of transformation-based tools to bear on understanding WCR biology. © 2017 The Royal Entomological Society.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

NASA Astrophysics Data System (ADS)

Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

2017-05-01

MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

PubMed Central

Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

2013-01-01

High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Targeting the Atypical Chemokine Receptor ACKR3/CXCR7: Phase 1 - Phage Display Peptide Identification and Characterization.

PubMed

Vestal, R D; LaJeunesse, D R; Taylor, E W

2016-01-01

One of the greatest challenges in fighting cancer is cell targeting and biomarker selection. The Atypical Chemokine Receptor ACKR3/CXCR7 is expressed on many cancer cell types, including breast cancer and glioblastoma, and binds the endogenous ligands SDF1/CXCL12 and ITAC/CXCL11. A 20 amino acid region of the ACKR3/CXCR7 N-terminus was synthesized and targeted with the NEB PhD-7 Phage Display Peptide Library. Twenty-nine phages were isolated and heptapeptide inserts sequenced; of these, 23 sequences were unique. A 3D molecular model was created for the ACKR3/CXCR7 N-terminus by mutating the corresponding region of the crystal structure of CXCR4 with bound SDF1/CXCL12. A ClustalW alignment was performed on each peptide sequence using the entire SDF1/CXCL12 sequence as the template. The 23-peptide sequences showed similarity to three distinct regions of the SDF1/CXCL12 molecule. A 3D molecular model was made for each of the phage peptide inserts to visually identify potential areas of steric interference of peptides that simulated CXCL12 regions not in contact with the receptor's Nterminus. An ELISA analysis of the relative binding affinity between the peptides identified 9 peptides with statistically significant results. The candidate pool of 9 peptides was further reduced to 3 peptides based on their affinity for the targeted N-terminus region peptide versus no target peptide present or a scrambled negative control peptide. The results clearly show the Phage Display protocol can be used to target a synthesized region of the ACKR3/CXCR7 N-terminus. The 3 peptides chosen, P20, P3, and P9, will be the basis for further targeting studies.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

PubMed

Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

2012-12-01

In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

A new molecular evolution model for limited insertion independent of substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2013-10-01

We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

PubMed

Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

2017-08-15

Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

Indel variant analysis of short-read sequencing data with Scalpel

PubMed Central

Fang, Han; Bergmann, Ewa A; Arora, Kanika; Vacic, Vladimir; Zody, Michael C; Iossifov, Ivan; O’Rawe, Jason A; Wu, Yiyang; Barron, Laura T Jimenez; Rosenbaum, Julie; Ronemus, Michael; Lee, Yoon-ha; Wang, Zihua; Dikoglu, Esra; Jobanputra, Vaidehi; Lyon, Gholson J; Wigler, Michael; Schatz, Michael C; Narzisi, Giuseppe

2017-01-01

As the second most common type of variation in the human genome, insertions and deletions (indels) have been linked to many diseases, but the discovery of indels of more than a few bases in size from short-read sequencing data remains challenging. Scalpel (http://scalpel.sourceforge.net) is an open-source software for reliable indel detection based on the microassembly technique. It has been successfully used to discover mutations in novel candidate genes for autism, and it is extensively used in other large-scale studies of human diseases. This protocol gives an overview of the algorithm and describes how to use Scalpel to perform highly accurate indel calling from whole-genome and whole-exome sequencing data. We provide detailed instructions for an exemplary family-based de novo study, but we also characterize the other two supported modes of operation: single-sample and somatic analysis. Indel normalization, visualization and annotation of the mutations are also illustrated. Using a standard server, indel discovery and characterization in the exonic regions of the example sequencing data can be completed in ~5 h after read mapping. PMID:27854363

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Influence of flanking sequences on presentation efficiency of a CD8+ cytotoxic T-cell epitope delivered by parvovirus-like particles.

PubMed

Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I

2004-03-01

We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.

A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

PubMed

Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

2017-10-01

Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

PubMed

Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

2018-04-01

While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing

DTIC Science & Technology

2010-10-14

High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Visualization of chromatin domains created by the gypsy insulator of Drosophila.

PubMed

Byrd, Keith; Corces, Victor G

2003-08-18

Insulators might regulate gene expression by establishing and maintaining the organization of the chromatin fiber within the nucleus. Biochemical fractionation and in situ high salt extraction of lysed cells show that two known protein components of the gypsy insulator are present in the nuclear matrix. Using FISH with DNA probes located between two endogenous Su(Hw) binding sites, we show that the intervening DNA is arranged in a loop, with the two insulators located at the base. Mutations in insulator proteins, subjecting the cells to a brief heat shock, or destruction of the nuclear matrix lead to disruption of the loop. Insertion of an additional gypsy insulator in the center of the loop results in the formation of paired loops through the attachment of the inserted sequences to the nuclear matrix. These results suggest that the gypsy insulator might establish higher-order domains of chromatin structure and regulate nuclear organization by tethering the DNA to the nuclear matrix and creating chromatin loops.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

Whole Genome Sequencing Identifies a 78 kb Insertion from Chromosome 8 as the Cause of Charcot-Marie-Tooth Neuropathy CMTX3

PubMed Central

Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.

2016-01-01

With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

TU-H-CAMPUS-JeP3-05: Adaptive Determination of Needle Sequence HDR Prostate Brachytherapy with Divergent Needle-By-Needle Delivery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borot de Battisti, M; Maenhout, M; Lagendijk, J J W

Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less

Evolution-based Virtual Content Insertion with Visually Virtual Interactions in Videos

NASA Astrophysics Data System (ADS)

Chang, Chia-Hu; Wu, Ja-Ling

With the development of content-based multimedia analysis, virtual content insertion has been widely used and studied for video enrichment and multimedia advertising. However, how to automatically insert a user-selected virtual content into personal videos in a less-intrusive manner, with an attractive representation, is a challenging problem. In this chapter, we present an evolution-based virtual content insertion system which can insert virtual contents into videos with evolved animations according to predefined behaviors emulating the characteristics of evolutionary biology. The videos are considered not only as carriers of message conveyed by the virtual content but also as the environment in which the lifelike virtual contents live. Thus, the inserted virtual content will be affected by the videos to trigger a series of artificial evolutions and evolve its appearances and behaviors while interacting with video contents. By inserting virtual contents into videos through the system, users can easily create entertaining storylines and turn their personal videos into visually appealing ones. In addition, it would bring a new opportunity to increase the advertising revenue for video assets of the media industry and online video-sharing websites.

In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

PubMed Central

Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

2018-01-01

Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

Annotation and visualization of endogenous retroviral sequences using the Distributed Annotation System (DAS) and eBioX

PubMed Central

Martínez Barrio, Álvaro; Lagercrantz, Erik; Sperber, Göran O; Blomberg, Jonas; Bongcam-Rudloff, Erik

2009-01-01

Background The Distributed Annotation System (DAS) is a widely used network protocol for sharing biological information. The distributed aspects of the protocol enable the use of various reference and annotation servers for connecting biological sequence data to pertinent annotations in order to depict an integrated view of the data for the final user. Results An annotation server has been devised to provide information about the endogenous retroviruses detected and annotated by a specialized in silico tool called RetroTector. We describe the procedure to implement the DAS 1.5 protocol commands necessary for constructing the DAS annotation server. We use our server to exemplify those steps. Data distribution is kept separated from visualization which is carried out by eBioX, an easy to use open source program incorporating multiple bioinformatics utilities. Some well characterized endogenous retroviruses are shown in two different DAS clients. A rapid analysis of areas free from retroviral insertions could be facilitated by our annotations. Conclusion The DAS protocol has shown to be advantageous in the distribution of endogenous retrovirus data. The distributed nature of the protocol is also found to aid in combining annotation and visualization along a genome in order to enhance the understanding of ERV contribution to its evolution. Reference and annotation servers are conjointly used by eBioX to provide visualization of ERV annotations as well as other data sources. Our DAS data source can be found in the central public DAS service repository, , or at . PMID:19534743

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

PubMed

Michalovova, M; Vyskot, B; Kejnovsky, E

2013-10-01

We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

PubMed

Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

2018-02-27

Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

PubMed Central

Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

2006-01-01

Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

USDA-ARS?s Scientific Manuscript database

Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

Simulators for training in ultrasound guided procedures.

PubMed

Farjad Sultan, Syed; Shorten, George; Iohom, Gabrielle

2013-06-01

The four major categories of skill sets associated with proficiency in ultrasound guided regional anaesthesia are 1) understanding device operations, 2) image optimization, 3) image interpretation and 4) visualization of needle insertion and injection of the local anesthetic solution. Of these, visualization of needle insertion and injection of local anaesthetic solution can be practiced using simulators and phantoms. This survey of existing simulators summarizes advantages and disadvantages of each. Current deficits pertain to the validation process.

Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

PubMed

Hsing, Michael; Cherkasov, Artem

2008-06-25

Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

Computation and visualization of uncertainty in surgical navigation.

PubMed

Simpson, Amber L; Ma, Burton; Vasarhelyi, Edward M; Borschneck, Dan P; Ellis, Randy E; James Stewart, A

2014-09-01

Surgical displays do not show uncertainty information with respect to the position and orientation of instruments. Data is presented as though it were perfect; surgeons unaware of this uncertainty could make critical navigational mistakes. The propagation of uncertainty to the tip of a surgical instrument is described and a novel uncertainty visualization method is proposed. An extensive study with surgeons has examined the effect of uncertainty visualization on surgical performance with pedicle screw insertion, a procedure highly sensitive to uncertain data. It is shown that surgical performance (time to insert screw, degree of breach of pedicle, and rotation error) is not impeded by the additional cognitive burden imposed by uncertainty visualization. Uncertainty can be computed in real time and visualized without adversely affecting surgical performance, and the best method of uncertainty visualization may depend upon the type of navigation display. Copyright © 2013 John Wiley & Sons, Ltd.

Systematic Characteristic Exploration of the Chimeras Generated in Multiple Displacement Amplification through Next Generation Sequencing Data Reanalysis

PubMed Central

Gao, Shen; Yao, Bei; Lu, Zuhong

2015-01-01

Background The chimeric sequences produced by phi29 DNA polymerase, which are named as chimeras, influence the performance of the multiple displacement amplification (MDA) and also increase the difficulty of sequence data process. Despite several articles have reported the existence of chimeric sequence, there was only one research focusing on the structure and generation mechanism of chimeras, and it was merely based on hundreds of chimeras found in the sequence data of E. coli genome. Method We finished data mining towards a series of Next Generation Sequencing (NGS) reads which were used for whole genome haplotype assembling in a primary study. We established a bioinformatics pipeline based on subsection alignment strategy to discover all the chimeras inside and achieve their structural visualization. Then, we artificially defined two statistical indexes (the chimeric distance and the overlap length), and their regular abundance distribution helped illustrate of the structural characteristics of the chimeras. Finally we analyzed the relationship between the chimera type and the average insertion size, so that illustrate a method to decrease the proportion of wasted data in the procedure of DNA library construction. Results/Conclusion 131.4 Gb pair-end (PE) sequence data was reanalyzed for the chimeras. Totally, 40,259,438 read pairs (6.19%) with chimerism were discovered among 650,430,811 read pairs. The chimeric sequences are consisted of two or more parts which locate inconsecutively but adjacently on the chromosome. The chimeric distance between the locations of adjacent parts on the chromosome followed an approximate bimodal distribution ranging from 0 to over 5,000 nt, whose peak was at about 250 to 300 nt. The overlap length of adjacent parts followed an approximate Poisson distribution and revealed a peak at 6 nt. Moreover, unmapped chimeras, which were classified as the wasted data, could be reduced by properly increasing the length of the insertion segment size through a linear correlation analysis. Significance This study exhibited the profile of the phi29MDA chimeras by tens of millions of chimeric sequences, and helped understand the amplification mechanism of the phi29 DNA polymerase. Our work also illustrated the importance of NGS data reanalysis, not only for the improvement of data utilization efficiency, but also for more potential genomic information. PMID:26440104

Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

PubMed

Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

2007-07-01

A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

PubMed

Jia, Xianbo; Lin, Xinjian; Chen, Jichen

2017-11-02

Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system.

PubMed

Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I

2018-05-01

Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

PREDICT: Pattern Representation and Evaluation of Data through Integration, Correlation, and Transformation

DTIC Science & Technology

2015-10-01

overview visualization to help clinicians identify patients that are changing and inserted these indices into the sepsis specific decision support...visualization, 4) Created a sepsis identification visualization tool to help clinicians identify patients headed for septic shock, and 5) Generated a...5 Sepsis Visualization

Compositions and methods for the expression of selenoproteins in eukaryotic cells

DOEpatents

Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

2012-09-25

Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

PubMed

Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

2011-01-21

DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Targeting the atypical chemokine receptor ACKR3/CXCR7 for the treatment of cancer and other diseases

NASA Astrophysics Data System (ADS)

Vestal, Richard D., Jr.

One of the greatest challenges in fighting cancer is cell targeting and biomarker selection. The Atypical Chemokine Receptor ACKR3/CXCR7 is expressed on many cancer cell types, including breast cancer and glioblastoma, and binds the endogenous ligands SDF1/CXCL12 and ITAC/CXCL11. A 20 amino acid region of the ACKR3/CXCR7 N-terminus was synthesized and targeted with the NEB PhD-7 Phage Display Peptide Library. Twenty-nine phages were isolated and heptapeptide inserts sequenced; of these, 23 sequences were unique. A 3D molecular model was created for the ACKR3/CXCR7 N-terminus by mutating the corresponding region of the crystal structure of CXCR4 with bound SDF1/CXCL12. A ClustalW alignment was performed on each peptide sequence using the entire SDF1/CXCL12 sequence as the template. The 23-peptide sequences showed similarity to three distinct regions of the SDF1/CXCL12 molecule. A 3D molecular model was made for each of the phage peptide inserts to visually identify potential areas of steric interference of peptides that simulated CXCL12 regions not in contact with the receptor's N-terminus. An ELISA analysis of the relative binding affinity between the peptides identified 9 peptides with statistically significant results. The candidate pool of 9 peptides was further reduced to 3 peptides based on their affinity for the targeted N-terminus region peptide versus no target peptide present or a scrambled negative control peptide. The results clearly show the Phage Display protocol can be used to target a synthesized region of the ACKR3/CXCR7 N-terminus. The 3 peptides chosen, P20, P3, and P9, showed no effect on the viability or proliferation upon exposure to MCF-7 and U87-MG cells. Membrane binding, colocalization, and cellular uptake were confirmed by whole-cell ELISA and confocal microscopy. The recovered peptides did not activate the receptor as confirmed by a Beta-Arrestin recruitment assay. The data shows that the peptide sequences recovered from the phage display protocol are viable candidates for targeting cancer cells and delivering material to them.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Video. Natural Orifice Translumenal Endoscopic Surgery with a miniature in vivo surgical robot.

PubMed

Lehman, Amy C; Dumpert, Jason; Wood, Nathan A; Visty, Abigail Q; Farritor, Shane M; Varnell, Brandon; Oleynikov, Dmitry

2009-07-01

The application of flexible endoscopy tools for Natural Orifice Translumenal Endoscopic Surgery (NOTES) is constrained due to limitations in dexterity, instrument insertion, navigation, visualization, and retraction. Miniature endolumenal robots can mitigate these constraints by providing a stable platform for visualization and dexterous manipulation. This video demonstrates the feasibility of using an endolumenal miniature robot to improve vision and to apply off-axis forces for task assistance in NOTES procedures. A two-armed miniature in vivo robot has been developed for NOTES. The robot is remotely controlled, has on-board cameras for guidance, and grasper and cautery end effectors for manipulation. Two basic configurations of the robot allow for flexibility during insertion and rigidity for visualization and tissue manipulation. Embedded magnets in the body of the robot and in an exterior surgical console are used for attaching the robot to the interior abdominal wall. This enables the surgeon to arbitrarily position the robot throughout a procedure. The visualization and task assistance capabilities of the miniature robot were demonstrated in a nonsurvivable NOTES procedure in a porcine model. An endoscope was used to create a transgastric incision and advance an overtube into the peritoneal cavity. The robot was then inserted through the overtube and into the peritoneal cavity using an endoscope. The surgeon successfully used the robot to explore the peritoneum and perform small-bowel dissection. This study has demonstrated the feasibility of inserting an endolumenal robot per os. Once deployed, the robot provided visualization and dexterous capabilities from multiple orientations. Further miniaturization and increased dexterity will enhance future capabilities.

Effect of Real-Time Feedback on Screw Placement Into Synthetic Cancellous Bone.

PubMed

Gustafson, Peter A; Geeslin, Andrew G; Prior, David M; Chess, Joseph L

2016-08-01

The objective of this study is to evaluate whether real-time torque feedback may reduce the occurrence of stripping when inserting nonlocking screws through fracture plates into synthetic cancellous bone. Five attending orthopaedic surgeons and 5 senior level orthopaedic residents inserted 8 screws in each phase. In phase I, screws were inserted without feedback simulating conventional techniques. In phase II, screws were driven with visual torque feedback. In phase III, screws were again inserted with conventional techniques. Comparison of these 3 phases with respect to screw insertion torque, surgeon rank, and perception of stripping was used to establish the effects of feedback. Seventy-three of 239 screws resulted in stripping. During the first phase, no feedback was provided and the overall strip rate was 41.8%; this decreased to 15% with visual feedback (P < 0.001) and returned to 35% when repeated without feedback. With feedback, a lower average torque was applied over a narrower torque distribution. Residents stripped 40.8% of screws compared with 20.2% for attending surgeons. Surgeons were poor at perceiving whether they stripped. Prevention and identification of stripping is influenced by surgeon perception of tactile sensation. This is significantly improved with utilization of real-time visual feedback of a torque versus roll curve. This concept of real-time feedback seems beneficial toward performance in synthetic cancellous bone and may lead to improved fixation in cancellous bone in a surgical setting.

Specifiers Properties Information Exchange (SPie): Minimum Building Information Model (BIM) Object Definitions

DTIC Science & Technology

2013-03-01

Weave Welding Method Wheel Assembly Wind Load Wind Loads Wind Uplift Resistance Wind Uplift Resistance Class Window Category Window Finish Window... wind - blast Elongation UFGS 2.1 percent Insert Value Visual Defects UFGS 2.1 n/a Insert Value ERDC/CERL CR-13-1 39 Attribute Source...Sustainability COBie Guide n/a insert reqts FRP Strengthening UFGS 1.2 n/a seismic - wind - blast Elongation UFGS 2.2 percent Insert Value Tensile

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Insertion sequence typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.

PubMed

Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W

1994-12-01

DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.

Comparison of the Ambu AuraFlex with the laryngeal mask airway Flexible: a manikin study.

PubMed

Sanuki, Takuro; Nakatani, Gosuke; Sugioka, Shingo; Daigo, Erina; Kotani, Junichiro

2011-07-01

The present study compared the Ambu AuraFlex and the laryngeal mask airway (LMA) Flexible with regard to time required for and success rates of insertion on a manikin by dental students who had never used an LMA. In addition, participants' views on ease of insertion of each device were surveyed. Subjects consisted of 30 dental students who inserted each airway device in a manikin. The time required for and success rates of insertion were measured. Subjects were then asked to rate the ease of insertion of each device using the 100-mm visual analog scale (from 0 mm = extremely easy to 100 mm = extremely difficult). Insertion time was shorter with the Ambu AuraFlex (26.6 ± 7.1 seconds) than with the LMA Flexible (30.3 ± 6.8 seconds; P = .045). The rate of successful insertion using the Ambu AuraFlex (28 of 30 attempts, 93.3%) was greater than that with the LMA Flexible (23 of 30 attempts, 76.7%), although the difference was not statistically significant (P = .145). Ambu AuraFlex insertion was considered less difficult (median, 41 mm; 10th to 90th percentiles, 18 to 78 mm) than LMA Flexible insertion (60 mm; 42 to 82 mm; P = .004), as rated using the 100-mm visual analog scale. The Ambu AuraFlex appears to be useful for inexperienced users because it enables quicker and easier insertion than the LMA Flexible. Copyright © 2011 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Utilization of next generation sequencing for analyzing transgenic insertions in plum

USDA-ARS?s Scientific Manuscript database

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

Assessing pooled BAC and whole genome shotgun strategies for assembly of complex genomes.

PubMed

Haiminen, Niina; Feltus, F Alex; Parida, Laxmi

2011-04-15

We investigate if pooling BAC clones and sequencing the pools can provide for more accurate assembly of genome sequences than the "whole genome shotgun" (WGS) approach. Furthermore, we quantify this accuracy increase. We compare the pooled BAC and WGS approaches using in silico simulations. Standard measures of assembly quality focus on assembly size and fragmentation, which are desirable for large whole genome assemblies. We propose additional measures enabling easy and visual comparison of assembly quality, such as rearrangements and redundant sequence content, relative to the known target sequence. The best assembly quality scores were obtained using 454 coverage of 15× linear and 5× paired (3kb insert size) reads (15L-5P) on Arabidopsis. This regime gave similarly good results on four additional plant genomes of very different GC and repeat contents. BAC pooling improved assembly scores over WGS assembly, coverage and redundancy scores improving the most. BAC pooling works better than WGS, however, both require a physical map to order the scaffolds. Pool sizes up to 12Mbp work well, suggesting this pooling density to be effective in medium-scale re-sequencing applications such as targeted sequencing of QTL intervals for candidate gene discovery. Assuming the current Roche/454 Titanium sequencing limitations, a 12 Mbp region could be re-sequenced with a full plate of linear reads and a half plate of paired-end reads, yielding 15L-5P coverage after read pre-processing. Our simulation suggests that massively over-sequencing may not improve accuracy. Our scoring measures can be used generally to evaluate and compare results of simulated genome assemblies.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae

PubMed Central

Muñoz, Rosario; López, Rubens; García, Ernesto

1998-01-01

We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131

The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

PubMed Central

Trinh, T. Q.; Sinden, R. R.

1993-01-01

We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

The use of endoillumination probe-assisted Descemet membrane endothelial keratoplasty for bullous keratopathy secondary to argon laser iridotomy

PubMed Central

Kobayashi, Akira; Yokogawa, Hideaki; Yamazaki, Natsuko; Masaki, Toshinori; Sugiyama, Kazuhisa

2015-01-01

Purpose To report the first case of Descemet membrane endothelial keratoplasty (DMEK) for bullous keratopathy (BK) secondary to argon laser iridotomy (ALI). Patient A 71-year-old woman presented with decreased visual acuity in her right eye due to BK secondary to ALI that was performed 10 years prior. Results Phacosurgery was performed first, followed by successful DMEK 4 months later. A DMEK shooter was used for donor insertion, which allowed for a stable anterior chamber during donor insertion, even when the anterior chamber was quite shallow. Also, removal of edematous epithelial cells and endoillumination probe-assisted DMEK was quite useful to visualize DMEK graft on the background of the dark brown iris seen in Asian eyes. The patient’s best corrected visual acuity rapidly increased from 20/200 to 25/20 after 1 month, with complete resolution of corneal edema. Conclusion We reported the first successful DMEK case for BK secondary to ALI. The use of a DMEK shooter for donor insertion and endoillumination assistance to visualize the DMEK graft was a useful technique for BK secondary to ALI. PMID:25609910

Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

PubMed Central

Chatre, Laurent; Ricchetti, Miria

2011-01-01

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

PubMed

Chatre, Laurent; Ricchetti, Miria

2011-03-08

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

The effect of gait training with shoe inserts on the improvement of pain and gait in sacroiliac joint patients.

PubMed

Cho, Byung-Yun; Yoon, Jung-Gyu

2015-08-01

[Purpose] The purpose of the current research was to identify how gait training with shoe inserts affects the pain and gait of sacroiliac joint dysfunction patients. [Subjects and Methods] Thirty subjects were randomly selected and assigned to be either the experimental group (gait training with shoe insert group) or control group. Each group consisted of 15 patients. Pain was measured by Visual Analogue Scale, and foot pressure in a standing position and during gait was measured with a Gateview AFA-50 system (Alpus, Seoul, Republic of Korea). A paired sample t-test was used to compare the pain and gait of the sacroiliac joint before and after the intervention. Correlation between pain and walking after gait training with shoe inserts was examined by Pearson test. The level of significance was set at α=0.05. [Results] It was found that application of the intervention to the experimental group resulted in a significant decrease in sacroiliac joint pain. It was also found that there was a significant correlation between Visual Analogue Scale score and dynamic asymmetric index (r= 0.796) and that there was a negative correlation between Visual Analogue Scale score and forefoot/rear foot peak pressure ratio (r=-0.728). [Conclusion] The results of our analysis lead us to conclude that the intervention with shoe inserts had a significant influence on the pain and gait of sacroiliac joint patients.

The effect of gait training with shoe inserts on the improvement of pain and gait in sacroiliac joint patients

PubMed Central

Cho, Byung-Yun; Yoon, Jung-Gyu

2015-01-01

[Purpose] The purpose of the current research was to identify how gait training with shoe inserts affects the pain and gait of sacroiliac joint dysfunction patients. [Subjects and Methods] Thirty subjects were randomly selected and assigned to be either the experimental group (gait training with shoe insert group) or control group. Each group consisted of 15 patients. Pain was measured by Visual Analogue Scale, and foot pressure in a standing position and during gait was measured with a Gateview AFA-50 system (Alpus, Seoul, Republic of Korea). A paired sample t-test was used to compare the pain and gait of the sacroiliac joint before and after the intervention. Correlation between pain and walking after gait training with shoe inserts was examined by Pearson test. The level of significance was set at α=0.05. [Results] It was found that application of the intervention to the experimental group resulted in a significant decrease in sacroiliac joint pain. It was also found that there was a significant correlation between Visual Analogue Scale score and dynamic asymmetric index (r= 0.796) and that there was a negative correlation between Visual Analogue Scale score and forefoot/rear foot peak pressure ratio (r=-0.728). [Conclusion] The results of our analysis lead us to conclude that the intervention with shoe inserts had a significant influence on the pain and gait of sacroiliac joint patients. PMID:26357428

MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system

NASA Astrophysics Data System (ADS)

Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.

2018-05-01

Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

PubMed

Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

2017-08-01

There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Ultrasonography in Acupuncture-Uses in Education and Research.

PubMed

Leow, Mabel Qi He; Cui, Shu Li; Mohamed Shah, Mohammad Taufik Bin; Cao, Taige; Tay, Shian Chao; Tay, Peter Kay Chai; Ooi, Chin Chin

2017-06-01

This study aims to explore the potential use of ultrasound in locating the second posterior sacral foramen acupuncture point, quantifying depth of insertion and describing surrounding anatomical structures. We performed acupuncture needle insertion on a study team member. There were four steps in our experiment. First, the acupuncturist located the acupuncture point by palpation. Second, we used an ultrasound machine to visualize the structures surrounding the location of the acupuncture point and measure the depth required for needle insertion. Third, the acupuncturist inserted the acupuncture needle into the acupuncture point at an angle of 30°. Fourth, we performed another ultrasound scan to ensure that the needle was in the desired location. Results suggested that ultrasound could be used to locate the acupuncture point and estimate the depth of needle insertion. The needle was inserted to a depth of 4.0 cm to reach the surface of the sacral foramen. Based on Pythagoras theorem, taking a needle insertion angle of 30° and a needle insertion depth of 4.0 cm, the estimated perpendicular depth is 1.8 cm. An ultrasound scan corroborated the depth of 1.85 cm. The use of an ultrasound-guided technique for needle insertion in acupuncture practice could help standardize the treatment. Clinicians and students would be able to visualize and measure the depth of the sacral foramen acupuncture point, to guide the depth of needle insertion. This methodological guide could also be used to create a standard treatment protocol for research. A similar mathematical guide could also be created for other acupuncture points in future. Copyright © 2017. Published by Elsevier B.V.

Design and preliminary analysis of a vaginal inserter for speculum-free cervical cancer screening

PubMed Central

Agudogo, Júlia; Krieger, Marlee S.; Miros, Robert; Proeschold-Bell, Rae Jean; Schmitt, John W.; Ramanujam, Nimmi

2017-01-01

Objective Cervical cancer screening usually requires use of a speculum to provide a clear view of the cervix. The speculum is one potential barrier to screening due to fear of pain, discomfort and embarrassment. The aim of this paper is to present and demonstrate the feasibility of a tampon-sized inserter and the POCkeT Colposcope, a miniature pen sized-colposcope, for comfortable, speculum-free and potentially self-colposcopy. Study design We explored different designs using 3D computer-aided design (CAD) software and performed mechanical testing simulations on each. Designs were rapid prototyped and tested using a custom vaginal phantom across a range of vaginal pressures and uterine tilts to select an optimal design. Two final designs were tested with fifteen volunteers to assess cervix visualization, comfort and usability compared to the speculum and the optimal design, the curved-tip inserter, was selected for testing in volunteers. Results We present a vaginal inserter as an alternative to the standard speculum for use with the POCkeT Colposcope. The device has a slim tubular body with a funnel-like curved tip measuring approximately 2.5 cm in diameter. The inserter has a channel through which a 2 megapixel (MP) mini camera with LED illumination fits to enable image capture. Mechanical finite element testing simulations with an applied pressure of 15 cm H2O indicated a high factor of safety (90.9) for the inserter. Testing of the device with a custom vaginal phantom, across a range of supine vaginal pressures and uterine tilts (retroverted, anteverted and sideverted), demonstrated image capture with a visual area comparable to the speculum for a normal/axial positioned uteri and significantly better than the speculum for anteverted and sideverted uteri (p<0.00001). Volunteer studies with self-insertion and physician-assisted cervix image capture showed adequate cervix visualization for 83% of patients. In addition, questionnaire responses from volunteers indicated a 92.3% overall preference for the inserter over the speculum and all indicated that the inserter was more comfortable than the speculum. The inserter provides a platform for self-cervical cancer screening and also enables acetic acid/Lugol’s iodine application and insertion of swabs for Pap smear sample collection. Conclusion This study demonstrates the feasibility of an inserter and miniature-imaging device for comfortable cervical image capture of women with potential for synergistic HPV and Pap smear sample collection. PMID:28562669

Import of honeybee prepromelittin into the endoplasmic reticulum: structural basis for independence of SRP and docking protein.

PubMed Central

Müller, G; Zimmermann, R

1987-01-01

Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722

The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

PubMed Central

Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

2014-01-01

Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

Evaluation of different magnetic resonance imaging contrast materials to be used as dummy markers in image-guided brachytherapy for gynecologic malignancies*

PubMed Central

Sales, Camila Pessoa; Carvalho, Heloisa de Andrade; Taverna, Khallil Chaim; Pastorello, Bruno Fraccini; Rubo, Rodrigo Augusto; Borgonovi, Arthur Felipe; Stuart, Silvia Radwanski; Rodrigues, Laura Natal

2016-01-01

Objective To identify a contrast material that could be used as a dummy marker for magnetic resonance imaging. Materials and Methods Magnetic resonance images were acquired with six different catheter-filling materials-water, glucose 50%, saline, olive oil, glycerin, and copper sulfate (CuSO4) water solution (2.08 g/L)-inserted into compatible computed tomography/magnetic resonance imaging ring applicators placed in a phantom made of gelatin and CuSO4. The best contrast media were tested in four patients with the applicators in place. Results In T2-weighted sequences, the best contrast was achieved with the CuSO4-filled catheters, followed by saline- and glycerin-filled catheters, which presented poor visualization. In addition (also in T2-weighted sequences), CuSO4 presented better contrast when tested in the phantom than when tested in the patients, in which it provided some contrast but with poor identification of the first dwell position, mainly in the ring. Conclusion We found CuSO4 to be the best solution for visualization of the applicator channels, mainly in T2-weighted images in vitro, although the materials tested presented low signal intensity in the images obtained in vivo, as well as poor precision in determining the first dwell position. PMID:27403016

MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

PubMed Central

Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

2011-01-01

We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Mechanism for DNA transposons to generate introns on genomic scales

PubMed Central

Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

2017-01-01

Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

FMRI investigation of cross-modal interactions in beat perception: Audition primes vision, but not vice versa

PubMed Central

Grahn, Jessica A.; Henry, Molly J.; McAuley, J. Devin

2011-01-01

How we measure time and integrate temporal cues from different sensory modalities are fundamental questions in neuroscience. Sensitivity to a “beat” (such as that routinely perceived in music) differs substantially between auditory and visual modalities. Here we examined beat sensitivity in each modality, and examined cross-modal influences, using functional magnetic resonance imaging (fMRI) to characterize brain activity during perception of auditory and visual rhythms. In separate fMRI sessions, participants listened to auditory sequences or watched visual sequences. The order of auditory and visual sequence presentation was counterbalanced so that cross-modal order effects could be investigated. Participants judged whether sequences were speeding up or slowing down, and the pattern of tempo judgments was used to derive a measure of sensitivity to an implied beat. As expected, participants were less sensitive to an implied beat in visual sequences than in auditory sequences. However, visual sequences produced a stronger sense of beat when preceded by auditory sequences with identical temporal structure. Moreover, increases in brain activity were observed in the bilateral putamen for visual sequences preceded by auditory sequences when compared to visual sequences without prior auditory exposure. No such order-dependent differences (behavioral or neural) were found for the auditory sequences. The results provide further evidence for the role of the basal ganglia in internal generation of the beat and suggest that an internal auditory rhythm representation may be activated during visual rhythm perception. PMID:20858544

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

Object-based attention underlies the rehearsal of feature binding in visual working memory.

PubMed

Shen, Mowei; Huang, Xiang; Gao, Zaifeng

2015-04-01

Feature binding is a core concept in many research fields, including the study of working memory (WM). Over the past decade, it has been debated whether keeping the feature binding in visual WM consumes more visual attention than the constituent single features. Previous studies have only explored the contribution of domain-general attention or space-based attention in the binding process; no study so far has explored the role of object-based attention in retaining binding in visual WM. We hypothesized that object-based attention underlay the mechanism of rehearsing feature binding in visual WM. Therefore, during the maintenance phase of a visual WM task, we inserted a secondary mental rotation (Experiments 1-3), transparent motion (Experiment 4), or an object-based feature report task (Experiment 5) to consume the object-based attention available for binding. In line with the prediction of the object-based attention hypothesis, Experiments 1-5 revealed a more significant impairment for binding than for constituent single features. However, this selective binding impairment was not observed when inserting a space-based visual search task (Experiment 6). We conclude that object-based attention underlies the rehearsal of binding representation in visual WM. (c) 2015 APA, all rights reserved.

Insertion sequences enrichment in extreme Red sea brine pool vent.

PubMed

Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

2017-03-01

Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

PubMed Central

Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

2012-01-01

The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

Auditory, visual and auditory-visual memory and sequencing performance in typically developing children.

PubMed

Pillai, Roshni; Yathiraj, Asha

2017-09-01

The study evaluated whether there exists a difference/relation in the way four different memory skills (memory score, sequencing score, memory span, & sequencing span) are processed through the auditory modality, visual modality and combined modalities. Four memory skills were evaluated on 30 typically developing children aged 7 years and 8 years across three modality conditions (auditory, visual, & auditory-visual). Analogous auditory and visual stimuli were presented to evaluate the three modality conditions across the two age groups. The children obtained significantly higher memory scores through the auditory modality compared to the visual modality. Likewise, their memory scores were significantly higher through the auditory-visual modality condition than through the visual modality. However, no effect of modality was observed on the sequencing scores as well as for the memory and the sequencing span. A good agreement was seen between the different modality conditions that were studied (auditory, visual, & auditory-visual) for the different memory skills measures (memory scores, sequencing scores, memory span, & sequencing span). A relatively lower agreement was noted only between the auditory and visual modalities as well as between the visual and auditory-visual modality conditions for the memory scores, measured using Bland-Altman plots. The study highlights the efficacy of using analogous stimuli to assess the auditory, visual as well as combined modalities. The study supports the view that the performance of children on different memory skills was better through the auditory modality compared to the visual modality. Copyright © 2017 Elsevier B.V. All rights reserved.

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

A Sequence of Sorting Strategies.

ERIC Educational Resources Information Center

Duncan, David R.; Litwiller, Bonnie H.

1984-01-01

Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information

PubMed Central

McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash

2018-01-01

ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869

Assessing pooled BAC and whole genome shotgun strategies for assembly of complex genomes

PubMed Central

2011-01-01

Background We investigate if pooling BAC clones and sequencing the pools can provide for more accurate assembly of genome sequences than the "whole genome shotgun" (WGS) approach. Furthermore, we quantify this accuracy increase. We compare the pooled BAC and WGS approaches using in silico simulations. Standard measures of assembly quality focus on assembly size and fragmentation, which are desirable for large whole genome assemblies. We propose additional measures enabling easy and visual comparison of assembly quality, such as rearrangements and redundant sequence content, relative to the known target sequence. Results The best assembly quality scores were obtained using 454 coverage of 15× linear and 5× paired (3kb insert size) reads (15L-5P) on Arabidopsis. This regime gave similarly good results on four additional plant genomes of very different GC and repeat contents. BAC pooling improved assembly scores over WGS assembly, coverage and redundancy scores improving the most. Conclusions BAC pooling works better than WGS, however, both require a physical map to order the scaffolds. Pool sizes up to 12Mbp work well, suggesting this pooling density to be effective in medium-scale re-sequencing applications such as targeted sequencing of QTL intervals for candidate gene discovery. Assuming the current Roche/454 Titanium sequencing limitations, a 12 Mbp region could be re-sequenced with a full plate of linear reads and a half plate of paired-end reads, yielding 15L-5P coverage after read pre-processing. Our simulation suggests that massively over-sequencing may not improve accuracy. Our scoring measures can be used generally to evaluate and compare results of simulated genome assemblies. PMID:21496274

Transposon variation by order during allopolyploidisation between Brassica oleracea and Brassica rapa.

PubMed

An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D

2014-07-01

Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

PubMed Central

Zillmann, M; Limauro, S E; Goodchild, J

1997-01-01

By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

PubMed

Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

2017-02-01

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

Few mitochondrial DNA sequences are inserted into the turkey (Meleagris gallopavo) nuclear genome: evolutionary analyses and informativity in the domestic lineage.

PubMed

Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L

2018-06-01

Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.

MRKAd5 HIV-1 Gag/Pol/Nef Vaccine-Induced T-Cell Responses Inadequately Predict Distance of Breakthrough HIV-1 Sequences to the Vaccine or Viral Load

PubMed Central

Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter

2012-01-01

Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

Feasibility of real-time magnetic resonance imaging-guided endomyocardial biopsies: An in-vitro study.

PubMed

Lossnitzer, Dirk; Seitz, Sebastian A; Krautz, Birgit; Schnackenburg, Bernhard; André, Florian; Korosoglou, Grigorios; Katus, Hugo A; Steen, Henning

2015-07-26

To investigate if magnetic resonance (MR)-guided biopsy can improve the performance and safety of such procedures. A novel MR-compatible bioptome was evaluated in a series of in-vitro experiments in a 1.5T magnetic resonance imaging (MRI) system. The bioptome was inserted into explanted porcine and bovine hearts under real-time MR-guidance employing a steady state free precession sequence. The artifact produced by the metal element at the tip and the signal voids caused by the bioptome were visually tracked for navigation and allowed its constant and precise localization. Cardiac structural elements and the target regions for the biopsy were clearly visible. Our method allowed a significantly better spatial visualization of the bioptoms tip compared to conventional X-ray guidance. The specific device design of the bioptome avoided inducible currents and therefore subsequent heating. The novel MR-compatible bioptome provided a superior cardiovascular magnetic resonance (imaging) soft-tissue visualization for MR-guided myocardial biopsies. Not at least the use of MRI guidance for endomyocardial biopsies completely avoided radiation exposure for both patients and interventionalists. MRI-guided endomyocardial biopsies provide a better than conventional X-ray guided navigation and could therefore improve the specificity and reproducibility of cardiac biopsies in future studies.

Enhanced learning of natural visual sequences in newborn chicks.

PubMed

Wood, Justin N; Prasad, Aditya; Goldman, Jason G; Wood, Samantha M W

2016-07-01

To what extent are newborn brains designed to operate over natural visual input? To address this question, we used a high-throughput controlled-rearing method to examine whether newborn chicks (Gallus gallus) show enhanced learning of natural visual sequences at the onset of vision. We took the same set of images and grouped them into either natural sequences (i.e., sequences showing different viewpoints of the same real-world object) or unnatural sequences (i.e., sequences showing different images of different real-world objects). When raised in virtual worlds containing natural sequences, newborn chicks developed the ability to recognize familiar images of objects. Conversely, when raised in virtual worlds containing unnatural sequences, newborn chicks' object recognition abilities were severely impaired. In fact, the majority of the chicks raised with the unnatural sequences failed to recognize familiar images of objects despite acquiring over 100 h of visual experience with those images. Thus, newborn chicks show enhanced learning of natural visual sequences at the onset of vision. These results indicate that newborn brains are designed to operate over natural visual input.

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

PubMed Central

Traverse, Charles C.

2017-01-01

ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Multiple Free Internal Limiting Membrane Flap Insertion in the Treatment of Macular Hole-Associated Retinal Detachment in High Myopia.

PubMed

Chen, San-Ni; Hsieh, Yi-Ting; Yang, Chung-May

2018-06-06

The aim of this paper was to evaluate the efficacy of multiple free internal limiting membrane (ILM) flap insertion in the management of macular hole-associated retinal detachment in high myopia. Eyes receiving operation for macular hole-associated retinal detachment were retrospectively recruited. Those in the study group received ILM peeling and multiple free ILM flap insertion, while those in the control group received ILM peeling only. Postoperative anatomical outcomes and best-corrected visual acuity were compared between the 2 groups. Twenty-seven eyes of 27 patients were recruited in this study (13 in the study group, 14 in the control group). After the operation, the retina was reattached in all cases in both groups. The macular hole closure rate was 100% in the study group but only 42.9% in the control group (adjusted p < 0.001). The eyes in the study group had better visual improvement (logMAR -0.58 ± 0.43) than those in the control group (logMAR -0.31 ± 0.50) with borderline significance (adjusted p = 0.078). For macular hole-associated retinal detachment in highly myopic eyes, the multiple free ILM flap insertion technique offers an effective way to close macular holes. Whether this result also means better visual outcome remains to be seen. © 2018 S. Karger AG, Basel.

Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases

PubMed Central

Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.

2013-01-01

There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

PubMed

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations

PubMed Central

Gumbart, James; Roux, Benoît

2012-01-01

The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850

The Design and Analysis of Transposon-Insertion Sequencing Experiments

PubMed Central

Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.

2016-01-01

Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926

Word and frame synchronization with verification for PPM optical communications

NASA Technical Reports Server (NTRS)

Marshall, William K.

1986-01-01

A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.

Sequence Diversity Diagram for comparative analysis of multiple sequence alignments.

PubMed

Sakai, Ryo; Aerts, Jan

2014-01-01

The sequence logo is a graphical representation of a set of aligned sequences, commonly used to depict conservation of amino acid or nucleotide sequences. Although it effectively communicates the amount of information present at every position, this visual representation falls short when the domain task is to compare between two or more sets of aligned sequences. We present a new visual presentation called a Sequence Diversity Diagram and validate our design choices with a case study. Our software was developed using the open-source program called Processing. It loads multiple sequence alignment FASTA files and a configuration file, which can be modified as needed to change the visualization. The redesigned figure improves on the visual comparison of two or more sets, and it additionally encodes information on sequential position conservation. In our case study of the adenylate kinase lid domain, the Sequence Diversity Diagram reveals unexpected patterns and new insights, for example the identification of subgroups within the protein subfamily. Our future work will integrate this visual encoding into interactive visualization tools to support higher level data exploration tasks.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Construction and sequence sampling of deep-coverage, large-insert BAC libraries for three model lepidopteran species

PubMed Central

Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R

2009-01-01

Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

PubMed Central

2012-01-01

Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

PubMed

Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

2012-04-30

Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

PubMed Central

Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

PubMed

Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

2015-04-01

In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

Virtual Reality simulator for dental anesthesia training in the inferior alveolar nerve block.

PubMed

Corrêa, Cléber Gimenez; Machado, Maria Aparecida de Andrade Moreira; Ranzini, Edith; Tori, Romero; Nunes, Fátima de Lourdes Santos

2017-01-01

This study shows the development and validation of a dental anesthesia-training simulator, specifically for the inferior alveolar nerve block (IANB). The system developed provides the tactile sensation of inserting a real needle in a human patient, using Virtual Reality (VR) techniques and a haptic device that can provide a perceived force feedback in the needle insertion task during the anesthesia procedure. To simulate a realistic anesthesia procedure, a Carpule syringe was coupled to a haptic device. The Volere method was used to elicit requirements from users in the Dentistry area; Repeated Measures Two-Way ANOVA (Analysis of Variance), Tukey post-hoc test and averages for the results' analysis. A questionnaire-based subjective evaluation method was applied to collect information about the simulator, and 26 people participated in the experiments (12 beginners, 12 at intermediate level, and 2 experts). The questionnaire included profile, preferences (number of viewpoints, texture of the objects, and haptic device handler), as well as visual (appearance, scale, and position of objects) and haptic aspects (motion space, tactile sensation, and motion reproduction). The visual aspect was considered appropriate and the haptic feedback must be improved, which the users can do by calibrating the virtual tissues' resistance. The evaluation of visual aspects was influenced by the participants' experience, according to ANOVA test (F=15.6, p=0.0002, with p<0.01). The user preferences were the simulator with two viewpoints, objects with texture based on images and the device with a syringe coupled to it. The simulation was considered thoroughly satisfactory for the anesthesia training, considering the needle insertion task, which includes the correct insertion point and depth, as well as the perception of tissues resistances during the insertion.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Insertion sequence ISRP10 inactivation of the oprD gene in imipenem-resistant Pseudomonas aeruginosa clinical isolates.

PubMed

Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang

2016-05-01

Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

PubMed

Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

2009-12-15

Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Diagnostic use of computational retrotransposon detection: Successful definition of pathogenetic mechanism in a ciliopathy phenotype.

PubMed

Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro

2017-05-01

Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.

In-plane ultrasonic needle tracking using a fiber-optic hydrophone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xia, Wenfeng, E-mail: wenfeng.xia@ucl.ac.uk; Desjardins, Adrien E.; Mari, Jean Martial

Purpose: Accurate and efficient guidance of needles to procedural targets is critically important during percutaneous interventional procedures. Ultrasound imaging is widely used for real-time image guidance in a variety of clinical contexts, but with this modality, uncertainties about the location of the needle tip within the image plane lead to significant complications. Whilst several methods have been proposed to improve the visibility of the needle, achieving accuracy and compatibility with current clinical practice is an ongoing challenge. In this paper, the authors present a method for directly visualizing the needle tip using an integrated fiber-optic ultrasound receiver in conjunction withmore » the imaging probe used to acquire B-mode ultrasound images. Methods: Needle visualization and ultrasound imaging were performed with a clinical ultrasound imaging system. A miniature fiber-optic ultrasound hydrophone was integrated into a 20 gauge injection needle tip to receive transmissions from individual transducer elements of the ultrasound imaging probe. The received signals were reconstructed to create an image of the needle tip. Ultrasound B-mode imaging was interleaved with needle tip imaging. A first set of measurements was acquired in water and tissue ex vivo with a wide range of insertion angles (15°–68°) to study the accuracy and sensitivity of the tracking method. A second set was acquired in an in vivo swine model, with needle insertions to the brachial plexus. A third set was acquired in an in vivo ovine model for fetal interventions, with insertions to different locations within the uterine cavity. Two linear ultrasound imaging probes were used: a 14–5 MHz probe for the first and second sets, and a 9–4 MHz probe for the third. Results: During insertions in tissue ex vivo and in vivo, the imaged needle tip had submillimeter axial and lateral dimensions. The signal-to-noise (SNR) of the needle tip was found to depend on the insertion angle. With the needle tip in water, the SNR of the needle tip varied with insertion angle, attaining values of 284 at 27° and 501 at 68°. In swine tissue ex vivo, the SNR decreased from 80 at 15° to 16 at 61°. In swine tissue in vivo, the SNR varied with depth, from 200 at 17.5 mm to 48 at 26 mm, with a constant insertion angle of 40°. In ovine tissue in vivo, within the uterine cavity, the SNR varied from 46.4 at 25 mm depth to 18.4 at 32 mm depth, with insertion angles in the range of 26°–65°. Conclusions: A fiber-optic ultrasound receiver integrated into the needle cannula in combination with single-element transmissions from the imaging probe allows for direct visualization of the needle tip within the ultrasound imaging plane. Visualization of the needle tip was achieved at depths and insertion angles that are encountered during nerve blocks and fetal interventions. The method presented in this paper has strong potential to improve the safety and efficiency of ultrasound-guided needle insertions.« less

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA-Sec and SECIS) insertion machinery in land plants.

PubMed

Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan

2014-02-25

This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.

Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

PubMed

Rodić, Nemanja; Burns, Kathleen H

2013-03-01

LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

Learning of goal-relevant and -irrelevant complex visual sequences in human V1.

PubMed

Rosenthal, Clive R; Mallik, Indira; Caballero-Gaudes, Cesar; Sereno, Martin I; Soto, David

2018-06-12

Learning and memory are supported by a network involving the medial temporal lobe and linked neocortical regions. Emerging evidence indicates that primary visual cortex (i.e., V1) may contribute to recognition memory, but this has been tested only with a single visuospatial sequence as the target memorandum. The present study used functional magnetic resonance imaging to investigate whether human V1 can support the learning of multiple, concurrent complex visual sequences involving discontinous (second-order) associations. Two peripheral, goal-irrelevant but structured sequences of orientated gratings appeared simultaneously in fixed locations of the right and left visual fields alongside a central, goal-relevant sequence that was in the focus of spatial attention. Pseudorandom sequences were introduced at multiple intervals during the presentation of the three structured visual sequences to provide an online measure of sequence-specific knowledge at each retinotopic location. We found that a network involving the precuneus and V1 was involved in learning the structured sequence presented at central fixation, whereas right V1 was modulated by repeated exposure to the concurrent structured sequence presented in the left visual field. The same result was not found in left V1. These results indicate for the first time that human V1 can support the learning of multiple concurrent sequences involving complex discontinuous inter-item associations, even peripheral sequences that are goal-irrelevant. Copyright © 2018. Published by Elsevier Inc.

Method and Apparatus for Evaluating the Visual Quality of Processed Digital Video Sequences

NASA Technical Reports Server (NTRS)

Watson, Andrew B. (Inventor)

2002-01-01

A Digital Video Quality (DVQ) apparatus and method that incorporate a model of human visual sensitivity to predict the visibility of artifacts. The DVQ method and apparatus are used for the evaluation of the visual quality of processed digital video sequences and for adaptively controlling the bit rate of the processed digital video sequences without compromising the visual quality. The DVQ apparatus minimizes the required amount of memory and computation. The input to the DVQ apparatus is a pair of color image sequences: an original (R) non-compressed sequence, and a processed (T) sequence. Both sequences (R) and (T) are sampled, cropped, and subjected to color transformations. The sequences are then subjected to blocking and discrete cosine transformation, and the results are transformed to local contrast. The next step is a time filtering operation which implements the human sensitivity to different time frequencies. The results are converted to threshold units by dividing each discrete cosine transform coefficient by its respective visual threshold. At the next stage the two sequences are subtracted to produce an error sequence. The error sequence is subjected to a contrast masking operation, which also depends upon the reference sequence (R). The masked errors can be pooled in various ways to illustrate the perceptual error over various dimensions, and the pooled error can be converted to a visual quality measure.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Visual Perceptual Echo Reflects Learning of Regularities in Rapid Luminance Sequences.

PubMed

Chang, Acer Y-C; Schwartzman, David J; VanRullen, Rufin; Kanai, Ryota; Seth, Anil K

2017-08-30

A novel neural signature of active visual processing has recently been described in the form of the "perceptual echo", in which the cross-correlation between a sequence of randomly fluctuating luminance values and occipital electrophysiological signals exhibits a long-lasting periodic (∼100 ms cycle) reverberation of the input stimulus (VanRullen and Macdonald, 2012). As yet, however, the mechanisms underlying the perceptual echo and its function remain unknown. Reasoning that natural visual signals often contain temporally predictable, though nonperiodic features, we hypothesized that the perceptual echo may reflect a periodic process associated with regularity learning. To test this hypothesis, we presented subjects with successive repetitions of a rapid nonperiodic luminance sequence, and examined the effects on the perceptual echo, finding that echo amplitude linearly increased with the number of presentations of a given luminance sequence. These data suggest that the perceptual echo reflects a neural signature of regularity learning.Furthermore, when a set of repeated sequences was followed by a sequence with inverted luminance polarities, the echo amplitude decreased to the same level evoked by a novel stimulus sequence. Crucially, when the original stimulus sequence was re-presented, the echo amplitude returned to a level consistent with the number of presentations of this sequence, indicating that the visual system retained sequence-specific information, for many seconds, even in the presence of intervening visual input. Altogether, our results reveal a previously undiscovered regularity learning mechanism within the human visual system, reflected by the perceptual echo. SIGNIFICANCE STATEMENT How the brain encodes and learns fast-changing but nonperiodic visual input remains unknown, even though such visual input characterizes natural scenes. We investigated whether the phenomenon of "perceptual echo" might index such learning. The perceptual echo is a long-lasting reverberation between a rapidly changing visual input and evoked neural activity, apparent in cross-correlations between occipital EEG and stimulus sequences, peaking in the alpha (∼10 Hz) range. We indeed found that perceptual echo is enhanced by repeatedly presenting the same visual sequence, indicating that the human visual system can rapidly and automatically learn regularities embedded within fast-changing dynamic sequences. These results point to a previously undiscovered regularity learning mechanism, operating at a rate defined by the alpha frequency. Copyright © 2017 the authors 0270-6474/17/378486-12$15.00/0.

Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

PubMed Central

Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

2015-01-01

To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.

PubMed

Park, Yungki; Helms, Volkhard

2008-08-15

To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.

Structure of yeast Argonaute with guide RNA

PubMed Central

Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

2012-01-01

The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

Identification of genomic indels and structural variations using split reads

PubMed Central

2011-01-01

Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

PubMed

Kietrys, Anna M; Velema, Willem A; Kool, Eric T

2017-11-29

Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.

PubMed

Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique

2012-12-01

A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.

Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

PubMed

Ehrmann, M A; Vogel, R E

2001-11-01

An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.

PubMed

Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J

2017-05-01

Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae):Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid

USDA-ARS?s Scientific Manuscript database

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

Memory and learning with rapid audiovisual sequences

PubMed Central

Keller, Arielle S.; Sekuler, Robert

2015-01-01

We examined short-term memory for sequences of visual stimuli embedded in varying multisensory contexts. In two experiments, subjects judged the structure of the visual sequences while disregarding concurrent, but task-irrelevant auditory sequences. Stimuli were eight-item sequences in which varying luminances and frequencies were presented concurrently and rapidly (at 8 Hz). Subjects judged whether the final four items in a visual sequence identically replicated the first four items. Luminances and frequencies in each sequence were either perceptually correlated (Congruent) or were unrelated to one another (Incongruent). Experiment 1 showed that, despite encouragement to ignore the auditory stream, subjects' categorization of visual sequences was strongly influenced by the accompanying auditory sequences. Moreover, this influence tracked the similarity between a stimulus's separate audio and visual sequences, demonstrating that task-irrelevant auditory sequences underwent a considerable degree of processing. Using a variant of Hebb's repetition design, Experiment 2 compared musically trained subjects and subjects who had little or no musical training on the same task as used in Experiment 1. Test sequences included some that intermittently and randomly recurred, which produced better performance than sequences that were generated anew for each trial. The auditory component of a recurring audiovisual sequence influenced musically trained subjects more than it did other subjects. This result demonstrates that stimulus-selective, task-irrelevant learning of sequences can occur even when such learning is an incidental by-product of the task being performed. PMID:26575193

Memory and learning with rapid audiovisual sequences.

PubMed

Keller, Arielle S; Sekuler, Robert

2015-01-01

We examined short-term memory for sequences of visual stimuli embedded in varying multisensory contexts. In two experiments, subjects judged the structure of the visual sequences while disregarding concurrent, but task-irrelevant auditory sequences. Stimuli were eight-item sequences in which varying luminances and frequencies were presented concurrently and rapidly (at 8 Hz). Subjects judged whether the final four items in a visual sequence identically replicated the first four items. Luminances and frequencies in each sequence were either perceptually correlated (Congruent) or were unrelated to one another (Incongruent). Experiment 1 showed that, despite encouragement to ignore the auditory stream, subjects' categorization of visual sequences was strongly influenced by the accompanying auditory sequences. Moreover, this influence tracked the similarity between a stimulus's separate audio and visual sequences, demonstrating that task-irrelevant auditory sequences underwent a considerable degree of processing. Using a variant of Hebb's repetition design, Experiment 2 compared musically trained subjects and subjects who had little or no musical training on the same task as used in Experiment 1. Test sequences included some that intermittently and randomly recurred, which produced better performance than sequences that were generated anew for each trial. The auditory component of a recurring audiovisual sequence influenced musically trained subjects more than it did other subjects. This result demonstrates that stimulus-selective, task-irrelevant learning of sequences can occur even when such learning is an incidental by-product of the task being performed.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Differentiating Visual from Response Sequencing during Long-term Skill Learning.

PubMed

Lynch, Brighid; Beukema, Patrick; Verstynen, Timothy

2017-01-01

The dual-system model of sequence learning posits that during early learning there is an advantage for encoding sequences in sensory frames; however, it remains unclear whether this advantage extends to long-term consolidation. Using the serial RT task, we set out to distinguish the dynamics of learning sequential orders of visual cues from learning sequential responses. On each day, most participants learned a new mapping between a set of symbolic cues and responses made with one of four fingers, after which they were exposed to trial blocks of either randomly ordered cues or deterministic ordered cues (12-item sequence). Participants were randomly assigned to one of four groups (n = 15 per group): Visual sequences (same sequence of visual cues across training days), Response sequences (same order of key presses across training days), Combined (same serial order of cues and responses on all training days), and a Control group (a novel sequence each training day). Across 5 days of training, sequence-specific measures of response speed and accuracy improved faster in the Visual group than any of the other three groups, despite no group differences in explicit awareness of the sequence. The two groups that were exposed to the same visual sequence across days showed a marginal improvement in response binding that was not found in the other groups. These results indicate that there is an advantage, in terms of rate of consolidation across multiple days of training, for learning sequences of actions in a sensory representational space, rather than as motoric representations.

BlockLogo: visualization of peptide and sequence motif conservation

PubMed Central

Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian; Sun, Jing; Schönbach, Christian; Reinherz, Ellis L.; Zhang, Guang Lan; Brusic, Vladimir

2013-01-01

BlockLogo is a web-server application for visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, selection of motif positions, type of sequence, and output format definition. The output has BlockLogo along with the sequence logo, and a table of motif frequencies. We deployed BlockLogo as an online application and have demonstrated its utility through examples that show visualization of T-cell epitopes and B-cell epitopes (both continuous and discontinuous). Our additional example shows a visualization and analysis of structural motifs that determine specificity of peptide binding to HLA-DR molecules. The BlockLogo server also employs selected experimentally validated prediction algorithms to enable on-the-fly prediction of MHC binding affinity to 15 common HLA class I and class II alleles as well as visual analysis of discontinuous epitopes from multiple sequence alignments. It enables the visualization and analysis of structural and functional motifs that are usually described as regular expressions. It provides a compact view of discontinuous motifs composed of distant positions within biological sequences. BlockLogo is available at: http://research4.dfci.harvard.edu/cvc/blocklogo/ and http://methilab.bu.edu/blocklogo/ PMID:24001880

Integration of soft tissue model and open haptic device for medical training simulator

NASA Astrophysics Data System (ADS)

Akasum, G. F.; Ramdhania, L. N.; Suprijanto; Widyotriatmo, A.

2016-03-01

Minimally Invasive Surgery (MIS) has been widely used to perform any surgical procedures nowadays. Currently, MIS has been applied in some cases in Indonesia. Needle insertion is one of simple MIS procedure that can be used for some purposes. Before the needle insertion technique used in the real situation, it essential to train this type of medical student skills. The research has developed an open platform of needle insertion simulator with haptic feedback that providing the medical student a realistic feel encountered during the actual procedures. There are three main steps in build the training simulator, which are configure hardware system, develop a program to create soft tissue model and the integration of hardware and software. For evaluating its performance, haptic simulator was tested by 24 volunteers on a scenario of soft tissue model. Each volunteer must insert the needle on simulator until rearch the target point with visual feedback that visualized on the monitor. From the result it can concluded that the soft tissue model can bring the sensation of touch through the perceived force feedback on haptic actuator by looking at the different force in accordance with different stiffness in each layer.

Increased Content Knowledge of Students with Visual Impairments as a Result of Extended Descriptions

ERIC Educational Resources Information Center

Ely, Richard; Emerson, Robert Wall; Maggiore, Theresa; Rothberg, Madeleine; O'Connell, Trisha; Hudson, Laurel

2006-01-01

The National Center for Accessible Media has developed a technology and protocol for inserting extended, enhanced descriptions of visually based concepts into artificially paused digital video. These "eDescriptions" describe material not fully explained by a narrator and provide analogies and explanation specifically designed for…

Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

PubMed Central

Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

PubMed

Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Human visual system-based color image steganography using the contourlet transform

NASA Astrophysics Data System (ADS)

Abdul, W.; Carré, P.; Gaborit, P.

2010-01-01

We present a steganographic scheme based on the contourlet transform which uses the contrast sensitivity function (CSF) to control the force of insertion of the hidden information in a perceptually uniform color space. The CIELAB color space is used as it is well suited for steganographic applications because any change in the CIELAB color space has a corresponding effect on the human visual system as is very important for steganographic schemes to be undetectable by the human visual system (HVS). The perceptual decomposition of the contourlet transform gives it a natural advantage over other decompositions as it can be molded with respect to the human perception of different frequencies in an image. The evaluation of the imperceptibility of the steganographic scheme with respect to the color perception of the HVS is done using standard methods such as the structural similarity (SSIM) and CIEDE2000. The robustness of the inserted watermark is tested against JPEG compression.

Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

PubMed

Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

2016-10-15

Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-02-15

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed Central

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-01-01

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

PubMed Central

Xiong, Y; Eickbush, T H

1988-01-01

Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species.

PubMed

Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin

2014-06-20

MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea, characterization of mTEs and building a curated database are prerequisite to extending their utilization for genomics and applied fields in Brassica crops. We have developed BrassicaTED as a unique web portal containing detailed characterization information for mTEs of Brassica species. At present, BrassicaTED has datasets for 41 mTE families, including 5894 and 6026 members from 20 MITE families, 1393 and 1639 members from 5 TRIM families, 1270 and 2364 members from 16 SINE families in B. rapa and B. oleracea, respectively. BrassicaTED offers different sections to browse structural and positional characteristics for every mTE family. In addition, we have added data on 289 MITE insertion polymorphisms from a survey of seven Brassica relatives. Genes with internal mTE insertions are shown with detailed gene annotation and microarray-based comparative gene expression data in comparison with their paralogs in the triplicated B. rapa genome. This database also includes a novel tool, K BLAST (Karyotype BLAST), for clear visualization of the locations for each member in the B. rapa and B. oleracea pseudo-genome sequences. BrassicaTED is a newly developed database of information regarding the characteristics and potential utility of mTEs including MITE, TRIM and SINEs in B. rapa and B. oleracea. The database will promote the development of desirable mTE-based markers, which can be utilized for genomics and breeding in Brassica species. BrassicaTED will be a valuable repository for scientists and breeders, promoting efficient research on Brassica species. BrassicaTED can be accessed at http://im-crop.snu.ac.kr/BrassicaTED/index.php.

A method for automatically abstracting visual documents

NASA Technical Reports Server (NTRS)

Rorvig, Mark E.

1994-01-01

Visual documents--motion sequences on film, videotape, and digital recording--constitute a major source of information for the Space Agency, as well as all other government and private sector entities. This article describes a method for automatically selecting key frames from visual documents. These frames may in turn be used to represent the total image sequence of visual documents in visual libraries, hypermedia systems, and training algorithm reduces 51 minutes of video sequences to 134 frames; a reduction of information in the range of 700:1.

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

Analysis of BAC end sequences in oak, a keystone forest tree species, providing insight into the composition of its genome

PubMed Central

2011-01-01

Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357

Mobile in vivo camera robots provide sole visual feedback for abdominal exploration and cholecystectomy.

PubMed

Rentschler, M E; Dumpert, J; Platt, S R; Ahmed, S I; Farritor, S M; Oleynikov, D

2006-01-01

The use of small incisions in laparoscopy reduces patient trauma, but also limits the surgeon's ability to view and touch the surgical environment directly. These limitations generally restrict the application of laparoscopy to procedures less complex than those performed during open surgery. Although current robot-assisted laparoscopy improves the surgeon's ability to manipulate and visualize the target organs, the instruments and cameras remain fundamentally constrained by the entry incisions. This limits tool tip orientation and optimal camera placement. The current work focuses on developing a new miniature mobile in vivo adjustable-focus camera robot to provide sole visual feedback to surgeons during laparoscopic surgery. A miniature mobile camera robot was inserted through a trocar into the insufflated abdominal cavity of an anesthetized pig. The mobile robot allowed the surgeon to explore the abdominal cavity remotely and view trocar and tool insertion and placement without entry incision constraints. The surgeon then performed a cholecystectomy using the robot camera alone for visual feedback. This successful trial has demonstrated that miniature in vivo mobile robots can provide surgeons with sufficient visual feedback to perform common procedures while reducing patient trauma.

Structural features of the rice chromosome 4 centromere.

PubMed

Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin

2004-01-01

A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.

Computational allergenicity prediction of transgenic proteins expressed in genetically modified crops.

PubMed

Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D

2011-09-01

Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.

MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2018-03-05

Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.

SvABA: genome-wide detection of structural variants and indels by local assembly.

PubMed

Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen

2018-04-01

Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.

Optical mapping and its potential for large-scale sequencing projects.

PubMed

Aston, C; Mishra, B; Schwartz, D C

1999-07-01

Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.

Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

PubMed Central

Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

2014-01-01

Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

BACCardI--a tool for the validation of genomic assemblies, assisting genome finishing and intergenome comparison.

PubMed

Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C

2005-04-01

We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.

Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

PubMed Central

Harden, N.; Ashburner, M.

1990-01-01

FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

Images created in a model eye during simulated cataract surgery can be the basis for images perceived by patients during cataract surgery

PubMed Central

Inoue, M; Uchida, A; Shinoda, K; Taira, Y; Noda, T; Ohnuma, K; Bissen-Miyajima, H; Hirakata, A

2014-01-01

Purpose To evaluate the images created in a model eye during simulated cataract surgery. Patients and methods This study was conducted as a laboratory investigation and interventional case series. An artificial opaque lens, a clear intraocular lens (IOL), or an irrigation/aspiration (I/A) tip was inserted into the ‘anterior chamber' of a model eye with the frosted posterior surface corresponding to the retina. Video images were recorded of the posterior surface of the model eye from the rear during simulated cataract surgery. The video clips were shown to 20 patients before cataract surgery, and the similarity of their visual perceptions to these images was evaluated postoperatively. Results The images of the moving lens fragments and I/A tip and the insertion of the IOL were seen from the rear. The image through the opaque lens and the IOL without moving objects was the light of the surgical microscope from the rear. However, when the microscope light was turned off after IOL insertion, the images of the microscope and operating room were observed by the room illumination from the rear. Seventy percent of the patients answered that the visual perceptions of moving lens fragments were similar to the video clips and 55% reported similarity with the IOL insertion. Eighty percent of the patients recommended that patients watch the video clip before their scheduled cataract surgery. Conclusions The patients' visual perceptions during cataract surgery can be reproduced in the model eye. Watching the video images preoperatively may help relax the patients during surgery. PMID:24788007

Genome-wide analysis of Tol2 transposon reintegration in zebrafish.

PubMed

Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir

2009-09-08

Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

Evaluation of a novel, ultrathin, tip-bending endoscope in a synthetic force-sensing pancreas with comparison to medical guide wires

PubMed Central

Chandler, John E; Lee, Cameron M; Babchanik, Alexander P; Melville, C David; Saunders, Michael D; Seibel, Eric J

2012-01-01

Purpose Direct visualization of pancreatic ductal tissue is critical for early diagnosis of pancreatic diseases and for guiding therapeutic interventions. A novel, ultrathin (5 Fr) scanning fiber endoscope (SFE) with tip-bending capability has been developed specifically to achieve high resolution imaging as a pancreatoscope during endoscopic retrograde cholangiopancreatography (ERCP). This device has potential to dramatically improve both diagnostic and therapeutic capabilities during ERCP by providing direct video feedback and tool guidance to clinicians. Methods Invasiveness of the new tip-bending SFE was evaluated by a performance comparison to ERCP guide wires, which are routinely inserted into the pancreatic duct during ERCP. An in vitro test model with four force sensors embedded in a synthetic pancreas was designed to detect and compare the insertion forces for 0.89 mm and 0.53 mm diameter guide wires as well as the 1.7 mm diameter SFE. Insertions were performed through the working channel of a therapeutic duodenoscope for the two types of guide wires and using a statistically similar direct insertion method for comparison to the SFE. Results Analysis of the forces detected by the sensors showed the smaller diameter 0.53 mm wire produced significantly less average and maximum forces during insertion than the larger diameter 0.89 mm wire. With the use of tip-bending and optical visualization, the 1.7 mm diameter SFE produced significantly less average force during insertion than the 0.89 mm wire at every sensor, despite its larger size. It was further shown that the use of tip-bending with the SFE significantly reduced the forces at all sensors, compared to insertions when tip-bending was not used. Conclusion Combining high quality video imaging with two-axis tip-bending allows a larger diameter guide wire-style device to be inserted into the pancreatic duct during ERCP with improved capacity to perform diagnostics and therapy. PMID:23166452

Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

PubMed

Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

2016-12-07

Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Clostridium perfringens type A–E toxin plasmids

PubMed Central

Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

2014-01-01

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

The topography of mutational processes in breast cancer genomes.

PubMed

Morganella, Sandro; Alexandrov, Ludmil B; Glodzik, Dominik; Zou, Xueqing; Davies, Helen; Staaf, Johan; Sieuwerts, Anieta M; Brinkman, Arie B; Martin, Sancha; Ramakrishna, Manasa; Butler, Adam; Kim, Hyung-Yong; Borg, Åke; Sotiriou, Christos; Futreal, P Andrew; Campbell, Peter J; Span, Paul N; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E; Thompson, Alastair M; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W M; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Kong, Gu; Thomas, Gilles; Sale, Julian; Rada, Cristina; Stratton, Michael R; Birney, Ewan; Nik-Zainal, Serena

2016-05-02

Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription, DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Furthermore, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.

Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

PubMed

Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

2015-11-18

RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

PubMed Central

Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

2005-01-01

Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

Development and characterization of simple sequence repeats for Bipolaris sokiniana and cross transferability to related species

USDA-ARS?s Scientific Manuscript database

Simple sequence repeats (SSR) markers were developed from a small insert genomic library for Bipolaris sorokiniana, a mitosporic fungal pathogen that causes spot blotch and root rot in switchgrass. About 59% of sequenced clones (n=384) harbored various SSR motifs. After eliminating the redundant seq...

Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

PubMed Central

Shih, Arthur Chun-Chieh; Lee, DT; Peng, Chin-Lin; Wu, Yu-Wei

2007-01-01

Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL . PMID:17319966

Increasing genomic diversity and evidence of constrained lifestyle evolution due to insertion sequences in Aeromonas salmonicida.

PubMed

Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J

2016-01-12

Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.

ProfileGrids: a sequence alignment visualization paradigm that avoids the limitations of Sequence Logos.

PubMed

Roca, Alberto I

2014-01-01

The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org.

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

Developing a de novo targeted knock-in method based on in utero electroporation into the mammalian brain.

PubMed

Tsunekawa, Yuji; Terhune, Raymond Kunikane; Fujita, Ikumi; Shitamukai, Atsunori; Suetsugu, Taeko; Matsuzaki, Fumio

2016-09-01

Genome-editing technology has revolutionized the field of biology. Here, we report a novel de novo gene-targeting method mediated by in utero electroporation into the developing mammalian brain. Electroporation of donor DNA with the CRISPR/Cas9 system vectors successfully leads to knock-in of the donor sequence, such as EGFP, to the target site via the homology-directed repair mechanism. We developed a targeting vector system optimized to prevent anomalous leaky expression of the donor gene from the plasmid, which otherwise often occurs depending on the donor sequence. The knock-in efficiency of the electroporated progenitors reached up to 40% in the early stage and 20% in the late stage of the developing mouse brain. Furthermore, we inserted different fluorescent markers into the target gene in each homologous chromosome, successfully distinguishing homozygous knock-in cells by color. We also applied this de novo gene targeting to the ferret model for the study of complex mammalian brains. Our results demonstrate that this technique is widely applicable for monitoring gene expression, visualizing protein localization, lineage analysis and gene knockout, all at the single-cell level, in developmental tissues. © 2016. Published by The Company of Biologists Ltd.

A noninvasive brain computer interface using visually-induced near-infrared spectroscopy responses.

PubMed

Chen, Cheng-Hsuan; Ho, Ming-Shan; Shyu, Kuo-Kai; Hsu, Kou-Cheng; Wang, Kuo-Wei; Lee, Po-Lei

2014-09-19

Visually-induced near-infrared spectroscopy (NIRS) response was utilized to design a brain computer interface (BCI) system. Four circular checkerboards driven by distinct flickering sequences were displayed on a LCD screen as visual stimuli to induce subjects' NIRS responses. Each flickering sequence was a concatenated sequence of alternative flickering segments and resting segments. The flickering segment was designed with fixed duration of 3s whereas the resting segment was chosen randomly within 15-20s to create the mutual independencies among different flickering sequences. Six subjects were recruited in this study and subjects were requested to gaze at the four visual stimuli one-after-one in a random order. Since visual responses in human brain are time-locked to the onsets of visual stimuli and the flicker sequences of distinct visual stimuli were designed mutually independent, the NIRS responses induced by user's gazed targets can be discerned from non-gazed targets by applying a simple averaging process. The accuracies for the six subjects were higher than 90% after 10 or more epochs being averaged. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Continuous Influx of Genetic Material from Host to Virus Populations

PubMed Central

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane

2016-01-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124

Continuous Influx of Genetic Material from Host to Virus Populations.

PubMed

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A

2016-02-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

Laparoscopic insertion of artificial periprostatic urinary sphincter.

PubMed

Gamé, Xavier; Bram, Raphael; Abu Anz, Sami; Doumerc, Nicolas; Guillotreau, Julien; Malavaud, Bernard; Rischmann, Pascal

2009-02-01

The objective of this case report is to describe the laparoscopic insertion of an artificial periprostatic urinary sphincter. We report the case of a paraplegic patient in whom an artificial urinary sphincter was inserted in a periprostatic position by way of laparoscopy to treat stress urinary incontinence. In addition to laparoscopy being minimally invasive, its advantages include the excellent quality of retroprostatic dissection and the perfect visualization it gives at the level of cuff positioning with respect to the anatomic landmarks. It is more appropriate to be able to cleave the interprostatorectal space to ensure passage of the cuff under perfectly safe conditions.

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Heteroleptic tin(II) initiators for the ring-opening (co)polymerization of lactide and trimethylene carbonate: mechanistic insights from experiments and computations.

PubMed

Wang, Lingfang; Kefalidis, Christos E; Sinbandhit, Sourisak; Dorcet, Vincent; Carpentier, Jean-François; Maron, Laurent; Sarazin, Yann

2013-09-27

The tin(II) complexes {LO(x)}Sn(X) ({LO(x)}(-) =aminophenolate ancillary) containing amido (1-4), chloro (5), or lactyl (6) coligands (X) promote the ring-opening polymerization (ROP) of cyclic esters. Complex 6, which models the first insertion of L-lactide, initiates the living ROP of L-LA on its own, but the amido derivatives 1-4 require the addition of alcohol to do so. Upon addition of one to ten equivalents of iPrOH, precatalysts 1-4 promote the ROP of trimethylene carbonate (TMC); yet, hardly any activity is observed if tert-butyl (R)-lactate is used instead of iPrOH. Strong inhibition of the reactivity of TMC is also detected for the simultaneous copolymerization of L-LA and TMC, or for the block copolymerization of TMC after that of L-LA. Experimental and computational data for the {LO(x)}Sn(OR)complexes (OR=lactyl or lactidyl) replicating the active species during the tin(II)-mediated ROP of L-LA demonstrate that the formation of a five-membered chelate is largely favored over that of an eight-membered one, and that it constitutes the resting state of the catalyst during this (co)polymerization. Comprehensive DFT calculations show that, out of the four possible monomer insertion sequences during simultaneous copolymerization of L-LA and TMC: 1) TMC then TMC, 2) TMC then L-LA, 3) L-LA then L-LA, and 4) L-LA then TMC, the first three are possible. By contrast, insertion of L-LA followed by that of TMC (i.e., insertion sequence 4) is endothermic by +1.1 kcal mol(-1), which compares unfavorably with consecutive insertions of two L-LA units (i.e., insertion sequence 3) (-10.2 kcal mol(-1)). The copolymerization of L-LA and TMC thus proceeds under thermodynamic control. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

PubMed

Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

2017-12-01

Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

Insertion Sequences

PubMed Central

Mahillon, Jacques; Chandler, Michael

1998-01-01

Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

PubMed Central

Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

2013-01-01

Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants.

PubMed

Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F

2015-07-08

Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.

Investigating Delamination Migration in Composite Tape Laminates

NASA Technical Reports Server (NTRS)

Ratcliffe, James G.; DeCarvalho, Nelson V.

2014-01-01

A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence

PubMed Central

Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.

2014-01-01

Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068

Distinct Bacteriophages Encoding Panton-Valentine Leukocidin (PVL) among International Methicillin-Resistant Staphylococcus aureus Clones Harboring PVL▿

PubMed Central

Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.

2011-01-01

Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787

Structural diversity of domain superfamilies in the CATH database.

PubMed

Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A

2006-07-14

The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).

Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan

Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

PubMed

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Phylo-VISTA: Interactive visualization of multiple DNA sequence alignments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shah, Nameeta; Couronne, Olivier; Pennacchio, Len A.

The power of multi-sequence comparison for biological discovery is well established. The need for new capabilities to visualize and compare cross-species alignment data is intensified by the growing number of genomic sequence datasets being generated for an ever-increasing number of organisms. To be efficient these visualization algorithms must support the ability to accommodate consistently a wide range of evolutionary distances in a comparison framework based upon phylogenetic relationships. Results: We have developed Phylo-VISTA, an interactive tool for analyzing multiple alignments by visualizing a similarity measure for multiple DNA sequences. The complexity of visual presentation is effectively organized using a frameworkmore » based upon interspecies phylogenetic relationships. The phylogenetic organization supports rapid, user-guided interspecies comparison. To aid in navigation through large sequence datasets, Phylo-VISTA leverages concepts from VISTA that provide a user with the ability to select and view data at varying resolutions. The combination of multiresolution data visualization and analysis, combined with the phylogenetic framework for interspecies comparison, produces a highly flexible and powerful tool for visual data analysis of multiple sequence alignments. Availability: Phylo-VISTA is available at http://www-gsd.lbl. gov/phylovista. It requires an Internet browser with Java Plugin 1.4.2 and it is integrated into the global alignment program LAGAN at http://lagan.stanford.edu« less

Retrospective comparison of three-dimensional imaging sequences in the visualization of posterior fossa cranial nerves.

PubMed

Ors, Suna; Inci, Ercan; Turkay, Rustu; Kokurcan, Atilla; Hocaoglu, Elif

2017-12-01

To compare efficancy of three-dimentional SPACE (sampling perfection with application-optimized contrasts using different flip-angle evolutions) and CISS (constructive interference in steady state) sequences in the imaging of the cisternal segments of cranial nerves V-XII. Temporal MRI scans from 50 patients (F:M ratio, 27:23; mean age, 44.5±15.9 years) admitted to our hospital with vertigo, tinnitus, and hearing loss were retrospectively analyzed. All patients had both CISS and SPACE sequences. Quantitative analysis of SPACE and CISS sequences was performed by measuring the ventricle-to-parenchyma contrast-to-noise ratio (CNR). Qualitative analysis of differences in visualization capability, image quality, and severity of artifacts was also conducted. A score ranging 'no artefact' to 'severe artefacts and unreadable' was used for the assessment of artifacts and from 'not visualized' to 'completely visualized' for the assesment of image quality, respectively. The distribution of variables was controlled by the Kolmogorov-Smirnov test. Samples t-test and McNemar's test were used to determine statistical significance. Rates of visualization of posterior fossa cranial nerves in cases of complete visualization were as follows: nerve V (100% for both sequences), nerve VI (94% in SPACE, 86% in CISS sequences), nerves VII-VIII (100% for both sequences), IX-XI nerve complex (96%, 88%); nerve XII (58%, 46%) (p<0.05). SPACE sequences showed fewer artifacts than CISS sequences (p<0.002). Copyright © 2017 Elsevier B.V. All rights reserved.

Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.

PubMed

Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio

2017-08-31

In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.

MR Performance Comparison of a PET/MR System Before and After SiPM-Based Time-of-Flight PET Detector Insertion

NASA Astrophysics Data System (ADS)

Khalighi, Mohammad Mehdi; Delso, Gaspar; Maramraju, Sri Harsha; Deller, Timothy W.; Levin, Craig S.; Glover, Gary H.

2016-10-01

A silicon photomultiplier (SiPM)-based time-of-flight capable PET detector has been integrated with a 70 cm wide-bore 3T MR scanner for simultaneous whole-body imaging (MR750w, GE Healthcare, Waukesha, WI). After insertion of the PET detector, the final PET/MR bore is 60 cm wide (SIGNA PET/MR, GE Healthcare, Waukesha, WI). The MR performance was compared before and after the PET ring insertion. B0 homogeneity, B1+ uniformity of the body coil along with peak B1+, coherent noise, and FBIRN (Function Biomedical Informatics Research Network) tests are used to compare the MR performance. It is shown that B0 homogeneity and coherent noise have not changed according to the system specifications. Peak B1+ is increased by 33% and B1+ inhomogeneity is increased by 4% after PET ring insertion due to a smaller diameter body coil design. The FBIRN test shows similar temporal stability before and after PET ring insertion. Due to a smaller body coil on the PET/MR system, the signal fluctuation to noise ratio (SFNR) and SNR for body receive coil, are improved by 40% and 160% for Echo Planar Imaging (EPI) and spiral sequences respectively. Comparison using RF- and gradient-intensive clinical sequences shows inserting the PET detectors into the wide-bore MRI has not compromised the MR image quality according to these tests.

Self-Organizing Hidden Markov Model Map (SOHMMM): Biological Sequence Clustering and Cluster Visualization.

PubMed

Ferles, Christos; Beaufort, William-Scott; Ferle, Vanessa

2017-01-01

The present study devises mapping methodologies and projection techniques that visualize and demonstrate biological sequence data clustering results. The Sequence Data Density Display (SDDD) and Sequence Likelihood Projection (SLP) visualizations represent the input symbolical sequences in a lower-dimensional space in such a way that the clusters and relations of data elements are depicted graphically. Both operate in combination/synergy with the Self-Organizing Hidden Markov Model Map (SOHMMM). The resulting unified framework is in position to analyze automatically and directly raw sequence data. This analysis is carried out with little, or even complete absence of, prior information/domain knowledge.

Visual management of large scale data mining projects.

PubMed

Shah, I; Hunter, L

2000-01-01

This paper describes a unified framework for visualizing the preparations for, and results of, hundreds of machine learning experiments. These experiments were designed to improve the accuracy of enzyme functional predictions from sequence, and in many cases were successful. Our system provides graphical user interfaces for defining and exploring training datasets and various representational alternatives, for inspecting the hypotheses induced by various types of learning algorithms, for visualizing the global results, and for inspecting in detail results for specific training sets (functions) and examples (proteins). The visualization tools serve as a navigational aid through a large amount of sequence data and induced knowledge. They provided significant help in understanding both the significance and the underlying biological explanations of our successes and failures. Using these visualizations it was possible to efficiently identify weaknesses of the modular sequence representations and induction algorithms which suggest better learning strategies. The context in which our data mining visualization toolkit was developed was the problem of accurately predicting enzyme function from protein sequence data. Previous work demonstrated that approximately 6% of enzyme protein sequences are likely to be assigned incorrect functions on the basis of sequence similarity alone. In order to test the hypothesis that more detailed sequence analysis using machine learning techniques and modular domain representations could address many of these failures, we designed a series of more than 250 experiments using information-theoretic decision tree induction and naive Bayesian learning on local sequence domain representations of problematic enzyme function classes. In more than half of these cases, our methods were able to perfectly discriminate among various possible functions of similar sequences. We developed and tested our visualization techniques on this application.

Evaluating Documents: The Case of Patient Package Inserts. Technical Report No. 2.

ERIC Educational Resources Information Center

Krug, Robert E.

To illustrate the types of factors that must be considered in evaluating public documents, this paper analyzes a number of possible outcomes resulting from one type of document, the patient package insert (PPI) designed to provide consumers of prescription drugs with information about the drugs. It first outlines the intended sequence for a PPI:…

Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device

NASA Astrophysics Data System (ADS)

Färber, Matthias; Heller, Julika; Handels, Heinz

2007-03-01

The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.

Getting a cue before getting a clue: Event-related potentials to inference in visual narrative comprehension

PubMed Central

Cohn, Neil; Kutas, Marta

2015-01-01

Inference has long been emphasized in the comprehension of verbal and visual narratives. Here, we measured event-related brain potentials to visual sequences designed to elicit inferential processing. In Impoverished sequences, an expressionless “onlooker” watches an undepicted event (e.g., person throws a ball for a dog, then watches the dog chase it) just prior to a surprising finale (e.g., someone else returns the ball), which should lead to an inference (i.e., the different person retrieved the ball). Implied sequences alter this narrative structure by adding visual cues to the critical panel such as a surprised facial expression to the onlooker implying they saw an unexpected, albeit undepicted, event. In contrast, Expected sequences show a predictable, but then confounded, event (i.e., dog retrieves ball, then different person returns it), and Explicit sequences depict the unexpected event (i.e., different person retrieves then returns ball). At the critical penultimate panel, sequences representing depicted events (Explicit, Expected) elicited a larger posterior positivity (P600) than the relatively passive events of an onlooker (Impoverished, Implied), though Implied sequences were slightly more positive than Impoverished sequences. At the subsequent and final panel, a posterior positivity (P600) was greater to images in Impoverished sequences than those in Explicit and Implied sequences, which did not differ. In addition, both sequence types requiring inference (Implied, Impoverished) elicited a larger frontal negativity than those explicitly depicting events (Expected, Explicit). These results show that neural processing differs for visual narratives omitting events versus those depicting events, and that the presence of subtle visual cues can modulate such effects presumably by altering narrative structure. PMID:26320706

Comparative sequence analysis revealed altered chromosomal organization and a novel insertion sequence encoding DNA modification and potentially stress-related functions in an Escherichia coli O157:H7 foodborne isolate

USDA-ARS?s Scientific Manuscript database

We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...

Unlocking Short Read Sequencing for Metagenomics

DOE PAGES

Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...

2010-07-28

We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

ProfileGrids: a sequence alignment visualization paradigm that avoids the limitations of Sequence Logos

PubMed Central

2014-01-01

Background The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. Results The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. Conclusions The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org. PMID:25237393

Simultaneous message framing and error detection

NASA Technical Reports Server (NTRS)

Frey, A. H., Jr.

1968-01-01

Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.

Portable disposable ultrathin endoscopy tested through percutaneous endoscopic gastrostomy.

PubMed

Baeg, Myong Ki; Lim, Chul-Hyun; Kim, Jin Su; Cho, Yu Kyung; Park, Jae Myung; Lee, Bo-In; Lee, In-Seok; Choi, Myung-Gyu

2016-11-01

A portable disposable ultrathin endoscope (DUE) with high visual quality and maneuverability would reduce the need for expensive facilities and emergency endoscopy could be available anywhere. It would increase patient satisfaction, prevent unnecessary sedation, and reduce infection. Our aim was to evaluate the usefulness of portable DUE in performing percutaneous endoscopic gastrostomy (PEG). We prospectively enrolled patients who underwent PEG under DUE guidance and compared them with historical controls who underwent PEG under conventional ultrathin endoscopy (CUE) guidance. The primary outcomes were successful stomach visualization and PEG tube insertion. Twenty-five patients (19 male) were enrolled and compared with 25 gender and indication-matched controls. The most common indications for PEG were aspiration due to stroke or brain injury, dementia, and head and neck cancer. Entrance into the stomach was achieved in 92.0% (23/25) and 96% (24/25) in the DUE and CUE groups, and PEG was performed in 91.3% (21/23) and 95.8% (23/24), respectively. The mean insertion time for the DUE and CUE groups were 22.7 ± 9.3 minutes and 17.1 ± 5.7 minutes (P = 0.044). The 3 cases of failure to reach the stomach in both groups were caused by esophageal blockage. The 3 cases of failed PEG tube insertion were caused by poor visualization of the insertion site. Bleeding and pneumoperitoneum occurred in 1 and 2 patients in the DUE group. One case of fever was noted in the CUE group. All adverse events were conservatively managed. Our study shows that portable DUE in facilities without endoscopy equipment may be clinically feasible.

Portable disposable ultrathin endoscopy tested through percutaneous endoscopic gastrostomy

PubMed Central

Baeg, Myong Ki; Lim, Chul-Hyun; Kim, Jin Su; Cho, Yu Kyung; Park, Jae Myung; Lee, Bo-In; Lee, In-Seok; Choi, Myung-Gyu

2016-01-01

Abstract Background: A portable disposable ultrathin endoscope (DUE) with high visual quality and maneuverability would reduce the need for expensive facilities and emergency endoscopy could be available anywhere. It would increase patient satisfaction, prevent unnecessary sedation, and reduce infection. Our aim was to evaluate the usefulness of portable DUE in performing percutaneous endoscopic gastrostomy (PEG). Methods: We prospectively enrolled patients who underwent PEG under DUE guidance and compared them with historical controls who underwent PEG under conventional ultrathin endoscopy (CUE) guidance. The primary outcomes were successful stomach visualization and PEG tube insertion. Results: Twenty-five patients (19 male) were enrolled and compared with 25 gender and indication-matched controls. The most common indications for PEG were aspiration due to stroke or brain injury, dementia, and head and neck cancer. Entrance into the stomach was achieved in 92.0% (23/25) and 96% (24/25) in the DUE and CUE groups, and PEG was performed in 91.3% (21/23) and 95.8% (23/24), respectively. The mean insertion time for the DUE and CUE groups were 22.7 ± 9.3 minutes and 17.1 ± 5.7 minutes (P = 0.044). The 3 cases of failure to reach the stomach in both groups were caused by esophageal blockage. The 3 cases of failed PEG tube insertion were caused by poor visualization of the insertion site. Bleeding and pneumoperitoneum occurred in 1 and 2 patients in the DUE group. One case of fever was noted in the CUE group. All adverse events were conservatively managed. Conclusions: Our study shows that portable DUE in facilities without endoscopy equipment may be clinically feasible. PMID:27902596

Novel mutations of the RS1 gene in a cohort of Chinese families with X-linked retinoschisis

PubMed Central

Chen, Jieqiong; Xu, Ke; Zhang, Xiaohui; Pan, Zhe; Dong, Bing

2014-01-01

Purpose X-linked retinoschisis is a retinal dystrophy caused by mutations in the RS1 gene in Xp22.1. These mutations lead to schisis (splitting) of the neural retina and subsequent reduction in visual acuity in affected men (OMIM # 312700). The aim of this study was to identify the RS1 gene mutations in a cohort of Chinese patients with X-linked retinoschisis, and to describe the associated phenotypes. Methods Patients and unaffected individuals from 16 unrelated families underwent detailed ophthalmic examinations. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. All exons including the exon-intron boundaries of the RS1 gene, were amplified by PCR and the products were analyzed by direct sequencing. Long-range PCR followed by DNA sequencing was used to define the breakpoints of the large deletion. Results Sixteen male individuals from 16 families were diagnosed with retinoschisis by clinical examination. The median age at review was 13.2 years (range: 5–34 years); the median best-corrected visual acuity upon review was 0.26 (range 0.02–1.0). Foveal schisis was found in 82.8% of the eyes (24/29) while peripheral schisis was present in 27.5% of the eyes (8/29). Sequencing of the RS1 gene identified 16 mutations, nine of which were novel. The mutations included eight missense mutations, all located in exons 4–6 (50.0%), two nonsense mutations (12.5%), four small deletions or insertions (25.0%), one splice site mutation (6.25%), and one large genomic deletion that included exon1 (6.25%). Conclusions The mutations found in our study broaden the spectrum of RS1 mutations. The identification of the specific mutation in each pedigree will allow future determination of female carrier status for genetic counseling purposes. PMID:24505212

Mobile element biology – new possibilities with high-throughput sequencing

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

2014-01-01

Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

DNA Data Visualization (DDV): Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

PubMed

Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard

2015-01-01

Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB

PubMed Central

Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

2012-01-01

The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441

Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB.

PubMed

Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

2012-01-01

The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB.

Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

PubMed

He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

2017-11-01

Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

Clinical effectiveness of lidocaine and benzocaine for topical anesthesia.

PubMed Central

Rosa, A. L.; Sverzut, C. E.; Xavier, S. P.; Lavrador, M. A.

1999-01-01

The effectiveness of lidocaine and benzocaine in reducing pain produced by needle insertion into the palate was evaluated in a double-blind and placebo-controlled study using a more suitable method. Twenty subjects, 10 men and 10 women, submitted to 4 sessions in which they were randomly treated with 5% lidocaine, a placebo that tasted like lidocaine, 20% benzocaine, and a placebo that tasted like benzocaine. At each session, a 27-gauge needle was inserted into the palate twice, once before (baseline) and once after drug application for 1 minute. Immediately after each insertion, subjects indicated on a visual analog scale the pain intensity perceived. Lidocaine and benzocaine were equally efficient, and both were better than placebo in reducing pain caused by insertion of needles into the palate. PMID:11692349

The zebrafish mutant vps18 as a model for vesicle-traffic related hypopigmentation diseases.

PubMed

Maldonado, Ernesto; Hernandez, Fabiola; Lozano, Carlos; Castro, Marta E; Navarro, Rosa E

2006-08-01

Hypopigmentation is a characteristic of several diseases associated with vesicle traffic defects, like the Hermansky-Pudlak, Chediak-Higashi, and Griscelli syndromes. Hypopigmentation is also a characteristic of the zebrafish mutant vps18(hi2499A), which is affected in the gene vps18, a component of the homotypic fusion and protein sorting complex that is involved in tethering during vesicular traffic. Vps18, as part of this complex, participates in the formation of early endosomes, late endosomes, and lysosomes. Here, we show that Vps18 is also involved in the formation of melanosomes. In the zebrafish mutant vps18(hi2499A) the retroviral insertion located at exon 4 of vps18, leads to the formation of two abnormal splicing variants lacking the coding sequence for the clathrin repeat and the RING finger conserved domains. A deficiency of Vps18 in zebrafish larvae results in hepatomegaly and skin hypopigmentation. We also observed a drastic reduction in the number of melanosomes in the eye's retinal pigmented epithelium along with the accumulation of immature melanosomes. A significant reduction in the vps18(hi2499A) larvae visual system capacity was found using the optokinetic response assay. We propose that the insertional mutant vps18(hi2499A) can be used as a model for studying hypopigmentation diseases in which vesicle traffic problems exist.

Impact of a transposon insertion in phzF2 on the specialized metabolite production and interkingdom interactions of Pseudomonas aeruginosa.

PubMed

Phelan, Vanessa V; Moree, Wilna J; Aguilar, Julieta; Cornett, Dale S; Koumoutsi, Alexandra; Noble, Suzanne M; Pogliano, Kit; Guerrero, Carlos A; Dorrestein, Pieter C

2014-05-01

In microbiology, gene disruption and subsequent experiments often center on phenotypic changes caused by one class of specialized metabolites (quorum sensors, virulence factors, or natural products), disregarding global downstream metabolic effects. With the recent development of mass spectrometry-based methods and technologies for microbial metabolomics investigations, it is now possible to visualize global production of diverse classes of microbial specialized metabolites simultaneously. Using imaging mass spectrometry (IMS) applied to the analysis of microbiology experiments, we can observe the effects of mutations, knockouts, insertions, and complementation on the interactive metabolome. In this study, a combination of IMS and liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to visualize the impact on specialized metabolite production of a transposon insertion into a Pseudomonas aeruginosa phenazine biosynthetic gene, phzF2. The disruption of phenazine biosynthesis led to broad changes in specialized metabolite production, including loss of pyoverdine production. This shift in specialized metabolite production significantly alters the metabolic outcome of an interaction with Aspergillus fumigatus by influencing triacetylfusarinine production.

Impact of a Transposon Insertion in phzF2 on the Specialized Metabolite Production and Interkingdom Interactions of Pseudomonas aeruginosa

PubMed Central

Phelan, Vanessa V.; Moree, Wilna J.; Aguilar, Julieta; Cornett, Dale S.; Koumoutsi, Alexandra; Noble, Suzanne M.; Pogliano, Kit; Guerrero, Carlos A.

2014-01-01

In microbiology, gene disruption and subsequent experiments often center on phenotypic changes caused by one class of specialized metabolites (quorum sensors, virulence factors, or natural products), disregarding global downstream metabolic effects. With the recent development of mass spectrometry-based methods and technologies for microbial metabolomics investigations, it is now possible to visualize global production of diverse classes of microbial specialized metabolites simultaneously. Using imaging mass spectrometry (IMS) applied to the analysis of microbiology experiments, we can observe the effects of mutations, knockouts, insertions, and complementation on the interactive metabolome. In this study, a combination of IMS and liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to visualize the impact on specialized metabolite production of a transposon insertion into a Pseudomonas aeruginosa phenazine biosynthetic gene, phzF2. The disruption of phenazine biosynthesis led to broad changes in specialized metabolite production, including loss of pyoverdine production. This shift in specialized metabolite production significantly alters the metabolic outcome of an interaction with Aspergillus fumigatus by influencing triacetylfusarinine production. PMID:24532776

Improved Protocols for Illumina Sequencing

PubMed Central

Bronner, Iraad F.; Quail, Michael A.; Turner, Daniel J.; Swerdlow, Harold

2013-01-01

In this unit, we describe a set of improvements we have made to the standard Illumina protocols to make the sequencing process more reliable in a high-throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. PMID:19582764

Sequencing cDNAs: An Introduction to DNA Sequence Analysis in the Undergraduate Molecular Genetics Course.

ERIC Educational Resources Information Center

Galewsky, Samuel

2000-01-01

Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)

Optimized scheduling technique of null subcarriers for peak power control in 3GPP LTE downlink.

PubMed

Cho, Soobum; Park, Sang Kyu

2014-01-01

Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system.

Optimized Scheduling Technique of Null Subcarriers for Peak Power Control in 3GPP LTE Downlink

PubMed Central

Park, Sang Kyu

2014-01-01

Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system. PMID:24883376

Assessment of sequence dependent geometric distortion in contrast-enhanced MR images employed in stereotactic radiosurgery treatment planning.

PubMed

Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis

2018-06-25

This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.

Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.

PubMed

Danhorn, Thomas; Young, Curtis R; DeLong, Edward F

2012-11-01

The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.

Reduction of Left Visual Field Lexical Decision Accuracy as a Result of Concurrent Nonverbal Auditory Stimulation

ERIC Educational Resources Information Center

Van Strien, Jan W.

2004-01-01

To investigate whether concurrent nonverbal sound sequences would affect visual-hemifield lexical processing, lexical-decision performance of 24 strongly right-handed students (12 men, 12 women) was measured in three conditions: baseline, concurrent neutral sound sequence, and concurrent emotional sound sequence. With the neutral sequence,…

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

PubMed

Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

2014-04-09

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

PubMed Central

Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

2014-01-01

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

Straddling "la otra frontera": Inserting MiChicana/o Visual Culture into Chicana/o Art History

ERIC Educational Resources Information Center

Miner, Dylan

2008-01-01

Although there is a surplus of literature dealing with U.S.-Mexico border identities and cultures, this article begins to problematize and reposition Chicana/o art historical discourse by engaging with the U.S.-Canada border. By investigating the relationship between working-class histories and Chicana/o visual culture in Michigan, the article…

Evaluation of second-generation sequencing of 19 dilated cardiomyopathy genes for clinical applications.

PubMed

Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H

2010-11-01

Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.

Controlling Posture and Vergence Eye Movements in Quiet Stance: Effects of Thin Plantar Inserts

PubMed Central

Foisy, A.; Gaertner, C.; Matheron, E.; Kapoula, Z.

2015-01-01

The purpose of this study was to assess properties of vergence and saccade eye movements as well as posture in quiet stance, and the effects of thin plantar inserts upon postural and oculomotor control. The performances of 36 young healthy subjects were recorded by a force platform and an eye tracker in three testing conditions: without plantar stimulation, with a 3 millimetre-thick plantar insert, either a Medial or a Lateral Arch Support (MAS / LAS). The results showed a decrease of the Surface and Variance of Speed and a more posterior position of the CoP with either stimulation compared with the control condition. The fractal analysis showed a decrease with MAS. Wavelet analysis in the time-frequency domain revealed an increase in the Cancelling Time of the low frequency band with MAS. These results suggest a better stability for a lower energy cost. Concerning eye movements, the inserts influenced only vergence (not saccades): MAS caused an increase of the phasic amplitude of divergence, and conversely a decrease of the tonic amplitude. In contrast, LAS caused an increase of the tonic amplitude of convergence. Thus, MAS renders divergence less visually driven, while LAS renders convergence more visually driven. We conclude that the CNS uses the podal signal for both postural and vergence control via specific mechanisms. Plantar inserts have an influence upon posture and vergence movements in a different way according to the part of the foot sole being stimulated. These results can be useful to clinicians interested in foot or eye. PMID:26637132

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

A single gene mutation that increases maize seed weight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giroux, M.J.; Shaw, J.; Hannah, L.C.

1996-06-11

The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Action starring narratives and events: Structure and inference in visual narrative comprehension

PubMed Central

Cohn, Neil; Wittenberg, Eva

2015-01-01

Studies of discourse have long placed focus on the inference generated by information that is not overtly expressed, and theories of visual narrative comprehension similarly focused on the inference generated between juxtaposed panels. Within the visual language of comics, star-shaped “flashes” commonly signify impacts, but can be enlarged to the size of a whole panel that can omit all other representational information. These “action star” panels depict a narrative culmination (a “Peak”), but have content which readers must infer, thereby posing a challenge to theories of inference generation in visual narratives that focus only on the semantic changes between juxtaposed images. This paper shows that action stars demand more inference than depicted events, and that they are more coherent in narrative sequences than scrambled sequences (Experiment 1). In addition, action stars play a felicitous narrative role in the sequence (Experiment 2). Together, these results suggest that visual narratives use conventionalized depictions that demand the generation of inferences while retaining narrative coherence of a visual sequence. PMID:26709362

Action starring narratives and events: Structure and inference in visual narrative comprehension.

PubMed

Cohn, Neil; Wittenberg, Eva

Studies of discourse have long placed focus on the inference generated by information that is not overtly expressed, and theories of visual narrative comprehension similarly focused on the inference generated between juxtaposed panels. Within the visual language of comics, star-shaped "flashes" commonly signify impacts, but can be enlarged to the size of a whole panel that can omit all other representational information. These "action star" panels depict a narrative culmination (a "Peak"), but have content which readers must infer, thereby posing a challenge to theories of inference generation in visual narratives that focus only on the semantic changes between juxtaposed images. This paper shows that action stars demand more inference than depicted events, and that they are more coherent in narrative sequences than scrambled sequences (Experiment 1). In addition, action stars play a felicitous narrative role in the sequence (Experiment 2). Together, these results suggest that visual narratives use conventionalized depictions that demand the generation of inferences while retaining narrative coherence of a visual sequence.

Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.

PubMed

Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A

2018-01-01

Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.

Aligning the unalignable: bacteriophage whole genome alignments.

PubMed

Bérard, Sèverine; Chateau, Annie; Pompidor, Nicolas; Guertin, Paul; Bergeron, Anne; Swenson, Krister M

2016-01-13

In recent years, many studies focused on the description and comparison of large sets of related bacteriophage genomes. Due to the peculiar mosaic structure of these genomes, few informative approaches for comparing whole genomes exist: dot plots diagrams give a mostly qualitative assessment of the similarity/dissimilarity between two or more genomes, and clustering techniques are used to classify genomes. Multiple alignments are conspicuously absent from this scene. Indeed, whole genome aligners interpret lack of similarity between sequences as an indication of rearrangements, insertions, or losses. This behavior makes them ill-prepared to align bacteriophage genomes, where even closely related strains can accomplish the same biological function with highly dissimilar sequences. In this paper, we propose a multiple alignment strategy that exploits functional collinearity shared by related strains of bacteriophages, and uses partial orders to capture mosaicism of sets of genomes. As classical alignments do, the computed alignments can be used to predict that genes have the same biological function, even in the absence of detectable similarity. The Alpha aligner implements these ideas in visual interactive displays, and is used to compute several examples of alignments of Staphylococcus aureus and Mycobacterium bacteriophages, involving up to 29 genomes. Using these datasets, we prove that Alpha alignments are at least as good as those computed by standard aligners. Comparison with the progressive Mauve aligner - which implements a partial order strategy, but whose alignments are linearized - shows a greatly improved interactive graphic display, while avoiding misalignments. Multiple alignments of whole bacteriophage genomes work, and will become an important conceptual and visual tool in comparative genomics of sets of related strains. A python implementation of Alpha, along with installation instructions for Ubuntu and OSX, is available on bitbucket (https://bitbucket.org/thekswenson/alpha).

Sequence-Based Mapping and Genome Editing Reveal Mutations in Stickleback Hps5 Cause Oculocutaneous Albinism and the casper Phenotype.

PubMed

Hart, James C; Miller, Craig T

2017-09-07

Here, we present and characterize the spontaneous X-linked recessive mutation casper , which causes oculocutaneous albinism in threespine sticklebacks ( Gasterosteus aculeatus ). In humans, Hermansky-Pudlak syndrome results in pigmentation defects due to disrupted formation of the melanin-containing lysosomal-related organelle (LRO), the melanosome. casper mutants display not only reduced pigmentation of melanosomes in melanophores, but also reductions in the iridescent silver color from iridophores, while the yellow pigmentation from xanthophores appears unaffected. We mapped casper using high-throughput sequencing of genomic DNA from bulked casper mutants to a region of the stickleback X chromosome (chromosome 19) near the stickleback ortholog of Hermansky-Pudlak syndrome 5 ( Hps5 ). casper mutants have an insertion of a single nucleotide in the sixth exon of Hps5 , predicted to generate an early frameshift. Genome editing using CRISPR/Cas9 induced lesions in Hps5 and phenocopied the casper mutation. Injecting single or paired Hps5 guide RNAs revealed higher incidences of genomic deletions from paired guide RNAs compared to single gRNAs. Stickleback Hps5 provides a genetic system where a hemizygous locus in XY males and a diploid locus in XX females can be used to generate an easily scored visible phenotype, facilitating quantitative studies of different genome editing approaches. Lastly, we show the ability to better visualize patterns of fluorescent transgenic reporters in Hps5 mutant fish. Thus, Hps5 mutations present an opportunity to study pigmented LROs in the emerging stickleback model system, as well as a tool to aid in assaying genome editing and visualizing enhancer activity in transgenic fish. Copyright © 2017 Hart and Milller.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

The Advanced Glaucoma Intervention Study (AGIS): 12. Baseline risk factors for sustained loss of visual field and visual acuity in patients with advanced glaucoma.

PubMed

2002-10-01

To examine the relationships between baseline risk factors and sustained decrease of visual field (SDVF) and sustained decrease of visual acuity (SDVA). Cohort study of participants in the Advanced Glaucoma Intervention Study (AGIS). This multicenter study enrolled patients between 1988 and 1992 and followed them until 2001; 789 eyes of 591 patients with advanced glaucoma were randomly assigned to one of two surgical sequences, argon laser trabeculoplasty (ALT)-trabeculectomy-trabeculectomy (ATT) or trabeculectomy-ALT-trabeculectomy (TAT). This report is based on data from 747 eyes. Eyes were offered the next intervention in the sequence upon failure of the previous intervention. Failure was based on recurrent intraocular pressure elevation, visual field defect, and disk rim criteria. Study visits occurred every 6 months; potential follow-up ranged from 8 to 13 years. For each intervention sequence, Cox multiple regression analyses were used to examine the baseline characteristics for association with two vision outcomes: SDVF and SDVA. The magnitude of the association is measured by the hazard ratio (HR), where HR for binary variables is the relative change in the hazard (or risk) of the outcome in eyes with the factor divided by the hazard in eyes without the factor, and HR for continuous variables is the relative change in the hazard (or risk) of the outcome in eyes with a unit increase in the factor. Characteristics associated with increased SDVF risk in the ATT sequence are: less baseline visual field defect (hazard ratio [HR] = 0.86, P <.001, 95% CI = 0.82-0.90), male gender (HR = 2.23, P <.001, 1.54-3.23), and worse baseline visual acuity (HR = 0.96, P =.001, 0.94-0.98); in the TAT sequence: less baseline visual field defect (HR = 0.93, P =.001, 0.89-0.97) and diabetes (HR = 1.87, P =.007, 1.18-2.97). Characteristics associated with increased SDVA risk in both treatment sequences are better baseline acuity (ATT: HR = 1.05, P <.001, 1.02-1.09; TAT: HR = 1.06, P <.001, 1.03-1.08), older age (ATT: HR = 1.05, P =.001, 1.02-1.08; TAT: HR = 1.04, P =.002, 1.01-1.06), and less formal education (ATT: HR = 1.92, P =.001, 1.29-2.88; TAT: HR = 1.77, P =.002, 1.22-2.54). For SDVF, risk factors were better baseline visual field in both treatment sequences, male gender, and worse baseline visual acuity in the ATT sequence, and diabetes in the TAT sequence. For SDVA, risk factors in both treatment sequences were better baseline visual acuity, older age, and less formal education.

Short-term memory stores organized by information domain.

PubMed

Noyce, Abigail L; Cestero, Nishmar; Shinn-Cunningham, Barbara G; Somers, David C

2016-04-01

Vision and audition have complementary affinities, with vision excelling in spatial resolution and audition excelling in temporal resolution. Here, we investigated the relationships among the visual and auditory modalities and spatial and temporal short-term memory (STM) using change detection tasks. We created short sequences of visual or auditory items, such that each item within a sequence arose at a unique spatial location at a unique time. On each trial, two successive sequences were presented; subjects attended to either space (the sequence of locations) or time (the sequence of inter item intervals) and reported whether the patterns of locations or intervals were identical. Each subject completed blocks of unimodal trials (both sequences presented in the same modality) and crossmodal trials (Sequence 1 visual, Sequence 2 auditory, or vice versa) for both spatial and temporal tasks. We found a strong interaction between modality and task: Spatial performance was best on unimodal visual trials, whereas temporal performance was best on unimodal auditory trials. The order of modalities on crossmodal trials also mattered, suggesting that perceptual fidelity at encoding is critical to STM. Critically, no cost was attributable to crossmodal comparison: In both tasks, performance on crossmodal trials was as good as or better than on the weaker unimodal trials. STM representations of space and time can guide change detection in either the visual or the auditory modality, suggesting that the temporal or spatial organization of STM may supersede sensory-specific organization.

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

PubMed Central

Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

PubMed

Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

Human MLH1 suppresses the insertion of telomeric sequences at intra-chromosomal sites in telomerase-expressing cells

PubMed Central

Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao

2017-01-01

Abstract Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability. PMID:28180301

Genetic variability in Melipona quinquefasciata (Hymenoptera, Apidae, Meliponini) from northeastern Brazil determined using the first internal transcribed spacer (ITS1).

PubMed

Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B

2009-01-01

Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.

Predicting Free Recalls

ERIC Educational Resources Information Center

Laming, Donald

2006-01-01

This article reports some calculations on free-recall data from B. Murdock and J. Metcalfe (1978), with vocal rehearsal during the presentation of a list. Given the sequence of vocalizations, with the stimuli inserted in their proper places, it is possible to predict the subsequent sequence of recalls--the predictions taking the form of a…

Laryngeal electromyography: electrode guidance based on 3-dimensional magnetic resonance tomography images of the larynx.

PubMed

Storck, Claudio; Gehrer, Raphael; Hofer, Michael; Neumayer, Bernhard; Stollberger, Rudolf; Schumacher, Ralf; Gugatschka, Markus; Friedrich, Gerhard; Wolfensberger, Markus

2012-01-01

Laryngeal electromyography (LEMG) is an important tool for the assessment of laryngeal nerve and muscle functioning. The purpose of the study was to determine electrode insertion angle and insertion depth for the various laryngeal muscles. Twenty-three cadaver larynges were examined with magnetic resonance tomography (MRT) and Materialize Interactive Medical Image Control System (Leuven, Belgium) 3-dimensional (3D) imaging software. Geometrical analysis was used to calculate the electrode insertion angles. All laryngeal muscles could be identified and 3D visualized on MRT scans. Although the insertion angles were the same in male and female larynges, the insertion depth was significantly larger in male than in female larynges (P<0.05). Of particular clinical importance is the fact that the electrode has to be directed lateral and upward for the thyroarytenoid muscle but lateral and downward for the lateral cricoarytenoid muscle (insertion point=midline lower border of the thyroid). This is the first study that analyzes electrode insertion angles and insertion depths for each laryngeal muscle using 3D imaging. We hope that the information gained from this study will help clinicians performing LEMG to localize the individual laryngeal muscles. Copyright © 2012 The Voice Foundation. Published by Mosby, Inc. All rights reserved.

Tandem Fusion of Hepatitis B Core Antigen Allows Assembly of Virus-Like Particles in Bacteria and Plants with Enhanced Capacity to Accommodate Foreign Proteins

PubMed Central

Peyret, Hadrien; Gehin, Annick; Thuenemann, Eva C.; Blond, Donatienne; El Turabi, Aadil; Beales, Lucy; Clarke, Dean; Gilbert, Robert J. C.; Fry, Elizabeth E.; Stuart, David I.; Holmes, Kris; Stonehouse, Nicola J.; Whelan, Mike; Rosenberg, William; Lomonossoff, George P.; Rowlands, David J.

2015-01-01

The core protein of the hepatitis B virus, HBcAg, assembles into highly immunogenic virus-like particles (HBc VLPs) when expressed in a variety of heterologous systems. Specifically, the major insertion region (MIR) on the HBcAg protein allows the insertion of foreign sequences, which are then exposed on the tips of surface spike structures on the outside of the assembled particle. Here, we present a novel strategy which aids the display of whole proteins on the surface of HBc particles. This strategy, named tandem core, is based on the production of the HBcAg dimer as a single polypeptide chain by tandem fusion of two HBcAg open reading frames. This allows the insertion of large heterologous sequences in only one of the two MIRs in each spike, without compromising VLP formation. We present the use of tandem core technology in both plant and bacterial expression systems. The results show that tandem core particles can be produced with unmodified MIRs, or with one MIR in each tandem dimer modified to contain the entire sequence of GFP or of a camelid nanobody. Both inserted proteins are correctly folded and the nanobody fused to the surface of the tandem core particle (which we name tandibody) retains the ability to bind to its cognate antigen. This technology paves the way for the display of natively folded proteins on the surface of HBc particles either through direct fusion or through non-covalent attachment via a nanobody. PMID:25830365

Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

PubMed

Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

2015-08-29

The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Short interspersed elements (SINEs) are a major source of canine genomic diversity.

PubMed

Wang, Wei; Kirkness, Ewen F

2005-12-01

SINEs are retrotransposons that have enjoyed remarkable reproductive success during the course of mammalian evolution, and have played a major role in shaping mammalian genomes. Previously, an analysis of survey-sequence data from an individual dog (a poodle) indicated that canine genomes harbor a high frequency of alleles that differ only by the absence or presence of a SINEC_Cf repeat. Comparison of this survey-sequence data with a draft genome sequence of a distinct dog (a boxer) has confirmed this prediction, and revealed the chromosomal coordinates for >10,000 loci that are bimorphic for SINEC_Cf insertions. Analysis of SINE insertion sites from the genomes of nine additional dogs indicates that 3%-5% are absent from either the poodle or boxer genome sequences--suggesting that an additional 10,000 bimorphic loci could be readily identified in the general dog population. We describe a methodology that can be used to identify these loci, and could be adapted to exploit these bimorphic loci for genotyping purposes. Approximately half of all annotated canine genes contain SINEC_Cf repeats, and these elements are occasionally transcribed. When transcribed in the antisense orientation, they provide splice acceptor sites that can result in incorporation of novel exons. The high frequency of bimorphic SINE insertions in the dog population is predicted to provide numerous examples of allele-specific transcription patterns that will be valuable for the study of differential gene expression among multiple dog breeds.

An analysis of the effectiveness of two topical anesthetics.

PubMed Central

Rosivack, R. G.; Koenigsberg, S. R.; Maxwell, K. C.

1990-01-01

This study compared the effectiveness of topical benzocaine 20%, lidocaine 5%, and a placebo in reducing the pain caused by needle insertion when the medicament was placed in the mucobuccal fold above the maxillary canine eminence. Both topical anesthetics and the placebo were randomly tested against each other bilaterally. For uniformity the agents were left in place for three minutes before needle insertion. A 27 gauge short needle mounted on an aspirating syringe was then inserted just past the bevel. Each subject rated the degree of pain on a visual analogue scale 100 mm in length. A pulse oximeter was used to record the heart rate. The results indicate that both topical anesthetics are significantly better than the placebo in reducing pain caused by needle insertion, although no statistically significant differences were found between the two topical anesthetics. Statistically significant differences in heart rate were seen, but these differences were not clinically significant. It is concluded that benzocaine 20% and lidocaine 5% significantly reduce the pain during needle insertion. PMID:2097909

EventThread: Visual Summarization and Stage Analysis of Event Sequence Data.

PubMed

Guo, Shunan; Xu, Ke; Zhao, Rongwen; Gotz, David; Zha, Hongyuan; Cao, Nan

2018-01-01

Event sequence data such as electronic health records, a person's academic records, or car service records, are ordered series of events which have occurred over a period of time. Analyzing collections of event sequences can reveal common or semantically important sequential patterns. For example, event sequence analysis might reveal frequently used care plans for treating a disease, typical publishing patterns of professors, and the patterns of service that result in a well-maintained car. It is challenging, however, to visually explore large numbers of event sequences, or sequences with large numbers of event types. Existing methods focus on extracting explicitly matching patterns of events using statistical analysis to create stages of event progression over time. However, these methods fail to capture latent clusters of similar but not identical evolutions of event sequences. In this paper, we introduce a novel visualization system named EventThread which clusters event sequences into threads based on tensor analysis and visualizes the latent stage categories and evolution patterns by interactively grouping the threads by similarity into time-specific clusters. We demonstrate the effectiveness of EventThread through usage scenarios in three different application domains and via interviews with an expert user.

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

Update on Rover Sequencing and Visualization Program

NASA Technical Reports Server (NTRS)

Cooper, Brian; Hartman, Frank; Maxwell, Scott; Yen, Jeng; Wright, John; Balacuit, Carlos

2005-01-01

The Rover Sequencing and Visualization Program (RSVP) has been updated. RSVP was reported in Rover Sequencing and Visualization Program (NPO-30845), NASA Tech Briefs, Vol. 29, No. 4 (April 2005), page 38. To recapitulate: The Rover Sequencing and Visualization Program (RSVP) is the software tool to be used in the Mars Exploration Rover (MER) mission for planning rover operations and generating command sequences for accomplishing those operations. RSVP combines three-dimensional (3D) visualization for immersive exploration of the operations area, stereoscopic image display for high-resolution examination of the downlinked imagery, and a sophisticated command-sequence editing tool for analysis and completion of the sequences. RSVP is linked with actual flight code modules for operations rehearsal to provide feedback on the expected behavior of the rover prior to committing to a particular sequence. Playback tools allow for review of both rehearsed rover behavior and downlinked results of actual rover operations. These can be displayed simultaneously for comparison of rehearsed and actual activities for verification. The primary inputs to RSVP are downlink data products from the Operations Storage Server (OSS) and activity plans generated by the science team. The activity plans are high-level goals for the next day s activities. The downlink data products include imagery, terrain models, and telemetered engineering data on rover activities and state. The Rover Sequence Editor (RoSE) component of RSVP performs activity expansion to command sequences, command creation and editing with setting of command parameters, and viewing and management of rover resources. The HyperDrive component of RSVP performs 2D and 3D visualization of the rover s environment, graphical and animated review of rover predicted and telemetered state, and creation and editing of command sequences related to mobility and Instrument Deployment Device (robotic arm) operations. Additionally, RoSE and HyperDrive together evaluate command sequences for potential violations of flight and safety rules. The products of RSVP include command sequences for uplink that are stored in the Distributed Object Manager (DOM) and predicted rover state histories stored in the OSS for comparison and validation of downlinked telemetry. The majority of components comprising RSVP utilize the MER command and activity dictionaries to automatically customize the system for MER activities.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

A surprisingly large RNase P RNA in Candida glabrata

PubMed Central

KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG

2005-01-01

We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816

JVM: Java Visual Mapping tool for next generation sequencing read.

PubMed

Yang, Ye; Liu, Juan

2015-01-01

We developed a program JVM (Java Visual Mapping) for mapping next generation sequencing read to reference sequence. The program is implemented in Java and is designed to deal with millions of short read generated by sequence alignment using the Illumina sequencing technology. It employs seed index strategy and octal encoding operations for sequence alignments. JVM is useful for DNA-Seq, RNA-Seq when dealing with single-end resequencing. JVM is a desktop application, which supports reads capacity from 1 MB to 10 GB.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

DEEP MOTIF DASHBOARD: VISUALIZING AND UNDERSTANDING GENOMIC SEQUENCES USING DEEP NEURAL NETWORKS.

PubMed

Lanchantin, Jack; Singh, Ritambhara; Wang, Beilun; Qi, Yanjun

2017-01-01

Deep neural network (DNN) models have recently obtained state-of-the-art prediction accuracy for the transcription factor binding (TFBS) site classification task. However, it remains unclear how these approaches identify meaningful DNA sequence signals and give insights as to why TFs bind to certain locations. In this paper, we propose a toolkit called the Deep Motif Dashboard (DeMo Dashboard) which provides a suite of visualization strategies to extract motifs, or sequence patterns from deep neural network models for TFBS classification. We demonstrate how to visualize and understand three important DNN models: convolutional, recurrent, and convolutional-recurrent networks. Our first visualization method is finding a test sequence's saliency map which uses first-order derivatives to describe the importance of each nucleotide in making the final prediction. Second, considering recurrent models make predictions in a temporal manner (from one end of a TFBS sequence to the other), we introduce temporal output scores, indicating the prediction score of a model over time for a sequential input. Lastly, a class-specific visualization strategy finds the optimal input sequence for a given TFBS positive class via stochastic gradient optimization. Our experimental results indicate that a convolutional-recurrent architecture performs the best among the three architectures. The visualization techniques indicate that CNN-RNN makes predictions by modeling both motifs as well as dependencies among them.

Effective learner-centered strategies for teaching adults: using visual media to engage the adult learner.

PubMed

Myers, Dennis R; Sykes, Catherine; Myers, Scott

2008-01-01

This article offers practical guidance for educators as they prepare specialists to enhance the lives and communities of older persons through the strategic use of visual media in age-related courses. Advantages and disadvantages of this learning innovation are provided as well as seven approaches for enriching instruction. Resources are included for locating effective visual media, matching course content with video resources, determining fair use of copyrighted media, and inserting video clips into PowerPoint presentations. Strategies for accessing assistive services for implementing visual media in the classroom are also addressed. This article promotes the use of visual media for the purpose of enriching gerontological and geriatrics instruction for the adult learner.

Engineering RNA phage MS2 virus-like particles for peptide display

NASA Astrophysics Data System (ADS)

Jordan, Sheldon Keith

Phage display is a powerful and versatile technology that enables the selection of novel binding functions from large populations of randomly generated peptide sequences. Random sequences are genetically fused to a viral structural protein to produce complex peptide libraries. From a sufficiently complex library, phage bearing peptides with practically any desired binding activity can be physically isolated by affinity selection, and, since each particle carries in its genome the genetic information for its own replication, the selectants can be amplified by infection of bacteria. For certain applications however, existing phage display platforms have limitations. One such area is in the field of vaccine development, where the goal is to identify relevant epitopes by affinity-selection against an antibody target, and then to utilize them as immunogens to elicit a desired antibody response. Today, affinity selection is usually conducted using display on filamentous phages like M13. This technology provides an efficient means for epitope identification, but, because filamentous phages do not display peptides in the high-density, multivalent arrays the immune system prefers to recognize, they generally make poor immunogens and are typically useless as vaccines. This makes it necessary to confer immunogenicity by conjugating synthetic versions of the peptides to more immunogenic carriers. Unfortunately, when introduced into these new structural environments, the epitopes often fail to elicit relevant antibody responses. Thus, it would be advantageous to combine the epitope selection and immunogen functions into a single platform where the structural constraints present during affinity selection can be preserved during immunization. This dissertation describes efforts to develop a peptide display system based on the virus-like particles (VLPs) of bacteriophage MS2. Phage display technologies rely on (1) the identification of a site in a viral structural protein that is present on the surface of the virus particle and can accept foreign sequence insertions without disruption of protein folding and viral particle assembly, and (2) on the encapsidation of nucleic acid sequences encoding both the VLP and the peptide it displays. The experiments described here are aimed at satisfying the first of these two requirements by engineering efficient peptide display at two different sites in MS2 coat protein. First, we evaluated the suitability of the N-terminus of MS2 coat for peptide insertions. It was observed that random N-terminal 10-mer fusions generally disrupted protein folding and VLP assembly, but by bracketing the foreign sequences with certain specific dipeptides, these defects could be suppressed. Next, the suitability of a coat protein surface loop for foreign sequence insertion was tested. Specifically, random sequence peptides were inserted into the N-terminal-most AB-loop of a coat protein single-chain dimer. Again we found that efficient display required the presence of appropriate dipeptides bracketing the peptide insertion. Finally, it was shown that an N-terminal fusion that tended to interfere specifically with capsid assembly could be efficiently incorporated into mosaic particles when co-expressed with wild-type coat protein.

Visual mental image generation does not overlap with visual short-term memory: a dual-task interference study.

PubMed

Borst, Gregoire; Niven, Elaine; Logie, Robert H

2012-04-01

Visual mental imagery and working memory are often assumed to play similar roles in high-order functions, but little is known of their functional relationship. In this study, we investigated whether similar cognitive processes are involved in the generation of visual mental images, in short-term retention of those mental images, and in short-term retention of visual information. Participants encoded and recalled visually or aurally presented sequences of letters under two interference conditions: spatial tapping or irrelevant visual input (IVI). In Experiment 1, spatial tapping selectively interfered with the retention of sequences of letters when participants generated visual mental images from aural presentation of the letter names and when the letters were presented visually. In Experiment 2, encoding of the sequences was disrupted by both interference tasks. However, in Experiment 3, IVI interfered with the generation of the mental images, but not with their retention, whereas spatial tapping was more disruptive during retention than during encoding. Results suggest that the temporary retention of visual mental images and of visual information may be supported by the same visual short-term memory store but that this store is not involved in image generation.

Management of idiopathic intracranial hypertension with a programmable lumboperitoneal shunt: Early experience.

PubMed

Alkherayf, Fahad; Abou Al-Shaar, Hussam; Awad, Michael

2015-09-01

To evaluate the clinical outcomes and complications rate among idiopathic intracranial hypertension (IIH) patients who underwent lumboperitoneal (LP) shunt insertion with a programmable Strata valve. We retrospectively evaluated patients who underwent LP shunt with a programmable Strata valve insertion at the University of Ottawa Civic Hospital from November 2012 to June 2013. The demographic data, clinical symptoms, opening pressure, pre-operative and post-operative visual fields, neuroimaging, visual acuity, disc status, and complications were recorded and analyzed. Seven female patients with IIH underwent insertion of an LP shunt with a programmable Strata valve. The mean opening pressure was 35.8 cm H2O. The initial valve setting was 1.5, and four patients required post-operative valve pressure adjustment. All patients showed significant improvement in objective visual testing at follow-up as well as less frequent headaches. None of the patients developed intra- or post-operative complications. LP shunts with programmable Strata valve systems are a potential alternative to conventional LP and programmable ventriculoperitoneal shunt systems as well as optic nerve sheath fenestration, due to their potential in avoiding brain injury, lower failure and complication rates, lower intracranial hypotension incidence, and flexibility in adjusting valve pressure settings post-operatively evading under- and overdrainage complications. They should be considered for the management of IIH instead of early design LP systems and VP shunts. A randomized multi-center trial should be conducted to compare the efficacy of these surgical techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

PubMed Central

Macé, Matthias; Crouau-Roy, Brigitte

2008-01-01

Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953

Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

PubMed

Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

2014-12-12

Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Ultrathin endoscope flexibility can predict discomfort associated with unsedated transnasal esophagogastroduodenoscopy

PubMed Central

Ono, Satoshi; Niimi, Keiko; Fujishiro, Mitsuhiro; Nakao, Tomoko; Suzuki, Kazushi; Ohike, Yumiko; Kodashima, Shinya; Yamamichi, Nobutake; Yamazaki, Tsutomu; Koike, Kazuhiko

2013-01-01

AIM: To evaluate the effects of choice of insertion route and ultrathin endoscope types. METHODS: This prospective study (January-June 2012) included 882 consecutive patients who underwent annual health checkups. Transnasal esophagogastroduodenoscopy (EGD) was performed in 503 patients and transoral EGD in 235 patients using six types of ultrathin endoscopes. Patients were given a choice of insertion route, either transoral or transnasal, prior to EGD examination. For transoral insertion, the endoscope was equipped with a thin-type mouthpiece and tongue depressor. Conscious sedation was not used for any patient. EGD-associated discomfort was assessed using a visual analog scale (VAS; no discomfort 0- maximum discomfort 10). RESULTS: Rates of preference for transnasal insertion were significantly higher in male (male/female 299/204 vs 118/117) and younger patients (56.8 ± 11.2 years vs 61.3 ± 13.0 years), although no significant difference was found in VAS scores between transoral and transnasal insertion (3.9 ± 2.3 vs 4.1 ± 2.5). Multivariate analysis revealed that gender, age, operator, and endoscope were independent significant predictors of VAS for transnasal insertion, although gender, age, and endoscope were those for transoral insertion. Further analysis revealed only the endoscopic flexibility index (EFI) as an independent significant predictor of VAS for transnasal insertion. Both EFI and tip diameter were independent significant predictors of VAS for transoral insertion. CONCLUSION: Flexibility of ultrathin endoscopes can be a predictor of EGD-associated discomfort, especially in transnasal insertion. PMID:23858379

Lidocaine-Prilocaine Cream as Analgesia for IUD Insertion: A Prospective, Randomized, Controlled, Triple Blinded Study

PubMed Central

Tavakolian, Samira; Doulabi, Mahbobeh Ahmadi; Baghban, Alireza Akbarzade; Mortazavi, Alireza; Ghorbani, Maryam

2015-01-01

Introduction: Copper IUD is a long term and reversible contraception which equals tubal ligation in terms of sterilization. One of the barriers to using this contraception method is the fear and the pain associated with its insertion. Eutectic mixture of local anesthetics (EMLA) 5% is a local anesthetic that contains 25 mg lidocaine and 25 mg of prilocaine per gram. Application of topical analgesic cream to the cervix for laser surgery, hysteroscopy and hysterosalpingography is known Aims: this study aimed to determine the effect of EMLA on IUD insertion pain. Methods: This triple blind clinical trial was conducted on 92 women in a clinic in Hamedan in 2012. After applying the cream on the cervix, pain in three steps, after using Tenaculum, after inserting hystrometr and after inserting IUD and removing IUD insertion tube were assessed with visual analog scale and were compared in EMLA group and placebo group Statistical analysis used to determine and compare the pain of independent t tests, Mann-Whitney U test and repeated measures analysis of variance and chi-square tests to determine the homogeneity of variables and Fisher’s exact test was used Results: Insertion hystrometr was determined as the most painful IUD insertion. The mean pain at step 2 (inserting hystrometr) was (3/11±2/53) in EMLA group, (5/23±2/31) in placebo group. EMLA cream significantly reduced the pain after using tenaculum (P<0/001), pain inserting Hystrometr (P< 0/001) and pain at IUD insertion and removing insertion tube (P< 0/001) Conclusions: Topical Application of EMLA 5% cream as a topical anesthetic on the cervix before insertion IUD reduced the pain during this procedure. PMID:25946948

LoRTE: Detecting transposon-induced genomic variants using low coverage PacBio long read sequences.

PubMed

Disdero, Eric; Filée, Jonathan

2017-01-01

Population genomic analysis of transposable elements has greatly benefited from recent advances of sequencing technologies. However, the short size of the reads and the propensity of transposable elements to nest in highly repeated regions of genomes limits the efficiency of bioinformatic tools when Illumina or 454 technologies are used. Fortunately, long read sequencing technologies generating read length that may span the entire length of full transposons are now available. However, existing TE population genomic softwares were not designed to handle long reads and the development of new dedicated tools is needed. LoRTE is the first tool able to use PacBio long read sequences to identify transposon deletions and insertions between a reference genome and genomes of different strains or populations. Tested against simulated and genuine Drosophila melanogaster PacBio datasets, LoRTE appears to be a reliable and broadly applicable tool to study the dynamic and evolutionary impact of transposable elements using low coverage, long read sequences. LoRTE is an efficient and accurate tool to identify structural genomic variants caused by TE insertion or deletion. LoRTE is available for download at http://www.egce.cnrs-gif.fr/?p=6422.

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120.

PubMed

deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B

2017-01-01

Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.

Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120

PubMed Central

Edlefsen, Paul T.; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A.; Fiore-Gartland, Andrew J.; Juraska, Michal; Carpp, Lindsay N.; Karuna, Shelly T.; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z.; Gottardo, Raphael; Koup, Richard A.; Bailer, Robert; Mascola, John R.; Graham, Barney S.; Roederer, Mario; O’Connell, Robert J.; Michael, Nelson L.; Robb, Merlin L.; Adams, Elizabeth; D’Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E.; Frahm, Nicole; Tomaras, Georgia D.; McElrath, M. Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E.; Hammer, Scott M.; Kim, Jerome H.; Mullins, James I.; Gilbert, Peter B.

2017-01-01

Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector. PMID:29149197

Genome Sequence of Lactobacillus delbrueckii subsp. lactis CNRZ327, a Dairy Bacterium with Anti-Inflammatory Properties.

PubMed

El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten

2014-07-17

Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.

Designing robust watermark barcodes for multiplex long-read sequencing.

PubMed

Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth

2017-03-15

To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

PubMed

He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

2013-09-04

To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

De novo insertion of an intron into the mammalian sex determining gene, SRY

PubMed Central

O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall

1998-01-01

Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

INTACS before or after laser in situ keratomileusis: correction of thin corneas with moderately high myopia.

PubMed

Ito, Mitsutoshi; Arai, Hiroyuki; Fukumoto, Teruki; Toda, Ikuko; Tsubota, Kazuo

2004-01-01

Intrastromal corneal ring segments (INTACS Micro-Thin Prescription Inserts by Addition Technologies, Fremont, Calif) were inserted as a combined surgery with laser in situ keratomileusis (LASIK) in six eyes with thin corneas to correct moderately high myopia. INTACS were implanted before LASIK (INTACS-LASIK) in three eyes and after LASIK (LASIK-INTACS) in three eyes. Mean preoperative manifest spherical equivalent refraction was -7.88 diopters. Mean follow-up was 306 days. No intraoperative complications occurred. The LASIK-INTACS eyes were slightly more overcorrected than the INTACS-LASIK eyes because of the enhanced performance of INTACS in the thinned corneal tissue. Induced astigmatism by INTACS per se was less in the LASIK-INTACS eyes than in the INTACS-LASIK eyes. At last examination, uncorrected visual acuity was better than 20/25 in all eyes. Best spectacle-corrected visual acuity was within 1 line of the preoperative value in all eyes. Both methods resulted in significant improvement in visual acuity and refraction. Based on our limited experience, however, LASIK followed by INTACS is preferred for reasons of safety, convenience, and lower induced cylinder.

High resolution micro-CT scanning as an innovative tool for evaluation of the surgical positioning of cochlear implant electrodes.

PubMed

Postnov, A; Zarowski, A; De Clerck, N; Vanpoucke, F; Offeciers, F E; Van Dyck, D; Peeters, S

2006-05-01

X-ray microtomography (micro-CT) is a new technique allowing for visualization of the internal structure of opaque specimens with a quasi-histological quality. Among multiple potential applications, the use of this technique in otology is very promising. Micro-CT appears to be ideally suited for in vitro visualization of the inner ear tissues as well as for evaluation of the electrode damage and/or surgical insertion trauma during implantation of the cochlear implant electrodes. This technique can greatly aid in design and development of new cochlear implant electrodes and is applicable for temporal bone studies. The main advantage of micro-CT is the practically artefact-free preparation of the samples and the possibility of evaluation of the interesting parameters along the whole insertion depth of the electrode. This paper presents the results of the first application of micro-CT for visualization of the inner ear structures in human temporal bones and for evaluation of the surgical positioning of the cochlear implant electrodes relative to the intracochlear soft tissues.

Laser Generated Leaky Acoustic Waves for Needle Visualization.

PubMed

Wu, Kai-Wen; Wang, Yi-An; Li, Pai-Chi

2018-04-01

Ultrasound (US)-guided needle operation is usually used to visualize both tissue and needle position such as tissue biopsy and localized drug delivery. However, the transducer-needle orientation is limited due to reflection of the acoustic waves. We proposed a leaky acoustic wave method to visualize the needle position and orientation. Laser pulses are emitted on top of the needle to generate acoustic waves; then, these acoustic waves propagate along the needle surface. Leaky wave signals are detected by the US array transducer. The needle position can be calculated by phase velocities of two different wave modes and their corresponding emission angles. In our experiments, a series of needles was inserted into a tissue mimicking phantom and porcine tissue to evaluate the accuracy of the proposed method. The results show that the detection depth is up to 51 mm and the insertion angle is up to 40° with needles of different diameters. It is demonstrated that the proposed approach outperforms the conventional B-mode US-guided needle operation in terms of the detection range while achieving similar accuracy. The proposed method reveals the potentials for further clinical applications.

Detection of different kidney stone types: an ex vivo comparison of ultrashort echo time MRI to reference standard CT.

PubMed

Ibrahim, El-Sayed H; Cernigliaro, Joseph G; Pooley, Robert A; Bridges, Mellena D; Giesbrandt, Jamie G; Williams, James C; Haley, William E

2016-01-01

With the development of ultrashort echo time (UTE) sequences, it may now be possible to detect kidney stones by using magnetic resonance imaging (MRI). In this study, kidney stones of varying composition and sizes were imaged using both UTE MRI as well as the reference standard of computed tomography (CT), with different surrounding materials and scan setups. One hundred and fourteen kidney stones were inserted into agarose and urine phantoms and imaged both on a dual-energy CT (DECT) scanner using a standard renal stone imaging protocol and on an MRI scanner using the UTE sequence with both head and body surface coils. A subset of the stones representing all composition types and sizes was then inserted into the collecting system of porcine kidneys and imaged in vitro with both CT and MRI. All of the stones were visible on both CT and MRI imaging. DECT was capable of differentiating between uric acid and nonuric acid stones. In MRI imaging, the choice of coil and large field of view (FOV) did not affect stone detection or image quality. The MRI images showed good visualization of the stones' shapes, and the stones' dimensions measured from MRI were in good agreement with the actual values (R(2)=0.886, 0.895, and 0.81 in the agarose phantom, urine phantom, and pig kidneys, respectively). The measured T2 relaxation times ranged from 4.2 to 7.5ms, but did not show significant differences among different stone composition types. UTE MRI compared favorably with the reference standard CT for imaging stones of different composition types and sizes using body surface coil and large FOV, which suggests potential usefulness of UTE MRI in imaging kidney stones in vivo. Copyright © 2015 Elsevier Inc. All rights reserved.

Auditory and visual sequence learning in humans and monkeys using an artificial grammar learning paradigm.

PubMed

Milne, Alice E; Petkov, Christopher I; Wilson, Benjamin

2017-07-05

Language flexibly supports the human ability to communicate using different sensory modalities, such as writing and reading in the visual modality and speaking and listening in the auditory domain. Although it has been argued that nonhuman primate communication abilities are inherently multisensory, direct behavioural comparisons between human and nonhuman primates are scant. Artificial grammar learning (AGL) tasks and statistical learning experiments can be used to emulate ordering relationships between words in a sentence. However, previous comparative work using such paradigms has primarily investigated sequence learning within a single sensory modality. We used an AGL paradigm to evaluate how humans and macaque monkeys learn and respond to identically structured sequences of either auditory or visual stimuli. In the auditory and visual experiments, we found that both species were sensitive to the ordering relationships between elements in the sequences. Moreover, the humans and monkeys produced largely similar response patterns to the visual and auditory sequences, indicating that the sequences are processed in comparable ways across the sensory modalities. These results provide evidence that human sequence processing abilities stem from an evolutionarily conserved capacity that appears to operate comparably across the sensory modalities in both human and nonhuman primates. The findings set the stage for future neurobiological studies to investigate the multisensory nature of these sequencing operations in nonhuman primates and how they compare to related processes in humans. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

The topography of mutational processes in breast cancer genomes

DOE PAGES

Morganella, Sandro; Alexandrov, Ludmil B.; Glodzik, Dominik; ...

2016-01-01

Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription,more » DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Lastly, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.« less

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

Protective Socket For Integrated Circuits

NASA Technical Reports Server (NTRS)

Wilkinson, Chris; Henegar, Greg

1988-01-01

Socket for intergrated circuits (IC's) protects from excessive voltages and currents or from application of voltages and currents in wrong sequence during insertion or removal. Contains built-in switch that opens as IC removed, disconnecting leads from signals and power. Also protects other components on circuit board from transients produced by insertion and removal of IC. Makes unnecessary to turn off power to entire circuit board so other circuits on board continue to function.

Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.

PubMed

Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P

2018-05-10

Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.

Using SINEs to probe ancient explosive speciation: "hidden" radiation of African cichlids?

PubMed

Terai, Yohey; Takahashi, Kazuhiko; Nishida, Mutsumi; Sato, Tetsu; Okada, Norihiro

2003-06-01

Cichlid fishes of the east African Great Lakes represent a paradigm of adaptive radiation. We conducted a phylogenetic analysis of cichlids including pan-African and west African species by using insertion patterns of short interspersed elements (SINEs) at orthologous loci. The monophyly of the east African cichlids was consistently supported by seven independent insertions of SINE sequences that are uniquely shared by these species. In addition, data from four other loci indicated that the genera Tilapia (pan-African) and Steatocranus (west African) are the closest relatives to east African cichlids. However, relationships among Tilapia, Steatocranus, and the east African clade were ambiguous because of incongruencies among topologies suggested by insertion patterns of SINEs at six other loci. One plausible explanation for this phenomenon is incomplete lineage sorting of alleles containing or missing a SINE insertion at these loci during ancestral speciation. Such incomplete sorting may have taken place earlier than 14 MYA, followed by random and stochastic fixation of the alleles in subsequent lineages. These observations prompted us to consider the possibility that cichlid speciation occurred at an accelerated rate during this period when the African Great Lakes did not exist. The SINE method could be useful for detecting ancient exclusive speciation events that tend to remain hidden during conventional sequence analyses because of accumulated point mutations.

Alignment efficiency and discomfort of three orthodontic archwire sequences: a randomized clinical trial.

PubMed

Ong, Emily; Ho, Christopher; Miles, Peter

2011-03-01

To compare the efficiency of orthodontic archwire sequences produced by three manufacturers. Prospective, randomized clinical trial with three parallel groups. Private orthodontic practice in Caloundra, QLD, Australia. One hundred and thirty-two consecutive patients were randomized to one of three archwire sequence groups: (i) 3M Unitek, 0·014 inch Nitinol, 0·017 inch × 0·017 inch heat activated Ni-Ti; (ii) GAC international, 0·014 inch Sentalloy, 0·016 × 0·022 inch Bioforce; and (iii) Ormco corporation, 0·014 inch Damon Copper Ni-Ti, 0·014 × 0·025 inch Damon Copper Ni-Ti. All patients received 0·018 × 0·025 inch slot Victory Series™ brackets. Mandibular impressions were taken before the insertion of each archwire. Patients completed discomfort surveys according to a seven-point Likert Scale at 4 h, 24 h, 3 days and 7 days after the insertion of each archwire. Efficiency was measured by time required to reach the working archwire, mandibular anterior alignment and level of discomfort. No significant differences were found in the reduction of irregularity between the archwire sequences at any time-point (T1: P = 0·12; T2: P = 0·06; T3: P = 0·21) or in the time to reach the working archwire (P = 0·28). No significant differences were found in the overall discomfort scores between the archwire sequences (4 h: P = 0·30; 24 h: P = 0·18; 3 days: P = 0·53; 7 days: P = 0·47). When the time-points were analysed individually, the 3M Unitek archwire sequence induced significantly less discomfort than GAC and Ormco archwires 24 h after the insertion of the third archwire (P = 0·02). This could possibly be attributed to the progression in archwire material and archform. The archwire sequences were similar in alignment efficiency and overall discomfort. Progression in archwire dimension and archform may contribute to discomfort levels. This study provides clinical justification for three common archwire sequences in 0·018 × 0·025 inch slot brackets.

Relationship between footwear comfort of shoe inserts and anthropometric and sensory factors.

PubMed

Mündermann, A; Stefanyshyn, D J; Nigg, B M

2001-11-01

The purposes of this study were (a) to determine lower extremity anthropometric and sensory factors that are related to differences in comfort perception of shoe inserts with varying shape and material and (b) to investigate whether shoe inserts that improve comfort decrease injury frequency in a military population. 206 military personnel volunteered for this study. The shoe inserts varied in arch and heel cup shape, hardness, and elasticity in the heel and forefoot regions. A no insert condition was included as the control condition. Measured subject characteristics included foot shape, foot and leg alignment, and tactile and vibration sensitivity of the plantar surface of the foot. Footwear comfort was assessed using a visual analog scale. Injury frequency was evaluated with a questionnaire. The statistical analyses included Student's t-tests for repeated measures, ANOVA (within subjects), MANOVA (within insert combinations), and chi-square tests. The average comfort ratings for all shoe inserts were significantly higher than the average comfort rating for the control condition. The incidence of stress fractures and pain at different locations was reduced by 1.5-13.4% for the insert compared with the control group. Foot arch height, foot and leg alignment, and foot sensitivity were significantly related to differences in comfort ratings for the hard/soft, the viscous/elastic, and the high arch/low arch insert combinations. Shoe inserts of different shape and material that are comfortable are able to decrease injury frequency. The results of this study showed that subject specific characteristics influence comfort perception of shoe inserts.

Visual pattern image sequence coding

NASA Technical Reports Server (NTRS)

Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

1990-01-01

The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

Evidence for Two Attentional Components in Visual Working Memory

ERIC Educational Resources Information Center

Allen, Richard J.; Baddeley, Alan D.; Hitch, Graham J.

2014-01-01

How does executive attentional control contribute to memory for sequences of visual objects, and what does this reveal about storage and processing in working memory? Three experiments examined the impact of a concurrent executive load (backward counting) on memory for sequences of individually presented visual objects. Experiments 1 and 2 found…

Room-Temperature C-H Functionalization Sequence under Benchtop Conditions for the Undergraduate Chemistry Laboratory

ERIC Educational Resources Information Center

Chen, Shuming

2018-01-01

An iridium(III)-mediated C-H functionalization sequence involving a concerted cyclometalation-deprotonation/migratory insertion pathway is reported for the undergraduate chemistry laboratory. The air- and water-stable iridacycle intermediates are readily isolated and characterized by NMR spectroscopy. Both steps of the experiment are performed at…

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

PubMed

Young, Robert S

2016-07-01

Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

Identification and Characterization of Domesticated Bacterial Transposases

PubMed Central

Gallie, Jenna; Rainey, Paul B.

2017-01-01

Abstract Selfish genetic elements, such as insertion sequences and transposons are found in most genomes. Transposons are usually identifiable by their high copy number within genomes. In contrast, REP-associated tyrosine transposases (RAYTs), a recently described class of bacterial transposase, are typically present at just one copy per genome. This suggests that RAYTs no longer copy themselves and thus they no longer function as a typical transposase. Motivated by this possibility we interrogated thousands of fully sequenced bacterial genomes in order to determine patterns of RAYT diversity, their distribution across chromosomes and accessory elements, and rate of duplication. RAYTs encompass exceptional diversity and are divisible into at least five distinct groups. They possess features more similar to housekeeping genes than insertion sequences, are predominantly vertically transmitted and have persisted through evolutionary time to the point where they are now found in 24% of all species for which at least one fully sequenced genome is available. Overall, the genomic distribution of RAYTs suggests that they have been coopted by host genomes to perform a function that benefits the host cell. PMID:28910967

Occurrence of coring after needle insertion through a rubber stopper: study with prednisolone acetate.

PubMed

Campagna, Raphael; Pessis, Eric; Guerini, Henri; Feydy, Antoine; Drapé, Jean-Luc

2013-02-01

To evaluate the occurrence of coring after needle insertion through the rubber stopper of prednisolone acetate vials. Two-hundred vials of prednisolone acetate were randomly distributed to two radiologists. Prednisolone acetate was drawn up through the rubber bung of the vials with an 18-gauge cutting bevelled needle and aspirated with a 5-ml syringe. The presence of coring was noted visually. We systematically put each core in a syringe refilled with 3 ml prednisolone acetate, and injected the medication through a 20-gauge spine needle. Computed tomography was performed to measure the size of each coring. Coring occurred in 21 out of 200 samples (10.5 %), and was visually detected in the syringe filled up with prednisolone in 11 of the 21 cases. Ten more occult cores were detected only after the syringes and needles were taken apart and rinsed. The core size ranged from 0.6 to 1.1 mm, and 1 of the 21 (4.7 %) cores was ejected through the 20-gauge needle. Coring can occur after the insertion of a needle through the rubber stopper of a vial of prednisolone acetate, and the resultant core can then be aspirated into the syringe.

Robot Sequencing and Visualization Program (RSVP)

NASA Technical Reports Server (NTRS)

Cooper, Brian K.; Maxwell,Scott A.; Hartman, Frank R.; Wright, John R.; Yen, Jeng; Toole, Nicholas T.; Gorjian, Zareh; Morrison, Jack C

2013-01-01

The Robot Sequencing and Visualization Program (RSVP) is being used in the Mars Science Laboratory (MSL) mission for downlink data visualization and command sequence generation. RSVP reads and writes downlink data products from the operations data server (ODS) and writes uplink data products to the ODS. The primary users of RSVP are members of the Rover Planner team (part of the Integrated Planning and Execution Team (IPE)), who use it to perform traversability/articulation analyses, take activity plan input from the Science and Mission Planning teams, and create a set of rover sequences to be sent to the rover every sol. The primary inputs to RSVP are downlink data products and activity plans in the ODS database. The primary outputs are command sequences to be placed in the ODS for further processing prior to uplink to each rover. RSVP is composed of two main subsystems. The first, called the Robot Sequence Editor (RoSE), understands the MSL activity and command dictionaries and takes care of converting incoming activity level inputs into command sequences. The Rover Planners use the RoSE component of RSVP to put together command sequences and to view and manage command level resources like time, power, temperature, etc. (via a transparent realtime connection to SEQGEN). The second component of RSVP is called HyperDrive, a set of high-fidelity computer graphics displays of the Martian surface in 3D and in stereo. The Rover Planners can explore the environment around the rover, create commands related to motion of all kinds, and see the simulated result of those commands via its underlying tight coupling with flight navigation, motor, and arm software. This software is the evolutionary replacement for the Rover Sequencing and Visualization software used to create command sequences (and visualize the Martian surface) for the Mars Exploration Rover mission.

Development of a reliable method to assess footwear comfort during running.

PubMed

Mündermann, Anne; Nigg, Benno M; Stefanyshyn, Darren J; Humble, R Neil

2002-08-01

The purposes of this study were: (a) to determine whether subjects are able to distinguish between differences in footwear with respect to footwear comfort; and (b) to determine how reliably footwear comfort can be assessed using a visual analogue scale (VAS) and a protocol including a control condition during running. Intraclass correlation coefficients (ICCs) between comfort ratings for repeated conditions were high (ICC = 0.799). Differences in comfort ratings between the insert conditions were significant. A paired t-test revealed a significant difference in overall comfort ratings for the control insert when tested after the soft insert compared to when tested after the hard insert (P = 0.008). The results of this study showed that VASs provide a reliable measure to assess footwear comfort during running under the conditions that: (a) a control condition is included; and (b) the average comfort rating of sessions 4-6 is used. Copyright 2002 Elsevier Science B.V.

Battlefield Visualization

DTIC Science & Technology

1998-12-15

A study analyzing battlefield visualization (BV) as a component of information dominance and superiority. This study outlines basic requirements for effective BV in terms of terrain data, information systems (synthetic environment; COA development and analysis tools) and BV development management, with a focus on technology insertion strategies. This study also reports on existing BV systems and provides 16 recommendations for Army BV support efforts, including interested organization, funding levels and duration of effort for each recommended action.

Haplotype estimation using sequencing reads.

PubMed

Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

2013-10-03

High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Visual Prediction in Infancy: What Is the Association with Later Vocabulary?

ERIC Educational Resources Information Center

Ellis, Erica M.; Gonzalez, Marybel Robledo; Deák, Gedeon O.

2014-01-01

Young infants can learn statistical regularities and patterns in sequences of events. Studies have demonstrated a relationship between early sequence learning skills and later development of cognitive and language skills. We investigated the relation between infants' visual response speed to novel event sequences, and their later receptive and…

Dynamic Assessment of Microbial Ecology (DAME): A web app for interactive analysis and visualization of microbial sequencing data

USDA-ARS?s Scientific Manuscript database

Dynamic Assessment of Microbial Ecology (DAME) is a shiny-based web application for interactive analysis and visualization of microbial sequencing data. DAME provides researchers not familiar with R programming the ability to access the most current R functions utilized for ecology and gene sequenci...

Visual Sequence Learning in Infancy: Domain-General and Domain-Specific Associations with Language

ERIC Educational Resources Information Center

Shafto, Carissa L.; Conway, Christopher M.; Field, Suzanne L.; Houston, Derek M.

2012-01-01

Research suggests that nonlinguistic sequence learning abilities are an important contributor to language development (Conway, Bauernschmidt, Huang, & Pisoni, 2010). The current study investigated visual sequence learning (VSL) as a possible predictor of vocabulary development in infants. Fifty-eight 8.5-month-old infants were presented with a…

Sockeye: A 3D Environment for Comparative Genomics

PubMed Central

Montgomery, Stephen B.; Astakhova, Tamara; Bilenky, Mikhail; Birney, Ewan; Fu, Tony; Hassel, Maik; Melsopp, Craig; Rak, Marcin; Robertson, A. Gordon; Sleumer, Monica; Siddiqui, Asim S.; Jones, Steven J.M.

2004-01-01

Comparative genomics techniques are used in bioinformatics analyses to identify the structural and functional properties of DNA sequences. As the amount of available sequence data steadily increases, the ability to perform large-scale comparative analyses has become increasingly relevant. In addition, the growing complexity of genomic feature annotation means that new approaches to genomic visualization need to be explored. We have developed a Java-based application called Sockeye that uses three-dimensional (3D) graphics technology to facilitate the visualization of annotation and conservation across multiple sequences. This software uses the Ensembl database project to import sequence and annotation information from several eukaryotic species. A user can additionally import their own custom sequence and annotation data. Individual annotation objects are displayed in Sockeye by using custom 3D models. Ensembl-derived and imported sequences can be analyzed by using a suite of multiple and pair-wise alignment algorithms. The results of these comparative analyses are also displayed in the 3D environment of Sockeye. By using the Java3D API to visualize genomic data in a 3D environment, we are able to compactly display cross-sequence comparisons. This provides the user with a novel platform for visualizing and comparing genomic feature organization. PMID:15123592

CBrowse: a SAM/BAM-based contig browser for transcriptome assembly visualization and analysis.

PubMed

Li, Pei; Ji, Guoli; Dong, Min; Schmidt, Emily; Lenox, Douglas; Chen, Liangliang; Liu, Qi; Liu, Lin; Zhang, Jie; Liang, Chun

2012-09-15

To address the impending need for exploring rapidly increased transcriptomics data generated for non-model organisms, we developed CBrowse, an AJAX-based web browser for visualizing and analyzing transcriptome assemblies and contigs. Designed in a standard three-tier architecture with a data pre-processing pipeline, CBrowse is essentially a Rich Internet Application that offers many seamlessly integrated web interfaces and allows users to navigate, sort, filter, search and visualize data smoothly. The pre-processing pipeline takes the contig sequence file in FASTA format and its relevant SAM/BAM file as the input; detects putative polymorphisms, simple sequence repeats and sequencing errors in contigs and generates image, JSON and database-compatible CSV text files that are directly utilized by different web interfaces. CBowse is a generic visualization and analysis tool that facilitates close examination of assembly quality, genetic polymorphisms, sequence repeats and/or sequencing errors in transcriptome sequencing projects. CBrowse is distributed under the GNU General Public License, available at http://bioinfolab.muohio.edu/CBrowse/ liangc@muohio.edu or liangc.mu@gmail.com; glji@xmu.edu.cn Supplementary data are available at Bioinformatics online.

Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

PubMed

Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

2011-04-01

Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

Dynamics and Differential Proliferation of Transposable Elements During the Evolution of the B and A Genomes of Wheat

PubMed Central

Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

2008-01-01

Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739

A Novel Cylindrical Representation for Characterizing Intrinsic Properties of Protein Sequences.

PubMed

Yu, Jia-Feng; Dou, Xiang-Hua; Wang, Hong-Bo; Sun, Xiao; Zhao, Hui-Ying; Wang, Ji-Hua

2015-06-22

The composition and sequence order of amino acid residues are the two most important characteristics to describe a protein sequence. Graphical representations facilitate visualization of biological sequences and produce biologically useful numerical descriptors. In this paper, we propose a novel cylindrical representation by placing the 20 amino acid residue types in a circle and sequence positions along the z axis. This representation allows visualization of the composition and sequence order of amino acids at the same time. Ten numerical descriptors and one weighted numerical descriptor have been developed to quantitatively describe intrinsic properties of protein sequences on the basis of the cylindrical model. Their applications to similarity/dissimilarity analysis of nine ND5 proteins indicated that these numerical descriptors are more effective than several classical numerical matrices. Thus, the cylindrical representation obtained here provides a new useful tool for visualizing and charactering protein sequences. An online server is available at http://biophy.dzu.edu.cn:8080/CNumD/input.jsp .

Differential display detects host nucleic acid motifs altered in scrapie-infected brain.

PubMed

Lathe, Richard; Harris, Alyson

2009-09-25

The transmissible spongiform encephalopathies (TSEs) including scrapie have been attributed to an infectious protein or prion. Infectivity is allied to conversion of the endogenous nucleic-acid-binding protein PrP to an infectious modified form known as PrP(sc). The protein-only theory does not easily explain the enigmatic properties of the agent including strain variation. It was previously suggested that a short nucleic acid, perhaps host-encoded, might contribute to the pathoetiology of the TSEs. No candidate host molecules that might explain transmission of strain differences have yet been put forward. Differential display is a robust technique for detecting nucleic acid differences between two populations. We applied this technique to total nucleic acid preparations from scrapie-infected and control brain. Independent RNA preparations from eight normal and eight scrapie-infected (strain 263K) hamster brains were randomly amplified and visualized in parallel. Though the nucleic acid patterns were generally identical in scrapie-infected versus control brain, some rare bands were differentially displayed. Molecular species consistently overrepresented (or underrepresented) in all eight infected brain samples versus all eight controls were excised from the display, sequenced, and assembled into contigs. Only seven ros contigs (RNAs over- or underrepresented in scrapie) emerged, representing <4 kb from the transcriptome. All contained highly stable regions of secondary structure. The most abundant scrapie-only ros sequence was homologous to a repetitive transposable element (LINE; long interspersed nuclear element). Other ros sequences identified cellular RNA 7SL, clathrin heavy chain, visinin-like protein-1, and three highly specific subregions of ribosomal RNA (ros1-3). The ribosomal ros sequences accurately corresponded to LINE; retrotransposon insertion sites in ribosomal DNA (p<0.01). These differential motifs implicate specific host RNAs in the pathoetiology of the TSEs.

Chronodes: Interactive Multifocus Exploration of Event Sequences

PubMed Central

POLACK, PETER J.; CHEN, SHANG-TSE; KAHNG, MINSUK; DE BARBARO, KAYA; BASOLE, RAHUL; SHARMIN, MOUSHUMI; CHAU, DUEN HORNG

2018-01-01

The advent of mobile health (mHealth) technologies challenges the capabilities of current visualizations, interactive tools, and algorithms. We present Chronodes, an interactive system that unifies data mining and human-centric visualization techniques to support explorative analysis of longitudinal mHealth data. Chronodes extracts and visualizes frequent event sequences that reveal chronological patterns across multiple participant timelines of mHealth data. It then combines novel interaction and visualization techniques to enable multifocus event sequence analysis, which allows health researchers to interactively define, explore, and compare groups of participant behaviors using event sequence combinations. Through summarizing insights gained from a pilot study with 20 behavioral and biomedical health experts, we discuss Chronodes’s efficacy and potential impact in the mHealth domain. Ultimately, we outline important open challenges in mHealth, and offer recommendations and design guidelines for future research. PMID:29515937

SU-D-BRF-05: A Novel System to Provide Real-Time Image-Guidance for Intrauterine Tandem Insertion and Placement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Price, M; Fontenot, J

Purpose: To develop a system that provides real-time image-guidance for intrauterine tandem insertion and placement for brachytherapy. Methods: The conceptualized system consists of an intrauterine tandem with a transparent, lensed tip, a flexible miniature fiber optic scope, light source and interface for CCD coupling. The tandem tip was designed to act as a lens providing a wide field-of-view (FOV) with minimal image distortion and focus length appropriate for the application. The system is designed so that once inserted, the image-guidance component of the system can be removed and brachytherapy can be administered without interfering with source transport or disturbing tandemmore » placement. Proof-of-principle studies were conducted to assess the conceptualized system's (1) lens functionality (clarity, focus and FOV) (2) and ability to visualize the cervical os of a female placed in the lithotomy position. Results: A prototype of this device was constructed using a commercial tandem modified to incorporate a transparent tip that internally coupled with a 1.9mm diameter fiber optic cable. The 900mm-long cable terminated at an interface that provided illumination as well as facilitated visualization of patient anatomy on a computer. The system provided a 23mm FOV with a focal length of 1cm and provided clear visualization of the cervix, cervical fornix and cervical os. The optical components of the system are easily removed without perturbing the position of a tandem placed in a common fixation clamp. Conclusion: Clinicians frequently encounter difficulty inserting an intrauterine tandem through the cervical os, circumventing fibrotic tissue or masses within the uterus, and positioning the tandem without perforating the uterus. To mitigate these challenges, we have designed and conducted proof-of- principle studies to discern the utility of a prototype device that provides real-time image-guidance for intrauterine tandem placement using fiber optic components.« less

Final technical report for: Insertional Mutagenesis of Brachypodium distachyon DE-AI02-07ER64452

DOE Office of Scientific and Technical Information (OSTI.GOV)

John, Vogel P.

Several bioenergy grasses are poised to become a major source of energy in the United States. Despite their increasing importance, we know little about the basic biology underlying the traits that control the utility of grasses as energy crops. Better knowledge of grass biology (e.g. identification of the genes that control cell wall composition, plant architecture, cell size, cell division, reproduction, nutrient uptake, carbon flux, etc.) could be used to design rational strategies for crop improvement and shorten the time required to domesticate these species. The use of an appropriate model system is an efficient way to gain this knowledge.more » Brachypodium distachyon is a small annual grass with all the attributes needed to be a modern model organism including simple growth requirements, fast generation time, small stature, small genome size and self-fertility. These attributes led to the recommendation in the DOE’s “Breaking the Biological Barriers to Cellulosic Ethanol: A Joint Research Agenda” report to propose developing and using B. distachyon as a model for energy crops to accelerate their domestication. Strategic investments (e.g. genome sequencing) in B. distachyon by the DOE are now bearing fruit and B. distachyon is being used as a model grass by hundreds of laboratories worldwide. Sequence indexed insertional mutants are an extremely powerful tool for both forward and reverse genetics. They allow researchers to order mutants in any gene tagged in the collection by simply emailing a request. The goal of this project was to create a collection of sequence indexed insertional mutants (T-DNA lines) for the model grass Brachypodium distachyon in order to facilitate research by the scientific community. During the course of this grant we created a collection of 23,649 B. distachyon T-DNA lines and identified 26,112 unique insertion sites. The collection can be queried through the project website (http://jgi.doe.gov/our-science/science-programs/plant-genomics/brachypodium/brachypodium-t-dna-collection/) and through the Phytozome genome browser (http://phytozome.jgi.doe.gov/pz/portal.html). The collection has been heavily utilized by the research community and, as of October 23, 2015, 223 orders for 12,069 seeds packets have been filled. In addition to creating this resource, we also optimized methods for transformation and sequencing DNA flanking insertion sites.« less

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

Comparison of the analgesic effects of oral tramadol and naproxen sodium on pain relief during IUD insertion.

PubMed

Karabayirli, Safinaz; Ayrim, Aylin Aker; Muslu, Bunyamin

2012-01-01

To compare the analgesic efficacy of oral tramadol and naproxen sodium on pain during insertion of an intrauterine device (IUD). Randomized, double-blinded, clinical trial (Canadian Task Force classification I). University-affiliated hospital. Single-center. One hundred three patients scheduled for insertion of an IUD. Patients were randomly assigned to receive oral tramadol 50 mg capsules (n = 35) or naproxen sodium 550 mg tablets (n = 34) or placebo (n = 34) 1 hour before insertion of the IUD. After insertion of the IUD, pain intensity was evaluated using a visual analog scale (VAS, 0-10). Adverse effects, patient satisfaction with the medication, and preference for using it during future insertions were also recorded. The VAS scores were significantly different during IUD insertion among the 3 groups (p = .001). Pain scores in the tramadol group were significantly lower than in the naproxen group (p = .003), and the scores in the naproxen group was significantly lower than in the control group (p = .001). Patient satisfaction with the medication and preference for its future use were significantly lower in the control group than in the other 2 groups (p = .001). Prophylactic analgesia using 50 mg tramadol and 550 mg naproxen, delivered orally, can be used to relieve pain during IUD insertion. However, tramadol capsules were found to be more effective than naproxen tablets. Copyright © 2012 AAGL. Published by Elsevier Inc. All rights reserved.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2008-06-24

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S; Cabantous, Stephanie

2013-02-12

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2011-06-14

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Circular permutant GFP insertion folding reporters

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2013-04-16

Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

Intracisternal A-Particle Element Transposition into the Murine β-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for β-Glucuronidase Deficiency in the C3H Mouse†

PubMed Central

Gwynn, Babette; Lueders, Kira; Sands, Mark S.; Birkenmeier, Edward H.

1998-01-01

The severity of human mucopolysaccharidosis type VII (MPS VII), or Sly syndrome, depends on the relative activity of the enzyme β-glucuronidase. Loss of β-glucuronidase activity can cause hydrops fetalis, with in utero or postnatal death of the patient. In this report, we show that β-glucuronidase activity is not detectable by a standard fluorometric assay in C3H/HeOuJ (C3H) mice homozygous for a new mutation, gusmps2J. These gusmps2J/gusmps2J mice are born and survive much longer than the previously characterized β-glucuronidase-null B6.C-H-2bm1/ByBir-gusmps (gusmps/gusmps) mice. Northern blot analysis of liver from gusmps2J/gusmps2J mice demonstrates a 750-bp reduction in size of β-glucuronidase mRNA. A 5.4-kb insertion in the Gus-sh nucleotide sequence from these mice was localized by Southern blot analysis to intron 8. The ends of the inserted sequences were cloned by inverse PCR and revealed an intracisternal A-particle (IAP) element inserted near the 3′ end of the intron. The sequence of the long terminal repeat (LTR) regions of the IAP most closely matches that of a composite LTR found in transposed IAPs previously identified in the C3H strain. The inserted IAP may contribute to diminished β-glucuronidase activity either by interfering with transcription or by destabilizing the message. The resulting phenotype is much less severe than that previously described in the gusmps/gusmps mouse and provides an opportunity to study MPS VII on a genetic background that clearly modulates disease severity. PMID:9774663

Timing of Visual Bodily Behavior in Repair Sequences: Evidence from Three Languages

ERIC Educational Resources Information Center

Floyd, Simeon; Manrique, Elizabeth; Rossi, Giovanni; Torreira, Francisco

2016-01-01

This article expands the study of other-initiated repair in conversation--when one party signals a problem with producing or perceiving another's turn at talk--into the domain of visual bodily behavior. It presents one primary cross-linguistic finding about the timing of visual bodily behavior in repair sequences: if the party who initiates repair…

An augmented reality haptic training simulator for spinal needle procedures.

PubMed

Sutherland, Colin; Hashtrudi-Zaad, Keyvan; Sellens, Rick; Abolmaesumi, Purang; Mousavi, Parvin

2013-11-01

This paper presents the prototype for an augmented reality haptic simulation system with potential for spinal needle insertion training. The proposed system is composed of a torso mannequin, a MicronTracker2 optical tracking system, a PHANToM haptic device, and a graphical user interface to provide visual feedback. The system allows users to perform simulated needle insertions on a physical mannequin overlaid with an augmented reality cutaway of patient anatomy. A tissue model based on a finite-element model provides force during the insertion. The system allows for training without the need for the presence of a trained clinician or access to live patients or cadavers. A pilot user study demonstrates the potential and functionality of the system.

A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

PubMed

Namouchi, Amine; Mardassi, Helmi

2006-11-01

Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.

Gene relocations within chloroplast genomes of Jasminum and Menodora (Oleaceae) are due to multiple, overlapping inversions.

PubMed

Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong

2007-05-01

The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.

Immersive visualization for navigation and control of the Mars Exploration Rovers

NASA Technical Reports Server (NTRS)

Hartman, Frank R.; Cooper, Brian; Maxwell, Scott; Wright, John; Yen, Jeng

2004-01-01

The Rover Sequencing and Visualization Program (RSVP) is a suite of tools for sequencing of planetary rovers, which are subject to significant light time delay and thus are unsuitable for teleoperation.

Surgical simulation software for insertion of pedicle screws.

PubMed

Eftekhar, Behzad; Ghodsi, Mohammad; Ketabchi, Ebrahim; Rasaee, Saman

2002-01-01

As the first step toward finding noninvasive alternatives to the traditional methods of surgical training, we have developed a small, stand-alone computer program that simulates insertion of pedicle screws in different spinal vertebrae (T10-L5). We used Delphi 5.0 and DirectX 7.0 extension for Microsoft Windows. This is a stand-alone and portable program. The program can run on most personal computers. It provides the trainee with visual feedback during practice of the technique. At present, it uses predefined three-dimensional images of the vertebrae, but we are attempting to adapt the program to three-dimensional objects based on real computed tomographic scans of the patients. The program can be downloaded at no cost from the web site: www.tums.ac.ir/downloads As a preliminary work, it requires further development, particularly toward better visual, auditory, and even proprioceptive feedback and use of the individual patient's data.

Imaging light responses of foveal ganglion cells in the living macaque eye.

PubMed

Yin, Lu; Masella, Benjamin; Dalkara, Deniz; Zhang, Jie; Flannery, John G; Schaffer, David V; Williams, David R; Merigan, William H

2014-05-07

The fovea dominates primate vision, and its anatomy and perceptual abilities are well studied, but its physiology has been little explored because of limitations of current physiological methods. In this study, we adapted a novel in vivo imaging method, originally developed in mouse retina, to explore foveal physiology in the macaque, which permits the repeated imaging of the functional response of many retinal ganglion cells (RGCs) simultaneously. A genetically encoded calcium indicator, G-CaMP5, was inserted into foveal RGCs, followed by calcium imaging of the displacement of foveal RGCs from their receptive fields, and their intensity-response functions. The spatial offset of foveal RGCs from their cone inputs makes this method especially appropriate for fovea by permitting imaging of RGC responses without excessive light adaptation of cones. This new method will permit the tracking of visual development, progression of retinal disease, or therapeutic interventions, such as insertion of visual prostheses.

Simultaneous bright‐ and black‐blood whole‐heart MRI for noncontrast enhanced coronary lumen and thrombus visualization

PubMed Central

Neji, Radhouene; Phinikaridou, Alkystis; Whitaker, John; Botnar, René M.; Prieto, Claudia

2017-01-01

Purpose To develop a 3D whole‐heart Bright‐blood and black‐blOOd phase SensiTive (BOOST) inversion recovery sequence for simultaneous noncontrast enhanced coronary lumen and thrombus/hemorrhage visualization. Methods The proposed sequence alternates the acquisition of two bright‐blood datasets preceded by different preparatory pulses to obtain variations in blood/myocardium contrast, which then are combined in a phase‐sensitive inversion recovery (PSIR)‐like reconstruction to obtain a third, coregistered, black‐blood dataset. The bright‐blood datasets are used for both visualization of the coronary lumen and motion estimation, whereas the complementary black‐blood dataset potentially allows for thrombus/hemorrhage visualization. Furthermore, integration with 2D image‐based navigation enables 100% scan efficiency and predictable scan times. The proposed sequence was compared to conventional coronary MR angiography (CMRA) and PSIR sequences in a standardized phantom and in healthy subjects. Feasibility for thrombus depiction was tested ex vivo. Results With BOOST, the coronary lumen is visualized with significantly higher (P < 0.05) contrast‐to‐noise ratio and vessel sharpness when compared to conventional CMRA. Furthermore, BOOST showed effective blood signal suppression as well as feasibility for thrombus visualization ex vivo. Conclusion A new PSIR sequence for noncontrast enhanced simultaneous coronary lumen and thrombus/hemorrhage detection was developed. The sequence provided improved coronary lumen depiction and showed potential for thrombus visualization. Magn Reson Med 79:1460–1472, 2018. © 2017 International Society for Magnetic Resonance in Medicine. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. PMID:28722267

GASP: Gapped Ancestral Sequence Prediction for proteins

PubMed Central

Edwards, Richard J; Shields, Denis C

2004-01-01

Background The prediction of ancestral protein sequences from multiple sequence alignments is useful for many bioinformatics analyses. Predicting ancestral sequences is not a simple procedure and relies on accurate alignments and phylogenies. Several algorithms exist based on Maximum Parsimony or Maximum Likelihood methods but many current implementations are unable to process residues with gaps, which may represent insertion/deletion (indel) events or sequence fragments. Results Here we present a new algorithm, GASP (Gapped Ancestral Sequence Prediction), for predicting ancestral sequences from phylogenetic trees and the corresponding multiple sequence alignments. Alignments may be of any size and contain gaps. GASP first assigns the positions of gaps in the phylogeny before using a likelihood-based approach centred on amino acid substitution matrices to assign ancestral amino acids. Important outgroup information is used by first working down from the tips of the tree to the root, using descendant data only to assign probabilities, and then working back up from the root to the tips using descendant and outgroup data to make predictions. GASP was tested on a number of simulated datasets based on real phylogenies. Prediction accuracy for ungapped data was similar to three alternative algorithms tested, with GASP performing better in some cases and worse in others. Adding simple insertions and deletions to the simulated data did not have a detrimental effect on GASP accuracy. Conclusions GASP (Gapped Ancestral Sequence Prediction) will predict ancestral sequences from multiple protein alignments of any size. Although not as accurate in all cases as some of the more sophisticated maximum likelihood approaches, it can process a wide range of input phylogenies and will predict ancestral sequences for gapped and ungapped residues alike. PMID:15350199

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Child Development and Structural Variation in the Human Genome

ERIC Educational Resources Information Center

Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

2013-01-01

Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

Genome-wide copy number variation in the bovine genome detected using low coverage sequence of popular beef breeds

USDA-ARS?s Scientific Manuscript database

Copy number variations (CNVs) are large insertions, deletions or duplications in the genome that vary between members of a species and are known to affect a wide variety of phenotypic traits. In this study, we identified CNVs in a population of bulls using low coverage next-generation sequence data....

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-10-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed Central

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-01-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The development of a cisgenic apple plant.

PubMed

Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare

2011-07-20

Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.

Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.

PubMed

Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B

2015-05-14

G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.

Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.

PubMed

d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P

2003-04-01

The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.

The distribution of a phage-related insertion sequence element in the cyanobacterium, Microcystis aeruginosa.

PubMed

Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko

2010-01-01

The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

Visually guided tube thoracostomy insertion comparison to standard of care in a large animal model.

PubMed

Hernandez, Matthew C; Vogelsang, David; Anderson, Jeff R; Thiels, Cornelius A; Beilman, Gregory; Zielinski, Martin D; Aho, Johnathon M

2017-04-01

Tube thoracostomy (TT) is a lifesaving procedure for a variety of thoracic pathologies. The most commonly utilized method for placement involves open dissection and blind insertion. Image guided placement is commonly utilized but is limited by an inability to see distal placement location. Unfortunately, TT is not without complications. We aim to demonstrate the feasibility of a disposable device to allow for visually directed TT placement compared to the standard of care in a large animal model. Three swine were sequentially orotracheally intubated and anesthetized. TT was conducted utilizing a novel visualization device, tube thoracostomy visual trocar (TTVT) and standard of care (open technique). Position of the TT in the chest cavity were recorded using direct thoracoscopic inspection and radiographic imaging with the operator blinded to results. Complications were evaluated using a validated complication grading system. Standard descriptive statistical analyses were performed. Thirty TT were placed, 15 using TTVT technique, 15 using standard of care open technique. All of the TT placed using TTVT were without complication and in optimal position. Conversely, 27% of TT placed using standard of care open technique resulted in complications. Necropsy revealed no injury to intrathoracic organs. Visual directed TT placement using TTVT is feasible and non-inferior to the standard of care in a large animal model. This improvement in instrumentation has the potential to greatly improve the safety of TT. Further study in humans is required. Therapeutic Level II. Copyright © 2017 Elsevier Ltd. All rights reserved.

Visual ModuleOrganizer: a graphical interface for the detection and comparative analysis of repeat DNA modules

PubMed Central

2014-01-01

Background DNA repeats, such as transposable elements, minisatellites and palindromic sequences, are abundant in sequences and have been shown to have significant and functional roles in the evolution of the host genomes. In a previous study, we introduced the concept of a repeat DNA module, a flexible motif present in at least two occurences in the sequences. This concept was embedded into ModuleOrganizer, a tool allowing the detection of repeat modules in a set of sequences. However, its implementation remains difficult for larger sequences. Results Here we present Visual ModuleOrganizer, a Java graphical interface that enables a new and optimized version of the ModuleOrganizer tool. To implement this version, it was recoded in C++ with compressed suffix tree data structures. This leads to less memory usage (at least 120-fold decrease in average) and decreases by at least four the computation time during the module detection process in large sequences. Visual ModuleOrganizer interface allows users to easily choose ModuleOrganizer parameters and to graphically display the results. Moreover, Visual ModuleOrganizer dynamically handles graphical results through four main parameters: gene annotations, overlapping modules with known annotations, location of the module in a minimal number of sequences, and the minimal length of the modules. As a case study, the analysis of FoldBack4 sequences clearly demonstrated that our tools can be extended to comparative and evolutionary analyses of any repeat sequence elements in a set of genomic sequences. With the increasing number of sequences available in public databases, it is now possible to perform comparative analyses of repeated DNA modules in a graphic and friendly manner within a reasonable time period. Availability Visual ModuleOrganizer interface and the new version of the ModuleOrganizer tool are freely available at: http://lcb.cnrs-mrs.fr/spip.php?rubrique313. PMID:24678954

Copy number determination of genetically-modified hematopoietic stem cells.

PubMed

Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke

2009-01-01

Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.

Ribosomes slide on lysine-encoding homopolymeric A stretches

PubMed Central

Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

2015-01-01

Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

NASA Astrophysics Data System (ADS)

Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

1990-09-01

Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

Deep Motif Dashboard: Visualizing and Understanding Genomic Sequences Using Deep Neural Networks

PubMed Central

Lanchantin, Jack; Singh, Ritambhara; Wang, Beilun; Qi, Yanjun

2018-01-01

Deep neural network (DNN) models have recently obtained state-of-the-art prediction accuracy for the transcription factor binding (TFBS) site classification task. However, it remains unclear how these approaches identify meaningful DNA sequence signals and give insights as to why TFs bind to certain locations. In this paper, we propose a toolkit called the Deep Motif Dashboard (DeMo Dashboard) which provides a suite of visualization strategies to extract motifs, or sequence patterns from deep neural network models for TFBS classification. We demonstrate how to visualize and understand three important DNN models: convolutional, recurrent, and convolutional-recurrent networks. Our first visualization method is finding a test sequence’s saliency map which uses first-order derivatives to describe the importance of each nucleotide in making the final prediction. Second, considering recurrent models make predictions in a temporal manner (from one end of a TFBS sequence to the other), we introduce temporal output scores, indicating the prediction score of a model over time for a sequential input. Lastly, a class-specific visualization strategy finds the optimal input sequence for a given TFBS positive class via stochastic gradient optimization. Our experimental results indicate that a convolutional-recurrent architecture performs the best among the three architectures. The visualization techniques indicate that CNN-RNN makes predictions by modeling both motifs as well as dependencies among them. PMID:27896980

Painless needle insertion in regional anesthesia of the eye.

PubMed

Vaalamo, M O; Paloheimo, M P; Nikki, P H

1995-04-01

We examined a new technique of applying topical anesthetic with cotton tip sticks to the conjunctiva before needle insertion in regional anesthesia of the eye. Oxybuprocaine 0.4% and lidocaine 4% were compared with balanced salt solution (BSS) as topical anesthetics of the conjunctiva in Study 1. Ninety patients were randomly assigned into three groups (n = 30) to receive one of the three topical anesthetics in a double-blind manner. Pain of the needle insertions was measured with visual analog scale score (VAS) and quantitative surface electromography (qEMG). Both oxybuprocaine and lidocaine reduced pain significantly when compared to BSS. In Study 2, with healthy volunteers, we compared our previous practice of merely applying three consecutive drops of oxybuprocaine on the conjunctiva before needle insertions to the new technique of placing additional cotton tip sticks soaked in oxybuprocaine on the conjunctiva. We found the needle insertion virtually pain free when the cotton tip sticks were added to the topical anesthesia. The use of this simple method of topical anesthesia before the eye block increases patient comfort significantly.

The Roles of Visualization and Symbolism in the Potential and Actual Infinity of the Limit Process

ERIC Educational Resources Information Center

Kidron, Ivy; Tall, David

2015-01-01

A teaching experiment-using Mathematica to investigate the convergence of sequence of functions visually as a sequence of objects (graphs) converging onto a fixed object (the graph of the limit function)-is here used to analyze how the approach can support the dynamic blending of visual and symbolic representations that has the potential to lead…

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Bouncing Ball with a Uniformly Varying Velocity in a Metronome Synchronization Task.

PubMed

Huang, Yingyu; Gu, Li; Yang, Junkai; Wu, Xiang

2017-09-21

Sensorimotor synchronization (SMS), a fundamental human ability to coordinate movements with external rhythms, has long been thought to be modality specific. In the canonical metronome synchronization task that requires tapping a finger along with an isochronous sequence, a well-established finding is that synchronization is much more stable to an auditory sequence consisting of auditory tones than to a visual sequence consisting of visual flashes. However, recent studies have shown that periodically moving visual stimuli can substantially improve synchronization compared with visual flashes. In particular, synchronization of a visual bouncing ball that has a uniformly varying velocity was found to be not less stable than synchronization of auditory tones. Here, the current protocol describes the application of the bouncing ball with a uniformly varying velocity in a metronome synchronization task. The usage of the bouncing ball in sequences with different inter-onset intervals (IOI) is included. The representative results illustrate synchronization performance of the bouncing ball, as compared with the performances of auditory tones and visual flashes. Given its comparable synchronization performance to that of auditory tones, the bouncing ball is of particular importance for addressing the current research topic of whether modality-specific mechanisms underlay SMS.

Feasibility of an endotracheal tube-mounted camera for percutaneous dilatational tracheostomy.

PubMed

Grensemann, J; Eichler, L; Hopf, S; Jarczak, D; Simon, M; Kluge, S

2017-07-01

Percutaneous dilatational tracheostomy (PDT) in critically ill patients is often led by optical guidance with a bronchoscope. This is not without its disadvantages. Therefore, we aimed to study the feasibility of a recently introduced endotracheal tube-mounted camera (VivaSight™-SL, ET View, Misgav, Israel) in the guidance of PDT. We studied 10 critically ill patients who received PDT with a VivaSight-SL tube that was inserted prior to tracheostomy for optical guidance. Visualization of the tracheal structures (i.e., identification and monitoring of the thyroid, cricoid, and tracheal cartilage and the posterior wall) and the quality of ventilation (before puncture and during the tracheostomy) were rated on four-point Likert scales. Respiratory variables were recorded, and blood gases were sampled before the interventions, before the puncture and before the insertion of the tracheal cannula. Visualization of the tracheal landmarks was rated as 'very good' or 'good' in all but one case. Monitoring during the puncture and dilatation was also rated as 'very good' or 'good' in all but one. In the cases that were rated 'difficult', the visualization and monitoring of the posterior wall of the trachea were the main concerns. No changes in the respiratory variables or blood gases occurred between the puncture and the insertion of the tracheal cannula. Percutaneous dilatational tracheostomy with optical guidance from a tube-mounted camera is feasible. Further studies comparing the camera tube with bronchoscopy as the standard approach should be performed. © 2017 The Acta Anaesthesiologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

Lineages of Streptococcus equi ssp. equi in the Irish equine industry.

PubMed

Moloney, Emma; Kavanagh, Kerrie S; Buckley, Tom C; Cooney, Jakki C

2013-01-01

Streptococcus equi ssp. equi is the causative agent of 'Strangles' in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2-8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK.

Lineages of Streptococcus equi ssp. equi in the Irish equine industry

PubMed Central

2013-01-01

Background Streptococcus equi ssp. equi is the causative agent of ‘Strangles’ in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Results Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2–8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. Conclusions The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK. PMID:23731628

Inserting Phase Change Lines into Microsoft Excel® Graphs.

PubMed

Dubuque, Erick M

2015-10-01

Microsoft Excel® is a popular graphing tool used by behavior analysts to visually display data. However, this program is not always friendly to the graphing conventions used by behavior analysts. For example, adding phase change lines has typically been a cumbersome process involving the insertion of line objects that do not move when new data is added to a graph. The purpose of this article is to describe a novel way to add phase change lines that move when new data is added and when graphs are resized.

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

Potential Links between Hepadnavirus and Bornavirus Sequences in the Host Genome and Cancer.

PubMed

Honda, Tomoyuki

2017-01-01

Various viruses leave their sequences in the host genomes during infection. Such events occur mainly in retrovirus infection but also sometimes in DNA and non-retroviral RNA virus infections. If viral sequences are integrated into the genomes of germ line cells, the sequences can become inherited as endogenous viral elements (EVEs). The integration events of viral sequences may have oncogenic potential. Because proviral integrations of some retroviruses and/or reactivation of endogenous retroviruses are closely linked to cancers, viral insertions related to non-retroviral viruses also possibly contribute to cancer development. This article focuses on genomic viral sequences derived from two non-retroviral viruses, whose endogenization is already reported, and discusses their possible contributions to cancer. Viral insertions of hepatitis B virus play roles in the development of hepatocellular carcinoma. Endogenous bornavirus-like elements, the only non-retroviral RNA virus-related EVEs found in the human genome, may also be involved in cancer formation. In addition, the possible contribution of the interactions between viruses and retrotransposons, which seem to be a major driving force for generating EVEs related to non-retroviral RNA viruses, to cancers will be discussed. Future studies regarding the possible links described here may open a new avenue for the development of novel therapeutics for tumor virus-related cancers and/or provide novel insights into EVE functions.

Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy.

PubMed

Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.

Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

PubMed Central

Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH

PubMed Central

Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M.

2017-01-01

Abstract Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. PMID:28961970

Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

PubMed Central

Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

1995-01-01

A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

Short Communication: Analysis of Minor Populations of Human Immunodeficiency Virus by Primer Identification and Insertion-Deletion and Carry Forward Correction Pipelines.

PubMed

Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M

2016-03-01

Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.

Heterochromatic self-association, a determinant of nuclear organization, does not require sequence homology in Drosophila.

PubMed Central

Sage, Brian T; Csink, Amy K

2003-01-01

Chromosomes of higher eukaryotes contain blocks of heterochromatin that can associate with each other in the interphase nucleus. A well-studied example of heterochromatic interaction is the brown(Dominant) (bwD) chromosome of D. melanogaster, which contains an approximately 1.6-Mbp insertion of AAGAG repeats near the distal tip of chromosome 2. This insertion causes association of the tip with the centric heterochromatin of chromosome 2 (2h), which contains megabases of AAGAG repeats. Here we describe an example, other than bwD, in which distally translocated heterochromatin associates with centric heterochromatin. Additionally, we show that when a translocation places bwD on a different chromosome, bwD tends to associate with the centric heterochromatin of this chromosome, even when the chromosome contains a small fraction of the sequence homology present elsewhere. To further test the importance of sequence homology in these interactions, we used interspecific mating to introgress the bwD allele from D. melanogaster into D. simulans, which lacks the AAGAG on the autosomes. We find that D. simulans bwD associates with 2h, which lacks the AAGAG sequence, while it does not associate with the AAGAG containing X chromosome heterochromatin. Our results show that intranuclear association of separate heterochromatic blocks does not require that they contain the same sequence. PMID:14668374

Isolation and Identification of Pathogenicity Mutant of Curvularia lunata via Restriction Enzyme-Mediated Integration.

PubMed

Wang, Y J; Liu, T; Hou, J M; Zuo, Y H

2013-09-01

In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdullayev, A. M.; Kulish, G. V.; Slyeptsov, O.

The evaluation of WWER-1000 Westinghouse fuel performance was done using the results of post–irradiation examinations of six LTAs and the WFA reload batches that have operated normally in mixed cores at South-Ukraine NPP, Unit-3 and Unit-2. The data on WFA/LTA elongation, FR growth and bow, WFA bow and twist, RCCA drag force and drag work, RCCA drop time, FR cladding integrity as well as the visual observation of fuel assemblies obtained during the 2006-2012 outages was utilized. The analysis of the measured data showed that assembly growth, FR bow, irradiation growth, and Zr-1%Nb grid and ZIRLO cladding corrosion lies withinmore » the design limits. The RCCA drop time measured for the LTA/WFA is about 1.9 s at BOC and practically does not change at EOC. The measured WFA bow and twist, and data of drag work on RCCA insertion showed that the WFA deformation in the mixed core is mostly controlled by the distortion of Russian FAs (TVSA) having the higher lateral stiffness. The visual inspection of WFAs carried out during the 2012 outages revealed some damage to the Zr-1%Nb grid outer strap for some WFAs during the loading sequence. The performed fundamental investigations allowed identifying the root cause of grid outer strap deformation and proposing the WFA design modifications for preventing damage to SG at a 225 kg handling trip limit.« less

Gene conversion as a mechanism for divergence of a chloroplast tRNA gene inserted in the mitochondrial genome of Brassica oleracea.

PubMed Central

Dron, M; Hartmann, C; Rode, A; Sevignac, M

1985-01-01

We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548

Genomic deletions created upon LINE-1 retrotransposition.

PubMed

Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V

2002-08-09

LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.

Method of generating ploynucleotides encoding enhanced folding variants

DOEpatents

Bradbury, Andrew M.; Kiss, Csaba; Waldo, Geoffrey S.

2017-05-02

The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention provides methods for generating thermostable variants of a target protein or polypeptide via an internal destabilization baiting strategy. Internally destabilization a protein of interest is achieved by inserting a heterologous, folding-destabilizing sequence (folding interference domain) within DNA encoding the protein of interest, evolving the protein sequences adjacent to the heterologous insertion to overcome the destabilization (using any number of mutagenesis methods), thereby creating a library of variants. The variants in the library are expressed, and those with enhanced folding characteristics selected.

The Plasmodium selenoproteome

PubMed Central

Lobanov, Alexey V.; Delgado, Cesar; Rahlfs, Stefan; Novoselov, Sergey V.; Kryukov, Gregory V.; Gromer, Stephan; Hatfield, Dolph L.; Becker, Katja; Gladyshev, Vadim N.

2006-01-01

The use of selenocysteine (Sec) as the 21st amino acid in the genetic code has been described in all three major domains of life. However, within eukaryotes, selenoproteins are only known in animals and algae. In this study, we characterized selenoproteomes and Sec insertion systems in protozoan Apicomplexa parasites. We found that among these organisms, Plasmodium and Toxoplasma utilized Sec, whereas Cryptosporidium did not. However, Plasmodium had no homologs of known selenoproteins. By searching computationally for evolutionarily conserved selenocysteine insertion sequence (SECIS) elements, which are RNA structures involved in Sec insertion, we identified four unique Plasmodium falciparum selenoprotein genes. These selenoproteins were incorrectly annotated in PlasmoDB, were conserved in other Plasmodia and had no detectable homologs in other species. We provide evidence that two Plasmodium SECIS elements supported Sec insertion into parasite and endogenous selenoproteins when they were expressed in mammalian cells, demonstrating that the Plasmodium SECIS elements are functional and indicating conservation of Sec insertion between Apicomplexa and animals. Dependence of the plasmodial parasites on selenium suggests possible strategies for antimalarial drug development. PMID:16428245

Molecular and bioinformatic analysis of the FB-NOF transposable element.

PubMed

Badal, Martí; Portela, Anna; Xamena, Noel; Cabré, Oriol

2006-04-12

The Drosophila melanogaster transposable element FB-NOF is known to play a role in genome plasticity through the generation of all sort of genomic rearrangements. Moreover, several insertional mutants due to FB mobilizations have been reported. Its structure and sequence, however, have been poorly studied mainly as a consequence of the long, complex and repetitive sequence of FB inverted repeats. This repetitive region is composed of several 154 bp blocks, each with five almost identical repeats. In this paper, we report the sequencing process of 2 kb long FB inverted repeats of a complete FB-NOF element, with high precision and reliability. This achievement has been possible using a new map of the FB repetitive region, which identifies unambiguously each repeat with new features that can be used as landmarks. With this new vision of the element, a list of FB-NOF in the D. melanogaster genomic clones has been done, improving previous works that used only bioinformatic algorithms. The availability of many FB and FB-NOF sequences allowed an analysis of the FB insertion sequences that showed no sequence specificity, but a preference for A/T rich sequences. The position of NOF into FB is also studied, revealing that it is always located after a second repeat in a random block. With the results of this analysis, we propose a model of transposition in which NOF jumps from FB to FB, using an unidentified transposase enzyme that should specifically recognize the second repeat end of the FB blocks.

Mitochondrial genes in the colourless alga Prototheca wickerhamii resemble plant genes in their exons but fungal genes in their introns.

PubMed Central

Wolff, G; Burger, G; Lang, B F; Kück, U

1993-01-01

The mitochondrial DNA from the colourless alga Prototheca wickerhamii contains two mosaic genes as was revealed from complete sequencing of the circular extranuclear genome. The genes for the large subunit of the ribosomal RNA (LSUrRNA) as well as for subunit I of the cytochrome oxidase (coxI) carry two and three intronic sequences respectively. On the basis of their canonical nucleotide sequences they can be classified as group I introns. Phylogenetic comparisons of the coxI protein sequences allow us to conclude that the P.wickerhamii mtDNA is much closer related to higher plant mtDNAs than to those of the chlorophyte alga C.reinhardtii. The comparison of the intron sequences revealed several unusual features: (1) The P.wickerhamii introns are structurally related to mitochondrial introns from various ascomycetous fungi. (2) Phylogenetic analyses indicate a close relationship between fungal and algal intronic sequences. (3) The P. wickerhamii introns are located at positions within the structural genes which can be considered as preferred intron insertion sites in homologous mitochondrial genes from fungi or liverwort. In all cases, the sequences adjacent to the insertion sites are very well conserved over large evolutionary distances. Our finding of highly similar introns in fungi and algae is consistent with the idea that introns have already been present in the bacterial ancestors of present day mitochondria and evolved concomitantly with the organelles. PMID:7680126

Use of low-coverage, large-insert, short-read data for rapid and accurate generation of enhanced-quality draft Pseudomonas genome sequences.

PubMed

O'Brien, Heath E; Gong, Yunchen; Fung, Pauline; Wang, Pauline W; Guttman, David S

2011-01-01

Next-generation genomic technology has both greatly accelerated the pace of genome research as well as increased our reliance on draft genome sequences. While groups such as the Genomics Standards Consortium have made strong efforts to promote genome standards there is a still a general lack of uniformity among published draft genomes, leading to challenges for downstream comparative analyses. This lack of uniformity is a particular problem when using standard draft genomes that frequently have large numbers of low-quality sequencing tracts. Here we present a proposal for an "enhanced-quality draft" genome that identifies at least 95% of the coding sequences, thereby effectively providing a full accounting of the genic component of the genome. Enhanced-quality draft genomes are easily attainable through a combination of small- and large-insert next-generation, paired-end sequencing. We illustrate the generation of an enhanced-quality draft genome by re-sequencing the plant pathogenic bacterium Pseudomonas syringae pv. phaseolicola 1448A (Pph 1448A), which has a published, closed genome sequence of 5.93 Mbp. We use a combination of Illumina paired-end and mate-pair sequencing, and surprisingly find that de novo assemblies with 100x paired-end coverage and mate-pair sequencing with as low as low as 2-5x coverage are substantially better than assemblies based on higher coverage. The rapid and low-cost generation of large numbers of enhanced-quality draft genome sequences will be of particular value for microbial diagnostics and biosecurity, which rely on precise discrimination of potentially dangerous clones from closely related benign strains.

Decarboxylative Hydroalkylation of Alkynes.

PubMed

Till, Nicholas A; Smith, Russell T; MacMillan, David W C

2018-05-02

The merger of open- and closed-shell elementary organometallic steps has enabled the selective intermolecular addition of nucleophilic radicals to unactivated alkynes. A range of carboxylic acids can be subjected to a CO 2 extrusion, nickel capture, migratory insertion sequence with terminal and internal alkynes to generate stereodefined functionalized olefins. This platform has been further extended, via hydrogen atom transfer, to the direct vinylation of unactivated C-H bonds. Preliminary studies indicate that a Ni-alkyl migratory insertion is operative.

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Visualizing and Clustering Protein Similarity Networks: Sequences, Structures, and Functions.

PubMed

Mai, Te-Lun; Hu, Geng-Ming; Chen, Chi-Ming

2016-07-01

Research in the recent decade has demonstrated the usefulness of protein network knowledge in furthering the study of molecular evolution of proteins, understanding the robustness of cells to perturbation, and annotating new protein functions. In this study, we aimed to provide a general clustering approach to visualize the sequence-structure-function relationship of protein networks, and investigate possible causes for inconsistency in the protein classifications based on sequences, structures, and functions. Such visualization of protein networks could facilitate our understanding of the overall relationship among proteins and help researchers comprehend various protein databases. As a demonstration, we clustered 1437 enzymes by their sequences and structures using the minimum span clustering (MSC) method. The general structure of this protein network was delineated at two clustering resolutions, and the second level MSC clustering was found to be highly similar to existing enzyme classifications. The clustering of these enzymes based on sequence, structure, and function information is consistent with each other. For proteases, the Jaccard's similarity coefficient is 0.86 between sequence and function classifications, 0.82 between sequence and structure classifications, and 0.78 between structure and function classifications. From our clustering results, we discussed possible examples of divergent evolution and convergent evolution of enzymes. Our clustering approach provides a panoramic view of the sequence-structure-function network of proteins, helps visualize the relation between related proteins intuitively, and is useful in predicting the structure and function of newly determined protein sequences.

Rapid and sensitive method to identify Mycobacterium avium subsp. paratuberculosis in cow's milk by DNA methylase genotyping.

PubMed

Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge

2013-03-01

Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.

Rapid and Sensitive Method To Identify Mycobacterium avium subsp. paratuberculosis in Cow's Milk by DNA Methylase Genotyping

PubMed Central

Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José

2013-01-01

Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time. PMID:23275511

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2013 CFR

2013-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2012 CFR

2012-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2014 CFR

2014-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

Functional impact of the human mobilome.

PubMed

Babatz, Timothy D; Burns, Kathleen H

2013-06-01

The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.

HangOut: generating clean PSI-BLAST profiles for domains with long insertions.

PubMed

Kim, Bong-Hyun; Cong, Qian; Grishin, Nick V

2010-06-15

Profile-based similarity search is an essential step in structure-function studies of proteins. However, inclusion of non-homologous sequence segments into a profile causes its corruption and results in false positives. Profile corruption is common in multidomain proteins, and single domains with long insertions are a significant source of errors. We developed a procedure (HangOut) that, for a single domain with specified insertion position, cleans erroneously extended PSI-BLAST alignments to generate better profiles. HangOut is implemented in Python 2.3 and runs on all Unix-compatible platforms. The source code is available under the GNU GPL license at http://prodata.swmed.edu/HangOut/. Supplementary data are available at Bioinformatics online.

Tol2 transposon-mediated transgenesis in Xenopus tropicalis.

PubMed

Hamlet, Michelle R Johnson; Yergeau, Donald A; Kuliyev, Emin; Takeda, Masatoshi; Taira, Masanori; Kawakami, Koichi; Mead, Paul E

2006-09-01

The diploid frog Xenopus tropicalis is becoming a powerful developmental genetic model system. Sequencing of the X. tropicalis genome is nearing completion and several labs are embarking on mutagenesis screens. We are interested in developing insertional mutagenesis strategies in X. tropicalis. Transposon-mediated insertional mutagenesis, once used exclusively in plants and invertebrate systems, is now more widely applicable to vertebrates. The first step in developing transposons as tools for mutagenesis is to demonstrate that these mobile elements function efficiently in the target organism. Here, we show that the Medaka fish transposon, Tol2, is able to stably integrate into the X. tropicalis genome and will serve as a powerful tool for insertional mutagenesis strategies in the frog.

Web based tools for data manipulation, visualisation and validation with interactive georeferenced graphs

NASA Astrophysics Data System (ADS)

Ivankovic, D.; Dadic, V.

2009-04-01

Some of oceanographic parameters have to be manually inserted into database; some (for example data from CTD probe) are inserted from various files. All this parameters requires visualization, validation and manipulation from research vessel or scientific institution, and also public presentation. For these purposes is developed web based system, containing dynamic sql procedures and java applets. Technology background is Oracle 10g relational database, and Oracle application server. Web interfaces are developed using PL/SQL stored database procedures (mod PL/SQL). Additional parts for data visualization include use of Java applets and JavaScript. Mapping tool is Google maps API (javascript) and as alternative java applet. Graph is realized as dynamically generated web page containing java applet. Mapping tool and graph are georeferenced. That means that click on some part of graph, automatically initiate zoom or marker onto location where parameter was measured. This feature is very useful for data validation. Code for data manipulation and visualization are partially realized with dynamic SQL and that allow as to separate data definition and code for data manipulation. Adding new parameter in system requires only data definition and description without programming interface for this kind of data.

Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

PubMed Central

Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

2009-01-01

Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies. PMID:19383142

Gene composer: database software for protein construct design, codon engineering, and gene synthesis.

PubMed

Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

2009-04-21

To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies.

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

PubMed

Oggioni, M R; Claverys, J P

1999-10-01

A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

Emergence of a Novel Chimeric Gene Underlying Grain Number in Rice

PubMed Central

Chen, Hao; Tang, Yanyan; Liu, Jianfeng; Tan, Lubin; Jiang, Jiahuan; Wang, Mumu; Zhu, Zuofeng; Sun, Xianyou; Sun, Chuanqing

2017-01-01

Grain number is an important factor in determining grain production of rice (Oryza sativa L.). The molecular genetic basis for grain number is complex. Discovering new genes involved in regulating rice grain number increases our knowledge regarding its molecular mechanisms and aids breeding programs. Here, we identified GRAINS NUMBER 2 (GN2), a novel gene that is responsible for rice grain number, from “Yuanjiang” common wild rice (O. rufipogon Griff.). Transgenic plants overexpressing GN2 showed less grain number, reduced plant height, and later heading date than control plants. Interestingly, GN2 arose through the insertion of a 1094-bp sequence from LOC_Os02g45150 into the third exon of LOC_Os02g56630, and the inserted sequence recruited its nearby sequence to generate the chimeric GN2. The gene structure and expression pattern of GN2 were distinct from those of LOC_Os02g45150 and LOC_Os02g56630. Sequence analysis showed that GN2 may be generated in the natural population of Yuanjiang common wild rice. In this study, we identified a novel functional chimeric gene and also provided information regarding the molecular mechanisms regulating rice grain number. PMID:27986805

Coiled-coil length: Size does matter.

PubMed

Surkont, Jaroslaw; Diekmann, Yoan; Ryder, Pearl V; Pereira-Leal, Jose B

2015-12-01

Protein evolution is governed by processes that alter primary sequence but also the length of proteins. Protein length may change in different ways, but insertions, deletions and duplications are the most common. An optimal protein size is a trade-off between sequence extension, which may change protein stability or lead to acquisition of a new function, and shrinkage that decreases metabolic cost of protein synthesis. Despite the general tendency for length conservation across orthologous proteins, the propensity to accept insertions and deletions is heterogeneous along the sequence. For example, protein regions rich in repetitive peptide motifs are well known to extensively vary their length across species. Here, we analyze length conservation of coiled-coils, domains formed by an ubiquitous, repetitive peptide motif present in all domains of life, that frequently plays a structural role in the cell. We observed that, despite the repetitive nature, the length of coiled-coil domains is generally highly conserved throughout the tree of life, even when the remaining parts of the protein change, including globular domains. Length conservation is independent of primary amino acid sequence variation, and represents a conservation of domain physical size. This suggests that the conservation of domain size is due to functional constraints. © 2015 Wiley Periodicals, Inc.

Interchromosomal recombination in Zea mays.

PubMed Central

Hu, W; Timmermans, M C; Messing, J

1998-01-01

A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274

Visual probes and methods for placing visual probes into subsurface areas

DOEpatents

Clark, Don T.; Erickson, Eugene E.; Casper, William L.; Everett, David M.

2004-11-23

Visual probes and methods for placing visual probes into subsurface areas in either contaminated or non-contaminated sites are described. In one implementation, the method includes driving at least a portion of a visual probe into the ground using direct push, sonic drilling, or a combination of direct push and sonic drilling. Such is accomplished without providing an open pathway for contaminants or fugitive gases to reach the surface. According to one implementation, the invention includes an entry segment configured for insertion into the ground or through difficult materials (e.g., concrete, steel, asphalt, metals, or items associated with waste), at least one extension segment configured to selectively couple with the entry segment, at least one push rod, and a pressure cap. Additional implementations are contemplated.

Time-resolved fluorescence imaging of slab gels for lifetime base-calling in DNA sequencing applications.

PubMed

Lassiter, S J; Stryjewski, W; Legendre, B L; Erdmann, R; Wahl, M; Wurm, J; Peterson, R; Middendorf, L; Soper, S A

2000-11-01

A compact time-resolved near-IR fluorescence imager was constructed to obtain lifetime and intensity images of DNA sequencing slab gels. The scanner consisted of a microscope body with f/1.2 relay optics onto which was mounted a pulsed diode laser (repetition rate 80 MHz, lasing wavelength 680 nm, average power 5 mW), filtering optics, and a large photoactive area (diameter 500 microns) single-photon avalanche diode that was actively quenched to provide a large dynamic operating range. The time-resolved data were processed using electronics configured in a conventional time-correlated single-photon-counting format with all of the counting hardware situated on a PC card resident on the computer bus. The microscope head produced a timing response of 450 ps (fwhm) in a scanning mode, allowing the measurement of subnano-second lifetimes. The time-resolved microscope head was placed in an automated DNA sequencer and translated across a 21-cm-wide gel plate in approximately 6 s (scan rate 3.5 cm/s) with an accumulation time per pixel of 10 ms. The sampling frequency was 0.17 Hz (duty cycle 0.0017), sufficient to prevent signal aliasing during the electrophoresis separation. Software (written in Visual Basic) allowed acquisition of both the intensity image and lifetime analysis of DNA bands migrating through the gel in real time. Using a dual-labeling (IRD700 and Cy5.5 labeling dyes)/two-lane sequencing strategy, we successfully read 670 bases of a control M13mp18 ssDNA template using lifetime identification. Comparison of the reconstructed sequence with the known sequence of the phage indicated the number of miscalls was only 2, producing an error rate of approximately 0.3% (identification accuracy 99.7%). The lifetimes were calculated using maximum likelihood estimators and allowed on-line determinations with high precision, even when short integration times were used to construct the decay profiles. Comparison of the lifetime base calling to a single-dye/four-lane sequencing strategy indicated similar results in terms of miscalls, but reduced insertion and deletion errors using lifetime identification methods, improving the overall read accuracy.

Electroencephalography: Subdural Multi-Electrode Brain Chip.

DTIC Science & Technology

1995-12-01

showing a blind subject reading Braille letters that had been inserted into his visual cortex by stimulating appropriate sets of electrodes. The...subject in Dobelle’s experiment 50 had been blind for 10 years and was able to read Braille at 30 letters a minute using a 64 electrode array for...Evans, "’ Braille ’ Reading by a Blind Volunteer by Visual cortex Stimulation," Nature, 259: 111-112 (January 1976). A.K. Engel, et al. "Temporal Coding

Shoe-stiffening inserts for first metatarsophalangeal joint osteoarthritis (the SIMPLE trial): study protocol for a randomised controlled trial.

PubMed

Munteanu, Shannon E; Landorf, Karl B; McClelland, Jodie A; Roddy, Edward; Cicuttini, Flavia M; Shiell, Alan; Auhl, Maria; Allan, Jamie J; Buldt, Andrew K; Menz, Hylton B

2017-04-27

This article describes the design of a parallel-group, participant- and assessor-blinded randomised controlled trial comparing the effectiveness of shoe-stiffening inserts versus sham shoe insert(s) for reducing pain associated with first metatarsophalangeal joint (MTPJ) osteoarthritis (OA). Ninety participants with first MTPJ OA will be randomised to receive full-length shoe-stiffening insert(s) (Carbon Fibre Spring Plate, Paris Orthotics, Vancouver, BC, Canada) plus rehabilitation therapy or sham shoe insert(s) plus rehabilitation therapy. Outcome measures will be obtained at baseline, 4, 12, 24 and 52 weeks; the primary endpoint for assessing effectiveness being 12 weeks. The primary outcome measure will be the foot pain domain of the Foot Health Status Questionnaire (FHSQ). Secondary outcome measures will include the function domain of the FHSQ, severity of first MTPJ pain (using a 100-mm Visual Analogue Scale), global change in symptoms (using a 15-point Likert scale), health status (using the Short-Form-12® Version 2.0 and EuroQol (EQ-5D-5L™) questionnaires), use of rescue medication and co-interventions, self-reported adverse events and physical activity levels (using the Incidental and Planned Activity Questionnaire). Data will be analysed using the intention-to-treat principle. Economic analysis (cost-effectiveness and cost-utility) will also be performed. In addition, the kinematic effects of the interventions will be examined at 1 week using a three-dimensional motion analysis system and multisegment foot model. This study will determine whether shoe-stiffening inserts are a cost-effective intervention for relieving pain associated with first MTPJ OA. The biomechanical analysis will provide useful insights into the mechanism of action of the shoe-stiffening inserts. Australian New Zealand Clinical Trials Registry, identifier: ACTRN12616000552482 . Registered on 28 April 2016.

Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

PubMed Central

Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

2013-01-01

Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

FASMA: a service to format and analyze sequences in multiple alignments.

PubMed

Costantini, Susan; Colonna, Giovanni; Facchiano, Angelo M

2007-12-01

Multiple sequence alignments are successfully applied in many studies for under- standing the structural and functional relations among single nucleic acids and protein sequences as well as whole families. Because of the rapid growth of sequence databases, multiple sequence alignments can often be very large and difficult to visualize and analyze. We offer a new service aimed to visualize and analyze the multiple alignments obtained with different external algorithms, with new features useful for the comparison of the aligned sequences as well as for the creation of a final image of the alignment. The service is named FASMA and is available at http://bioinformatica.isa.cnr.it/FASMA/.

Rover Sequencing and Visualization Program

NASA Technical Reports Server (NTRS)

Cooper, Brian; Hartman, Frank; Maxwell, Scott; Yen, Jeng; Wright, John; Balacuit, Carlos

2005-01-01

The Rover Sequencing and Visualization Program (RSVP) is the software tool for use in the Mars Exploration Rover (MER) mission for planning rover operations and generating command sequences for accomplishing those operations. RSVP combines three-dimensional (3D) visualization for immersive exploration of the operations area, stereoscopic image display for high-resolution examination of the downlinked imagery, and a sophisticated command-sequence editing tool for analysis and completion of the sequences. RSVP is linked with actual flight-code modules for operations rehearsal to provide feedback on the expected behavior of the rover prior to committing to a particular sequence. Playback tools allow for review of both rehearsed rover behavior and downlinked results of actual rover operations. These can be displayed simultaneously for comparison of rehearsed and actual activities for verification. The primary inputs to RSVP are downlink data products from the Operations Storage Server (OSS) and activity plans generated by the science team. The activity plans are high-level goals for the next day s activities. The downlink data products include imagery, terrain models, and telemetered engineering data on rover activities and state. The Rover Sequence Editor (RoSE) component of RSVP performs activity expansion to command sequences, command creation and editing with setting of command parameters, and viewing and management of rover resources. The HyperDrive component of RSVP performs 2D and 3D visualization of the rover s environment, graphical and animated review of rover-predicted and telemetered state, and creation and editing of command sequences related to mobility and Instrument Deployment Device (IDD) operations. Additionally, RoSE and HyperDrive together evaluate command sequences for potential violations of flight and safety rules. The products of RSVP include command sequences for uplink that are stored in the Distributed Object Manager (DOM) and predicted rover state histories stored in the OSS for comparison and validation of downlinked telemetry. The majority of components comprising RSVP utilize the MER command and activity dictionaries to automatically customize the system for MER activities. Thus, RSVP, being highly data driven, may be tailored to other missions with minimal effort. In addition, RSVP uses a distributed, message-passing architecture to allow multitasking, and collaborative visualization and sequence development by scattered team members.

A three-dimensional visualization preoperative treatment planning system for microwave ablation in liver cancer: a simulated experimental study.

PubMed

Liu, Fangyi; Cheng, Zhigang; Han, Zhiyu; Yu, Xiaoling; Yu, Mingan; Liang, Ping

2017-06-01

To evaluate the application value of three-dimensional (3D) visualization preoperative treatment planning system (VPTPS) for microwave ablation (MWA) in liver cancer. The study was a simulated experimental study using the CT imaging data of patients in DICOM format in a model. Three students (who learn to interventional ultrasound for less than 1 year) and three experts (who have more than 5 years of experience in ablation techniques) in MWA performed the preoperative planning for 39 lesions (mean diameter 3.75 ± 1.73 cm) of 32 patients using two-dimensional (2D) image planning method and 3D VPTPS, respectively. The number of planning insertions, planning ablation rate, and damage rate to surrounding structures were compared between2D image planning group and 3D VPTPS group. There were fewer planning insertions, lower ablation rate and higher damage rate to surrounding structures in 2D image planning group than 3D VPTPS group for both students and experts. When using the 2D ultrasound planning method, students could carry out fewer planning insertions and had a lower ablation rate than the experts (p < 0.001). However, there was no significant difference in planning insertions, the ablation rate, and the incidence of damage to the surrounding structures between students and experts using 3D VPTPS. 3DVPTPS enables inexperienced physicians to have similar preoperative planning results to experts, and enhances students' preoperative planning capacity, which may improve the therapeutic efficacy and reduce the complication of MWA.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE PAGES

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...

2016-06-10

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less